DE69637431T2 - RECOMBINANT POXVIRUS CYTOMEGALOVIRUS COMPOSITIONS AND ITS USE - Google Patents

Description

This application is a continuation part of the application serial no. 08 / 471,014, filed June 6, 1995, which in turn is a continuation-in-part of the application Serial no. 08/105 483, filed on August 13, 1993, now U.S. Patent No. 5,494,807 , in turn, a continuation of the application serial no. 07/847 951, filed March 6, 1992, which in turn is a continuation part of the application serial no. 07/713 967, filed on June 11, 1991, which in turn is a continuation part of the application serial no. 07 / 666,056, filed March 7, 1991; the registration serial no. 08/036 217, which was filed on March 24, 1993, was a continuation of the application serial no. 07/666 056 and was on 15 November 1994 as U.S. Patent No. 5,364,773 granted. This application is also a continuation of US application serial no. 08 / 124,668, filed September 21, 1993, now U.S. Patent No. 5,482,713 , as a division of registration serial no. 07 / 502,834, filed April 4, 1990, now U.S. Patent No. 5,338,683 ; the registration serial no. 07/502 834 was a partial continuation of application serial no. 07 / 394,488, filed August 16, 1989, which is a continuation-in-part of application Serial no. 07 / 339,004, filed April 17, 1989; and a partial continuation of registration serial no. 07/090 209, filed 27 August 1987, which is a division of application serial no. 06/622 135, filed on June 19, 1984, now U.S. Patent No. 4,722,848 , which is a partial continuation of the application serial no. 06/446 824, filed December 8, 1982, now U.S. Patent No. 4,603,112 , which was a partial continuation of US application serial no. 06/334 456, filed December 24, 1981, now U.S. Patent No. 4,769,330 , was

FIELD OF THE INVENTION

The The present invention relates to a modified poxvirus and Process for the preparation and use thereof; for example Vaccinia virus or avipox (eg canarypox or fowlpox or Fowl pox) z. B. modified recombinant poxvirus cytomegalovirus (CMV), e.g. B. human Cytomegalovirus (HCMV), such as an attenuated recombinant, specifically a NYVAC or ALVAC CMV or HCMV recombinant. In more detail The invention relates to improved vectors for insertion and expression of foreign genes for use as safe immunization vehicles to elicit an immune response against CMV or HCMV virus. Thus, the invention relates to a recombinant poxvirus, wherein the virus expresses gene products of CMV or HCMV, and immunogenic Compositions which provide an immunological response to CMV or HCMV infections, when administered to a host or in vitro (e.g. ex vivo modalities) and the products of expression of the poxvirus which in itself to elicit an immune response, e.g. B. for production of antibodies, where the antibodies useful against CMV or HCMV infection are, in either seropositive or seronegative Individuals are useful, or wherein the expression products or antibodies caused therefrom, isolated from an animal or human or cell culture, as the case may be, for the preparation of a diagnostic kit, test or assay for detection of the virus or of infected cells or the expression of the antigens or products are usable in other systems. The isolated ones Expression products are especially useful in kits, tests or Assays for Detecting Antibodies in a system, host, serum or sample, or for production of antibodies. The poxvirus recombinants preferably contain DNA encoding for everything or all of CMV or HCMVgB, -gH, -gL, -pp150, -pp65 and -IE1, including Recombinants, which are truncated versions of IE1; and the recombinant poxvirus DNA is useful for probes for CMV or HCMV or for the preparation of PCR primers for detecting the Presence or absence of CMV or HCMV or antigens thereof.

In This patent application is referred to several publications. The full citation this reference is immediately preceding the description at the end of the description the claims, or where the publication mentioned will be found.

BACKGROUND OF THE INVENTION

Vaccinia virus and, more recently, other pox viruses are for the insertion and expression of foreign genes has been used. The basic technique for inserting foreign genes into live infectious poxvirus includes the recombination between smallpox DNA sequences, which is a foreign genetic element flank in a donoplasmid, and homologous sequences which present in the rescuing poxvirus (Piccini et al., 1987).

Specifically, the recombinant poxviruses are constructed in two steps known in the art and analogous to the methods for producing synthetic recombinants of poxviruses, such as the vaccinia virus and avipox virus described in U.S. Patent Nos. 4,936,866 and 5,605,954 U.S. Patent Nos. 4,769,330 . 4,772 848 . 4 603 112 . 5 100 587 and 5 179 993 ,

First the DNA gene sequence to be inserted into the virus is in particular an open reading frame from a non-smallpox source, into an E. coli plasmid construct into which DNA is inserted which is homologous to a section of the DNA of the poxvirus is. Separately, the DNA gene sequence to be inserted is attached to a Promoter ligated. The promoter-gene linkage is in the plasmid construct positioned so that the promoter-gene linkage on both ends of Flanking DNA which is homologous to a DNA sequence which a region of smallpox DNA flanking a non-essential locus contains.

The resulting plasmid construct is then transformed by growth within amplified and isolated from E. coli bacteria (Clewell, 1972) (Clewell et al., 1969; Maniatis et al., 1982).

When Second is the isolated plasmid containing the one to be inserted Contains DNA gene sequence, together with the poxvirus into a cell culture, e.g. B. chick embryo fibroblasts transfected. Recombination between homologous smallpox DNA in the plasmid or the viral genome results in a poxvirus which by the presence, in a nonessential region of its genome, modified by foreign DNA sequences. The term "foreign" DNA refers to exogenous DNA, in particular DNA from a non-smallpox source, which is for gene products coded, usually are not produced by the genome into which the exogenous DNA is introduced.

genetic Recombination is generally the replacement of homologous segments DNA between two strands of DNA. For certain viruses, RNA can replace DNA. Homologous sections of nucleic acid are sections of nucleic acid (DNA or RNA) which have the same sequence of nucleotide bases.

genetic Recombination can be natural Way during the replication or production of new viral genomes within the infected host cell take place. Thus, a genetic Recombination between viral genes during the viral replication cycle occur, which takes place in a host cell with two or several different viruses or other genetic constructs is co-infected. A section of DNA from a first genome becomes replaceable in constructing the section of the genome of a second co-infecting Virus used in which the DNA is homologous to that of the first viral Genome is.

Indeed can recombination also between DNA sections in different Genomes that are not perfectly homologous take place. When a such section originates from a first genome leading to a section of another genome, except in the present, for example, one in one area the homologous DNA inserted genetic marker or for an antigenic Determinant coding gene, within the first section, is homologous, recombination can still take place, and the products of this Recombination are then due to the presence of this genetic Marker or gene detectable in the recombinant viral genome. additional Strategies are recent for the Production of recombinant vaccinia virus.

The successful expression of the inserted genetic DNA sequence through the modified infectious Virus requires two conditions. First, the insertion in a non-essential Region of the virus so that the modified virus remains viable. The second condition for the expression of the inserted DNA is the presence of a promoter in the appropriate relationship to the inserted DNA. The promoter must be placed so that it is upstream of the DNA sequence to be expressed is localized.

Vaccinia virus has been used successfully to vaccinate against smallpox in worldwide extinction smallpox in 1980 culminated. In the course of its history, many are strains originated from vaccinia. These different strains show varying immunogenicity and are to varying degrees with associated with potential complications, the most worrying of which post-vaccinal encephalitis and generalized vaccinia are (Bebehani, 1983).

With the extinction the smallpox is a new role for Vaccinia became important, that of a genetically engineered one Vector for the expression of foreign genes. Genes that have an immense number of heterologous antigens have been expressed in vaccinia, what often protective immunity against Challenge by the corresponding pathogen leads (summarized in a clear manner in Tartaglia et al., 1990a).

from Vaccinia vector genetic background has been shown the protective effectiveness of the affect expressed foreign immunogen. For example, the protected Expression of Epstein-Barr virus (EBV) gp340 in the Wyeth vaccine strain of vaccinia virus Lisztaffen not against induced by EBV virus Lymphoma while the expression of the same gene in the WR laboratory strain of vaccinia virus was protective (Morgan et al., 1988).

One exact balance between the effectiveness and the safety of a Vaccinia-based Recombinant vaccine candidates are extremely important. The recombinant Virus must die Presenting immunogen (s) in a way which causes a protective immune response in the vaccinated animal, but in which any significant pathogenic properties are lacking. That's why the weakening The vector strain is a highly desirable advance over that current state of the art.

A Number of vaccinia genes have been identified which are non-essential for the Growth of the virus in tissue culture and their deletion or Inactivation reduces virulence in a variety of animal systems.

The gene encoding vaccinia virus thymidine kinase (TK) has been mapped (Hruby et al., 1982) and sequenced (Hruby et al., 1983; Weir et al., 1983). Inactivation or complete deletion of the thymidine kinase gene does not prevent the growth of vaccinia virus in a wide variety of cells in cell culture. TC ^- vaccinia virus is also capable of replication in vivo at the site of inoculation in a variety of hosts in a variety of ways in the location.

For herpes simplex virus type 2 has been shown that intravaginal inoculation of guinea pigs with TK ^- virus resulted in significantly lower virus titers in the spinal cord than in the inoculation with TK ⁺ virus was the case (Stanberry et al. 1985). It has been shown that herpesvirus-encoded TK activity in vitro was not significant for virus growth in actively metabolized cells, but was required for virus growth in resting cells (Jamieson et al., 1974).

The attenuation of TK ^- vaccinia has been demonstrated in mice inoculated intracerebrally and intraperitoneally (Buller et al., 1985). An attenuation was observed for both the neurovirulent WR laboratory strain and the Wyeth vaccine strain. In mice were inoculated on the intradermal routes, TK generated ^- recombinants vaccinia equivalent neutralizing anti-vaccinia antibodies compared with the parental TK ⁺ vaccinia virus, indicating that the loss of TK function the immunogenicity of the Vaccinia virus vector was not significantly reduced in this test system. Following intranasal inoculation of mice with TK ^- and TK ⁺ recombinant vaccinia virus (WR strain), significantly less virus spread to other sites, including the brain, has been detected (Taylor et al., 1991a).

One another enzyme involved in nucleotide metabolism Ribonucleotide reductase. The loss of virally-encoded ribonucleotide reductase activity in herpes simplex virus (HSV) by deletion of the gene encoding the large subunit shown to no effect on viral (s) growth and DNA synthesis in dividing Cells in vitro but compromised the ability of the virus to be serum-eaten Cells grow to a high degree (Goldstein et al., 1988). Using a mouse model for acute HSV infection of the eye and reactivatable latent infection in the trigeminal ganglia showed a reduced virulence for HSV, in which the large subunit was delegated by ribonucleotide reductase compared to virulence, which is exhibited by wild-type HSV (Jacobson et al., 1989).

Either the small one (Slabaugh et al., 1988) as well as the large one (Schmidtt et al., 1988) subunits of ribonucleotide reductase have been reported in Vaccinia virus identified. Insertional inactivation of the large subunit of ribonucleotide reductase in the WR strain of vaccinia virus leads to attenuation of the virus as measured by intracranial inoculation of mice was (Child et al., 1990).

The hemagglutinin gene (HA) of vaccinia virus has been mapped and sequenced (Shida, 1986). The HA gene of vaccinia virus is not essential for growth in tissue culture (Ichihashi et al., 1971). Inactivation of the HA gene of vaccinia virus results in reduced neurovirulence in rabbits inoculated by the intracranial route and less damage in rabbits at the site of intradermal inoculation (Shida et al., 1988). The HA locus was used for the insertion of foreign genes into the WR strain (Shida et al., 1987), derivatives of the Lister strain (Shida et al., 1988), and the Copenhagen strain (Guo et al., 1989) Vaccinia virus used. Recombinant HA ^- vaccinia virus expressing foreign genes was shown to be immunogenic (Guo et al, 1989; Itamura et al, 1990; Shida et al... 1988; Shida et al., 1987) and protect against challenge with the relevant pathogen (Guo et al., 1989, Shida et al., 1987).

Cowpox virus (Brighton Red strain) produces red (hemorrhagic) smallpox on the Chorionallantois membrane of chicken eggs. Spontaneous deletions within the cowpox genome produce mutants which white Producing smallpox (Pickup et al., 1984). The hemorrhagic function (u) mapped on a 38 kDa large Protein encoded by an early gene (Pickup et al., 1986). This gene, which has homology to serine protease inhibitors has, inhibited shown the host inflammatory response on cowpox virus (Palumbo et al., 1989) and is an inhibitor of blood clotting.

The u gene is present in the WR strain of vaccinia virus (Kotwal et al., 1989b). mice which are inoculated with a WR vaccinia virus recombinant, in which the u-region is inactivated by insertion of a foreign gene has been producing higher Antibody levels against the foreign gene product compared to mice, which with a similar recombinant vaccinia virus in which the u gene intact (Zhou et al., 1990). The u-region is in a broken non-functional Form present in the Copenhagen strain of vaccinia virus (open reading frame B13 and B14, according to terminology, reported in Goebel et al., 1990a, b).

The Cowpox virus is present in infected cells in cytoplasmic inclusion bodies of the Type A (ATI) localized (Kato et al., 1959). It is believed that the function of ATI is the protection of cowpox virus virions during transmission from animal to animal (Bergoin et al., 1971). The ATI region of the Cowpox genome encodes a 160 kDa protein containing the matrix the ATI body (Funahashi et al., 1988; Patel et al., 1987). The vaccinia virus generally produces no ATI, although there is a homologous region in contains its genome. In the WR strain of Vaccinia, the ATI region of the genome is considered to be a 94 kDa protein translated (Patel et al., 1988). In the Copenhagen strain of vaccinia virus are most of the DNA sequences, which correspond to the ATI region deleted, with the remaining 3'-end of the region with Sequences upstream the ATI region to form the open reading frame (ORF) A26L is fused (Goebel et al., 1990a, b).

A Variety of spontaneous (Altenburger et al., 1989; Drillien et al., 1981; Lai et al., 1989; Moss et al., 1981; Paez et al., 1985; Panicali et al., 1981) and constructed (Perkus et al., 1991, Perkus et al., 1989; Perkus et al., 1986) deletions are near the left End of the vaccinia virus genome been reported. From a WR strain of vaccinia virus with a 10 kb in size spontaneous deletion (Moss et al., 1981, Panicali et al., 1981) to be attenuated by intracranial inoculation in mice (Buller et al., 1985). This deletion was later shown To include 17 potential ORFs (Kotwal et al., 1988b). Specific genes within the deleted Close region the virokine N1L and a 35 kDa protein (C3L, according to the in Goebel et al., 1990a, b, reported terminology). insertional Inactivation of N1L reduces virulence in intracranial Inoculation for normal and nude mice (Kotwal et al., 1989a). The 35 kDa protein becomes like N1L in secreted the medium from vaccinia virus infected cells. The protein contains homology to the family of complement control proteins, in particular the complement 4B binding protein (C4bp) (Kotwal et al., 1988a). Like the cellular C4bp binds the vaccinia 35 kDa protein to the fourth component of the Complements and inhibits the classical complement cascade (Kotwal et al., 1990). Thus, the 35 kDa vaccinia protein appears to be involved to be there to help the virus, host defense mechanisms to get around.

The The left end of the vaccinia genome includes two genes which are termed Host range genes have been identified, K1L (Gillard et al., 1986) and C7L (Perkus et al., 1990). The deletion of these two Gene reduces the ability of the vaccinia virus, on a variety of human cell lines too grow (Perkus et al., 1990).

Two additional vaccine vector systems involve the use of naturally-restricted poxviruses, avipox viruses. Both fowlpox virus (FPV, fowlpoxvirus) and canarypox virus (CPV) have been engineered to express foreign gene products. Fowlpox virus (FPV) is the prototypical virus of the avipox genus of the poxvirus family. The virus causes an economically significant disease of poultry that has been widely controlled since the 1920's through the use of live attenuated vaccines. Replication of avipox viruses is restricted to avian species (Matthews, 1982), and there are no reports in the literature of avipoxvirus causing productive infection in any non-avian species, including humans. This host restriction provides an inherent safety barrier to the transmission of the virus to other species and allows the use of avipoxvirus-based vaccine vectors in veterinary and human applications an attractive proposal.

FPV is advantageously as a vector which antigens poultry pathogens expressed. The hemagglutinin protein of a virulent Avian influenza virus was expressed in a FPV recombinant (Taylor et al., 1988a). After inoculation of the recombinant in chickens and turkeys an immune response was induced which was protective against either a homologous or heterologous virulent influenza virus challenge was (Taylor et al., 1988a). FPV recombinants containing the surface glycoproteins of "Newcastle Disease" virus, have also been developed (Taylor et al., 1990; Edbauer et al., 1990).

In spite of the host restriction regarding the replication of FPV and CPV on avian systems, was added Recombinants derived from these viruses, to express extrinsic proteins in cells of non-bird origin. Furthermore, such recombinant viruses have been shown to provide immunological responses which were directed against the foreign gene product, and, where appropriate, it has been shown to be a challenge of challenge against the corresponding pathogen (Tartaglia et al., 1993a, b; Taylor et al., 1992; 1991b; 1988b).

human Cytomegalovirus (HCMV) is a member of the Betaherpesviridae subfamily (Family Herpesviridae). HCMV is ubiquitous in humans, with one commonly mild or imperceptible acute infection, followed by persistence or latency. However, HCMV is a significant cause of morbidity and infant mortality, which become infected in-utero (Stagno et al., 1983). HCMV is the most common infectious complication of organ transplantation (Glenn et al., 1981) and immunocompromised Wirts (Weller et al., 1971). In AIDS patients, CMV is retinitis the leading one Cause of blindness (Roarty et al., 1993; Gallant et al., 1992; Gross et al., 1990). A potential role of HCMV in coronary restenosis is recent (Speir et al., 1994). The live weakened Towne tribe protects from HCMV proven seronegative kidney transplant recipients before the serious clinical Symptoms of HCMV infection (Plotkin et al., 1976, 1984 and 1989) and protects initially seronegative healthy individuals from infection and clinical symptoms after a subcutaneous challenge with a wild type strain of HCMV (Plotkin et al., 1989). There remain concerns about the Use of a live HCMV vaccine due to the Herpesvirus infections in humans characteristic latency reactivation phenomenon and because of the assets some tribes of HCMV, cells in vitro malignant to transform (Albrecht and Rapp, 1973, Galloway et al., 1986). For these reasons may be a recombinant subunit CMV vaccine for immunization be more acceptable in humans.

The The role of individual HCMV proteins in protective immunity is unclear. Three immunologically distinct families of HCMV-associated Glycoproteins have been described (Gretch et al., 1988b); GCI (gp55 and gp93-130); gCII (gp47-52) and gCIII (gp85-p145). The neutralization of HCMV is in vitro with antibodies been demonstrated which for each of these glycoprotein families are specific (Pachl et al., 1989; Rasmussen et al., 1988; Karl et al., 1986).

The for gCI coding gene is homologous to HSV I-gB (Cranage et al., 1986). HCMVgB is termed a glycosylated, uncleaved precursor with an apparent Molecular weight of 130-140 which synthesizes from cellular proteinase to an N-terminal, 90-110 kDa big, and C-terminal, 55-58 kDa huge Product is processed, which in a disulfide-linked complex remain associated (Britt and Auger, 1986; Britt and Vugler, 1989; Reis et al., 1993). Monoclonal antibodies capable of Neutrals of HCMV have been obtained from mice that are infected with Lysates of HCMV-infected cells or HCMV virions were immunized, these monoclonal antibody mainly with the C-terminal, 55-58 kDa big Fragments were reactive (Britt, 1984; Kari et al., 1986; Pereira et al., 1984; Rasmussen et al., 1988). However, the led Immunization with biochemically purified gP93 to the development of gp-93-specific neutralizing mAbs (Kari et al., 1990).

HCMV gB can serve to protect immunity to cause in humans: immunization with the purified gB protein induces neutralizing antibody (Gönczöl et al., 1990), and human monoclonal anti-gB antibodies neutralize the virus (Masuho et al., 1987). Following a natural Infection is for HCMV-gB specific neutralizing antibody observed. If gB-specific antibody is absorbed from human sera, the HCMV neutralizing antibody titers significantly reduced (50-88%, Gönczöl et al. 1991; 0-98% Mean 48%, Marshall et al., 1992). There is also evidence of activation of helper T cells by the gB protein in naturally seropositive humans (Liu et al., 1991), and gB-specific CTL are in some studies in humans (Borysiewicz et al., 1988; Liu et al., 1991; Riddell et al., 1991).

The gCII glycoproteins are derived from a gene or genes in the US6 gene family (US6 to US11, Gretch et al., 1988a). These glycoproteins are of human anti-HCMV antibody in Sera recognized from convalescent adults. However, serums failed from congenitally infected infants with persistent infection to react with gCII glycoproteins (Kari and Gehrz, 1990), suggesting that gCII is important for human protective immune responses against HCMV can be.

The gP86 component of the gCIII complex is encoded by a gene which is homologous to HSV-I gH (Cranage et al., 1988, Pachl et al., 1989). The gH protein of HCMV is capable of inducing a neutralizing immune response in humans (10% of those infected with HCMV Individuals have a detectable level of circulating gH-specific antibodies on (Rasmussen et al., 1991)) and in laboratory animals (Baboonian et al., 1989; Cranage et al., 1988; Ehrlich et al., 1988; Rasmussen et al., 1984). Murine neutralize gH-specific monoclonal antibodies the virus infectivity in a complement-independent Weise (Baboonian et al., 1989; Cranage et al., 1988; Rasmussen et al., 1984) and inhibit viral spread (Pachl et al., 1989), suggesting that gH is for virus attachment, penetration and / or dissemination can be.

Even though gH on the surface of HCMV-infected cells is found (Cranage et al., 1988) it is, when expressed by a variety of recombinant systems, limited to the endoplasmic reticulum (Spaete et al., 1991). Co-expression of the HCMV UL115 gene product (Glycoprotein gL) leads to form a stable complex of these two proteins and to Transport of gH to the cell surface (Spaete et al., 1993; Kaye et al., 1992).

HCMV synthesizes a number of matrix-titer phosphoproteins. The pp150 phosphoprotein to a great extent immunogenic, and apparently more potent than any other the HCMV structural proteins (Jahn et al., 1987). A second matrix phosphoprotein, pp65, evokes a variable humoral response in humans (Jahn et al., 1987; Plachter et al., 1990). This protein can cause lymphoproliferation, Production of IL-2 and interferon, B cell stimulation of antibody and naturally Killer cell activity stimulate (Forman et al., 1985). It also serves as a target antigen for HCMV-specific, HLA-restricted cytotoxic T cells (CTLs) (Pande et al., 1991; Gilbert et al., 1993).

additional Structural proteins can for the Inducing a protective Immune response against HCMV may be required. The main capsid protein (UL86) is known to induce specific antibodies during a natural Infection and is considered as the common antigen of the CMV group (Spaete et al., 1994). The Tegument Phosphoprotein pp28 (UL99) is also known to call sustained antibody responses while a natural one Infection. Furthermore, this protein is also immunogenic as a CTL target has been implicated (Charpentier et al., 1986). The immune response against the upper Tegument phosphoprotein pp71 (UL82) is not as well characterized as the others Tegument phosphoproteins (pp28, pp65) but, as a known tegument protein, requires further attention.

In addition to these structural proteins, some non-structural proteins may also be candidates for inclusion in a recombinant subunit vaccine. Immunization of mice with a recombinant vaccinia virus expressing murine cytomegalovirus (MCMV) -pp89 (functional homologue of HCMV-IE1) induces CD8 ⁺ T-cell responses which confer protective immunity to challenge with MCMV (Jonjic et al., 1988). The human CMV Major Immediate Early (IE1) protein has been shown to be a target for CTLs isolated from HCMV seropositive individuals (Borysiewicz et al., 1988). Since IE1 is among the initial viral proteins that are expressed and necessary to induce the expression of other CMV genes and initiate the viral life cycle in latently infected cells (Blanton and Tevethia, 1981; Cameron and Preston, 1981; DeMarchi et al , 1980; McDonough and Spector, 1983; Wathen et al., 1981), IE1-directed CTL responses may be important for the control and / or elimination of HCMV infection. Recently, Gilbert et al. (1993) suggested that HCMV has developed a mechanism by which other virally encoded proteins selectively interact with the presentation of IE-derived peptides in association with class I major histocompatibility complex (MHC) molecules.

Some additional Non-structural proteins can also candidates for inclusion in a recombinant subunit HCMV vaccine candidate be. The "Immediate Early "protein IE2 (UL122) and the regulatory protein UL69 are known to contain human T-helper epitopes (Beninga et al., 1995).

A Approach to the development of a subunit HCMV vaccine consists in the use of live viral vectors for expression relevant HCMV gene products.

you can therefore assume that the provision of a CMV or an HCMV recombinant poxvirus and compositions and products thereof, in particular NYVAC or ALVAC-based CMV or HCMV recombinants and compositions and products thereof, especially those recombinants containing Coding for any or all of HCMV-gB, -gH, -gL, -pp150, -pp65 and -IE1, including Recombinants, which changed or shortened Express versions of IE1 and / or gB, and compositions and products thereof, a highly desirable advance over the current state of the art would be.

OBJECTIVES AND SUMMARY THE INVENTION

It is therefore an object of this invention, modified recombinant Provide viruses, the viruses increased security and a method for producing such recombinant Provide viruses.

It Another object of this invention is an antigenic recombinant Poxvirus vaccine or an immunological composition with an increased Levels of safety compared to known recombinant poxvirus vaccines provide.

It It is also an object of this invention to provide a modified vector to provide for expressing a gene product in a host, wherein the vector is modified to have attenuated virulence owns in the host.

It Another object of this invention is a method of expression of a gene product in an in vitro cultured cell using a modified recombinant virus or a modified An elevated vector Provide a mirror of security.

These and other objects and advantages of the present invention become easier to see after considering the following.

In In one aspect, the present invention relates to a modified one recombinant virus, having inactivated virus-encoded genetic Functions, so that the recombinant virus has a weakened virulence and an increased Safety. The functions may be non-essential or associated with virulence. The virus is advantageously a poxvirus, in particular a Vaccinia virus or an avipox virus, such as a chicken pox virus or canarypox virus. The modified recombinant virus can, within a non-essential Region of the virus genome, a heterologous DNA sequence, which include HCMV-derived antigen or epitope encoded as any or all of HCMVgB, -gH, -gL, -pp150, -pp65, and -IE1, including modified or shortened Versions of IE1 and / or gB.

In In another aspect, the present invention relates to an antigenic, immunological or vaccine composition or a therapeutic Composition for inducing an antigenic or immunological Response in a host animal inoculating with the composition wherein the vaccine is a carrier and a modified recombinant Includes virus, having inactivated non-essential virus-encoded genetic Functions, so that the recombinant virus has a weakened virulence and increased Safety. In the composition according to the present invention Virus used in the invention is advantageously a poxvirus, in particular a vaccinia virus or an avipox virus, such as a chicken pox virus or canarypox virus. The modified recombinant virus can within a non-essential region of the virus genome a heterologous Include DNA sequence, which a z. B. encodes HCMV-derived antigenic protein, like any or all of HCMV-gB, -gH, -gL, -pp150, -pp65, -IE1, including modified or shortened Versions of IE1 and / or gB.

In In yet another aspect, the present invention relates to a immunogenic composition containing a modified recombinant Virus in which non-essential virus-encoded genetic functions are thus inactivated are that the recombinant virus has a weakened virulence and increased safety having. The modified recombinant virus closes, within a non-essential region of the virus genome, a heterologous one DNA sequence, which encodes an antigenic protein (eg derived from HCMV, like any or all of HCMV-gB, -gH, -gL, -pp150, -pp65, -IE1, including modified or shortened Versions of IE1 and / or gB), the composition being, if it is administered to a host for inducing an immunological Response is capable of being specific for the antigen is.

In In another aspect, the present invention relates to a method for expressing a gene product in a cell in vitro Introduce a modified recombinant virus, the attenuated virulence and increased Has security in the cell. The modified recombinant Virus can, within a non-essential region of the virus genome, a heterologous DNA sequence which is an antigenic protein coded, z. Derived from HCMV, such as any or all from HCMV-gB, -gH, -gL, -pp150, -pp65, -IE1, including modified or shortened Versions of IE1 and / or gB. The cells can then go directly into the individual be reinfused or used to specific reactivities for reinfusion to amplify (ex-vivo therapy).

In In another aspect, the present invention relates to a method for expressing a gene product in a cell which is in vitro is cultivated, by introducing a modified recombinant virus that has attenuated virulence and increased Has security in the cell. The modified recombinant virus can, within a non-essential region of the virus genome, a heterologous DNA sequence which is an antigenic protein coded, z. Derived from HCMV, such as any or all from HCMV-gB, -gH, -gL, -pp150, -pp65, -IE1, including modified or shortened Versions of IE1 and / or gB. The product can then be sent to individuals or animals are administered to stimulate an immune response. The generated antibodies can useful in individuals for the prevention or treatment of HCMV, and the antibodies Individuals or animals or the isolated in vitro expression products may be present in Diagnostic kits, assays or tests used to determine the Presence or absence, in a sample, such as serum, of HCMV or antigens thereof or antibodies against it (and therefore the absence or presence of the virus or the products or an immune response to the virus or antigens) determine.

In yet another aspect, the present invention relates to a modified recombinant virus in which non-essential virus-encoded genetic functions are inactivated such that the virus has attenuated virulence, and wherein the modified recombinant virus further comprises DNA from a heterologous source in one contains non-essential region of the virus genome. The DNA may encode HCMV, as for any or all of HCMV-gB, -gH, -gL, -pp150, -pp65, -IE1, including altered or shortened versions of IE1 and / or gB. In particular, the genetic functions are inactivated by deleting an open reading frame encoding a virulence factor or by using naturally-restricted viruses. The virus used according to the present invention is advantageously a poxvirus, in particular a vaccinia virus or avipox virus, such as fowlpox virus or canarypox virus. Advantageously, the open reading frame is selected from the group consisting of J2R, B13R + B14R, A26L, A56R, C7L-K1L and I4L (according to the terminology reported in Goebel et al., 1990a, b); and a combination of them. In this regard, the open reading frame comprises a thymidine kinase gene, a hemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host region gene region or a large ribonucleotide reductase subunit; or a combination of them. A suitably modified Copenhagen strain of vaccinia virus is identified as NYVAC (Tartaglia et al., 1992), or a vaccinia virus, of which J2R, B13R + B14R, A26L, A56R, C7L-K1L and I4L or a thymidine kinase gene, a haemorrhagic region, a type A inclusion body region, a hemagglutinin gene, a host range region, and a large ribonucleotide reductase subunit have been deleted (see also U.S. Patent No. 5,364,773 ). Alternatively, a suitable poxvirus is an ALVAC or a canarypox virus (Rentschler vaccine strain) which has been attenuated, for example, by more than 200 serial passages on chick embryo fibroblasts, with one master seed of four consecutive plaque Purification under agar was subjected, from which a plaque clone was amplified by five additional passages.

The In a still further aspect, the invention relates to the product of Expression of the recombinant according to the invention Poxvirus and uses thereof, such as for the formation of antigenic, immunological or vaccine compositions for treatment, prevention, Diagnosis or testing; and DNA from the recombinant poxvirus, which useful in the construction of DNA probes and PCR primers.

These and other embodiments are disclosed or are exhaustive from the following Description obvious and included by her.

BRIEF DESCRIPTION OF THE DRAWINGS

The following detailed Description, which is given in an exemplary manner, with but not intended, the invention only to the described specific embodiments restrict may best be in the context of the accompanying drawings be understood, in which:

1 schematically shows a method of constructing the plasmid pSD460 for the deletion of the thymidine kinase gene and production of the recombinant vaccinia virus vP410;

2 schematically shows a method for the construction of the plasmid pSD486 for the deletion of the hemorrhagic region and production of the recombinant vaccinia virus vP553;

3 schematically shows a method for the construction of the plasmid pMP494Δ for the deletion of the ATI region and for the production of the recombinant vaccinia virus vP618;

4 schematically shows a method for the construction of the plasmid pSD467 for the deletion of the hemagglutinin gene and for the production of the recombinant vaccinia virus vP723;

5 schematically shows a method for the construction of the plasmid pMPCK1Δ for the deletion of the gene cluster [C7L-K1L] and the production of the recombinant vaccinia virus vP804;

6 schematically shows a method for the construction of the plasmid pSD548 for the deletion of the large ribonucleotide reductase subunit and the generation of the recombinant vaccinia virus vP866 (NYVAC);

7 schematically shows a method for the construction of the plasmid pRW842 for the insertion of the Rabies glycoprotein G gene into the TK deletion locus and the production of the recombinant vaccinia virus vP879;

8th shows the DNA sequence of a 3209 base pair canarypox DNA fragment containing the C5 ORF (SEQ ID NO: 27) (the C5 ORF begins at position 1537 and ends at position 1857);

9A and 9B schematically show a method for the construction of recombinant canarypox virus vCP65 (ALVAC-RG);

10 schematically shows the ORFs deleted to generate NYVAC;

11A to 11D Graphs of Rabies neutralizing antibody titer (RFFIT, IU / ml), the booster effect of HDC and vCP65 (10 ^5.5 TCID ₅₀ ) in volunteers previously vaccinated with either the same or the alternative vaccine (vaccines were obtained given days 0, 28 and 180, antibody titers were measured on days 0, 7, 28, 35, 56, 173, 187 and 208);

12 shows the DNA sequence of HCMVgB (Towne strain) (SEQ ID NO: 37);

13A and B show the DNA sequence of the H6 promoter-directed HCMVgB and NYVAC sequences flanking the TK locus (SEQ ID NO: 38) (the 5 'end of the H6 promoter-directed CMVgB is attached position 3447, the CMVgB coding sequence ranges from position 3324 to position 606);

14A to C show the DNA sequence of a 7351 base pair fragment of canarypox DNA containing the C3 ORF (SEQ ID NO: 39) (the C3 ORF begins at position 1458 and ends at position 2897). ;

15A to C show the DNA sequence of the H6 promoter-driven HCMVgB and ALVAC sequences flanking the C3 locus (SEQ ID NO: 40) (the 5 'end of the H6 promoter-driven CMVgB is present Position 4425; the CMVgB coding sequence extends from position 4301 to position 1581);

16A and B show the DNA sequence of the H6 promoter-driven HCMVgB and NYVAC sequences flanking the ATI locus (SEQ ID NO: 41) (the 5 'end of the H6 promoter-targeted CMVgB is at position 3348 the CMVgB coding sequence extends from position 3224 to position 504);

17 shows the DNA sequence of HCMVgB (Towne strain) having its transmembrane region deleted (SEQ ID NO: 42);

18A and B show the DNA sequence of the H6 promoter-targeted HCMVgB without its transmembrane region and NYVAC sequences flanking the ATI locus (SEQ ID NO: 43) (the 5 'end of the H6 promoter-targeted CMVgB is in position 3173, the CMVgB coding sequence extends from position 3050 to position 504);

19 shows the DNA sequence of HCMVgB (Towne strain) in which its transmembrane region is deleted and which contains an altered cleavage site (SEQ ID NO: 44);

20A and B show the DNA sequence of the H6 promoter-directed HCMVgB without its transmembrane region and containing an altered cleavage site, plus NYVAC sequences flanking the ATI locus (SEQ ID NO: 45) (the 5 'end of the H6 vector). promoter-directed CMVgB is at position 3173; the CMVgB coding sequence extends from position 3050 to position 504);

21 shows the DNA sequence of HCMVgH (Towne strain) (SEQ ID NO: 46);

22A and B show the DNA sequence of the 42K promoter-directed HCMVgH plus NYVAC sequences flanking the I4L locus (SEQ ID NO: 47) (the 5 'end of the 42K promoter-gated CMVgH is in position 641, the CMVgH coding sequence ranges from position 708 to 2933);

23A and B show the DNA sequence of the 42K promoter-directed CMVgH and ALVAC sequences flanking the C5 locus (SEQ ID NO: 48) (the 5 'end of the 42K promoter-gated CMVgH is at position 1664; CMVgH coding sequence ranges from position 1730 to 3955);

24 Figure 4 shows the DNA sequence of the 42K promoter-directed CMVgH and flanking WR sequences (SEQ ID NO: 49) (the 5 'end of the 42K promoter-directed CMVgH is at position 2457, the CMVgH coding sequence is from position 2391 to 166);

25 shows the DNA sequence of HCMV-IE1 (AD169 strain) (SEQ ID NO: 50);

26 Figure 4 shows the DNA sequence of the H6 promoter-directed CMVIE1 and flanking WR sequences (SEQ ID NO: 51) (the 5 'end of the H6 promoter-directed CMVIE1 is at position 1796, the CMVIE1 coding sequence ranges from position 1673 to 201);

27A and B show the DNA sequence of the H6 promoter-driven CMVIE1 and NYVAC sequences flanking the ATI locus (SEQ ID NO: 52) (the 5 'end of the H6 promoter-directed CMVIE1 is at position 2030; CMVIE1 coding sequence ranges from position 1906 to position 434);

28 shows the DNA sequence of HCMVIE1 (AD169 strain) without amino acids 292-319 (SEQ ID NO: 53);

29A and B show the DNA sequence of the H6 promoter-driven CMVIE1, without amino acids 292-319, and NYVAC sequences flanking the ATI locus (SEQ ID NO: 54) (the 5 'end of the H6 promoter-driven CMVIE1 is at position 1940, the CMVIE1 coding sequence ranges from position 1816 to position 434);

30 shows the DNA sequence of the exon 4 segment of HCMVIE1 (AD169 strain) (SEQ ID NO: 55);

31 shows the DNA sequence of the H6 promoter-driven CMVIE1 exon 4 segment and NYVAC sequences flanking the I4L locus (SEQ ID NO: 56) (the 5 'end of the H6 promoter-directed IE1 exon gene). 4 is at position 630 and the CMVIE1 exon 4 coding sequence ranges from position 754 to position 1971).

32A and B show the DNA sequence of the H6 promoter-driven CMVIE1 exon 4 segment and ALVAC sequences flanking the C5 locus (SEQ ID NO: 57) (the 5 'end of the H6 promoter-driven IE1). Exon-4 is at position 1647 and the CMVIE1 exon-4 coding sequence extends from position 1771 to position 2988).

33 shows the DNA sequence of HCMVIE1 (AD169 strain) without amino acids 2-32 (SEQ ID NO: 58);

34 Figure 4 shows the DNA sequence of the H6 promoter-driven CMVIE1 without amino acids 2-32 and NYVAC sequences flanking the I4L locus (SEQ ID NO: 59) (the 5 'end of H6 promoter-driven IE1 without amino acids 2 -32 is at position 630; the coding sequence for CMVIE1 without amino acids 2-32 ranges from position 754 to position 2133);

35A and B show the DNA sequence of the H6 promoter-driven CMVIE1 without amino acids 2-32 and ALVAC sequences flanking the C5 locus (SEQ ID NO: 60) (the 5 'end of the H6 promoter-driven IE1 without Amino acids 2-32 is at position 1647, the CMVIE1 coding sequence for CMVIE1 without amino acids 2-32 ranges from position 1771 to position 3150);

36 shows the DNA sequence of HCMV pp65 (Towne strain) (SEQ ID NO: 61);

37 Figure 4 shows the DNA sequence of the H6 promoter-driven CMVpp65 and NYVAC sequences flanking the HA locus (SEQ ID NO: 62) (the 5 'end of the H6 promoter-targeted pp65 is at position 476; the CMVpp65 coding sequence ranges from position 600 to 2282);

38A and B show the DNA sequence of a 3706 base pair canarypox DNA fragment containing the C6 ORF (SEQ ID NO: 63) (the C6 ORF begins at position 377 and ends at position 2254);

39A and B show the DNA sequence of the H6 promoter-driven CMVpp65 and ALVAC sequences flanking the C6 locus (SEQ ID NO: 64) (the 5 'end of the H6 promoter-targeted pp65 is at position 496; the CMVpp65 coding sequence ranges from position 620 to 2302);

40 Figure 4 shows the DNA sequence of the H6 promoter-driven CMVpp65 and flanking WR sequences (SEQ ID NO: 65) (the 5 'end of the H6 promoter-directed pp65 is at position 168, and the CMVpp65 coding sequence is from position 292 to 1974);

41 shows the DNA sequence of HCMV pp150 (Towne strain) (SEQ ID NO: 66);

42A and B show the DNA sequence of the 42K promoter-driven CMVpp150 and NYVAC sequences flanking the ATI locus (SEQ ID NO: 67) (the 5 'end of the 42K promoter-directed pp150 is at position 3645; the CMVpp150 coding sequence ranges from position 3580 to 443);

43A and B show the DNA sequence of the 42K promoter-directed CMVpp150 and ALVAC sequences flanking the C6 locus (SEQ ID NO: 68) (the 5 'end of the 42K promoter-directed pp150 is at position 3714; the CMVpp150 coding sequence ranges from position 3649 to 512);

44A and B show the DNA sequence of the 42K promoter-gated CMVpp150 gene and flanking WR sequences (SEQ ID NO: 69) (the 5 'end of the H6 promoter-targeted pp150 is at position 3377, encoding the CMVpp150 Sequence ranges from position 3312 to 175);

45A and B show the DNA sequence of the 42K promoter-gated HCMVgH and the H6 promoter-directed HCMVIE exon 4 and NYVAC sequences flanking the I4L locus (SEQ ID NO: 70) (the 5 'end of the 42K promoter-controlled CMVgH is located at position 2935, the CMVgH coding sequence extends from position 2869 to position 644, and the 5 'end of the H6 promoter-directed CMVIE exon 4 is at position 2946, the CMVIE exon 4 coding sequence extends from position 3070 to position 4287);

46A to C show the DNA sequence of the H6 promoter-directed HCMV pp65 and the 42K promoter-directed HCMVpp150 and ALVAC sequences flanking the C6 locus (SEQ ID NO: 71) (the 5 'end of the H6 promoter-driven CMVpp65 is at position 496, the CMVpp65 coding sequence extends from position 620 to position 2302, the 5 'end of the 42K promoter-directed CMVpp150 is at position 5554, and the CMVpp150 coding sequence extends from position 5489 to position 2352 );

47 shows the DNA sequence of HCMVgL (Towne strain) (SEQ ID NO: 72);

48A and B show the DNA sequence of the H6 promoter-gated HCMVgB and the H6 promoter-gated HCMVgL and NYVAC sequences flanking the TK locus (SEQ ID NO: 73) (the 5 'end the H6 promoter-driven CMVgB is at position 3447; the CMVgB coding sequence ranges from position 3324 to position 606; the 5 'end of the H6 promoter-driven CMVgL is at position 3500; the CMVgL coding sequence extends from position 3624 to position 4460);

49 shows the results of HCMV IE1 CTL stimulation by ALVAC-IE1 (vCP256) (percentage of cytotoxicity, white bars = WR, black bars = WR IE1, striped bars = non-autologous);

50 Figure 10 shows the results of stimulation of HCMV pp65 CTLs by ALVAC-pp65 (vCP260) (human CTLs, stimulated in vitro and tested for HCMV pp65 CTLs using a methodology similar to that described for 49 was applied; Percentage of cytotoxicity; white bars = WR, black bars = WR-pp65, striped bars = non-autologous);

51 shows the results of stimulation of HCMV-IEI CTLs by ALVAC-IE1 (vCP256) (similar methodology to those used for 49 with the exception that following 6 days of incubation for the restimulation, the mononuclear responder cells were incubated with immunomagnetic beads coupled to monoclonal anti-human CD3, CD4 or CD8; Percentage of cytotoxicity; white bars = WR, black bars = WR-IE1, striped bars = HLA mismatch);

52A to D show the expression of CMV-gB by COPAK recombinants in Vero and HeLa cells (cell and medium fractions from infected cells radiolabeled with [S35] methionine) were immunoprecipitated with guinea pig anti-CMV gB Vero medium (A), HeLa medium (B), Vero cell (C) and HeLa cell (D) fractions resulting from infections with vP993 COPAK strain (lanes 1) are shown. , vP1126, expressing the entire gB (lanes 2), vP1128, expressing gB without the transmembrane site (lanes 3), and vP1145 expressing the gB without transmembrane and with altered cleavage sites (lanes 4) derived; furthest right track contains molecular weight markers);

53A and B show vaccinia infection of Vero and HeLa cells, detected by expression of vaccinia "early" protein E3L (cell fractions from infected cells, radiolabelled with [35 S] -methionine, were immunoprecipitated with rabbit anti-p25 (E3L) showing Vero (A) and HeLa cell fractions (B) derived from infections with vP993 (lanes 1), vP1126 (lanes 2), vP1128 (lanes 3) and vP1145 (lanes 4); furthest right track contains molecular weight markers);

54 shows a comparison of CMV gB production by Vero, HeLa and MRC-5 cells (SDS-PAGE and Western blot analysis were performed on the medium of MRC-5 cells (lanes 1, 4), Vero Cells (lanes 2, 5) or HeLa cells (lanes 3, 6) after infection with vP1145 (lanes 1, 2, 3) or vP993 (lanes 4, 5, 6); CMV gB was detected with monoclonal CH380; Molecular weight markers are present in lane M);

55 Figure 4 shows immunoprecipitation of CMV-gB by a panel of monoclonal antibodies and guinea pig anti-gB (radiolabelled medium fractions from Vero cells infected with vP993 (lanes 1), vP1126 (lanes 2), vP1128 (lanes 3) and vP1145 (lanes 4) were immunoprecipitated with guinea pig anti-CMV gB or with monoclonal [antibodies] 13-127, 13-128, CH380, HCMV 34 or HCMV 37, the leftmost lane containing molecular weight markers);

56 Figure 3 shows Western blot analysis of fractions and bed material from CMV gB immunoaffinity chromatography columns (column 19 fractions containing eluting gB (lane 5), flow-through material (lane 6) and impure gB material applied to the column ( Lane 7) were analyzed by SDS-PAGE and Western blot using monoclonal [antibody] CH380 and included in the assay were bed material from column 19 (lane 2) and column 11 (lane 3) and gB which was column 7 (lane 4); molecular weight markers are present in lane 1);

57 Figure 4 shows an SDS-PAGE analysis of CMV-gB eluted from an immunoaffinity chromatography column (fractions 8.16 to 8.22, eluted from column 8, electrophoretically separated on a 10% gel under reducing conditions and stained with silver);

58 Figure 4 shows the SDS-PAGE analysis of five batches of immunoaffinity-purified CMV-gB (Samples 1-5, lanes 1-5) were electrophoresed on a 10% gel under reducing conditions and stained with Coomassie blue; M contains molecular weight markers);

59 . 59A show the characterization of immunoaffinity-purified CMV gB (approach 5, analyzed by SDS-PAGE, as shown in FIG 58A and B, was scanned with a densitometer and bands were defined (lane 7, marks 1-8), where 59A a densitometer recording by the track 7 shows);

60A and B show immunoblot analysis of immunoaffinity purified CMV gB (purified HIV env (lanes 1), affinity purified CMV gB (lanes 2), impure CMV gB (lane B3) or monoclonal CH380 (lane A3) were electrophoresed on a 10% gel, blotted onto nitrocellulose paper and probed for the presence of mouse IgG H and L chains or CMVgB using goat anti-mouse IgG (A) and monoclonal CH380 (B), respectively Molecular weight markers are present in lanes 4);

61A and B show the immunoprecipitation / immunoblot analysis of immunoaffinity purified gB (Lane 1 of immunoaffinity purified gB (1) or impure gB (B) was mixed with the monoclonal [Antibodies] CH380 (Lanes 1), 13-127 (Lanes 2), 13-128 (lanes 3), HCMV 37 (lanes 4) or HCMV 34 (lanes 5), the immunoprecipitates were electrophoretically separated on a 10% gel under reducing conditions, blotted to nitrocellulose and probed for the presence of gB, Guinea pig anti-CMB gB was used; the leftmost lanes are molecular weight markers);

62A and B show immunoblot analysis of affinity-purified CMV gB (Vero cell lysates (lanes A3, B2), CEF lysates (lane A2), vaccinia-infected Vero cells (lane B3), murine CMV gB (lanes 4), affinity purified CMV gB (lanes 5) or purified HIV env (lanes 6) were electrophoresed on a 10% gel under reducing conditions, blotted to nitrocellulose and assayed for the presence of Vero cell proteins using rabbit anti -Vero cells (A) or probed for vaccinia proteins using rabbit anti-vaccinia (B); molecular weight markers are present in lanes 1);

63A -C show the DNA sequence of the H6 promoter-directed HCMVpp65 and the 42K promoter-directed HCMVpp150 and ALVAC sequences flanking the C6 locus (SEQ ID NO: 188) (the 5 'end of the H6 promoter-targeted CMVpp65 at position 496. The CMVpp65 coding sequence extends from position 620 to 2302. The 5 'end of the 42K promoter-directed CMVpp150 is at position 2341. The CMVpp150 coding sequence extends from position 2406 to 5543);

64A and B show the DNA sequence of a 5798 bp fragment of canarypox DNA containing the C ₇ ORF (tk) (SEQ ID NO: 189) (the C ₇ ORF starts at position 4412 and ends at the Position 4951);

65A and B show the DNA sequence of the H6 promoter-directed HCMVgL gene and ALVAC sequences flanking the C ₇ locus (the 5 'end of the H6 promoter-directed CMVgL gene is at position 2136. The CMVgL coding sequence extends from heading 2260 to 3093);

66A and B show the DNA sequence of the H6 promoter-gated HCMVgL gene and the H6 promoter-gated HCMV IE1 exon4 gene and ALVAC sequences flanking the C ₇ locus (SEQ ID NO: 190) (U.S. The 5'-end of the H6 promoter-directed CMVgL gene is at position 3476. The CMVgL coding region extends from position 3600 to 4433. The 5 'end of the H6 promoter-directed IE1 exon 4 is at position 3469. The CMV -IE1-exon4 coding region extends from position 3345 to 2128);

67 shows the DNA sequence of HCMVgH (SEQ ID NO: 191) (Towne strain) in which its transmembrane region and cytoplasmic tail were deleted; and

68A and B show the DNA sequence of the H6 promoter-gated HCMVgL gene and the 42K promoter-gated truncated HCMVgH gene and NYVAC sequences flanking the ATI locus (SEQ ID NO: 191) (the 5 'end The CMVgL coding region extends from position 2793 to 3626. The 5 'end of the 42K promoter-driven, truncated CMVgH gene is at position 2650. The truncated CMVgH coding sequence extends from position 2584 to 434).

DETAILED DESCRIPTION OF THE INVENTION

To develop a new vaccinia vaccine strain, NYVAC (vP866), the Copenhagen vaccine strain of vaccinia virus was modified by the deletion of six non-essential regions of the genome encoding known or potential virulence factors. The sequential deletions are described in detail below (See U.S. Patent No. 5,364,773 ). All designations of restriction fragments, open reading frames and nucleotide positions of vaccinia are based on the terminology listed in Goebel et al., 1990a, b.

The Deletion loci were also used as recipient loci for the insertion of foreign genes constructed.

• (1) Thymidinkinasegen (TK; J2R) vP410;
• (2) hämorrhagische Region (u; B13R + B14R) vP553;
• (3) Einschlusskörper-Region vom Typ A (ATI; A26L) vP618;
• (4) Hämagglutiningen (HA; A56R) vP723;
• (5) Wirtsbereich-Gen-Region (C7L-K1L) vP804; und
• (6) große Ribonukleotidreduktase-Untereinheit (I4L) vP866 (NYVAC).

The NYVAC deleted regions are listed below. Also listed are the abbreviations and designations of open reading frames for the deleted regions (Goebel et al., 1990a, b) and the designation of the vaccinia recombinant (vP), which contains all deletions up to the indicated deletion:

• (1) thymidine kinase gene (TK; J2R) vP410;
• (2) hemorrhagic region (and B13R + B14R) vP553;
• (3) inclusion body type A region (ATI; A26L) vP618;
• (4) hemagglutinin (HA; A56R) vP723;
• (5) host region gene region (C7L-K1L) vP804; and
• (6) Large ribonucleotide reductase subunit (I4L) vP866 (NYVAC).

NYVAC is a genetically engineered vaccinia virus strain which is characterized by generates the specific deletion of eighteen open reading frames which encode gene products, some of which are virulence and the host range (Tartaglia et al., 1992, Goebel et al., 1990a, b). The deletion of the host range gene diminished the ability of the virus, to replicate in tissue culture cells that are made from certain Species such as pig and human are derived (Tartaglia et al., 1992; Perkus et al., 1990). In addition to the reduced Replication competence, it has been shown that NYVAC is highly attenuated, by a number of criteria, including (a) Lack of hardening or ulceration on rabbit skin, (b) rapid removal of the Site of inoculation; (c) high level of avirulence on intracranial inoculation in newborn mice in comparison with other vaccinia strains, including WYETH, and (d) failure, death, secondary damage or a disseminated infection with intraperitoneal inoculation in immunocompromised animals (Tartaglia et al., 1992). Despite the strongly weakened features from NYVAC were NYVAC based Recombinants for protection of mice before a Rabies challenge (Tartaglia et al., 1992), by pigs facing a challenge with the Japanese Encephalitis virus and pseudorabies virus challenge (Brockmeier et al., 1993; Konishi et al., 1992) and horses facing a challenge with the equine influenza virus (Taylor et al., 1993).

NYVAC is also highly attenuated according to a number of criteria, including i) decreased virulence following intracerebral inoculation in neonatal mice, ii) harmlessness in genetically (nu ⁺ / nu ⁺ ) or chemically (cyclophosphamide) immunocompromised mice, iii) failure, a iv) lack of significant hardening and ulceration on rabbit skin, v) rapid removal from the site of inoculation, and vi) greatly reduced replication competence on a number of tissue culture cell lines, including those of human origin , Nonetheless, NYVAC-based vectors induce excellent responses to extrinsic immunogens and provided protective immunity.

Avipox virus based Recombinants as living vectors see a further approach to Development of recombinant subunit vaccines. These Viruses are characterized by their ability to only replicable in bird species, naturally restricted. TROVAC indicates a weakened Fowlpox, which was a plaque-cloned isolate derived the FP-1 vaccine strain of Fowlpox virus, which is responsible for the Vaccination of chickens is allowed with an age of 1 day.

ALVAC is an attenuated canarypox virus-based vector which was a plaque-cloned derivative of the approved canarypox vaccine Kanapox (Tartaglia et al., 1992). ALVAC has some common properties, which are the same as some general features of Kanapox. ALVAC-based recombinant viruses expressing extrinsic immunogens have also been shown to be effective vaccine vectors (Tartaglia et al., 1993a, b). For example, mice immunized with an ALVAC recombinant expressing the Rabies virus glycoprotein were protected from lethal challenge with Rabies virus (Tartaglia et al., 1992), suggesting the potential for ALVAC as Vaccine vector clarifies. ALVAC-based recombinants have also been found in dogs challenged with canine Distemper virus (Taylor et al., 1992) and Rabies virus (Perkus et al., 1994) in feline leukemia virus challenged cats ( Tartaglia et al., 1993b), and in horses challenged with equine influenza virus (Taylor et al., 1993).

This avipox vector is limited to bird species for productive replication. On human cell cultures, canarypox virus replication is aborted early in the viral replication cycle, prior to viral DNA synthesis. Nonetheless, when manipulated to express extrinsic immunogens, authentic expression and processing is observed in vitro in mammalian cells, and inoculation into numerous mammalian species induces antibody and cellular immune responses against the extrinsic immunogen and provides protection against challenge with the associated pathogen (Taylor et al., 1992; Taylor et al., 1991b). Recent phase I clinical trials in both Europe and the United States for canarypox / rabies glycoprotein recombinant (ALVAC-RG; vCP65) demonstrated that the experimental vaccine was well tolerated and induced protective levels of Rabies virus neutralizing antibody titer ( Cadoz et al., 1992; Fries et al., 1992). In fact, reactogenicity in volunteers following administration of ALVAC-RG was minimal; and following two administrations of ALVAC-RG at a dose of 10 ^5.5 TCID ₅₀ , all vaccinated individuals developed Rabies neutralizing antibodies. In addition, peripheral blood mononuclear cells (PBMCs) derived from the subjects vaccinated with ALVAC-RG showed significant levels of lymphocyte proliferation when stimulated with purified Rabies virus (Fries et al., 1992).

A ALVAC recombinant expressing the HIV envelope glycoprotein gp160 (ALVAC-HIV; vCP125), is in a phase I clinical trial on humans in a prime / boost / rejuvenation protocol with recombinant gp160 (Pialoux et al., 1995). The reactogenicity in volunteers following the administration of ALVAC-HIV was minimal, and this vaccine candidate primed both humoral as well as cell-mediated HIV-1 envelope-specific Immune responses.

recent Research has indicated that a Prime / Boost protocol, wherein an immunization with a poxvirus recombinant, which expresses a foreign gene product, a boost using a purified subunit preparation form This gene product follows, an increased immune response in relation to the response causes, which with each product alone is caused. Human volunteers treated with a vaccinia recombinant, the HIV-1 envelope glycoprotein expressed, immunized and purified with a purified HIV-1 envelope glycoprotein subunit preparation Refreshed or boosted, show higher HIV-1 neutralizing antibody titers as persons using only the vaccinia recombinant or purified Envelope glycoprotein alone (Graham et al., 1993; Cooney et al., 1993). People receiving two injections of an ALVAC HIV-1 env recombinant (vCP125) failed to develop HIV-specific antibodies. Boosting with purified rgp160 from a vaccinia virus recombinant led to detectable, HIV-1 neutralizing antibodies. In addition, the specific was Lymphocyte T cell proliferation against rgp160 by the booster significantly increased with rgp160. Specific Case cytotoxic lymphocyte activity was also detected with this vaccination schedule (Pialoux et al., 1995). Macaques immunized with a vaccinia recombinant which were the monkey immunodeficiency virus (SIV) envelope glycoprotein and with SIV envelope glycoprotein from a baculovirus recombinant have been boosted SIV challenge protected (Hu et al., 1991, 1992). In the same way can purified HCMVgB protein in prime / boost protocols with NYVAC or ALVAC gB recombinants be used.

NYVAC, ALVAC and TROVAC are also considered to be unique among them All poxviruses have been recognized as being the "Recombinant DNA Advisory Committee" of the National Institutes of Health ("NIH") (U.S. Service), which guidelines for the physical containment or closure of genetic material such as viruses and vectors, d. H. Guidelines for safety procedures in the application of such viruses and vectors, depending on the pathogenicity of each Virus or vector based releases, a downgrade in the physical containment class of Granted BSL2 to BSL1. No other poxvirus has a class of physical containment of BSL1 on. Even the Copenhagen strain of vaccinia virus - the usual smallpox vaccine - owns a higher one Class of physical containment, namely BSL2. Accordingly, became recognized in the field that NYVAC, ALVAC and TROVAC a lower pathogenicity as any other poxvirus.

CMV is a common cause of morbidity and mortality in AIDS patients, recipients of bone marrow transplants, and patients receiving immunosuppressant therapies for neoplastic disease be subjected to severe diseases. There is no effective, well-tolerated pharmaceutical therapy for CMV infection. One approach could be the ex vivo stimulation of CMV-specific donor CTLs for the treatment and control of the often fatal pneumonia caused by CMV infection in recipients of a bone marrow transplant. In fact, the treatment and control of human CMV infection by adoptive transfer of CMV-CTL clones has been successfully demonstrated (Riddell et al., 1992). In this case, however, CMV has been used to stimulate and maintain the CMV-specific CTL clones used in this therapeutic protocol. The use of CMV for the purpose of ex vivo stimulation of CTL clones has its disadvantages, the most obvious being the possibility of introducing additional CMV into an immunocompromised patient. The availability of immunotherapeutic agents that provide a safe and acceptable method for stimulating antigen-specific cellular immune effector activities appears to be a major deficiency in the area of adoptive immunotherapy. Protein subunits, while potentially safe, are notoriously unsuitable for stimulating CTLs. Peptides, which are generally considered safe and yet effective in stimulating a CTL response, are highly limited in their ability to stimulate CTL responses. Peptides are typically only capable of inducing a CTL response against only one CTL epitope of many possible CTL epitopes contained within a single protein. In addition, peptides typically stimulate CTL responses only in a limited proportion of the population, limited only to those individuals expressing a particular major allele of the human major histocompatibility complex (MHC). Recombinant virus vectors are considered to be excellent inducers of CTL reactivities because they are capable of expressing all of the antigen, thereby not being limited to a single epitope for a single segment of the population. However, most of these virus vectors, such as adenovirus, are capable of replication and are not considered safe for use in this type of protocol. Because ALVAC recombinants do not replicate in mammalian cells, but are capable of stimulating antigen-specific CTL responses, as shown by data contained within this patent application, ALVAC recombinants represent a unique safe and effective method for the ex vivo. Stimulation of virus-specific CTL clones for use in immunotherapeutic applications.

These Invention relates to NYVAC, ALVAC and vaccinia (WR strain) recombinants, containing the HCMV genes, the gB, gH, gL, pp150, pp65 and IE1, including truncated versions thereof, which are further described in the examples below become.

In clearly based on the attenuation profiles of NYVAC, ALVAC and TROVAC vectors and their proven ability to both humoral and cellular to elicit immunological responses to extrinsic immunogens (Tartaglia et al., 1993a, b; Taylor et al., 1992; Konishi et al., 1992), such recombinant viruses offer a clear advantage over previously described recombinant viruses Vaccinia-based viruses.

The Administration procedure for Recombinant virus or expression products thereof, compositions invention, such as immunological, antigenic or vaccine compositions or therapeutic compositions, may by parenteral Pathway (intradermal, intramuscular or subcutaneous). Such Allows administration a systemic immune response.

More generally, the antigenic, immunological or vaccine compositions or therapeutic compositions (compositions containing the poxvirus recombinants of the invention) of the invention may be prepared according to standard techniques well known to those skilled in the pharmaceutical art. Such compositions may be administered in dosages and by techniques well known to those skilled in the medical arts, taking into account such factors as the age, sex, weight and condition of the particular patient, and the route of administration. The compositions may be administered alone in seropositive individuals or may be co-administered or sequentially administered with compositions of the invention or with other immunological, antigenic or vaccine or therapeutic compositions. The compositions may be administered alone in seronegative individuals or may be co-administered or sequentially administered with compositions of the invention or with other antigenic, immunological, vaccine or therapeutic compositions. Such other compositions may include purified antigens from HCMV or from the expression of such antigens by a recombinant poxvirus or other vector system, or such other compositions may include a recombinant poxvirus that expresses other HCMV antigens or biological response response modifiers such factors as the age, gender, weight and condition of each patient and the route of administration are taken into account.

Examples Compositions of the invention include liquid preparations for administration to e.g. As oral, nasal, anal, vaginal openings, etc., such as suspensions, Syrups or elixirs; and preparations for the parenteral, subcutaneous, intradermal, intramuscular or intravenous Administration (eg, injectable administration), such as sterile suspensions or emulsions. In such compositions, the recombinant Poxvirus in admixture with a suitable carrier, diluent or excipients, such as sterile water, physiological saline, glucose or the like.

Further can the products of expression of the recombinant poxviruses of the invention be used directly to an immune response in either seronegative or seropositive. To stimulate individuals or in animals. Consequently can the expression products in compositions of the invention instead of or additionally to the recombinant according to the invention Poxvirus in the aforementioned Compositions are used.

Furthermore stimulate the recombinant according to the invention Poxvirus and the expression products thereof an immune or antibody response in humans and animals, and therefore these products are antigens. From these antibodies or antigens, by general techniques known in the art, monoclonal antibodies are produced and these monoclonal antibodies or the antigens can be expressed in well-known antibody binding assays, diagnostic Kits or tests are used to detect the presence or absence of particular HCMV antigen (s) and therefore the presence or absence of the virus or the expression of the antigen (s) (in HCMV or others Systems), or merely to determine if an immune response against the virus or antigen (s) has been stimulated. These monoclonal antibody or the antigens can also in an immunoadsorbent chromatography can be used to HCMV or expression products of the recombinant according to the invention To recover or isolate poxvirus.

• (i) Induzierung einer immunologischen Antwortreaktion in seronegativen Individuen (Anwendung als oder als Teil eines Impfstoff-Schemas);
• (ii) Therapie in seropositiven Individuen; und
• (iii) Methode zur Erzeugung von HCMV-Protein in vitro ohne Gefahr einer Virusinfektion.

More specifically, the recombinants and compositions of the present invention have numerous applications, including:

• (i) inducing an immunological response in seronegative individuals (used as or as part of a vaccine schedule);
• (ii) therapy in seropositive individuals; and
• (iii) Method of producing HCMV protein in vitro without risk of virus infection.

The Products of the expression of the recombinant poxvirus according to the invention can be used directly to an immune response in either seronegative or seropositive persons or in animals. Therefore can the expression products in compositions of the invention instead from or in addition to the recombinant according to the invention Poxvirus can be used.

Furthermore stimulate the recombinant according to the invention Poxvirus and the expression products thereof an immune or antibody response in humans and animals. These antibodies can be synthesized by the art known techniques, monoclonal antibodies are produced, and these monoclonal antibodies or the expression products of the poxvirus according to the invention and composition can in well known antibody binding assays, Diagnostic kits or tests are used to detect the presence or absence of particular HCMV antigen (s) or antibody (s) and therefore, to determine the presence or absence of the virus, or just to determine if an immune response to the virus or the antigen (s) has been stimulated. These monoclonal antibodies can also used in an immunoadsorbent chromatography to HCMV or expression products of the recombinant poxvirus according to the invention to win, isolate or prove. Process for the preparation of monoclonal antibodies and for Applications of Monoclonal Antibodies, and Applications and methods for HCMV antigens - the Expression products of the poxvirus according to the invention and composition - are the One of ordinary skill in the art is well-known in the art. You can in diagnostic procedures, kits, tests or assays, and for the recovery of Materials by immunoadsorbent chromatography or by immunoprecipitation.

Monoclonal antibodies are immunoglobulins produced by hybridoma cells. A monoclonal antibody reacts with a single antigenic determinant and provides greater specificity than a conventional serum-derived antibody. In addition, the screening of a large number of monoclonal antibodies makes it possible to obtain an individual antibody of the desired species selectivity, binding ability and desired isotope. Hybridoma cell lines provide a constant, inexpensive source of chemically identical antibodies, and preparations of such antibodies can be readily standardized. Methods of producing monoclonal antibodies are well known to those of ordinary skill in the art, e.g. Koprowski, H., et al., U.S. Patent No. 4,196,265 , which was granted on April 1, 1989.

Applications of monoclonal antibodies are known. Such an application consists in diagnostic procedures, e.g. David, G., and Greene, H., U.S. Patent No. 4,376,110 , which was granted on March 8, 1983.

monoclonal antibody have also been used to materials by immunoadsorbent chromatography to win, for. B. Milstein, C., 1980, Scientific American 243: 66, 70.

henceforth can the recombinant of the invention Pox virus or expression products thereof are used to a response in cells in vitro or ex vivo for subsequent reinfusion to stimulate in a patient. If the patient is seronegative reinfusion serves to stimulate an immune response, e.g. B. an immunological or antigenic response, such as active immunization. In a seropositive individual, the Reinfusion to stimulate or boost the immune system against HCMV.

consequently For example, the recombinant poxvirus of the invention has several applications in: antigenic, immunological or vaccine compositions, such as for administration to seronegative individuals. In therapeutic Compositions in seropositive individuals undergoing therapy require, to stimulate or boost the immune system against HCMV. In in vitro for generating antigens which are further expressed in antigenic, immunological or vaccine compositions or in therapeutic compositions. To the Generating antibodies (either by direct administration or by administration of a Expression product of the recombinant poxvirus according to the invention) or of expression products or antigens which continue to be used can be: in diagnosis, tests or kits to detect the presence or Absence of antigens in a sample, such as serums, for detecting the presence or absence of HCMV in one Sample, such as sera, or to determine if an immune response is against the virus or against particular antigen (s) has been caused; or in immunoadsorbent chromatography, immunoprecipitation and the same.

Furthermore For example, the recombinant poxviruses of the invention are useful for Generation of DNA for Probes or for PCR primers which can be used to detect the presence or Absence of hybridisable DNA detect or to DNA amplify, for. B. to detect HCMV in a sample or Amplifying HCMV DNA.

Other Applicability also exists for embodiments of the invention.

One better understanding The present invention and its many advantages will be apparent from the following examples, which are for illustration are indicated.

EXAMPLES

DNA cloning and synthesis. Plasmids were constructed by standard procedures screened and bred (Maniatis et al., 1982; Perkus et al., 1985; Piccini et al., 1987). Restriction endonucleases were purchased from Bethesda Research Laboratories, Gaithersburg, MD, New England Biolabs, Beverly, MA; and Boehringer Mannheim Biochemicals, Indianapolis, IN. The Klenow fragment E. coli polymerase was from Boehringer Mannheim Biochemicals receive. BAL-31 exonuclease and phage T4 DNA ligase were generated from New England Biolabs received. The reagents were used as it was stated by the different manufacturers.

Synthetic oligodeoxyribonucleotides were prepared on a Biosearch 8750 or Applied Biosystems 380B DNA synthesizer as previously described (Perkus et al., 1989). DNA sequencing was performed by the dideoxy chain termination method (Sanger et al., 1977) using Sequenase (Tabor et al., 1987) as previously described (Guo et al., 1989). DNA sequencing using polymerase chain reaction (PCR) sequence confirmation (Engelke et al., 1988) was performed using tailor-made oligonucleotide primers and the GeneAmp DNA amplification reagent kit (Perkin Elmer Cetus, Norwalk, CT) in an automated DNA library. Thermocycler performed by Perkin Elmer Cetus. Excess DNA sequences were deleted from plasmids by restriction endonuclease digestion, followed by limited digestion with BAL-31 exonuclease and mutagenesis (Mandecki, 1986) using synthetic oligonucleotides.

cells, Virus and transfection. The origins and conditions of cultivation of the Copenhagen strain of vaccinia virus have been previously described (Guo et al., 1989). The production of recombinant virus by recombination, In situ hybridization of nitrocellulose filters and screening for B-galactosidase activity take place as before (Piccini et al., 1987).

The origins and conditions of cultivation of the Copenhagen strain of vaccinia virus and NYVAC are earlier (Guo et al., 1989; Tartaglia et al., 1992). The Recombinant virus production by recombination, in situ hybridization of nitrocellulose filters and screening for B-galactosidase activity like in old times (Panicali et al., 1982; Perkus et al., 1989).

The Parental canarypox virus (Rentschler strain) is a vaccine strain for canaries. Of the Vaccine strain was obtained from a wild type isolate and by toned down more than 200 serial passages on chick embryo fibroblasts. One Master virus seed germ was four consecutive plaque cleanings under agar, and one plaque clone was replaced by five additional ones Passengers amplified, after which the source stock virus as the parental virus was used in in vitro recombination assays. The plaque-purified canarypox isolate is referred to as ALVAC.

Of the Strain of fowlpox virus (FPV), which is called FP-1, is earlier have been described (Taylor et al., 1988a). It is a attenuated Vaccine strain that useful for the vaccination of chickens is one day old. The parent virus strain Duvette was obtained in France as a fowlpox scab from a chicken. The virus was killed by about 50 serial passages in embryonated chicken eggs, followed by 25 passages on chicken embryo fibroblast cells weakened. The virus became four subsequent Plaque purifications subjected. A plaque isolate was further amplified in primary CEF cells, and a source stock virus, designated TROVAC, has been set up.

The viral vectors NYVAC, ALVAC and TROVAC and their derivatives were multiplied, as before (Piccini et al., 1987; Taylor et al., 1988a, b). Vero cells and chicken embryo fibroblasts (CEF) were multiplied, as before (Taylor et al., 1988a, b).

With respect to NYVAC and especially Examples 1 to 6, reference will be made to U.S. Patent No. 5,364,773 taken.

EXAMPLE 1 - CONSTRUCTION OF PLASMID pSD460 FOR DELETION OF THYMIDINE KINASE (J2R)

With reference to the 1 contains the plasmid pSD406 vaccinia-HindIII-J (Pos. 83359-88377), cloned in pUC8. pSD406 was cut with HindIII and PvuII, and the 1.7 kb fragment from the left side of HindIII-J was cloned into pUC8 which had been cut with HindIII / SmaI to form pSD447. pSD447 contains the entire gene for J2R (Pos. 83855-84385). The initiation codon is contained within a NlaIII site and the termination codon is contained within an SspI site. The direction of transcription is in 1 indicated by an arrow.

wurden mit dem 0,5 kb großen HindIII/NlaIII-Fragment in das pUC18-Vektorplasmid ligiert, welches mit HindIII/EcoRI geschnitten worden war, wodurch man das Plasmid pSD449 erzeugte.To obtain a left flanking arm, a 0.8 kb HindIII / EcoRI fragment was isolated from pSD447, then digested with NlaIII, and a 0.5 kb HindIII / NlaIII fragment was isolated. The annealed synthetic oligonucleotides MPSYN43 / MPSYN44 (SEQ ID NO: 1 / SEQ ID NO: 2)

were ligated with the 0.5 kb HindIII / NlaIII fragment into the pUC18 vector plasmid which had been cut with HindIII / EcoRI to produce plasmid pSD449.

ligiert, wodurch man pSD459 erzeugte.To obtain a restriction fragment containing a right flanking vaccinia arm and pUC vector sequences, pSD447 was probed with SspI (partially) within the vaccinia sequences and with HindIII was cut at the pUC / vaccinia junction and a 2.9 kb vector fragment was isolated. This vector fragment was labeled with the annealed synthetic oligonucleotides MPSYN45 / MPSYN46 (SEQ ID NO: 3 / SEQ ID NO: 4).

ligated, generating pSD459.

als Primer synthetisiert. Rekombinantes Virus vP410 wurde durch Plaque-Hybridisierung identifiziert.To combine the left and right flanking arms into a plasmid, a 0.5 kb HindIII / SmaI fragment from pSD449 was isolated and ligated with the pSD459 vector plasmid cut with HindIII / SmaI to give plasmid pSD460 produced. pSD460 was used as a donor plasmid for recombination with wild-type parental vaccinia virus Copenhagen strain VC-2. ³² P-labeled probe was prepared by primer extension using MPSYN45 (SEQ ID NO: 3) as template and the complementary 20mer oligonucleotide MPSYN47 (SEQ ID NO: 5).

synthesized as a primer. Recombinant virus vP410 was identified by plaque hybridization.

EXAMPLE 2 - CONSTRUCTION OF PLASMIDE pSD486 FOR THE DELETION OF THE HAMORRHAGIC REGION (B13R + B14R)

With reference to the 2 contains the plasmid pSD419 Vaccinia-SalI-G (Pos. 160744-173351), cloned in pUC8. pSD422 contains the adjacent vaccinia SalI fragment to the right, SalI-J (Pos. 173351-182746), cloned into pUC8. To construct a plasmid in which the hemorrhagic region u, B13R-B14R (pos 172549-173552) is deleted, pSD419 was used as the source for the left flanking arm, and pSD422 was used as the source for the right flanking arm , The direction of transcription for the u region is in the 2 indicated by an arrow.

ligiert, wodurch man pSD479 erzeugt. pSD479 enthält ein Initiationscodon (unterstrichen), gefolgt von einer BamHI-Stelle. Um E. coli-Beta-Galactosidase in dem B13-B14(u)-Deletions-Locus unter die Steuerung des u-Promotors zu platzieren, wurde ein 3,2 kb großes BamHI-Fragment, enthaltend das Beta-Galactosidase-Gen (Shapira et al., 1983), in die BamHI-Stelle von pSD479 inseriert, wodurch man pSD479BG erzeugte. pSD479BG wurde als Donorplasmid für die Rekombination mit Vaccinia-Virus vP410 verwendet. Rekombinantes Vaccinia-Virus vP533 wurde als ein blauer Plaque in Gegenwart von chromogenem Substrat X-gal isoliert. In vP533 ist die B13R-B14R-Region deletiert und ist durch Beta-Galactosidase ersetzt.In order to remove unwanted sequences from pSD419, the sequences to the left of the NcoI site (Item 172253) were removed by digestion of pSD419 with NcoI / SmaI, followed by blunt-ended sequences with Klenow fragment of E. coli polymerase and Ligation, producing plasmid pSD476. A right flanking vaccinia arm was obtained by digestion of pSD422 with HpaI at the termination codon of B14R and digestion with NruI 0.3 kb to the right. This 0.3 kb fragment was isolated and ligated with a 3.4 kb HincII vector fragment isolated from pSD476 to generate plasmid pSD477. The location of the partial deletion of the vaccinia u region in pSD477 is indicated by a triangle. The remaining B13R coding sequences in pSD477 were removed by digestion with ClaI / HpaI and the resulting vector fragment was annealed with the annealed synthetic oligonucleotides SD22mer / SD20mer (SEQ ID NO: 6 / SEQ ID NO: 7).

ligated, generating pSD479. pSD479 contains an initiation codon (underlined) followed by a BamHI site. To place E. coli beta-galactosidase in the B13-B14 (u) deletion locus under the control of the u promoter, a 3.2 kb BamHI fragment containing the beta-galactosidase gene (Shapira et al., 1983), into the BamHI site of pSD479, generating pSD479BG. pSD479BG was used as a donor plasmid for recombination with vaccinia virus vP410. Recombinant vaccinia virus vP533 was isolated as a blue plaque in the presence of chromogenic substrate X-gal. In vP533, the B13R-B14R region is deleted and replaced by beta-galactosidase.

ligiert, wodurch man das Plasmid pSD478 erzeugte. Als Nächstes wurde die EcoRI-Stelle an der pUC/Vaccinia-Grenzstelle durch Verdau von pSD478 mit EcoRI zerstört, gefolgt von Erzeugen glatter Enden mit Klenow-Fragment von E. coli-Polymerase und Ligation, wodurch man das Plasmid pSD478E^– erzeugte. pSD478E^– wurde mit BamHI und HpaI verdaut und mit den annealten synthetischen Oligonukleotiden HEM5/HEM6 (SEQ. ID. Nr.: 10/SEQ. ID. Nr.: 11)

ligiert, wodurch man das Plasmid pSD486 erzeugt. pSD486 wurde als Donorplasmid für die Rekombination mit rekombinantem Vaccinia-Virus vP533 verwendet, wodurch man vP553 erzeugte, welches als ein klarer Plaque in Gegenwart von X-gal isoliert wurde.To remove beta-galactosidase sequences from vP533, plasmid pSD486, a derivative of pSD477, containing a polylinker region but no initiation codon at the u-deletion interface was used. First, the ClaI / HpaI vector fragment from pSD477 referred to above was ligated with the annealed synthetic oligonucleotides SD42mer / SD40mer (SEQ ID NO: 8 / SEQ ID NO: 9).

ligated to produce plasmid pSD478. Next the EcoRI site at the pUC / vaccinia boundary site was destroyed by digestion of pSD478 with EcoRI followed by creating blunt ends with Klenow fragment of E. coli polymerase and ligation, yielding the plasmid pSD478E ^- generated. pSD478E ^- was digested with BamHI and HpaI and annealed with the synthetic oligonucleotides HEM5 / HEM6 (SEQ ID NO: 10 / SEQ ID NO: 11).

ligated, creating the plasmid pSD486. pSD486 was used as a donor plasmid for recombination with recombinant vaccinia virus vP533, producing vP553, which was isolated as a clear plaque in the presence of X-gal.

EXAMPLE 3 - CONSTRUCTION OF PLASMID pMP494Δ ZUR DELETION OF THE ATI REGION (A26L)

ligiert, wodurch die Region stromaufwärts von A26L rekonstruiert wurde und der A26L-ORF mit einer kurzen Polylinkerregion ersetzt wurde, enthaltend die Restriktionsstellen BglII, EcoRI und HpaI, wie oben angegeben. Das resultierende Plasmid wurde als pSD485 bezeichnet. Da die BglII- und EcoRI-Stellen in der Polylinkerregion von pSD485 nicht einmalig sind, wurden unerwünschte BglII und EcoRI-Stellen aus dem Plasmid pSD483 (oben beschrieben) durch Verdauen mit BglII (Pos. 140136) und mit EcoRI an der pUC/Vaccinia-Grenzstelle, gefolgt von Erzeugen glatter Enden mit Klenow-Fragment von E. coli-Polymerase und Ligation, entfernt. Das resultierende Plasmid wird als pSD489 bezeichnet. Das 1,8 kb große ClaI (Pos. 137198)/EcoRV (Pos. 139048)-Fragment aus pSD489, welches den A26L-ORF enthält, wurde mit dem entsprechenden 0,7 kb großen Polylinker-enthaltenden ClaI/EcoRV-Fragment aus pSD485 ersetzt, wodurch man pSD492 erzeugte. Die BglII- und EcoRI-Stellen in der Polylinkerregion von pSD492 sind einmalig.With reference to 3 contains pSD414 SalI-B, cloned in pUC8. In order to remove unwanted DNA sequences to the left of the A26L region, pSD414 was cut with XbaI within the vaccinia sequences (heading 137079) and with HindIII at the pUC / vaccinia junction, then with Klenow fragment from E. coli polymerase blunt ended and ligated, resulting in plasmid pSD483. To remove desired vaccinia DNA sequences to the right of the A26L region, pSD483 was cut with EcoRI (position 140665 and at the pUC / vaccinia junction) and ligated to form the plasmid pSD484. To remove the A26L coding region, pSD484 was cut with NdeI (partially) just upstream of the A26L ORF (position 139004) and with HpaI (position 137889) just downstream of the A26L ORF. The 5.2 kb vector fragment was isolated and annealed with the synthetic oligonucleotides ATI3 / ATI4 (SEQ ID NO: 12 / SEQ ID NO: 13).

which reconstructed the region upstream of A26L and replaced the A26L ORF with a short polylinker region containing the restriction sites BglII, EcoRI and HpaI as indicated above. The resulting plasmid was named pSD485. Since the BglII and EcoRI sites in the polylinker region of pSD485 are not unique, undesired BglII and EcoRI sites were isolated from plasmid pSD483 (described above) by digestion with BglII (Pos. 140136) and EcoRI at the pUC / vaccinia. Bound site, followed by blunt-ending with Klenow fragment of E. coli polymerase and ligation. The resulting plasmid is referred to as pSD489. The 1.8kb ClaI (Pos. 137198) / EcoRV (Pos. 139048) fragment from pSD489 containing the A26L ORF was digested with the corresponding 0.7 kb polylinker-containing ClaI / EcoRV fragment from pSD485 replaced, creating pSD492. The BglII and EcoRI sites in the polylinker region of pSD492 are unique.

A 3.3 kb in size BglII cassette containing the E. coli beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11kDa promoter (Bertholet et al., 1985; Perkus et al., 1990), was inserted into the BglII site of pSD492, forming pSD493KBG. The plasmid pSD493KBG was used in a recombination with rescue virus vP553. Recombinant vaccinia virus vP581 containing beta-galactosidase in containing the A26L deletion region was termed a blue plaque isolated in the presence of X-gal.

deletiert. Im resultierenden Plasmid pMP494Δ ist Vaccinia-DNA, umfassend die Positionen [137889-138937], was den gesamten A26L-ORF einschließt, deletiert. Eine Rekombination zwischen dem pMP494Δ und der Beta-Galactosidase enthaltenden Vaccinia-Rekombinante vP581 führte zur Vaccinia-Deletionsmutante vP618, welche als klarer Plaque in Gegenwart von X-gal isoliert wurde.To generate a plasmid for the removal of beta-galactosidase sequences from the vaccinia recombinant virus vP581, the polylinker region of plasmid pSD492 was isolated by mutagenesis (Mandecki, 1986) using the synthetic oligonucleotide MPSYN177 (SEQ. 14)

deleted. In the resulting plasmid pMP494Δ is vaccinia DNA comprising the positions [137889-138937], which includes the entire A26L ORF deleted. Recombination between the vaccinia recombinant vP581 containing pMP494Δ and the beta-galactosidase resulted in the vaccinia deletion mutant vP618, which was isolated as a clear plaque in the presence of X-gal.

EXAMPLE 4 - CONSTRUCTION OF PLASMIDE pSD467 FOR THE DELETION OF HÄMAGGLUTININGEN (A56R)

ligiert, wodurch die DNA-Sequenzen stromaufwärts des A56R-ORF rekonstruiert wurden und der A56R-ORF mit einer Polylinkerregion, wie oben angegeben, ersetzt wurde. Das resultierende Plasmid ist pSD466. Die Vaccinia-Deletion in pSD466 umfasst die Positionen [161185-162053]. Die Stelle der Deletion in pSD466 ist durch ein Dreieck in der 4 angegeben.With reference to 4 crosses the Vaccinia-SalI-G restriction fragment (Pos. 160744-173351) the HindIII-A / B-Grenzstelle (Pos. 162539). pSD419 contains vaccinia SalI-G cloned into pUC8. The direction of transcription for hemagglutinin (HA) is in 4 indicated by an arrow. HindIII-B derived vaccinia sequences were removed by digestion of pSD419 with HindIII within vaccinia sequences and at the pUC / vaccinia junction followed by ligation. The resulting plasmid, pSD456, contains the HA gene, A56R, flanked by 0.4 kb Vaccinia sequences to the left and 0.4 kb vaccinia sequences to the right. A56R coding sequences were removed by cutting pSD456 with RsaI (partial; Pos. 161090) upstream of the A56R coding sequences and with EaqI (Pos. 162054) near the end of the gene. The 3.6 kb RsaI / EaqI vector fragment from pSD456 was isolated and annealed with the annealed synthetic oligonucleotides MPSYN59 (SEQ ID NO: 15), MPSYN62 (SEQ ID NO: 16), MPSYN60 (SEQ ID No. 17) and MPSYN61 (SEQ ID NO: 18).

which reconstituted the DNA sequences upstream of the A56R ORF and replaced the A56R ORF with a polylinker region as indicated above. The resulting plasmid is pSD466. The vaccinia deletion in pSD466 comprises the positions [161185-162053]. The site of the deletion in pSD466 is indicated by a triangle in the 4 specified.

A 3.2 kb in size BglII / BamHI (partial) cassette containing the E. coli beta-galactosidase gene (Shapira et al. 1983) under the control of the vaccinia 11kDa promoter (Bertholet et al., 1985; Guo et al., 1989), was placed in the BglII site of pSD466 inserted, forming pSD466KBG. The plasmid pSD466KBG was used in a recombination with rescue virus vP618. recombinant Vaccinia virus vP708 containing beta-galactosidase in the A56R deletion, was isolated as a blue plaque in the presence of X-gal.

Beta-galactosidase sequences were deleted from vP708 using the donor plasmid pSD467. pSD467 is identical to pSD466, except that EcoRI, SmaI, and BamHI sites the pUC / vaccinia junction by digestion of pSD466 with EcoRI / BamHI, followed by blunt ending with Klenow fragment of E. coli polymerase and ligation were removed. The recombination between vP708 and pSD467 led to the recombinant vaccinia deletion mutant vP723, which isolates as a clear plaque in the presence of X-gal has been.

EXAMPLE 5 - CONSTRUCTION OF PLASMIDE pMPCSK1Δ FOR THE DELETION THE OPEN READER [C7L-K1L]

With reference to the 5 the following vaccinia clones were used in the construction of pMPCSK1Δ. pSD420 is SalI-H cloned in pUC8. PSD435 is KpnI-F cloned in pUC18. pSD435 was cut with SphI and religated to form pSD451. In pSD451, the DNA sequences to the left of the SphI site (Pos. 27416) are located in HindIII-M (Perkus et al., 1990). pSD409 is HindIII-M cloned into pUC8.

entfernt. Das resultierende Plasmid, pMP409D, enthält eine einmalige BglII-Stelle, welche in den M2L-Deletions-Locus inseriert ist, wie oben angegeben. Eine 3,2 kb große BamHI(partiell)/BglII-Kassette, welche das E. coli-Beta-Galactosidase-Gen (Shapira et al., 1983) unter der Steuerung des 11-kDa-Promotors (Bertholet et al., 1985) enthält, wurde in pMP409D, der mit BglII geschnitten worden war, inseriert. Das resultierende Plasmid pMP409DBG (Guo et al., 1990) wurde als Donorplasmid für die Rekombination mit dem rettenden Vaccinia-Virus vP723 verwendet. Rekombinantes Vaccinia-Virus vP784, welches Beta-Galactosidase inseriert in dem M2L-Deletions-Locus enthält, wurde als ein blauer Plaque in Gegenwart von X-gal isoliert.To provide a substrate for the deletion of the [C7L-K1L] gene cluster from vaccinia, E. coli beta-galactosidase was first inserted into the vaccinia M2L deletion locus (Guo et al., 1990) as follows. Around To eliminate the BglII site in pSD409, the plasmid was cut with BglII in vaccine sequences (Pos. 28212) and with BamHI at the pUC / vaccinia junction and then ligated to form the plasmid pMP409B. pMP409B was cut at the unique SphI site (Pos 27416). M2L coding sequences were isolated by mutagenesis (Guo et al., 1990; Mandecki et al., 1986) using the synthetic oligonucleotide

away. The resulting plasmid, pMP409D, contains a unique BglII site inserted into the M2L deletion locus as indicated above. A 3.2 kb BamHI (partial) / BglII cassette containing the E. coli beta-galactosidase gene (Shapira et al., 1983) under the control of the 11 kDa promoter (Bertholet et al., 1985 ) was inserted into pMP409D which had been cut with BglII. The resulting plasmid pMP409DBG (Guo et al., 1990) was used as a donor plasmid for recombination with the vaccinia vP723 rescue vaccine. Recombinant vaccinia virus vP784, containing beta-galactosidase inserted in the M2L deletion locus, was isolated as a blue plaque in the presence of X-gal.

A plasmid in which the vaccinia genes [C7L-K1L] were deleted was assembled into pUC8, which had been cut with SmaI, HindIII and blunt-ended with the Klenow fragment of E. coli polymerase. The left flanking arm consisting of vaccinia HindIII C sequences was prepared by digestion of pSD420 with XbaI (Pos. 18628), followed by blunt-end formation with Klenow fragment of E. coli polymerase and digestion with BglII (Pos 19706). The right flanking arm consisting of vaccinia HindIII K sequences was obtained by digestion of pSD451 with BglII (Pos 29062) and EcoRV (Pos 29778). In the resulting plasmid pMP581CK, vaccinia sequences are deleted between the BglII site (Pos. 19706) in HindIII-C and the BglII site (Pos. 29062) in HindIII-K. The site of deletion of the vaccinia sequences in the plasmid pMP581CK is described in the 5 indicated by a triangle.

unterzogen. Das resultierende Plasmid pMPCSK1Δ ist hinsichtlich den Vaccinia-Sequenzen-Positionen 18805-29108 deletiert, welche 12 offene Vaccinia-Leserahmen überspannen [C7L-K1L]. Die Rekombination zwischen pMPCSK1Δ und der Beta-Galactosidase enthaltenden Vaccinia-Rekombinante vP784 führte zu der Vaccinia-Deletionsmutante vP804, welche als ein klarer Plaque in Gegenwart von X-gal isoliert wurde.To remove excess DNA at the vaccinia deletion interface, plasmid pMP581CK was cut at the NcoI sites within the vaccinia sequences (Pos 18811, 19655), treated with Bal-31 exonuclease, and mutagenized (Mandecki, 1986 ) using the synthetic oligonucleotide MPSYN233 (SEQ ID NO: 20)

subjected. The resulting plasmid pMPCSK1Δ is deleted for vaccinia sequences positions 18805-29108 spanning 12 vaccinia open reading frames [C7L-K1L]. Recombination between pMPCSK1Δ and the vaccinia recombinant vP784 containing beta-galactosidase resulted in the vaccinia deletion mutant vP804, which was isolated as a clear plaque in the presence of X-gal.

EXAMPLE 6 - CONSTRUCTION OF PLASMIDE pSD548 DELETION OF THE BIG RIBONUCLEOTIDREDUCTASE SUB-UNIT (I4L)

With reference to the 6 contains the plasmid pSD405 vaccinia-HindIII-I (Pos. 63875-70367), cloned in pUC8. pSD405 was digested with EcoRV within vaccinia sequences (Pos. 67933) and SmaI at the pUC / vaccinia junction and ligated to form plasmid pSD518. pSD518 was used as the source of all vaccinia restriction fragments used in the construction of pSD548.

The vaccinia I4L gene ranges from position 67371-65059. The direction of transcription for I4L is in 6 indicated by an arrow. To obtain a vector plasmid fragment in which a portion of the I4L coding sequences is deleted, pSD518 was digested with BamHI (Pos. 65381) and HpaI (Pos. 67001) and blunt-ended using the Klenow fragment of E. coli polymerase. This 4.8 kb vector fragment was ligated with a 3.2 kb SmaI cassette containing the E. coli beta-galactosidase gene (Shapira et al., 1983) under the control of the vaccinia 11 kDa promoter (Bertholet et al., 1985; Perkus et al., 1990), resulting in the plasmid pSD524KBG. pSD524KBG was used as a donor plasmid for recombination with vaccinia virus vP804. Recombinant vaccinia virus vP855, containing beta-galactosidase in a partial deletion of the I4L gene, was isolated as a blue plaque in the presence of X-gal.

To delete beta-galactosidase and the remainder of the I4L ORF from vP855, the deletion plasmid pSD548 was constructed. The left and right flanking vaccinia arms were added separately in pUC8 assembled as described in detail below and schematically in the 6 is pictured.

ligiert, wodurch das Plasmid pSD531 gebildet wurde. pSD531 wurde mit RsaI (partiell) und BamHI geschnitten, und ein 2,7 kb großes Vektorfragment wurde isoliert. pSD518 wurde mit BglII (Pos. 64 459)/RsaI (Pos. 64 994) geschnitten, und ein 0,5 kb großes Fragment wurde isoliert. Die zwei Fragmente wurden unter Bildung von pSD537 miteinander ligiert, welches den vollständigen flankierenden Vaccinia-Arm links von den I4L codierenden Sequenzen enthält.To construct a vector plasmid to accommodate the left flanking vaccinia arm, pUC8 was cut with BamHI / EcoRI and annealed with the synthetic oligonucleotides 518A1 / 518A2 (SEQ ID NO: 21 / SEQ ID NO: 22).

ligated, whereby the plasmid pSD531 was formed. pSD531 was cut with RsaI (partial) and BamHI and a 2.7 kb vector fragment was isolated. pSD518 was cut with BglII (Pos. 64,459) / RsaI (Pos. 64,994) and a 0.5 kb fragment was isolated. The two fragments were ligated together to form pSD537 which contains the full flanking vaccinia arm to the left of the I4L coding sequences.

ligiert, wodurch das Plasmid pSD532 gebildet wurde. pSD532 wurde mit RsaI (partiell)/EcoRI geschnitten, und ein 2,7 kb großes Vektorfragment wurde isoliert. pSD518 wurde mit RsaI innerhalb der Vaccinia-Sequenzen (Pos. 67 436) und mit EcoRI an der Vaccinia/pUC-Grenzstelle geschnitten, und ein 0,6 kb großes Fragment wurde isoliert. Die zwei Fragmente wurden mitein ander ligiert, wodurch pSD538 gebildet wurde, welches den vollständigen flankierenden Vaccinia-Arm rechts von den I4L codierenden Sequenzen enthält.To construct a vector plasmid to accommodate the right flanking vaccinia arm, pUC8 was cut with BamHI / EcoRI and annealed with the synthetic oligonucleotides 518B1 / 518B2 (SEQ ID NO: 23 / SEQ ID NO: 24).

ligated, whereby the plasmid pSD532 was formed. pSD532 was cut with RsaI (partial) / EcoRI and a 2.7 kb vector fragment was isolated. pSD518 was cut with RsaI within the vaccinia sequences (Pos. 67 436) and with EcoRI at the vaccinia / pUC junction, and a 0.6 kb fragment was isolated. The two fragments were ligated together to form pSD538, which contains the complete flanking vaccinia arm to the right of the I4L coding sequences.

The right flanking vaccinia arm was isolated as a 0.6 kb EcoRI / BglII fragment from pSD538 and ligated into pSD537 vector plasmid which had been cut with EcoRI / BglII. In the resulting plasmid pSD539, the I4L ORF (pos. 65047-67386) is replaced by a polylinker region flanked by 0.6 kb of vaccinia DNA to the left and 0.6 kb of vaccinia DNA to the right, all in one pUC. Background. The site of deletion within the vaccinia sequences is in the 6 indicated by a triangle. To avoid possible recombination of beta-galactosidase sequences in the pUC-derived portion of pSD539 with beta-galactosidase sequences in the recombinant vaccinia virus vP855, the vaccinia I4L deletion cassette was moved from pSD539 into pRC11, a pUC derivative, from which all beta-galactosidase sequences have been removed and replaced with a polylinker region (Colinas et al., 1990). pSD539 was cut with EcoRI / PstI and the 1.2 kb fragment was isolated. This fragment was ligated into pRC11 cut with EcoRI / PstI (2.35 kb), forming pSD548. Recombination between pSD548 and the beta-galactosidase-containing vaccinia recombinant vP855 resulted in the vaccinia deletion mutant vP866, which was isolated as a clear plaque in the presence of X-gal.

DNA from the recombinant vaccinia virus vP866 was isolated by restriction digestion, followed by electrophoresis on an agarose gel, analyzed. The Restriction patterns were as expected. Polymerase chain reactions (PCR) (Engelke et al., 1988) using vP866 as template and primers flanking the six deletion loci described above were generated DNA fragments of the expected sizes. A Sequence analysis of the PCR-generated fragments around the deletion cleavage sites confirmed around, that the crossing points were as expected. recombinant Vaccinia virus vP866 containing the six engineered deletions as described above, the vaccinia vaccine strain was designated "NYVAC".

EXAMPLE 7 - INSERTION OF A RABIES-GLYCOPROTEIN G GENE IN NYVAC

The gene encoding Rabies glycoprotein G under the control of the vaccinia H6 promoter (Taylor et al., 1988a, b) was inserted into the TK deletion plasmid pSD513. pSD513 is identical to the plasmid pSD460 ( 1 ) except for the presence of a polylinker region.

unter Bildung des Vektorplasmids pSD513. pSD513 wurde mit SmaI geschnitten und mit einer SmaI-Enden tragenden, 1,8 kb großen Kassette ligiert, welche das Gen, codierend das Rabies-Glykoprotein-G-Gen unter der Steuerung des Vaccinia-H6-Promotors enthielt (Taylor et al., 1988a, b). Das resultierende Plasmid wurde als pRW842 bezeichnet. pRW842 wurde als Donorplasmid für die Rekombination mit NYVAC-Rettungs-Virus (vP866) verwendet. Rekombinantes Vaccinia-Virus vP879 wurde durch Plaque-Hybridisierung unter Verwendung von markierter DNA-Sonde gegen Rabies-Glykoprotein G codierende Sequenzen identifiziert.With reference to 7 the polylinker region was inserted by cutting pSD460 with SmaI and ligating the plasmid vector with the annealed synthetic oligonucleotides VQ1A / VQ1B (SEQ ID NO: 25 / SEQ ID NO: 26).

to form the vector plasmid pSD513. pSD513 was cut with SmaI and ligated to a SmaI-end bearing 1.8 kb cassette containing the gene encoding the Rabies glycoprotein G gene under the control of the vaccinia H6 promoter (Taylor et al. 1988a, b). The resulting plasmid was named pRW842. pRW842 was used as a donor plasmid for recombination with NYVAC rescue virus (vP866). Recombinant vaccinia virus vP879 was identified by plaque hybridization using labeled DNA probe against Rabies glycoprotein G coding sequences.

The modified recombinant viruses of the present invention Advantages as recombinant vaccine vectors. The weakened virulence of the vector advantageously reduces the opportunity for opportunity a "runaway" or outlier infection because of vaccination in the vaccinated individual and also reduces transmission or contagion from vaccinated to unvaccinated individuals or contamination the environment.

The modified recombinant viruses also find advantageous application in a method of expressing a gene product in an in in vitro cultured cell by introducing the modified recombinant Virus containing foreign DNA, which gene products are encoded and expressed in the cell, into the cell.

EXAMPLE 8 - CONSTRUCTION OF ALVAC RECOMBINANT, WHICH RABIES VIRUS GLYCOPROTEIN G EXPRESS

This Example describes the development of ALVAC, a canarypox virus vector and a canarypox Rabies recombinant called ALVAC-RG (vCP65), and their safety and effectiveness.

cell and viruses. Parental canarypox virus (Rentschler strain) is a vaccine strain for canaries. Of the Vaccine strain was obtained from a wild-type isolate and by attenuated more than 200 serial passenger genes on chick embryo fibroblasts. One Master viral seed was given four consecutive plaque cleanings under agar, and one plaque clone was replaced by five additional ones Passengers amplified, after which the source stock virus as the parental virus was used in in vitro recombinant tests. The plaque-purified canarypox isolate is referred to as ALVAC.

Construction of a Canarypox Insertion Vector. An 880 bp canarypox PvuII fragment was ligated between the PvuII sites of pUC9 to form pRW764.5. The sequence of this fragment is in 8th (SEQ ID NO: 27) between positions 1372 and 2251. The boundaries of an open reading frame designated C5 have been defined. It was found that the open reading frame was initiated at position 166 within the fragment and terminated at position 487. The C5 deletion was made without interruption from open reading frames. Bases from position 167 to position 455 were replaced with the sequence (SEQ ID NO: 28) GCTTCCCGGGAATTCTAGCTAGCTAGTTT. This replacement sequence contains HindIII, SmaI and EcoRI insertion sites followed by translation stops and a transcriptional termination signal recognized by vaccinia virus RNA polymerase (Yuen et al., 1987). The deletion of the C5 ORF was performed as described below. The plasmid pRW764.5 was partially cut with RsaI and the linear product was isolated. The linear RsaI fragment was again cut with BglII and the pRW764.5 fragment, now with a RsaI to BglII deletion from position 156 to position 462, was isolated and used as a vector for the following synthetic oligonucleotides:

The Oligonucleotides RW145 and RW146 were annealed and ligated into the pRW764.5-RsaI described above. and -BglII vector inserted. The resulting plasmid is called pRW831.

Construction of the Insertion Vector Containing the Rabies G Gene. The construction of pRW838 is illustrated below. Oligonucleotides A to E, which overlap the translation initiation codon of the H6 promoter with the Rabies G ATG, were cloned into pUC9, as pRW737. Oligonucleotides A through E contain the H6 promoter, starting at NruI, to the HindIII site of Rabies G, followed by BglII. The sequences of oligonucleotides A to E ((SEQ ID NO: 31) - (SEQ ID NO: 35)) are the following:

The diagram of the annealed oligonucleotides A to E is as follows:

The Oligonucleotides A to E were treated with kinase, annealed (95 ° C during 5 Minutes, then cooled to room temperature) and between the PvuII sites of pUC9. The resulting plasmid, pRW737, was cut with HindIII and BglII and as a vector for the 1.6 kbp HindIII-BglII fragment from ptg155PRO (Kieny et al., 1984), which generated pRW739. The ptg155PRO-HindIII site is located 86 bp downstream of the Rabies G translation initiation codon. BglII is located downstream of the Rabies G translation stop codon in ptg155PRO. pRW739 was partially cut with NruI, complete with BglII and containing a 1.7 kbp NruI-BglII fragment containing the 3'-end of the previously described H6 promoter (Taylor et al., 1988a, b; Guo et al., 1989; Perkus et al., 1989) to the end of the entire Rabies G gene, was inserted between the NruI and BamHI sites of pRW824. The resulting plasmid is designated pRW832. The insertion added in pRW824 the H6 promoter 5 'of NruI added. The pRW824 sequence of BamHI followed by SmaI is (SEQ ID NO: 36): GGATCCCCGGG. pRW824 is a plasmid which contains a non-relevant gene, which is exactly linked to the vaccinia virus H6 promoter. One Digestion with NruI and BamHI completely eliminated this non-relevant gene. The 1.8 kbp pRW832-SmaI fragment containing H6 promoter-driven Rabies G, was inserted into the SmaI of pRW831, whereby the plasmid pRW838 was formed.

Development of ALVAC-RG. Plasmid pRW838 was infected into ALVAC-infected primary CEF cells using the previously described calcium phosphate precipitation method (Panicali et al., 1982; Piccini et al., 1987). Positive plaques were determined on the basis of hybridization to a specifi Rabies G probe and subjected to 6 rounds of plaque purification until a pure population was obtained. A representative plaque was then amplified and the resulting ALVAC recombinant was designated ALVAC-RG (vCP65) (see also US Pat 9A and 9B ). The correct insertion of the Rabies G gene into the ALVAC genome without subsequent mutation was confirmed by sequence analysis.

Immunofluorescence. While The final stages of assembly of mature Rabies virus particles will be the Transported glycoprotein component from the Golgi apparatus to the plasma membrane, where it accumulates, leaving the carboxy terminus in the cytoplasm ranges and the bulk of the protein on the outer surface of the Cell membrane is present. To confirm, that the Rabies glycoprotein expressed in ALVAC-RG is correctly displayed Immunofluorescence was performed on primary CEF cells infected with ALVAC or ALVAC-RG. immunofluorescence was carried out like in old times (Taylor et al., 1990) using a monoclonal antibody Rabies-G antibody. It became a strong surface fluorescence detected on CEF cells infected with ALVAC-RG, but not with the parent ALVAC.

Immunoprecipitation. Preformed monolayers of primary CEF, Vero (a line of African Green Monkey kidney cells, ATCC # CCL81) and MRC-5 cells (a fibroblast-like cell line derived from normal human fetal lung tissue, ATCC # CCL171) were obtained at 10 pfu per Cell with parental virus ALVAC and recombinant virus ALVAC-RG in the presence of radioactively labeled ³⁵ S-methionine inoculated and treated as described earlier (Taylor et al., 1990). Immunoprecipitation reactions were performed using a Rabies G specific monoclonal antibody. The efficient expression of a Rabies-specific glycoprotein with a molecular weight of approximately 67 kDa was detected with the recombinant ALVAC-RG. No Rabies-specific products were detected in uninfected cells or cells infected with the parental ALVAC virus.

sequential Passagierungs experiment. In investigations with ALVAC virus in one Range of non-bird species was not a proliferative infection or overt disease (Taylor et al., 1991b). However, to prove that neither the parent nor the recombinant Virus could be adapted for growth in non-bird cells, a sequential pass experiment was performed.

• (1) Primäre Kükenembryo-Fibroblasten (CEF)-Zellen, erzeugt aus 11 Tage alten Embryonen des weißen Leghorns;
• (2) Vero-Zellen – eine kontinuierliche Linie von Nierenzellen der Afrikanischen Grünen Meerkatze (ATCC # CCL81); und
• (3) MRC-5-Zellen – eine diploide Zelllinie, abgeleitet aus humanem fötalem Lungengewebe (ATCC # CCL171).

The two viruses, ALVAC and ALVAC-RG, were inoculated into 10 cell sequential blind passages in three cell substrates:

• (1) Primary chick embryo fibroblast (CEF) cells produced from 11-day old white leghorn embryos;
• (2) Vero cells - a continuous line of African Green Monkey kidney cells (ATCC # CCL81); and
• (3) MRC-5 cells - a diploid cell line derived from human fetal lung tissue (ATCC # CCL171).

The initial inoculation was performed at a moi (multiplicity of infection) of 0.1 pfu per cell using three 60 mm dishes of each cell substrate containing 2 x 10 ⁶ cells per dish. One dish was inoculated in the presence of 40 μg / ml cytosine arabinoside (Ara C), an inhibitor of DNA replication. After an absorption period of 1 hour at 37 ° C, the inoculum was removed and the monolayer washed to remove unabsorbed virus. At this point the medium was replaced with 5 ml EMEM + 2% NBCS on two dishes (samples t0 and t7) and 5 ml EMEM + 2% NBCS containing 40 μg / ml Ara C on the third (sample t7A). Sample t0 was frozen at -70 ° C to provide an indication of residual entry virus. The samples t7 and t7A were incubated at 37 ° C for 7 days, after which the contents were harvested and the cells disrupted by indirect sonication.

One ml of sample t7 from each cell substrate was undiluted three dishes of the same cell substrate (to provide the Samples t0, t7 and t7A) and on a dish of primary CEF cells inoculated. Samples t0, t7 and t7A were as in the passage 1 treated. The additional Inoculation on CEF cells was included to one amplification step for the provide more sensitive detection of virus present in non-avian cells could be present.

These Procedure was during 10 (CEF and MRC-5) or 8 (Vero) sequential blind passages. The samples were then frozen and thawed three times and through Titration on primary CEF monolayers assayed.

The Virus yield in each sample was then monitored by plaque titration CEF monolayers detected under agarose. The summarized Results of the experiment are shown in Tables 1 and 2.

The Results show that both the parent ALVAC and the recombinant ALVAC-RG able to sustained replication on CEF monolayers without loss of titers are. In Vero cells, the levels of the virus fell 2 passages for ALVAC and 1 passage for ALVAC-RG below the detection limit. In MRC-5 cells was a similar Result obvious, and after a passage did not become a virus detected. Although the results for only four passages in the Tables 1 and 2, the series for 8 (Vero) was shown and 10 (MRC-5) passages continued, with no detectable adjustment from one of the viruses to growth in non-bird cells.

In of passage 1 were relatively high levels of virus in the t7 sample present in MRC-5 and Vero cells. However, this mirror was to virus equivalent to that observed in the t0 sample and the t7A sample that had been incubated in the presence of cytosine arabinoside was in which no viral replication can take place. This showed that levels of virus, observed after 7 days in non-avian cells, residual virus and not neu replicated virus.

Around Making the assay more sensitive became part of the 7-day harvest from each cell substrate on a permissive CEF monolayer and at the cytopathic effect (CPE) or after 7 days if no CPE was obviously harvested. The results of this experiment are shown in Table 3. Even after amplification by a permissive cell substrate became virus only in MRC-5 and Vero cells while two additional ones Passages detected. These results showed that among the applied conditions, no adaptation of either virus to growth in Vero or MRC-5 cells.

inoculation of macaques. Four HIV seropositive macaques were initially with ALVAC-RG inoculated as described in Table 4. After 100 Days, these animals were reinoculated to determine a booster effect, and additional seven animals were inoculated with a variety of doses. blood was taken at appropriate intervals and the sera were after heat inactivation at 56 ° C while 30 minutes, analyzed for the presence of anti-rabies antibody, the "Rapid Fluorescent Focus Inhibition "assay (Smith et al., 1973).

Inoculation of chimpanzees. Two adult male chimpanzees (50 to 65 kg weight range) were inoculated intramuscularly or subcutaneously with 1 x 10 ⁷ pfu vCP65. The animals were monitored for responses and were sampled at regular intervals for analysis of the presence of anti-rabies antibodies by the RFFI assay (Smith et al., 1973). The animals were reinoculated at an equivalent dose 13 weeks after the initial inoculation.

Inoculation of mice. Groups of mice were inoculated with 50 to 100 μl of a range of dilutions of different batches of vCP65. The mice were inoculated in the balls of the foot. On day 14, the mice were challenged by intracranial inoculation of 15-43 mouse LD _{50 of} the virulent CVS strain of Rabies virus. The survival of the mice was monitored and a 50% protective dose (PD ₅₀ ) was calculated 28 days after inoculation.

Inoculation of dogs and cats. Ten beagle dogs at 5 months of age and 10 cats at 4 months of age were inoculated subcutaneously with either 6.7 or 7.7 log ₁₀ TCID ₅₀ of ALVAC-RG. Four dogs and four cats were not inoculated. The animals were bled 14 and 28 days after inoculation and anti-rabies antibody was assayed in an RFFI assay. Animals receiving 6.7 log ₁₀ TCID ₅₀ ALVAC-RG were treated with 3.7 log ₁₀ mouse LD ₅₀ (dogs) or 4.3 log ₁₀ mouse LD ₅₀ (cats) from the NYGS 29 days after vaccination -Rabies virus challenge strain challenged.

inoculation of squirrel monkeys. Three groups of four squirrel monkeys (Saimiri sciureus) were inoculated with one of three viruses, namely (a) ALVAC, the parental canarypox virus, (b) ALVAC-RG, the recombinant, which expresses the Rabies G glycoprotein, or (c) vCP37, a Canarypox recombinants containing the envelope glycoprotein of feline leukemia virus expressed. The inoculations were performed under ketamine anesthesia. each Animal received at the same time: (1) 20 μl, instilled on the surface of the right eye without scarification; (2) 100 μl as several drops in the Mouth; (3) 100 μl in each of two intradermal injection sites in the shaved Skin of the outer surface of the right arm; and (4) 100 μl in the anterior muscle of the right thigh.

Four monkeys were inoculated with each virus, two with a total of 5.0 log ₁₀ pfu and two with a total of 7.0 log ₁₀ pfu. The animals were bled at regular intervals and the sera were analyzed for the presence of Rabies antibody using an RFFI assay (Smith et al., 1973). The animals were monitored daily for reactions to the vaccine. Six months after the initial inoculation, the four monkeys receiving ALVAC-RG were subcutaneously subcutaneously primed with two monkeys initially receiving vCP37 and two monkeys initially receiving ALVAC and a 6.5 log ₁₀ pfu naive monkey on ALVAC-RG inoculated. Sera were monitored for the presence of rabies-neutralizing antibody in an RFFI assay (Smith et al., 1973).

• (a) Vero, Nierenzellen der Afrikanischen Grünen Meerkatze, ATCC # CCL81;
• (b) MRC-5, humane embryonale Lunge, ATCC # CCL 171;
• (c) WISH, humanes Amnion, ATCC # CCL 25;
• (d) Detroit-532, humane Vorhaut, Down-Syndrom, ATCC # CCL 54; und
• (e) Primäre CEF-Zellen.

Inoculation of human cell lines with ALVAC-RG. To determine whether efficient expression of a foreign gene could be obtained in non-avian cells in which the virus did not replicate productively, five cell types, one of bird origin and four of non-bird origin, were identified for virus yield. Expression of rabies G foreign gene and accumulation of virus-specific DNA analyzed. The inoculated cells were:

• (a) Vero, African Green Monkey kidney cells, ATCC # CCL81;
• (b) MRC-5, human embryonic lung, ATCC # CCL 171;
• (c) WISH, human amnion, ATCC # CCL 25;
• (d) Detroit-532, human foreskin, Down syndrome, ATCC # CCL 54; and
• (e) Primary CEF cells.

Chick embryo fibroblast cells prepared from 11-day white leghorn embryos were included as a positive control. All inoculations were performed on preformed monolayers of 2 x 10 ⁶ cells, as discussed below.

A. Method for DNA analysis.

Three dishes of each cell line were inoculated at 5 pfu / cell of the virus under test leaving an extra dish of each cell line uninoculated. One dish was incubated in the presence of 40 μg / ml cytosine arabinoside (Ara C). After an adsorption period of 60 minutes at 37 ° C, the inoculum was removed and the monolayer washed twice to remove unadsorbed virus. Medium (with or without Ara C) was then replaced. Cells from a dish (without Ara C) were harvested as a zero-time sample. The remaining dishes were incubated at 37 ° C for 72 hours, after which the cells were harvested and used to analyze DNA accumulation. Each sample of 2 x 10 ⁶ cells was resuspended in 0.5 ml of phosphate buffered saline (PBS) containing 40 mM EDTA and incubated for 5 minutes at 37 ° C. An equal volume of 1.5% agarose preheated at 42 ° C and containing 120 mM EDTA was added to the cell suspension and mixed gently. The suspension was transferred to an agarose plug and allowed to cure for at least 15 minutes. The agarose plugs were then removed and incubated for 12-16 hours at 50 ° C in a volume of lysis buffer (1% sarcosyl, 100 μg / ml proteinase K, 10 mM Tris-HCl pH 7.5, 200 mM EDTA) completely cover the plug, incubate. The lysis buffer was then replaced with 5.0 ml of sterile 0.5 x TBE (44.5 mM Tris-borate, 44.5 mM boric acid, 0.5 mM EDTA) and changed at 4 ° C for 6 hours with 3 changes equilibrated to TBE buffer. The viral DNA within the plug was fractionated from cellular RNA and DNA using a pulsed field electrophoresis system. Electrophoresis was carried out at 180 V for 20 hours with a ramp of 50-90 seconds at 15 ° C in 0.5 × TBE. The DNA was run with lambda DNA molecular weight standards. After electrophoresis, the viral DNA band was visualized by staining with ethidium bromide. The DNA was then transferred to a nitrocellulose membrane and probed with radiolabeled probe prepared from purified genomic ALVAC DNA.

B. Estimation of virus yield.

Peel were inoculated exactly as described above, with the exception that the input multiplicity amounted to 0.1 pfu / cell. 72 hours after infection were Cells through three consecutive cycles of freezing and Thawing lysed. The virus yield was determined by plaque titration on CEF monolayers.

C. Analysis of Rabies G Gene Expression.

Trays were inoculated with recombinant or parental virus at a multiplicity of 10 pfu / cell, leaving an additional dish as uninfected virus control. After an absorption period of one hour, the medium was removed and replaced with methionine-free medium. After a period for 30 minutes, this medium was replaced with methionine-free medium containing 25 μCi / ml ³⁵ S-methionine. Infected cells were labeled overnight (approximately 16 hours) and then lysed by the addition of buffer A lysis buffer. Immunoprecipitation was performed as previously described (Taylor et al., 1990) using a Rabies G specific monoclonal antibody.

Results: appraisal the viral yield. The results of a titration regarding the yield is 0.1 pfu / cell 72 hours after inoculation shown in Table 5. The results show that while a productive infection in the avian cells can be obtained, no increase virus yield detected by this method in the four non-avian cell systems can be.

Analysis of the accumulation of viral DNA. To determine if the blocking of productive viral replication occurred in the non-avian cells before or after DNA replication, DNA from the cell lysates was fractionated by electrophoresis, transferred to nitrocellulose, and probed for the presence of virus-specific DNA. DNAs from non-infected CEF cells, ALVAC-RG-infected CEF cells at zero time, ALVAC-RG-infected CEF cells at 72 hours post-infection, and ALVAC-RG-infected CEF cells at 72 hours post-infection The presence of 40 μg / ml cytosine arabinoside all showed some background activity, presumably due to contaminating cellular CEF DNA in the radiolabelled ALVAC DNA probe preparation. However, ALVAC-RG-infected CEF cells showed a strong band in the region of approximately 350 kbp 72 hours after infection, representing an ALVAC-specific viral DNA accumulation. No such band is detectable when the culture is incubated in the presence of the DNA synthesis inhibitor cytosine arabinoside. Equivalent samples prepared in Vero cells showed a very pale band at approximately 350 kbp in the ALVAC-RG infected Vero cells at zero time point. This level represented the remainder of the virus. The intensity of the band was enhanced 72 hours after infection, indicating that some level of virus-specific DNA replication had occurred in Vero cells, which had not resulted in an increase in viral progeny. Equivalent samples prepared in MRC-5 cells showed that no virus-specific DNA accumulation was detected under these conditions in this cell line. This experiment was then expanded to include additional human cell lines, specifically WISH and Detroit 532 cells. ALVAC-infected CEF cells served as a positive control. No accumulation of virus-specific DNA was detected in either WISH or Detroit cells inoculated with ALVAC-RG. It should be noted that the detection limits of this method have not been fully confirmed and accumulation of viral DNA can take place but at a level below the sensitivity of the method. Other experiments in which viral DNA replication was measured by ³ H-thymidine incorporation support the results obtained with Vero and MRC-5 cells.

Analysis of rabies gene expression. To determine whether any viral gene expression, particularly that of the inserted foreign gene, occurs in the human cell lines even in the absence of viral DNA replication, immunoprecipitation experiments were performed on ³⁵ S-methionine labeled lysates of avian and non-avian cells were infected with ALVAC and ALVAC-RG. The results of immunoprecipitation using a Rabies G-specific monoclonal antibody demonstrated specific immunoprecipitation of a 67 kDa glycoprotein in CEF, Vero and MRC-5, WISH and Detroit cells infected with ALVAC-RG. No such Rabies specific gene products were detected in any of the uninfected and parental infected cell lysates.

The Results of this experiment showed that in the analyzed human cell lines, although the ALVAC-RG recombinant to initiate an infection and expressing a foreign gene product under the transcriptional Control of the H6 early / late vaccinia virus promoter was able to replication not by a DNA replication progress, nor that there are any generated, traceable viral progeny gave. In the Vero cells, although a certain amount of ALVAC-RG-specific DNA accumulation was no viral progeny were observed by these methods demonstrated. These results would suggest that in the analyzed human cell lines the Block viral replication before the onset of DNA replication whereas in Vero cells the blockage follows occurs at the beginning of viral DNA replication.

To determine whether the Rabies glycoprotein expressed in ALVAC-RG was immunogenic, a variety of animal species were tested by inoculating the recombinant. The effectiveness of current Rabies vaccines is evaluated in a mouse model system. A similar test was therefore performed using ALVAC-RG. Nine different preparations of virus (including a vaccine batch (J) prepared after 10 serial tissue culture passages of the seed virus) with infectious titers ranging from 6.7 to 8.4 log ₁₀ TCID ₅₀ per ml were serially diluted , and 50 to 100 μl of the dilutions were made inoculated into the balls of four to six week old mice. The mice were challenged 14 days later by the intracranial route with 300 μl of Rabies virus CVS strain containing 15 to 43 mouse LD ₅₀ as determined by lethality titration in a control group of mice. The efficacy, expressed as PD ₅₀ (50% protective dose or 50% protective dose), was calculated 14 days after the challenge. The results of the experiment are shown in Table 6. The results indicated that ALVAC-RG was consistently capable of protecting mice against rabies virus challenge with a PD ₅₀ value in the range of 3.33 to 4.56 with a mean of 3.73 (standard deviation, respectively) STD 0.48) was able to. As an extension of this study, male mice were inoculated intracranially with 50 μl of virus containing 6.0 log ₁₀ TCID ₅₀ of ALVAC-RG, or with an equivalent volume of uninfected cell suspension. Mice were sacrificed on days 1, 3 and 6 after inoculation and their brains were removed, fixed and cut. Histopathological examination revealed no evidence of neurovirulence of ALVAC-RG in mice.

To evaluate the safety and efficacy of ALVAC-RG for dogs and cats, a group of 14 Beagles aged 5 months and 14 cats of 4 months of age were analyzed. Four animals of each species were not vaccinated. Five animals received 6.7 log ₁₀ TCID ₅₀ subcutaneously and five animals received 7.7 log ₁₀ TCID ₅₀ in the same way. The animals were bled for analysis for anti-rabies antibody. Animals receiving no inoculation or 6.7 log ₁₀ TCID ₅₀ ALVAC-RG were treated with 3.7 log ₁₀ mouse LD ₅₀ (dogs, in the temporal muscle) or 4.3 log ₁₀ mice 29 days post vaccination -LD ₅₀ (cats, in the neck) of the NYGS Rabies virus challenge strain challenged. The results of the experiment are shown in Table 7.

No adverse reactions to inoculation were observed in either cats or dogs with either of the two doses of inoculum virus. Four of 5 dogs immunized with 6.7 log ₁₀ TCID ₅₀ had antibody titers on day 14 post vaccination and all dogs had titers after 29 days. All dogs were protected from a challenge that killed three out of four controls. In cats, three out of five cats receiving 6.7 log ₁₀ TCID _{50 had} specific antibody titers on day 14, and all cats were positive on day 29, although the mean antibody titer was low at 2.9 IU. Three out of five cats survived a challenge that killed all the controls. All cats immunized with 7.7 log ₁₀ TCID ₅₀ had antibody titers on day 14 and on day 29 the geometric mean titer was calculated as 8.1 International Units.

The immune response of squirrel monkey (Saimiri sciureus) to inoculation with ALVAC, ALVAC-RG and a unrelated canarypox virus recombinant was investigated. Groups of monkeys were inoculated as described above and the sera were analyzed for the presence of Rabies specific antibody. In addition to minor typical skin reactions to inoculation via the intradermal route, no negative reactivity was observed in any of the monkeys. Only small amounts of residual virus were isolated from skin damage after intradermal inoculation on days two and four after inoculation. All samples were seven on day seven and negative thereafter. There was no local response to intramuscular injection. All four monkeys inoculated with ALVAC-RG developed neutralizing anti-rabbit serum antibodies as measured in an RFFI assay. Approximately six months after the initial inoculation, all monkeys and one additional naive monkey were inoculated again by subcutaneous route on the outer surface of the left thigh with 6.5 log ₁₀ TCID ₅₀ ALVAC-RG. Sera were analyzed for the presence of anti-rabies antibodies. The results are shown in Table 8.

Four the five Monkeys naive as to rabies developed one serological response seven days after inoculation with ALVAC-RG. All five Monkeys had detectable antibodies 11 days after inoculation. Of the four monkeys with previous exposure to the Rabies glycoprotein, all showed a significant increase in Serum neutralization titers between days 3 and 7 after vaccination. The results show that the vaccination of squirrel monkeys with ALVAC-RG causes no adverse side effects, and a primary neutralizing antibody response can be induced. An anamnestic response will also be done induced at vaccination. Previous exposure to ALVAC or canarypox recombinant containing an unrelated foreign gene expresses, bothers not the induction of an anti-rabies immune response at vaccination.

The immunological response of HIV-2 seropositive macaques to inoculation with ALVAC-RG was investigated. The animals were inoculated as described above and the presence of neutralizing anti-rabies serum antibody was checked in an RFFI assay. The results, shown in Table 9, indicated that HIV-2 positive animals inoculated by the subcutaneous route were anti-rabies antibodies developed 11 days after inoculation. An anamnestic response was detected following a booster inoculation given approximately three months after the first inoculation. In animals receiving the recombinant by the oral route, no response was detected. In addition, a series of six animals were inoculated with decreasing doses of ALVAC-RG administered either intramuscularly or subcutaneously. Five of the six inoculated animals showed a response at 14 days post-vaccination with no significant difference in antibody citer.

Two chimpanzees previously exposed to HIV were inoculated with 7.0 log ₁₀ pfu of ALVAC-RG by the subcutaneous or intramuscular route. Three months after the inoculations, both animals were vaccinated again in an identical manner. The results are shown in Table 10.

• a: Diese Probe wurde beim Null-Zeitpunkt geerntet und repräsentiert das restliche Eingangs-Virus. Der Titer wird als log₁₀ pfu pro ml ausgedrückt.
• b: Diese Probe wurde 7 Tage nach der Infektion geerntet.
• c: Diese Probe wurde in Gegenwart von 40 μg/ml Cytosin-Arabinosid inokuliert und 7 Tage nach der Infektion geerntet.
• d: Nicht dektierbar

Tabelle 2. Sequenzielle Passagierung von ALVAC-RG in Vogel- und Nicht-Vogel-Zellen. CEF Vero MRC-5 Passage 1 Probe T0^a 3,0 2,9 2,9 t7^b 7,1 1,0 1,4 t7A^c 1,8 1,4 1,2 Passage 2 Probe T0 5,1 0,4 0,4 t7 7,1 N. D.^d N. D. t7A 3,8 N. D. N. D. Passage 3 Probe T0 5,1 0,4 N. D. t7 7,2 N. D. N. D. t7A 3,6 N. D. N. D. Passage 4 Probe T0 5,1 N. D. N. D. t7 7,0 N. D. N. D. t7A 4,0 N. D. N. D.

• a: Diese Probe wurde beim Null-Zeitpunkt geerntet und repräsentiert das restliche Eingangs-Virus. Der Titer wird als log₁₀ pfu pro ml ausgedrückt.
• b: Diese Probe wurde 7 Tage nach der Infektion geerntet.
• c: Diese Probe wurde in Gegenwart von 40 μg/ml Cytosin-Arabinosid inokuliert und 7 Tage nach der Infektion geerntet.
• d: Nicht dektierbar

Tabelle 3. Amplifikation von restlichem Virus durch Passagierung in CEF-Zellen. CEF Vero MRC-5 a) ALVAC Passage 2^a 7,0^b 6,0 5,2 3 7,5 4,1 4,9 4 7,5 N. D.^c N. D. 5 7,1 N. D. N. D. b) ALVAC-RG Passage 2^a 7,2 5,5 5,5 3 7,2 5,0 5,1 4 7,2 N. D. N. D. 5 7,2 N. D. N. D.

• a: Die Passage 2 repräsentiert die Amplifikation in CEF-Zellen der 7-Tage-Probe aus Passage 1.
• b: Der Titer wird als log₁₀ pfu pro ml ausgedrückt.
• c: Nicht dektierbar

Tabelle 4. Ablaufplan der Inokulation von Rhesus-Makaken mit ALVAC-RG (vCP65). Tier Inokulation 176L Primär: Sekundär: 1 × 10⁸ pfu an vCP65 oral in TANG 1 × 10⁷ pfu an vCP65 plus 1 × 10⁷ pfu an vCP82^a auf subkutanem bzw. SC-Weg 185 L Primär: Sekundär: 1 × 10⁸ pfu an vCP65 oral in Tang 1 × 10⁷ pfu an vCP65 plus 1 × 10⁷ pfu an vCP82 auf SC-Weg 177L Primär: Sekundär: 5 × 10⁷ pfu SC an vCP65 auf SC-Weg 1 × 10⁷ pfu an vCP65 plus 1 × 10 pfu an vCP82 auf SC-Weg 186L Primär: Sekundär: 5 × 10⁷ pfu an vCP65 auf SC-Weg 1 × 10⁷ pfu an vCP65 plus 1 × 10⁷ pfu vCP82 auf SC-Weg 178L Primär: 1 × 10⁷ pfu an vCP65 auf SC-Weg 182L Primär: 1 × 10⁷ pfu an vCP65 auf IM-Weg 179L Primär: 1 × 10⁶ pfu an vCP65 auf SC-Weg 183L Primär: 1 × 10⁶ pfu an vCP65 auf IM-Weg 180L Primär: 1 × 10⁶ pfu an vCP65 auf SC-Weg 184L Primär: 1 × 10⁵ pfu an vCP65 auf IM-Weg 187L Primär: 1 × 10⁷ pfu an vCP65 oral

• a: vCP82 ist eine Kanarienpocken-Virus-Rekombinante, welche die Masemvirus-Fusions- und Hämagglutinin-Gene exprimieren.

Tabelle 5. Analyse der Ausbeute in mit ALVAC-RG inokulierten Vogel- und Nicht-Vogel-Zellen Proben-Zeit Zelltyp t0 t72 t72A^b Expt. 1 CEF 3,3^a 7,4 1,7 Vero 3,0 1,4 1,7 MRC-5 3,4 2,0 1,7 Expt. 2 CEF 2,9 7,5 < 1,7 WISH 3,3 2,2 2,0 Detroit-532 2,8 1,7 < 1,7

• a: Der Titer wird als log₁₀ pfu pro ml ausgedrückt.
• b: Kultur, inkubiert in Gegenwart von 40 μg/ml Cytosin-Arabinosid

Tabelle 6. Wirksamkeit von ALVAC-RG, wie in Mäusen getestet Test Herausforderungs-Dosis^a PD₅₀ ^b Anfangs-Impfkeim 43 4,56 Primärer Impfkeim 23 3,34 Impfstoff-Ansatz H 23 4,52 Impfstoff-Ansatz I 23 3,33 Impfstoff-Ansatz K 15 3,64 Impfstoff-Ansatz L 15 4,03 Impfstoff-Ansatz M 15 3,32 Impfstoff-Ansatz N 15 3,39 Impfstoff-Ansatz J 23 3,42

• a: als Maus-LD₅₀ ausgedrückt
• b: als log₁₀ TCID₅₀ ausgedrückt

Tabelle 7. Effektivität von ALVAC-RG in Hunden und Katzen Dosis Hunde Katzen Antikörper^a Überleben^b Antikörper Überleben 6,7 11,9 5/5 2,9 3/5 7,7 10,1 N. T. 8,1 N. T.

• a: Antikörper an Tag 29 nach der Inokulation, ausgedrückt als der geometrische Mittelwert-Titer in Internationalen Einheiten.
• b: Ausgedrückt als Verhältnis von Überlebenden gegenüber herausgeforderten Tieren

Tabelle 8. Serologische Anti-Rabies-Antwortreaktion von Totenkopfäffchen, die mit Kanarienpocken-Virus-Rekombinanten inokuluiert wurden Affe # Frühere Exposition Rabies neutralisierender Serum-Antikörper –196^b 0 3 7 11 21 28 22 ALVAC^c NT^g < 1,2 < 1,2 < 1,2 2,1 2,3 2,2 51 ALVAC^c NT < 1,2 < 1,2 1,7 2,2 2,2 2,2 39 vCP37^d NT < 1,2 < 1,2 1,7 2,1 2,2 N. T.^g 55 vCP37^d NT < 1,2 < 1,2 1,7 2,2 2,1 N. T. 37 ALVAC-RG^e 2,2 < 1,2 < 1,2 3,2 3,5 3,5 3,2 53 ALVAC-RG^e 2,2 < 1,2 < 1,2 3,6 3,6 3,6 3,4 38 ALVAC-RG^f 2,7 < 1,7 < 1,7 3,2 3,8 3,6 N. T. 54 ALVAC-RG^f 3,2 < 1,7 < 1,5 3,6 4,2 4,0 3,6 57 keine NT < 1,2 < 1,2 1,7 2,7 2,7 2,3

• a: Wie durch RFFI-Test an den angegebenen Tagen bestimmt und in Internationalen Einheiten ausgdrückt
• b: Tag-196 steht für Serum von Tag 28 nach der primären Impfung
• c: die Tiere erhielten 5,0 log₁₀ TCID₅₀ an ALVAC
• d: die Tiere erhielten 5,0 log₁₀ TCID₅₀ an vCP37
• e: die Tiere erhielten 5,0 log₁₀ TCID₅₀ an ALVAC-RG
• f: die Tiere erhielten 7,0 log₁₀ TCID₅₀ an ALVAC-RG
• g: nicht getestet

Tabelle 9. Inokulation von Rhesus-Makaken mit ALVAC-RG^a

• a: siehe Tabelle 9 für Ablaufplan der Inokulationen.
• b: Die Tiere 176L und 185L erhielten 8,0 log₁₀ pfu auf oralem Wege in 5 ml Tang. Das Tier 187L erhielt 7,0 log₁₀ pfu auf oralem Wege nicht in Tang.
• c: Tag der Nach-Impfung für die Tiere 176L, 185L, 177L und 186L auf s. c. Wege, und der primären Impfung für die Tiere 178L, 182L, 179L, 183L, 180L, 184L und 187L.
• d: Titer, ausgedrückt als Kehrwert der letzten Verdünnung, welche eine Hemmung der Fluoreszenz in einem RFFI-Test zeigt.

Tabelle 10. Inokulation von Schimpansen mit ALVAC-RG Wochen nach Inokulation Tier 431 i. m. Tier 457 s. c. 0 < 8^a < 8 1 < 8 < 8 2 8 32 4 16 32 8 16 32 12^b/0 16 8 13/1 128 128 15/3 256 512 20/8 64 128 26/12 32 128

• a: Titer, ausgedrückt als Kehrwert der letzten Verdünnung, welche eine Hemmung der Fluoreszenz in einem RFFI-Test zeigt.
• b: Tag der Re-Inokulation

No side effect reactivity to inoculation was noted either by intramuscular or subcutaneous route. Both chimpanzees responded to the primary inoculation at 14 days, and a strong response was detected following the re-vaccination. Table 1. Sequential passage of ALVAC in avian and non-avian cells. CEF Vero MRC-5 Passage 1 sample to ^a 2.4 3.0 2.6 t7 ^b 7.0 1.4 0.4 t7A ^c 1.2 1.2 0.4 Passage 2 sample to 5.0 0.4 ND ^d t7 7.3 0.4 ND T7A 3.9 ND ND Passage 3 sample to 5.4 0.4 ND t7 7.4 ND ND T7A 3.8 ND ND Passage 4 sample to 5.2 ND ND t7 7.1 ND ND T7A 3.9 ND ND

• a: This sample was harvested at zero time and represents the remaining input virus. The titer is expressed as log ₁₀ pfu per ml.
• b: This sample was harvested 7 days after the infection.
• c: This sample was inoculated in the presence of 40 μg / ml cytosine arabinoside and harvested 7 days after infection.
• d: Not decodable

Table 2. Sequential passage of ALVAC-RG in avian and non-avian cells. CEF Vero MRC-5 Passage 1 sample T0 ^a 3.0 2.9 2.9 t7 ^b 7.1 1.0 1.4 t7A ^c 1.8 1.4 1.2 Passage 2 sample T0 5.1 0.4 0.4 t7 7.1 ND ^d ND T7A 3.8 ND ND Passage 3 sample T0 5.1 0.4 ND t7 7.2 ND ND T7A 3.6 ND ND Passage 4 sample T0 5.1 ND ND t7 7.0 ND ND T7A 4.0 ND ND

• a: This sample was harvested at zero time and represents the remaining input virus. The titer is expressed as log ₁₀ pfu per ml.
• b: This sample was harvested 7 days after the infection.
• c: This sample was inoculated in the presence of 40 μg / ml cytosine arabinoside and harvested 7 days after infection.
• d: Not decodable

Table 3. Amplification of residual virus by passage in CEF cells. CEF Vero MRC-5 a) ALVAC passage 2 ^a 7.0 ^b 6.0 5.2 3 7.5 4.1 4.9 4 7.5 ND ^c ND 5 7.1 ND ND b) ALVAC-RG passage 2 ^a 7.2 5.5 5.5 3 7.2 5.0 5.1 4 7.2 ND ND 5 7.2 ND ND

• a: Passage 2 represents the amplification in CEF cells of the 7-day sample from passage 1.
• b: The titer is expressed as log ₁₀ pfu per ml.
• c: Not declinable

Table 4. Flowchart of inoculation of rhesus macaques with ALVAC-RG (vCP65). animal inoculation 176L Primary sekundary: 1 x 10 ⁸ pfu of vCP65 orally in TANG 1 x 10 ⁷ pfu on vCP65 plus 1 x 10 ⁷ pfu on vCP82 ^a on subcutaneous and SC routes ^, respectively 185 l Primary sekundary: 1 x 10 ⁸ pfu of vCP65 orally in Tang 1 x 10 ⁷ pfu on vCP65 plus 1 x 10 ⁷ pfu on vCP82 on SC route 177L Primary sekundary: 5 x 10 ⁷ pfu SC to vCP65 on SC path 1 x 10 ⁷ pfu to vCP65 plus 1 x 10 pfu to vCP82 on SC path 186L Primary sekundary: 5 x 10 ⁷ pfu on vCP65 on SC path 1 x 10 ⁷ pfu on vCP65 plus 1 x 10 ⁷ pfu vCP82 on SC path 178L Primary: 1 × 10 ⁷ pfu of vCP65 on SC route 182L Primary: 1 × 10 ⁷ pfu to vCP65 on IM way 179L Primary: 1 x 10 ⁶ pfu of vCP65 on SC route 183L Primary: 1 x 10 ⁶ pfu on vCP65 on IM way 180L Primary: 1 x 10 ⁶ pfu of vCP65 on SC route 184L Primary: 1 × 10 ⁵ pfu on vCP65 on IM way 187L Primary: 1 x 10 ⁷ pfu of vCP65 orally

• a: vCP82 is a canarypox virus recombinant expressing the masem virus fusion and hemagglutinin genes.

Table 5. Analysis of yield in ALVAC-RG inoculated avian and non-avian cells Sample time cell type t0 t72 t72A ^b Expt. 1 CEF 3.3 ^a 7.4 1.7 Vero 3.0 1.4 1.7 MRC-5 3.4 2.0 1.7 Expt. 2 CEF 2.9 7.5 <1.7 WISH 3.3 2.2 2.0 Detroit 532 2.8 1.7 <1.7

• a: The titer is expressed as log ₁₀ pfu per ml.
• b: Culture incubated in the presence of 40 μg / ml cytosine arabinoside

Table 6. Effectiveness of ALVAC-RG as tested in mice test Challenge Dose ^a PD ₅₀ ^b Initial seed is 43 4.56 Primary seed 23 3.34 Vaccine Approach H 23 4.52 Vaccine Approach I 23 3.33 Vaccine Approach K 15 3.64 Vaccine Approach L 15 4.03 Vaccine Approach M 15 3.32 Vaccine Approach N 15 3.39 Vaccine Approach J 23 3.42

• a: expressed as mouse LD ₅₀
• b: expressed as log ₁₀ TCID ₅₀

Table 7. Effectiveness of ALVAC-RG in dogs and cats dose dogs cats Antibody ^a Survival ^b antibody to survive 6.7 11.9 5.5 2.9 3.5 7.7 10.1 NT 8.1 NT

• a: Antibody on day 29 after inoculation, expressed as the geometric mean titer in International Units.
• b: Expressed as the ratio of survivors to challenged animals

Table 8. Serological anti-rabies response of squirrel monkeys inoculated with canarypox virus recombinants Monkey # Earlier exposure Rabies neutralizing serum antibody -196 ^b 0 3 7 11 21 28 22 ALVAC ^c NT ^g <1.2 <1.2 <1.2 2.1 2.3 2.2 51 ALVAC ^c NT <1.2 <1.2 1.7 2.2 2.2 2.2 39 vCP37 ^d NT <1.2 <1.2 1.7 2.1 2.2 NT ^g 55 vCP37 ^d NT <1.2 <1.2 1.7 2.2 2.1 NT 37 ALVAC-RG ^e 2.2 <1.2 <1.2 3.2 3.5 3.5 3.2 53 ALVAC-RG ^e 2.2 <1.2 <1.2 3.6 3.6 3.6 3.4 38 ALVAC-RG ^f 2.7 <1.7 <1.7 3.2 3.8 3.6 NT 54 ALVAC-RG ^f 3.2 <1.7 <1.5 3.6 4.2 4.0 3.6 57 none NT <1.2 <1.2 1.7 2.7 2.7 2.3

• a: As determined by RFFI test on the dates indicated and expressed in International Units
• b: Day-196 stands for serum from day 28 after primary vaccination
• c: the animals received 5.0 log ₁₀ TCID ₅₀ to ALVAC
• d: animals received 5.0 log ₁₀ TCID ₅₀ of vCP37
• e: the animals received 5.0 log ₁₀ TCID ₅₀ to ALVAC-RG
• f: the animals received 7.0 log ₁₀ TCID ₅₀ to ALVAC-RG
• g: not tested

Table 9. Inoculation of rhesus macaques with ALVAC-RG ^a

• a: see Table 9 for inoculation schedule.
• b: The animals 176L and 185L received 8.0 log ₁₀ pfu orally in 5 ml of seaweed. The 187L animal did not receive 7.0 log ₁₀ pfu orally in the tang.
• c: day of post-vaccination for animals 176L, 185L, 177L and 186L on sc, and primary vaccination for animals 178L, 182L, 179L, 183L, 180L, 184L and 187L.
• d: titer expressed as reciprocal of the last dilution showing inhibition of fluorescence in an RFFI assay.

Table 10. Inoculation of chimpanzees with ALVAC-RG Weeks after inoculation Animal 431 in the Animal 457 sc 0 <8 ^a <8 1 <8 <8 2 8th 32 4 16 32 8th 16 32 12 ^b / 0 16 8th 1.13 128 128 3.15 256 512 8.20 64 128 26/12 32 128

• a: titre expressed as reciprocal of the last dilution showing inhibition of fluorescence in an RFFI assay.
• b: day of re-inoculation

EXAMPLE 9 - IMMUNIZATION OF PEOPLE USING CANARYPOX, WHICH EXPRESSES RABIES GLYCOPROTEINS (ALVAC-RG; vCP65)

ALVAC-RG (vCP65) was generated as in Example 9 and the 9A and 9B described.

For scale-up and Vaccine production was cultured ALVAC-RG (vCP65) in primary CEF, which derived from specified pathogen-free eggs. The cells were at a multiplicity of 0.1 and incubated for three days at 37 ° C.

The Vaccine virus suspension was purified by ultrasonication in serum-free Receive medium of infected cells; Cell debris were then removed by centrifugation and filtration removed. The resulting clarified suspension was treated with lyophilization stabilizer (Mixture of amino acids) supplemented, distributed in single-dose containers and freeze-dried. Three approaches with decreasing titer were by ten-fold serial dilutions the virus suspension in a mixture of serum-free medium and Lyophilization stabilizer, prepared before lyophilization.

Quality control tests were on the cell substrates, media and virus seed germs and End product applied, with an emphasis on the search for contaminating Agents and harmlessness in laboratory rodents. It was no unwanted Characteristic determined.

preclinical Dates. In vitro studies showed that VERO or MRC-5 cells do not support the growth of ALVAC-RG (vCP65); a series of eight (VERO) and 10 (MRC) blind-serial passages caused no detectable Adaptation of the virus to growth in these non-bird lines. Analyzes of human cell lines (MRC-5, WISH, Detroit 532, HEL, HNK or EBV-transformed lymphoblastoid cells), infected or inoculated with ALVAC-RG (vCP65), showed no accumulation of virus-specific DNA, suggesting that in these cells the block in replication takes place before the DNA synthesis. Significantly [found] however, the expression of the rabbit virus glycoprotein gene in all tested cell lines [instead of], indicating that the abort step in the canarypox replication cycle occurs before viral DNA replication.

The safety and efficacy of ALVAC-RG (vCP65) has been documented in a series of experiments in animals. A number of species, including canaries, chickens, ducks, geese, laboratory rodents (mice in infancy and adulthood), hamsters, guinea pigs, rabbits, cats and dogs, squirrel monkeys, rhesus macaques and chimpanzees, have been given dosages in the range inoculated from 10 ⁵ to 10 ⁸ pfu. A variety of routes have been used, most commonly subcutaneously, intramuscularly and intradermally, but also orally (monkeys and mice) and intracerebral (mice).

In canaries, ALVAC-RG (vCP65) caused a "take" lesion at the site of scarification without signs of illness or death. Intradermal inoculation of rabbits resulted in a typical poxvirus inoculation reaction which did not spread and healed in seven to ten days. There were no adverse side reactions due to canarypox in any of the test animals. Immunogenicity was documented by the development of anti-rabies antibodies following inoculation of ALVAC-RG (vCP65) in rodents, dogs, cats and primates, as measured by the Rapid Fluorescent Focus Inhibition Test (RFFIT). Protection was also demonstrated in rabies virus challenge experiments in mice, dogs, and cats immunized with ALVAC-RG (vCP65).

Volunteers. twenty-five healthy adults at the age of 20-45 with no previous History of a rabies immunization were included in the investigation added. Her health was completely medical Prehistory, body examinations, hematological and blood chemistry analyzes. exclusion criteria pregnancy, allergies, immunosuppression closed everyone Type, chronic debilitating disease, Cancer, injection of immunoglobulins in the last three months and seropositivity across from human immunodeficiency virus (HIV) or hepatitis B virus surface antigen.

Study design. Participants were assigned statistically to either standard "human diploid cell" vaccine vaccine (HDC), Lot # E0751 (Pasteur Merieux Serums & Vaccine, Lyon, France) or to receive the investigational vaccine ALVAC-RG (vCP65).

The trial was referred to as a dose escalation study. Three sets of experimental ALVAC-RG (vCP65) vaccine were used sequentially in three groups of volunteers (Groups A, B and C) with two-week intervals between each step. The concentration of the three approaches was 10 ^3.5 , 10 ^4.5 and 10 ^5.5 tissue culture infectious doses (TCID ₅₀ ) per dose, respectively.

Everyone Volunteer received two doses of the same vaccine subcutaneously the deltoid region at an interval of four weeks. The nature of the injected vaccine was given to participants at the time of first injection was unknown, but was known to the investigator.

Around the risk of immediate hypersensitivity at the time of the second injection, the Volunteers of group B, which the medium dose of trial vaccine were given an injection with the an hour before lower dose, and those who have been assigned to the higher dose were (group C), consecutively got the lower and the average dose in hourly Intervals.

six months later became the receivers the highest Dosage of ALVAC-RG (vCP65) (Group C) and HDC vaccine one third dose of vaccine administered; they became statistical divided to either the same vaccine as before or the alternative To receive vaccine. As a result, four groups were corresponding according to the following immunization scheme: 1. HDC, HDC-HDC; Second HDC, HDC-ALVAC-RG (vCP65); 3. ALVAC-RG (vCP65), ALVAC-RG (vCP65) -HDC; 4 ALVAC-RG (vCP65), ALVAC-RG (vCP65), ALVAC-RG (vCP65).

monitoring of side effects. All subjects were followed for 1 hour Injected and monitored while the next five days re-examined every day. They were asked for local and systemic reactions while the next three weeks and were interviewed twice a week by telephone.

Laboratory investigations. Blood samples were taken before admission to the study and two, four and received six days after each injection. The analysis included a total count blood cells, liver enzymes and creatine kinase assays.

Antibody assays. Antibody assays were seven days before the first injection and on days 7, 28, 35, 56, 173, 187 and 208 of the investigation.

Levels of neutralizing antibodies to rabies were determined using the Rapid Fluorescent Focus Inhibition (RFFIT) test (Smith et al., 1973). Canarypox antibodies were measured by direct ELISA. The antigen, a suspension of purified canarypox virus disrupted with 0.1% Triton X100, was coated in microplates. Fixed dilutions of the sera were allowed to react for two hours at room temperature and reacting antibodies were detected with a peroxidase-labeled anti-human IgG goat serum. The results are expressed as the optical density reading at 490 nm.

Analysis. Twenty-five subjects were picked up and completed the investigation. These were 10 men and 15 women, and the average age was 31.9 (21 to 48). All but three subjects showed signs of a previous smallpox vaccination; the three remaining subjects had no typical scar and vaccination history. Three subjects received each of the lower doses of experimental vaccine (10 ^3.5 and 10 ^4.5 TCID ₅₀ ), nine subjects received 10 ^5.5 TCID ₅₀ , and 10 received the HDC vaccine.

Security (Table 11). During the primary series of immunization, a higher fever than 37.7 ° C within 24 hours of injection in an HDC receiver (37.8 ° C) and in a recipient of vCP65 10 ^5.5 TCID ₅₀ (38 ° C) noticed. No further systemic response attributable to the vaccine was observed in any subject.

Local responses were reported in 9/10 recipients of the HDC vaccine injected subcutaneously and in 0/3, 1/3 and 9/9 recipients of vCP65 10 ^3.5 , 10 ^4.5 and 10 ^5.5 TCID, respectively ₅₀ noticed.

pain sensitivity was the most common Symptom and was always mild. Other local symptoms closed redness and curing which were also mild and temporary. All symptoms typically sounded and lasted within 24 hours never longer than 72 hours.

It There was no significant change in the blood cell counts, Liver enzymes or creatine kinase levels.

Immune responses: Neutralizing antibodies to rabies (Table 12). Twenty-eight days after the first injection, all HDC recipients had protective titers (≥ 0.5 IU / ml). In contrast, none of the ALVAC-RG (vCP65) receivers in Groups A and B (10 ^3.5 and 10 ^4.5 TCID ₅₀ ) and only 2/9 in Group C (10 ^5.5 TCID ₅₀ ) achieved this protective titer.

At the Day 56 (i.e., 28 days after the second injection) became protective titers in 0/3 group A, 2/3 group B and 9/9 group C receivers of ALVAC-RG (vCP65) vaccine, and persisted in all 10 HDC receivers.

At the Day 56, the geometric mean titers were 0.05, 0.47, 4.4 or 11.5 IU / ml in groups A, B, C and HDC, respectively.

At the Day 180 had the Rabies antibody titers Essentially decreased in all subjects, but remained above that minimal protective Titers of 0.5 IU / ml in 5/10 HCD recipients and in 5/9 ALVAC-RG (vCP65) receivers; the geometric mean titers were 0.51 and 0.45 IU / ml, respectively in the groups HCD and C.

Antibodies against Canarypox virus (Table 13). The observed pre-immune titers varied widely, the titers varied from 0.22 to 1.23 O.D. units, despite the absence of any previous contact with canaries in those subjects with the highest titers. If you as a greater than two times increase between the titres before immunization and after the second injection defined, seroconversion was obtained in 1/3 subjects in group B and in 9/9 subjects in group C, whereas no subject in Groups A or HDC showed seroconversion.

Booster injection. The vaccine became similarly good six months later, at the time of the booster injection Fever was noted in 2/9 HDC booster receivers and 1/10 ALVAC-RG (vCP65) booster recipients. Local reactions were in 5/9 recipients of HDC booster and in 6/10 receivers of the ALVAC-RG (vCP65) Booster.

Observations. The 11A - 11D show graphs of Rabies neutralizing antibody titers (Rapid Fluorescent Focus Inhibition Test or RFFIT, IU / ml): Booster effect of HDC and vCP65 (10 ^5.5 TCID ₅₀ ) in volunteers previously treated with either the same or the alternative Vaccine had been immunized. Vaccines were administered on days 0, 28 and 180. Antibody titers were measured on days 0, 7, 28, 35, 56, 173 and 187 and 208.

As shown in 11A to 11D , the administered booster dose resulted in a further increase irrespective of the immunization scheme, rabies antibody titers in each subject. However, the ALVAC-RG (vCP65) booster generally elicited lower immune responses than the HDC booster, and the ALVAC-RG (vCP65), ALAVC-RG (vCP65) -ALVAC-RG (vCP65) groups had significantly lower titers than the three other groups. Similarly, ALVAC-RG (vCP65) booster injection resulted in an increase in canarypox antibody titers in 3/5 subjects who had previously received the HDC vaccine and in all five subjects previously treated with ALVAC RG (vCP65).

in the Generally, none of the local side effects were from the administration from vCP65 featuring a local replication of the virus. In particular, damages were the Skin, like those after an injection of vaccine were observed, absent. Despite the obvious absence resulted in replication of the virus the injection in the volunteers to produce significant amounts at antibodies both against the canarypox vector as well as against the expressed Rabies glycoprotein.

Rabies neutralizing antibodies were assayed by the Rapid Fluorescent Focus Inhibition Test (RFFIT), which is known to correlate well with the sero-neutralization assay in mice. Of 9 recipients of 10 ^5.5 TCID _50, five had low-level response after the first dose. Protective titers of Rabies antibodies were obtained after the second injection in all recipients of the highest dose tested and even in 2 of the 3 medium dose recipients. In this study, both vaccines were administered subcutaneously, as is usually recommended for live vaccines, but not for the inactivated HDC vaccine. This injection route was chosen because it best allowed a careful injection site study, but this could explain the late onset of antibodies in HDC recipients: in fact, none of the HDC recipients had antibody elevation on day 7, whereas in most studies, in which HDC vaccine is given intramuscularly, this is the case in a significant proportion of subjects (Klietmann et al., Geneva, 1981; Kuwert et al., 1981). However, this invention is not necessarily limited to the subcutaneous route of administration.

The GMT (geometric mean titer) of Rabies neutralizing antibodies was lower in the experimental vaccine than in the HDC control vaccine, but were still over for a protection required minimum titer. The clear dose-effect response, which with the three dosages used in this study was, suggests that a higher Dosage a stronger one Give an answer could. Certainly, the person skilled in the art can use this description as an appropriate one Dosage for choose a given patient.

The Ability, the antibody response boosters is another important result of this example; actually became an increase in terms of Rabies antibody titers in each subject after the 6-month dose, regardless of Immunization Schemes, which shows that the pre-existing Immunity, caused either by the canarypox vector or the rabbit glycoprotein, no blocking effect on the booster with the recombinant Vaccine candidate or the conventional HDC Rabies vaccine had. This is in contrast to findings from other sources with vaccinia recombinants in humans that penetrate the immune response a pre-existing immunity can be blocked (Cooney et al., 1991; Etinger et al., 1991).

• *p = 0,007, t-Test nach Student

TABELLE 13: Kanarienpocken-Antikörper: Geometrische Mittelwert-Titer* im ELISA Tage vCP65-Dosierung TCID₅₀/Dosis 0 7 28 35 56 10^3,5 0,69 ND 0,76 ND 0,68 10^4,5 0,49 0,45 0,56 0,63 0,87 10^5,5 0,38 0,38 0,77 1,42 1,63 HDC-Kontrolle 0,45 0,39 0,40 0,35 0,39

• * optische Dichte bei Verdünnung von 1/25

Thus, this example clearly demonstrates that a non-replicating poxvirus can serve as an immunization vector in humans, with all the advantages conferred by replicating agents on the immune response, but without the security problem caused by a completely permissive virus. Furthermore, from this disclosure, such as this example and other examples, are suitable dosages and ways or means of administering or immunizing recombinants containing either rabies or other coding, or expression products thereof, within the reach of those skilled in the art Area, as well as species for in vitro expression. TABLE 11: Reactions in the 5 days following vaccination. vCP65 dosage (TCID ₅₀ ) 10 ^3.5 10 ^4.5 10 ^5.5 HDC control injection 1. Second 1. Second 1. Second 1. Second Num. d. vaccinated subjects 3 3 3 3 9 9 10 10 Temp.> 37.7 ° C 0 0 0 0 0 1 1 0 soreness 0 0 1 1 6 8th 8th 6 reddening 0 0 0 0 0 4 5 4 hardening 0 0 0 0 0 4 5 4 TABLE 12: Rabies Neutralizing Antibodies (REFIT; IU / ml) Individual Titers and Geometric Mean Titers (GMT) days No. TCID ₅₀ / dose 0 7 28 35 56 1 10 ^3.5 <0.1 <0.1 <0.1 <0.1 0.2 3 10 ^3.5 <0.1 <0.1 <0.1 <0.1 <0.1 4 10 ^3.5 <0.1 <0.1 <0.1 <0.1 <0.1 GMT <0.1 <0.1 <0.1 <0.1 <0.1 6 10 ^4.5 <0.1 <0.1 <0.1 <0.1 <0.1 7 10 ^4.5 <0.1 <0.1 <0.1 2.4 1.9 10 10 ^4.5 <0.1 <0.1 <0.1 1.6 1.1 GMT <0.1 <0.1 0.1 0.58 0.47 11 10 ^5.5 <0.1 <0.1 1.0 3.2 4.3 13 10 ^5.5 <0.1 <0.1 0.3 6.0 8.8 14 10 ^5.5 <0.1 <0.1 0.2 2.1 9.4 17 10 ^5.5 <0.1 <0.1 <0.1 1.2 2.5 18 10 ^5.5 <0.1 <0.1 0.7 8.3 12.5 20 10 ^5.5 <0.1 <0.1 <0.1 0.3 3.7 21 10 ^5.5 <0.1 <0.1 0.2 2.6 3.9 23 10 ^5.5 <0.1 <0.1 <0.1 1.7 4.2 25 10 ^5.5 <0.1 <0.1 <0.1 0.6 0.9 GMT <0.1 <0.1 0.16 1.9 4.4 * 2 HDC <0.1 <0.1 0.8 7.1 7.2 5 HDC <0.1 <0.1 9.9 12.8 18.7 8th HDC <0.1 <0.1 12.7 21.1 16.5 9 HDC <0.1 <0.1 6.0 9.9 14.3 12 HDC <0.1 <0.1 5.0 9.2 25.3 15 HDC <0.1 <0.1 2.2 5.2 8.6 16 HDC <0.1 <0.1 2.7 7.7 20.7 19 HDC <0.1 <0.1 2.6 9.9 9.1 22 HDC <0.1 <0.1 1.4 8.6 6.6 24 HDC <0.1 <0.1 0.8 5.8 4.7 GMT <0.1 <0.1 2.96 9.0 11.5 *

• * p = 0.007, student t-test

TABLE 13: Canarypox Antibodies: Geometric Mean Titers * in ELISA days vCP65 dosage TCID ₅₀ / dose 0 7 28 35 56 10 ^3.5 0.69 ND 0.76 ND 0.68 10 ^4.5 0.49 0.45 0.56 0.63 0.87 10 ^5.5 0.38 0.38 0.77 1.42 1.63 HDC control 0.45 0.39 0.40 0.35 0.39

• * optical density at dilution of 1/25

EXAMPLE 10 - COMPARISON OF ALVAC AND NYVAC LD ₅₀ WITH DIFFERENT VACCINIA VIRUS BARS

Mice. male Swiss Webster breeding mice were obtained from Taconic Farms (Germantown, NY) and released Access to mouse food and water until use at 3 weeks of age ("normal" mice). newborn Swiss Webster breeding mice Both sexes were and were following in time Regulated pregnancies obtained by Taconic Farms carried out were. All newborn mice used were within one Two-day period delivered.

Viruses. ALVAC was obtained by plaque purification of a canarypox virus population derived and became primary Chick embryo fibroblast cells (CEF). Following purification by centrifugation over sucrose density gradient ALVAC was tested for plaque-forming moieties in CEF cells counted. The WR (L) variant of vaccinia virus was selected by selection of WR phenotypes with huge Derived plaques (Panicali et al., 1981). The Wyeth "New York State Board of Health "vaccine strain of vaccinia virus was derived from the "Pharmaceuticals Calf Lymph Type" vaccine Drywax, Control number 302001 B, received. The Copenhagen strain vaccinia virus VC-2 was obtained from the Institut Merieux, France. The vaccinia virus strain NYVAC was derived from Copenhagen VC-2. All vaccinia virus strains except the Wyeth strain, were cultured in Vero kidney cells of the African Green Monkey, purified by sucrose gradient density centrifugation and for of plaque forming units on Vero cells. Of the Wyeth strain was grown in CEF cells and plaque-forming Units in CEF cells counted.

Inoculations. Groups of 10 normal mice were intracranial (ic) with 0.05 ml of one of several dilutions of the virus inoculated, which were prepared by 10-fold serial dilution of the Output stock preparations in sterile phosphate-buffered saline. In some cases, undiluted stock source virus preparation was used for the Used inoculation.

groups of 10 newborn mice at 1 to 2 days of age, ic were inoculated similarly to the normal mice, except that an injection volume of 0.03 ml was used.

All Mice were Every day in terms of mortality during a period of 14 days (newborn mice) or 21 days (normal mice) observed after inoculation. Mice, which in the morning after The inoculations found dead were due to a potential Tods excluded by injury.

The lethal dose (LD ₅₀ ) required to cause mortality for 50% of the experimental population was determined by the Proedional method of Reed and Muench (Reed and Muench, 1938).

Comparison of the LD ₅₀ of ALVAC and NYVAC with various vaccinia virus strains for normal, young stock mice on the ic pathway. In young normal mice, the virulence of NYVAC and ALVAC was several orders of magnitude lower than that of the other vaccinia virus strains tested (Table 14). NYVAC and ALVAC were found to be 3,000 times less virulent in normal mice than the Wyeth strain; over 12,500 times less virulent than the parental VC-2 strain; and over 63,000,000 times less virulent than the WR (L) variant. These results suggest that NYVAC is highly attenuated compared to other vaccinia strains, and that ALVAC is useful in young mice receiving intracranial administration In general, proliferation is generally not virulent, although both may cause mortality in mice at extremely high doses (3.85 × 10 ⁸ PFUs, ALVAC, and 3 × 10 ⁸ PFUs, NYVAC) through an indeterminate mechanism in this pathway of inoculation.

Comparison of the LD ₅₀ of ALVAC and NYVAC with various vaccinia virus strains for newborn livestock mice on the ic pathway. The relative virulence of 5 pox virus strains for normal, newborn mice was tested by titration in an intracranial (ic) challenge model system (Table 15). With mortality as the endpoint, LD ₅₀ values showed that ALVAC is over 100,000 times less virulent than the vaccinia virus Wyeth vaccine strain; over 200,000 times less virulent than the Copenhagen VC-2 strain of vaccinia virus; and over 25,000,000 times less virulent than the WR-L variant of vaccinia virus. Nevertheless, at the highest dose tested, 6.3 x 10 ⁷ PFUs resulted in a 100% mortality. The cause of death, although not actually determined, was probably not of a toxicological or traumatic nature, since the mean survival time (MST) of mice of the highest dose group (approximately 6.3 LD ₅₀ ) was 6.7 ± 1.5 days , Compared to WR (L) at a challenge dose of 5 LD ₅₀ , with the MST amounting to 4.8 ± 0.6 days, the MST of ALVAC challenged mice was significantly longer (P = 0.001).

In relation to NYVAC, Wyeth became more than 15,000 more virulent; VC-2 more than 35,000 times more virulent; and WR (L) more than 3,000,000 times more virulent. Similar to ALVAC caused the two highest doses of NYVAC, 6 × 10 ⁸ and 6 × 10 ⁷ PFUs, a mortality of 100%. However, the MST of mice challenged with the highest dose, equivalent to 380 LD _{50 , was} only 2 days (9 deaths on day 2 and 1 on day 4). In contrast, all mice challenged with the highest dose of WR-L, equivalent to 500 LD ₅₀ , survived until day 4. Table 14. Calculated 50% lethal dose for mice in various vaccinia virus strains and for canarypox virus (ALVAC) on the ic route. SMALLPOX VIRUS STRAIN CALCULATED LD ₅₀ (PFUs) WR (L) 2.5 VC-2 1.26 × 10 ⁴ WYETH 5.00 × 10 ⁴ NYVAC 1.58 × 10 ⁸ ALVAC 1.58 × 10 ⁸ Table 15. Calculated 50% lethal dose for newborn mice in various vaccinia virus strains and for canarypox virus (ALVAC) on the ic pathway. SMALLPOX VIRUS STRAIN CALCULATED LD ₅₀ (PFUs) WR (L) 0.4 VC-2 0.1 WYETH 1.6 NYVAC 1.58 × 10 ⁶ ALVAC 1.00 × 10 ⁷

EXAMPLE 11 - EVALUATION OF NYVAC (vP866) AND NYVAC-RG (vP879)

Immunoprecipitations. Preformed monolayers of avian or non-avian cells were inoculated with 10 pfu per cell of parental NYVAC (vP866) or NYVAC-RG (vP879) virus. The inoculation was carried out in EMEM which was free of methionine and supplemented with 2% dialyzed fetal bovine serum. After one hour of incubation, the inoculum was removed and the medium was replaced with EMEM (methionine-free) containing 20 μCi / ml of ³⁵ S-methionine. After an overnight incubation of approximately 16 hours, cells were supplemented by the addition of Buffer A (1% Nonidet P-40, 10 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.01% sodium azide, 500 units per ml of aprotinin and 0.02% phenylmethylsulfonyl fluoride). Immunoprecipitation was provided using a monoclonal antibody specific for Rabies glycoprotein designated 24-3F10 by Dr. med. C. Trinarchi, Griffith Laboratories, New York State Department of Health, Albany, New York, and a rat anti-mouse conjugate obtained from Boehringer Mannheim Corporation (Cat. # 605-500). Protein A-Sepharose CL-48, obtained from Pharmacia LKB Biotechnology Inc. of Piscataway, New Jersey, was used as the carrier matrix. The immunoprecipitates were assayed on 10% polyacrylamide gels according to the method of Dreyfuss et al. (1984) fractionated. The gels were fixed, treated with 1 M Na salicylate for one hour for fluorography, and exposed to Kodak XAR-2 film to visualize the immunoprecipitated protein species.

Sources of animals. "New Zealand White" rabbits were obtained from Hare-Marland (Hewitt, New Jersey). Three-week-old male Swiss Webster culture mice, time-regulated pregnant female Swiss Webster culture mice and four-week-old Swiss Webster nude mice (nu ⁺ nu ⁺ ) were obtained from Taconic Farms, Inc. (Germantown, New York). All animals were kept according to NIH guidelines. All animal protocols were approved by the institutional IACUC. When deemed necessary, mice that were apparently terminally ill were killed.

Evaluation of damage in rabbits. Each of two rabbits was inoculated intradermally at multiple sites with 0.1 ml PBS containing 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ or 10 ⁸ pfu of each test virus, or with PBS alone. Rabbits were observed daily from day 4 until damage was resolved. Indurations and ulcerations were measured and recorded.

Virus recovery from inoculation sites. A single rabbit was inoculated intradermally at several sites with 0.1 ml PBS containing 10 ⁶ , 10 or 10 ⁸ pfu of each test virus, or with PBS alone. After 11 days, the rabbit was killed and skin biopsy samples taken from each of the inoculation sites were aseptically prepared by mechanical disruption and indirect sonication for virus recovery. Infectious virus was assayed for CEF monolayers by plaque titration.

virulence in mice. Groups of ten or, in the nude mouse experiment, five mice became ip with one of several dilutions inoculated into virus in 0.5 ml of sterile PBS. Furthermore, reference is made taken to Example 11.

treatment with cyclophosphamide (CY). mice were injected on the ip route with 4 mg (0.02 ml) of CY (Sigma) on day-2, followed by virus injection on day 0. On the following days the infection was given to mice an ip injection with CY: 4 mg on day 1; 2 mg on days 4, 7 and 11; 3 mg on days 14, 18, 21, 25 and 28. Immunosuppression was monitored indirectly by counting the white one blood corpuscle with a counter Counter "on the day 11. The average white blood cell count was on 13500 cells per μl for untreated Mice (n = 4) and 4220 cells per μl for CY-treated Control mice (n = 5).

Calculation of the LD ₅₀ . The lethal dose (LD ₅₀ ) required to produce 50% mortality was determined by the proportional method of Reed and Muench (Reed and Muench 1938).

Efficacy testing of NYVAC-RG in mice. Four to six week old mice were challenged with 50 to 100 μl of a range of dilutions (2.0-8.0 log ₁₀ Tissue Culture Infectious Dose 50% (TCID ₅₀ )) of either VV-RG (Kieny et al. 1984), ALVAC-RG (Taylor et al., 1991b) or the NYVAC-RG in the footpad. Each group consisted of eight mice. Fourteen days after vaccination, mice were challenged by intracranial inoculation with 15 LD ₅₀ Rabies virus CVS strain (0.03 ml). On day 28, the surviving mice were counted and the 50% protective dose (PD ₅₀ ) was calculated.

Derivation of NYVAC (vP866). The vaccinia virus NYVAC strain was generated from VC-2, a plaque-cloned isolate of the COPENHAGEN vaccine strain. To generate NYVAC from VC-2, eighteen vaccinia ORFs, including a number of virulence-associated viral functions, were precisely deleted in a series of sequential manipulations as described earlier in this disclosure. These deletions were constructed in a manner to avoid the appearance of new unwanted open reading frames. 10 schematically shows the ORFs deleted to generate NYVAC. In the upper area of 10 the HindIII restriction map of the vaccinia virus genome is shown (VC-2 plaque isolate, COPENHAGEN strain). Enlarged are the six regions of VC-2 that were sequentially deleted when generating NYVAC. The deletions were described earlier in this disclosure (Examples 1 to 6). Below such a deletion locus are listed the ORFs deleted from this locus, along with the functions or homologies and molecular weight of their gene products.

replication studies NYVAC and ALVAC on human tissue cell lines. To the extent of replication of the NYVAC strain of vaccinia virus (vP866) in human cells To determine origin, six cell lines were set at an input multiplicity of 0.1 pfu inoculated under liquid culture per cell and incubated for 72 hours. The CO PENHAGEN parental clone (VC-2) became parallel inoculated to. primary Chick embryo fibroblasts (CEF) cells (obtained from 10-11 Day old embryonated eggs of SPF origin, Spafas, Inc., Storrs, CT) were included to allow a permissive cell substrate for all viruses represent. The cultures were analyzed on the basis of two criteria: the onset of productive viral replication and expression an extrinsic antigen.

The Replication potential of NYVAC in a number of human-derived Cells are shown in Table 16. Both VC-2 and NYVAC are capable to a productive replication in CEF cells, although at NYVAC with slight reduced yields. VC-2 is also capable of productive Replication in the six human-derived cell lines, the were tested at comparable yields, except in the EBV-transformed lymphoblastoid cell line JT-1 (human lymphoblastoid Cell line transformed with the Epstein-Barr virus, see Rickinson et al., 1984). In contrast, NYVAC is highly sensitive to his ability attenuated in any of the tested human-derived cell lines productively replicate. Low growth of infectious virus over remaining Viral levels were obtained from NYVAC-infected MRC-5 (ATCC # CCL171, human embryonic lung origin), DETROIT 532- (ATCC # CCL54, human Foreskin, down [s] syndrome), HEL 299- (ATCC # CCL137, human embryonic Lung cells) and HNK cells (human neonatal kidney cells, Whittiker Bioproducts, Inc., Walkersville, MD, cat. # 70-151). Replication on these cell lines was significantly reduced compared to viral yields from NYVAC-infected CEF cells or with parental VC-2 (Table 16). It should be noted that the yields at 24 hours in CEF cells for both NYVAC as well as VC-2 equivalent to the 72-hour yield. Allowing human cell line cultures additional Incubate for 48 hours (two more viral growth cycles), may therefore have enhanced the resulting relative virus yield.

consistent with the low levels of virus yields used in the Human derived cell lines MRC-5 and DETROIT 532 were obtained were detectable but decreased levels of accumulated NYVAC-specific DNA detected. The extent of DNA accumulation in the NYVAC-infected MRC-5 and DETROIT 532 cell lines relative to that infected in NYVAC CEF cells was in parallel with relative virus yields. NYVAC-specific viral DNA accumulation was not found in any of the observed other cells derived from humans.

An equivalent Experiment was also carried out using the avipox virus ALVAC. The Results of virus replication are also in Table 16 shown. No progeny virus was in any of the human cell lines detectable, consistent with the host range restriction of Canarypox virus is on bird species. Also consistent with the lack of productive replication of ALVAC in these Human-derived cells is the observation that no ALVAC-specific DNA accumulation detectable in any of the human-derived cell lines was.

Expression of Rabies glycoprotein by NYVAC-RG (vP879) in human cells. To determine whether efficient expression of a foreign gene could be obtained in the absence of significant levels of productive viral replication, the same cell lines were present with the NYVAC recombinant expressing the rabbit virus glycoprotein (vP879, Example 7) of ³⁵ S-methionine inoculated. Immunoprecipitation of the rabbit glycoprotein was performed from the radiolabeled culture lysate using a monoclonal antibody specific for the rabbit glycoprotein. Immunoprecipitation of a 67 kDa protein was detected, consistent with a fully glycosylated form of the Rabies glycoprotein. No serologically cross-reactive product was detected in uninfected or parental NYVAC-infected cell lysates. Equivalent results were obtained with all other human cells analyzed.

Inoculations on the rabbit skin. The induction and nature of skin damage to rabbits following intradermal (id) inoculation has previously been used as a measure of the pathogenicity of vaccinia virus strains (Buller et al., 1988; Child et al., 1990; Fenner, 1958, Flexner et al., 1987; Ghendon and Chernos 1964). Therefore, the nature of lesions associated with id inoculations with the vaccinia strains WR (ATCC # VR119, plaque-purified on CV-1 cells, ATCC # CCL70, and a plaque isolate termed L variant, ATCC # VR2035, selected as described in Panicali et al., 1981), WYETH (ATCC # VR325, marketed as DRYVAC from Wyeth Laboratories, Marietta, PA), COPENHAGEN (VC-2) and NYVAC, by inoculation of two rabbits ( A069 and A128). The two rabbits show different overall susceptibility to virus, with rabbit A128 showing less severe responses than rabbit A069. In rabbit A128 the damage was relatively small and disappeared 27 days after inoculation. On rabbit A069, the lesions were intense, especially with respect to WR inoculation sites, and disappeared only after 49 days. The intensity of the damage was also dependent on the location of the inoculation sites relative to the lymphatic drainage network. In particular, all sites above the spine showed more severe damage and required longer healing times than the damage localized on the flanks. All damage was measured daily from day 4 onwards until the disappearance of the last damage, and the average of the maximum damage size and days to fall were calculated (Table 17). No local reactions were observed from sites injected with the control PBS. Ulcerative damage was observed at sites injected with the vaccinia virus strains WR, VC-2 and WYETH. Significantly, no hardening or ulcer damage was observed at sites of inoculation with NYVAC.

Persistence of infectious virus at the site of inoculation. To check the relative persistence of these viruses at the site of inoculation, a rabbit was injected intradermally at several sites with 0.1 ml PBS containing 10 ⁶ , 10 ⁷ or 10 ⁸ pfu of VC-2, WR, WYETH or NYVAC, inoculated. For each virus, the 10 ⁷ pfu dose was located above the spine, flanked by the 10 ⁶ and 10 ⁸ doses. The sites of inoculation were observed daily for 11 days. WR produced the strongest response, followed by VC-2 and WYETH (Table 18). Ulceration was first observed on day 9 for WR and WYETH and on day 10 for VC-2. Sites inoculated with NYVAC or control PBS showed no hardening or ulceration. On day 11 post-inoculation, skin samples were excised from the sites of inoculation, mechanically disrupted, and virus was titered on CEF cells. The results are shown in Table 18. In no case was more virus recovered at this time than administered. The recovery of vaccinia strain WR was approximately 10 ⁶ pfu of virus at each site, regardless of the amount of virus administered. The recovery of vaccine strains WYETH and VC-2 was 10 ³ to 10 ⁴ pfu, regardless of the amount administered. No infectious virus was recovered from sites inoculated with NYVAC.

Inoculation of genetically or chemically immunodeficient mice. Intraperitoneal inoculation of high doses of NYVAC (5 x 10 ⁸ pfu) or ALVAC (10 ⁹ pfu) in nude mice caused no deaths, no damage and no apparent disease during the entire 100 day observation period. In contrast, mice inoculated with WR (10 ³ to 10 ⁴ pfu), WYETH (5 x 10 ⁷ or 5 x 10 ⁸ pfu) or VC-2 (10 ⁴ to 10 ⁹ pfu) showed disseminated damage typical for poxviruses are, first on the toe, then on the tail, followed by severe orchitis or orchitis in some animals. In WR or WYETH-infected mice, the occurrence of disseminated damage generally ultimately resulted in death, whereas most VC-2 infected mice eventually recovered. The calculated LD ₅₀ values are given in Table 19.

In particular, VC-2 inoculated mice began to show damage on their toes (red pustules) and 1 to 2 days later on the tail. These lesions occurred between 11 and 13 days after inoculation (pi) in mice given the highest doses (109, 10 ⁸ , 10, and 10 ⁶ pfu), 16 pi in the daytime mice given 10 ⁵ pfu , and on day 21 pi in mice given 10 ⁴ pfu. No damage was observed during the 100-day observation period in mice inoculated with 10 ³ and 10 ² pfu. Testicular inflammation was noted on day 23 pi in mice given 10 ⁹ and 10 ⁸ pfu, and about 7 days later in the other groups (10 ⁷ to 10 ⁴ pfu). The testicular inflammation was particularly intense in the 10 ⁹ and 10 ⁸ -pfu groups and, although declining, was observed until the end of the 100-day observation period. Some smallpox-like lesions were observed on the skin of a few mice, appearing for approximately 30-35 days pi. Most smallpox damage usually healed between 60-90 days pi. Only one mouse in the 10 ⁹ pfu inoculated group died (day 34 pi) and one mouse died in the group inoculated with 10 ⁸ pfu (day 94 pi). In the VC-2 inoculated mice, no other deaths were observed.

Mice inoculated with 10 ⁴ pfu of the WR strain of vaccinia began to show smallpox damage by day 17 pi. This damage appeared identical to the damage exhibited by the VC-2 injected mice (swollen toes, tail). Mice inoculated with 10 ³ pfu of the WR strain did not develop damage until 34 days pi. Testicular inflammation was noted only in the mice inoculated with the highest dose of WR (10 ⁴ pfu). During the later stages of the observation period, damage occurred around the mouth and the mice stopped eating. All mice inoculated with 10 ⁴ pfu of WR died between 21 days and 31 days pi or were killed if deemed necessary. Four of the 5 mice injected with 10 ³ pfu WR died between 35 days and 57 days pi, or were sacrificed if deemed necessary. No deaths were observed in mice inoculated with lower doses of WR (1 to 100 pfu).

Mice inoculated with the vaccinia virus WYETH strain at higher doses (5 x 10 ⁷ and 5 x 10 ⁸ pfu) showed damage to the toe and tail, developed testicular inflammation and died. Mice injected with WYETH at 5 x 10 ⁶ pfu or less showed no signs of disease or damage.

As shown in Table 19, CY-treated mice provided a more sensitive model for the assay of poxvirus virulence than does nude mice. The LD ₅₀ values for the WR, WYETH and VC-2 vaccinia virus strains were significantly lower in this model system than in the nude mouse model. In addition, damage was evolved in mice which had been injection treated with WYETH, WR and VC-2 vaccinia viruses as indicated below at higher doses of each virus, resulting in more rapid lesion formation. As observed with nude mice, CY-treated mice injected with NYVAC or ALVAC developed no damage. However, unlike nude mice, some deaths were seen in CY-treated mice challenged with NYVAC or ALVAC, regardless of dose. These random occurrences are doubtful in terms of cause of death.

Mice that received an injection of all doses of WYETH (9.5 x 10 ⁴ to 9.5 x 10 ⁸ pfu) showed pox damage on their tail and / or on their toes between 7 and 15 days pi. In addition, the tails and toes were swollen. The development of damage on the tail was typical of smallpox damage with the formation of a pustule, ulceration and ultimately the formation of a scab. Mice inoculated with all doses of VC-2 (1.65 x 10 ⁵ to 1.65 x 10 ⁹ ) also developed smallpox damage on their tails and / or toes, analogous to those of WYETH-injected mice. These damages were observed between 7-12 days after inoculation. No damage was observed in mice injected with lower doses of WR virus, although deaths occurred in these groups.

Test the efficacy of NYVAC-RG. In order to determine that attenuation of the vaccinia virus CO-PENHAGEN strain had been effected without significant change in the ability of the resulting NYVAC strain to be a useful vector, comparative efficacy tests were performed. To monitor the immunogenic potential of the vector during the sequential genetic manipulations performed to attenuate the virus, a rabies virus glycoprotein was used as the extrinsic reporter antigen. The protective efficacy of the vectors expressing the Rabies glycoprotein gene was evaluated in the standard Rabis NIH mouse efficacy assay (Seligmann, 1973). Table 20 shows that PD ₅₀ values obtained with the highly attenuated NYVAC vector are identical to those obtained using a COPENHAGEN-based recombinant containing the Rabies glycoprotein gene in the tk locus (Kieny et al , 1984), and similar to PD ₅₀ values obtained with ALVAC-RG, a canarypox-based vector restricted in bird species replication.

Observations. NYVAC, which deleted known virulence genes and has been restricted in terms of in vitro growth characteristics, was analyzed in animal model systems to examine its attenuation characteristics. These studies were compared to the vaccinia virus neurovirulent laboratory strain WR, two vaccinia virus vaccine strains, WYETH (New York City Board of Health) and COPENHAGEN (VC-2), and a canary pox virus strain ALVAC (See also Example 11). carried out. Taken together, these viruses provided a range of relative pathogenic potentials in the mouse challenge model and rabbit skin model, with WR being the most virulent strain, WYETH and COPENHAGEN (VC-2) providing previously used attenuated vaccine strains with documented properties, and ALVAC an example of a poxvirus whose replication is restricted to bird species. Results from these in vivo analyzes clearly demonstrate the strongly attenuated properties of NYVAC relative to the vaccinia virus strains WR, WYETH, and COPENHAGEN (VC-2) (Tables 14-20). Significantly, the LD ₅₀ values for NYVAC were comparable to those observed with the avian avipox virus ALVAC. Deaths due to NYVAC, as well as ALVAC, were only observed when extremely high doses of virus were administered by intracranial route (Example 11, Tables 14, 15, 19). It has not yet been determined whether these deaths are due to non-specific consequences of inoculating a high protein mass were based. Results from analyzes in immunocompromised mouse models (naked and CY treated) also demonstrate the relatively high attenuation properties of NYVAC compared to the strains WR, WYETH and COPENHAGEN (Tables 17 and 18). Significantly, no evidence of disseminated vaccinia infection or vaccinia disease was observed in NYVAC-inoculated animals or ALVAC-inoculated animals throughout the observation period. The deletion of several virulence-associated genes in NYVAC shows a synergistic effect in terms of pathogenicity. Another measure of harmlessness of NYVAC was provided by intradermal administration to rabbit skin (Tables 17 and 18). In view of the results with ALVAC, a virus incapable of replicating in non-avian species, the ability to replicate at the site of inoculation is not the only correlate with the reactivity since intradermal inoculation of ALVAC in a dose-dependent manner with areas caused a hardening. Therefore, factors other than replicating the virus are likely to contribute to the formation of the damage. The deletion of specific, virulence-associated genes in NYVAC prevents the onset of damage.

Taken together, show the results in this example and in the previous ones Examples, including Example 10, the severely weakened Nature of NYVAC relative to WR and the previously used vaccinia virus vaccine strains WYETH and COPENHAGEN. Indeed the pathogenic profile of NYVAC was similar in the animal model systems tested that of ALVAC, a smallpox virus known only productively replicated in bird species. The apparently limited capacity of NYVAC, productive to replicate cells derived from humans (Table 16) and other species including Mouse, pig, dog and horse are derived, represents a considerable Barrier ready, showing a potential transfer to non-vaccinated Restrict or avoid contacts or the general environment, in addition to that a vector with reduced probability of propagation provided within the vaccinated individual.

Significantly, the NYVAC-based vaccine candidates have been shown to be effective. NYVAC recombinants expressing foreign gene products from a variety of pathogens have elicited immunological responses against the foreign gene products in several animal species, including primates. In particular, a NYVAC-based recombinant expressing the Rabies glycoprotein was able to protect mice against a lethal Rabies challenge. The efficacy of the NYVAC-based Rabies glycoprotein recombinant was comparable to the PD ₅₀ value for a COPENHAGEN-based recombinant containing the Rabies glycoprotein in the tk lotus (Table 20). NYVAC-based recombinants have also been shown to elicit measles virus neutralizing antibodies in rabbits and protection against challenge by pseudorabies virus and Japanese encephalitis virus in swine. The severely attenuated NYVAC strain provides safety benefits in human, veterinary, medical, and veterinary applications (Tartaglia et al., 1992). In addition, the use of NYVAC as a general laboratory expression vector system can greatly reduce the biological hazards associated with the use of vaccinia virus.

• ^a pfu von angegebenem Vaccinia-Virus in 0,1 ml PBS, intradermal in eine Stelle inokuliert.
• ^b mittlere Maximumgröße der Schäden (mm²)
• ^c mittlere Zeit nach der Inokulation für ein vollständiges Abheilen des Schadens.
• ^d keine Schäden erkennbar.

TABELLE 16 Replikation von COPENHAGEN (VC-2), NYVAC und ALVAC in von Vögeln oder Menschen abgeleiteten Zelllinien Zellen Stunden nach der Infektion Ausbeute^a Ausbeute VC-2 NYVAC ALVAC CEF 0 3,8^b 3,7 4,5 24 8,3 7,8 6,6 48 8,6 7,9 7,7 72 8,3 7,7 7,5 25 72A^c < 1,4 1,8 3,1 MRC-5 0 3,8 3,8 4,7 72 7,2 4,6 3,8 0,25 72A 2,2 2,2 3,7 WISH* 0 3,4 3,4 4,3 72 7,6 2,2 3,1 0,0004 72A -^d 1,9 2,9 DETROIT 0 3,8 3,7 4,4 72 7,2 5,4 3,4 1,6 72A 1,7 1,7 2,9 HEL 0 3,8 3,5 4,3 72 7,5 4,6 3,3 0,125 72A 2,5 2,1 3,6 JT-1 0 3,1 3,1 4,1 72 6,5 3,1 4,2 0,039 72A 2,4 2,1 4,4 HNK 0 3,8 3,7 4,7 72 7,6 4,5 3,6 0,079 72A 3,1 2,7 3,7

• a: Ausbeute an NYVAC 72 Stunden nach der Infektion, ausgedrückt als Prozentsatz der Ausbeute an VAC-2 nach 72 Stunden auf der gleichen Zelllinie.
• b: Titer, ausgedrückt als LOG₅₀ pfu pro ml.
• c: Die Probe wurde in Gegenwart von 40 μg/ml Cytosin-Arabinosid inkubiert.
• d: Nicht bestimmt.
• *: ATCC #CCL25, humane Amnion-Zellen.

Tabelle 18. Persistenz von Pockenviren an der Stelle der intradermalen Inokulation Virus Inokulum-Dosis Insgesamt zurückgewonnenes Virus WR 8,0^a 6,14 7,0 6,26 6,0 6,21 WYETH 8,0 3,66 7,0 4,10 6,0 3,59 VC-2 8,0 4,47 7,0 4,74 6,0 3,97 NYVAC 8,0 0 7,0 0 6,0 0

• a: ausgedrückt als log₁₀ pfu.

Tabelle 19. Virulenzuntersuchungen in immunkompromittierten Mäusen Pockenvirus-Stamm LD₅₀ ^a Nacktmäuse Cyclophosphamid-behandelte Mäuse WR 422 42 VC-2 > 10⁹ < 1,65 × 10⁵ WYETH 1,58 × 10⁷ 1,83 × 10⁶ NYVAC > 5,50 × 10⁸ 7,23 × 10⁸ ALVAC > 10⁹ ≥ 5,00 × 10^8b

• a: berechnete 50%-Letaldosis (pfu) für Nackt- oder Cyclophosphamid-behandelte Mäuse durch die angegebenen Vaccinia-Viren, und für ALVAC, mittels intraperitonealem Weg.
• b: 5 von 10 Mäusen starben bei der höchsten Dosis von 5 × 10⁸ pfu.

Tabelle 20. Vergleichende Wirksamkeit von NYVAC-RG und ALVAC-RG in Mäusen Rekombinante PD₅₀ ^a VV-RG 3,74 ALVAC-RG 3,86 NYVAC-RG 3,70

• a: Vier bis sechs Wochen alte Mäuse wurden in den Fußballen inokuliert mit 50–100 μl einer Auswahl an Verdünnungen (2,0–8,0 log₁₀ Gewebekultur-Infektions-Dosis-50% (TCID₅₀) von entweder VV-RG (Kieny et al., 1984), ALVAC-RG (vCP65) oder NYVAC-RG (vP879). Am Tag 14 wurden Mäuse jeder Gruppe durch intracraniale Inokulation von 30 μl eines lebenden CVS-Stamms von Rabies-Virus, entsprechend 15 "Letale-Dosis-50%" (LD₅₀) pro Maus, herausgefordert. Am Tag 28 wurden die überlebenden Mäuse gezählt, und eine protektive Dosis 50% (PD₅₀) wurde berechnet.

According to the following criteria, the results of this example and the examples herein, including Example 10, show that NYVAC is highly attenuated: a) no detectable hardening or ulceration at the site of inoculation (rabbit skin); b) rapid removal of the infectious virus from the intradermal site of inoculation (rabbit skin); c) absence of testicular inflammation (nude mice); d) greatly reduced virulence (intracranial challenge, both three week old and newborn mice); e) greatly reduced pathogenicity and failure to spread in immunodeficient subjects (nude and cyclophosphamide-treated mice); and f) drastically reduced ability to replicate on a variety of human tissue culture cells. Despite the fact that it is severely attenuated, NYVAC, as a vector, retains the ability to induce strong immune responses to extrinsic antigens. Table 17. Hardening and ulceration at the site of intradermal inoculation of rabbit skin VIRUS STRAIN DOSE ^a HARDENING ulceration Size ^b Days ^c size days WR 10 ⁴ 386 30 88 30 10 ⁵ 622 35 149 32 10 ⁶ 1057 34 271 34 10 ⁷ 877 35 204 35 10 ⁸ 581 25 88 26 WYETH 10 ⁴ 32 5 - ^d - 10 ⁵ 116 15 - - 10 ⁶ 267 17 3 15 10 ⁷ 202 17 3 24 10 ⁸ 240 29 12 31 VC-2 10 ⁴ 64 7 - - 10 ⁵ 86 8th - - 10 ⁶ 136 17 - - 10 ⁷ 167 21 6 10 10 ⁸ 155 32 6 8th NYVAC 10 ⁴ - - - - 10 ⁵ - - - - 10 ⁶ - - - - 10 ⁷ - - - - 10 ⁸ - - - -

• ^a pfu of given vaccinia virus in 0.1 ml of PBS, inoculated intradermally into one site.
• ^b mean maximum size of the damage (mm ² )
• ^c mean time after inoculation for complete healing of the damage.
• ^d no damage visible.

TABLE 16 Replication of COPENHAGEN (VC-2), NYVAC and ALVAC in avian or human derived cell lines cell Hours after infection Yield ^a yield VC-2 NYVAC ALVAC CEF 0 3.8 ^b 3.7 4.5 24 8.3 7.8 6.6 48 8.6 7.9 7.7 72 8.3 7.7 7.5 25 72A ^c <1.4 1.8 3.1 MRC-5 0 3.8 3.8 4.7 72 7.2 4.6 3.8 0.25 72A 2.2 2.2 3.7 WISH * 0 3.4 3.4 4.3 72 7.6 2.2 3.1 0.0004 72A - ^d 1.9 2.9 DETROIT 0 3.8 3.7 4.4 72 7.2 5.4 3.4 1.6 72A 1.7 1.7 2.9 HEL 0 3.8 3.5 4.3 72 7.5 4.6 3.3 0,125 72A 2.5 2.1 3.6 JT-1 0 3.1 3.1 4.1 72 6.5 3.1 4.2 0,039 72A 2.4 2.1 4.4 HNK 0 3.8 3.7 4.7 72 7.6 4.5 3.6 0.079 72A 3.1 2.7 3.7

• a: Yield of NYVAC 72 hours after infection, expressed as a percentage of the yield of VAC-2 after 72 hours on the same cell line.
• b: titer expressed as LOG ₅₀ pfu per ml.
• c: The sample was incubated in the presence of 40 μg / ml cytosine arabinoside.
• d: Not determined.
• *: ATCC # CCL25, human amnion cells.

Table 18. Persistence of poxviruses at the site of intradermal inoculation virus Inoculum dose Total recovered virus WR 8.0 ^a 6.14 7.0 6.26 6.0 6.21 WYETH 8.0 3.66 7.0 4.10 6.0 3.59 VC-2 8.0 4.47 7.0 4.74 6.0 3.97 NYVAC 8.0 0 7.0 0 6.0 0

• a: expressed as log ₁₀ pfu.

Table 19. Virulence studies in immunocompromised mice Smallpox virus strain LD ₅₀ ^a nude mice Cyclophosphamide-treated mice WR 422 42 VC-2 > 10 ⁹ <1.65 × 10 ⁵ WYETH 1.58 × 10 ⁷ 1.83 × 10 ⁶ NYVAC > 5.50 × 10 ⁸ 7.23 × 10 ⁸ ALVAC > 10 ⁹ ≥ 5.00 × 10 ^8b

• a: calculated 50% total dose (pfu) for nude- or cyclophosphamide-treated mice by the vaccinia viruses indicated, and for ALVAC by intraperitoneal route.
• b: 5 out of 10 mice died at the highest dose of 5x10 ⁸ pfu.

Table 20. Comparative efficacy of NYVAC-RG and ALVAC-RG in mice recombinant PD ₅₀ ^a VV-RG 3.74 ALVAC-RG 3.86 NYVAC-RG 3.70

• a: Four to six week old mice were inoculated in the footpad with 50-100 μl of a range of dilutions (2.0-8.0 log ₁₀ Tissue Culture Infection Dose 50% (TCID ₅₀ ) of either VV-RG ( Kieny et al., 1984), ALVAC-RG (vCP65) or NYVAC-RG (vP879). On day 14, mice of each group were challenged by intracranial inoculation of 30 μl of a live CVS strain of Rabies virus, corresponding to 15 "lethal Dose -50% "(LD ₅₀ ) per mouse challenged. On day 28, the surviving mice were counted and a 50% protective dose (PD ₅₀ ) was calculated.

Example 12 - Cloning of HCMV gB into Poxvirus vectors

Cloning of the HCMV gB gene into the vaccinia donor plasmid pMP22BHP. The 4800 bp HindIII-BamHI fragment of the HindIII-D fragment of HCMV DNA (Towne strain) was cloned into the 2800 bp HindIII-BamHI fragment of plasmid pIBI24 (International Biotechnologies, Inc. New Haven, CT) , By in vitro mutagenesis (Kunkel, 1985) using oligonucleotides CMVM5 (SEQ ID NO: 74) (5'-GCCTCATCGCTGCTGGATATCCGTTAAGTTTGTATCGTAATGGAATCCAGGATCTG-3 ') and CMVM3 (SEQ ID NO: 75) (5'). '-GACAGAGACTTGTGATTTTTATAAGCTTCGTAAGCTGTCA-3'), the gB gene was modified to be expressed under the control of the vaccinia H6 promoter (Taylor et al., 1988a, b; Perkus et al., 1989). The plasmid containing the modified gB was designated 24CMVgB (5 + 3). The DNA sequence of the CMVgB gene is in the 12 (SEQ ID NO: 37).

The Plasmid pMP2VCL (which has a polylinker region with vaccinia sequences upstream of the K1L host range gene) was digested within the polylinker with HindIII and XhoI and ligated to the annealed oligonucleotides SPHPRHA A to D, thereby SP131 containing a HindIII site, the H6 promoter from -124 to -1 (Perkus et al., 1989) and a polylinker region.

The 2900 bp in size EcoRV-BamHI fragment of 24CMVgB (5 + 3) was inserted into the 3100 bp EcoRV-BglII fragment cloned from SP131. This cloning step brought the gB gene under the control of the H6 promoter. The resulting plasmid is called SP131CMVgB.

The Plasmid pSD22-H contains a 2.9 kb big one BglII fragment derived from the HindIII F region of the WR strain of vaccinia virus, which is ligated into the BamHI site of pUC8. The one-time BamHI site in pSD22-H is a non-essential site which as an insertion locus for Foreign genes is used (Panicali and Paoletti, 1982). The plasmid pMP22BHP is a derivative of pSD22-H in which the unique BamHI site by the addition an extended polylinker region for the insertion of foreign DNA was modified. The plasmid pMP22BHP was digested with HindIII and to a 2.9 kb HindIII fragment from SP131CMVgB (containing the H6 promoter-driven gB gene) to give the Plasmid SAg22CMVgB generated. Around the polylinker region in sAg22CMVgB to modify, the plasmid was digested with BamHI, followed by partial digestion with HindIII, and purified. The ligation to a 50 bp big BamHI / HindIII polylinker derived from IBI24 led to Plasmid 22CMVgB.

cloning of the HCMVgB gene into the NYVAC donor plasmid pSD542. The plasmid pSD542 (a NYVAC TK locus donor plasmid) was prepared from plasmid pSD513 (Tartaglia et. al., 1992). The polylinker region in pSD513 was by cutting with PstI / BamHI and ligating to the annealed synthetic Oligonucleotides MPSYN288 (SEQ ID NO: 80) (5'-GGTCGACGGATCCT-3 ') and MPSYN289 (SEQ ID NO: 81) (5'-GATCAGGATCCGTCGACCTGCA-3') modified led to the plasmid pSD542.

22CMVgB was digested with BamHI and NsiI to generate a fragment containing the H6 promoter and part of the gB gene, as well as NsiI and PstI to generate a fragment containing the rest of the gB gene. These two fragments were ligated to pSD542, which had been digested with BamHI and PstI within its polylinker to generate the NYVAC donor plasmid 542CMVgB. The DNA sequence of the CMVgB gene and flanking sequences contained in 542CMVgB are in 13A and B (SEQ ID NO: 38).

Cloning of the HCMV gB gene into the ALVAC donor plasmid CP3LVOH6. A 8.5 kb canarypox BglII fragment was cloned into the BamHI site of the pBS-SK plasmid vector (Stratagene, La Jolla, CA) to generate pWW5. Nucleotide sequence analysis revealed a reading frame designated C3, starting at position 1458 and ending at position 2897 in the sequence in 14A -C (SEQ ID NO: 39). To construct a donor plasmid for insertion of foreign genes into the C3 locus, with complete excision of the open C3 reading frame, PCR primers were used to amplify the 5 'and 3' sequences relative to C3. The primers for the 5 'sequence were RG277 (SEQ ID NO: 82) (5'-CAGTTGGTACCACTGGTATTTTATTTCAG-3') and RG278 (SEQ ID NO: 83) (5'-TATCTGAATTCCTGCAGCCCGGGTTTTTATAGCTAATTAGTCAAATGTGAGTTAATATTAG-3 '). ,

The Primer for the 3 '' sequences were RG279 (SEQ ID NO: 84) (5'-TCGCTGAATTCGATATCAAGCTTATCGATTTTTATGACTAGTTAATCAAATAAAAAGCATACAAGC-3 ') and RG280 (SEQ. ID. No .: 85) (5'-TTATCGAGCTCTGTAACATCAGTATCTAAC-3 '). The primers were designed to be a multiple cloning site, flanked by transcriptional and translational termination signals from vaccinia. Also included at the 5'-end and 3'-end of the left arm and right arm became appropriate restriction sites (Asp718 and EcoRI for the left arm and EcoRI and SacI for the right arm), which made it possible that the two arms in Asp718 / SacI-digested pBS-SK plasmid vector could be ligated. The resulting plasmid was named pC3I designated.

One 908 bp large Fragment of canarypox DNA, immediately upstream of the C3 locus, was obtained by digesting the plasmid pWW5 with NsiI and SspI. A 604th bp big Fragment of canarypox DNA was amplified by PCR (Engelke et al. 1988) using the plasmid PWW5 as template and the oligonucleotides CP16 (SEQ ID NO: 86) (5'-TCCGGTACCGCGGCCGCAGATATTTGTTAGCTTCTGC-3 ') and CP 17 (SEQ. ID. No .: 87) (5'-TCGCTCGAGTAGGATACCTACCTACTACCTACG-3 '). The 604 bp in size Fragment was digested with Asp718 and XhoI (sites located at the 5 'ends of the oligonucleotides CP16 or CP17 present) and digested in Asp718 XhoI and alkaline phosphatase-treated IBI25 (International Biotechnologies, Inc., New Haven, CT), giving the Plasmid SPC3LA generated. SPC3LA became within IBI25 with EcoRV and within the canarypox DNA digested with NsiI and attached to the 908 bp big NsiI-SspI fragment ligated to produce SPCPLAX containing 1444 bp canarypox DNA upstream of the C3 locus.

isoliert. Das 279 bp große Fragment wurde mit XhoI und SacI (Stellen, vorhanden an den 5'-Enden der Oligonukleotide CP19 bzw. CP20) verdaut und in SacI-XhoI-verdauten und mit alkalischer Phosphatase behandelten IBI25 kloniert, wodurch man das Plasmid SPC3RA erzeugte.A 2178 bp BglII-StyI fragment of canarypox DNA was isolated from the plasmid pXX4 (which contains a 6.5 kb NsiI fragment of canarypox DNA cloned into the PstI site of pBS-SK). A 279 bp fragment of canarypox DNA was amplified by PCR (Engelke et al., 1988) using plasmid pXX4 as template and oligonucleotides CP19 (SEQ ID NO: 88).

isolated. The 279 bp fragment was digested with XhoI and SacI (sites present at the 5 'ends of oligonucleotides CP19 and CP20, respectively) and cloned into SacI-XhoI digested and alkaline phosphatase-treated IBI25 to generate plasmid SPC3RA.

To add extra unique sites to the polylinker, pC3I was digested with EcoRI and ClaI within the polylinker region, treated with alkaline phosphatase and ligated to the kinased and annealed oligonucleotides CP12 (SEQ ID NO: 90) (5'-AATTCCTCGAGGGATCC-3 '). and CP13 (SEQ ID NO: 91) (5'-CGGGATCCCTCGAGG-3 ') (containing an EcoRI sticky end, an XhoI site, BamHI site, and a ClaI-compatible sticky end) to give the plasmid SPCP3S was generated. SPCP3S was digested with StyI and SacI (pBS-SK) within the canarypox sequences downstream of the C3 locus and ligated to a 261 bp BglII-SacI fragment from SPC3RA and the 2178 bp BglII-StyI fragment from pXX4 The plasmid CPRAL was generated which contained 2572 bp canarypox DNA downstream of the C3 locus. SPCP3S was digested with Asp718 (in pBS-SK) and AccI within the canarypox sequences upstream of the C3 locus and ligated to a 1436 bp Asp718-AccI fragment from SPCPLAX to generate the plasmid CPLAL, which contained 1457 bp canarypox. DNA upstream of the C3 locus. CPLAL was digested with StyI and SacI (in pBS-SK) within the canarypox sequences downstream of the C3 locus and ligated to a 2438 bp StyI-SacI fragment from CPRAL, thereby The plasmid CP3L was generated which generated 1457 bp canarypox DNA upstream of the C3 locus, stop codon in six reading frames, an early transcription termination signal, a polylinker region, an early transcription termination signal, stop codons in six reading frames, and 2572 bp canarypox DNA downstream of the C3 locus.

The early / late H6 vaccinia virus promoter (Taylor et al., 1988a, b; Perkus et al., 1989) was amplified by PCR (Engelke et. al., 1988) using pRW838 (a plasmid containing the Rabies glycoprotein gene (Kieny et al., 1984) linked to the H6 promoter) as template and the oligonucleotides CP21 (SEQ ID. No. 92) (5'-TCGGGATCCGGGTTAATTAATTAGTTATTAGACAAGGTG-3 ') and CP22 (SEQ. ID. No .: 93) (5'-TAGGAATTCCTCGAGTACGATACAAACTTAAGCGGATATCG-3 '). The PCR product was with BamHI and EcoRI (sites located at the 5 'ends of the oligonucleotides CP21 and CP22 are present) and ligated to CP3L, which binds with BamHI and EcoRI was digested in the polylinker to give the plasmid VQH6CP3L generated.

The ALVAC donor plasmid VQH6CP3L was digested with XhoI within the polylinker and NruI within the H6 promoter, and a NruI / HindIII fragment of 22CMVgB containing part of the H6 promoter and gB gene and one from pIBI24 by XhoI and HindIII digest derived polylinker, to generate the ALVAC donor plasmid CP3LCMVgB. The DNA sequence of the CMVgB gene plus additional flanking DNA sequences in plasmid CP3LCMVgB are inserted into the 15A -C shown (SEQ ID NO: 40).

cloning of the HCMV gB gene whose transmembrane region is deleted into the NYVAC donor plasmid pSD553.

The Plasmid pSD553 is a vaccinia deletion / insertion plasmid of COPAK series. It contains the vaccinia K1L host range gene (Gillard et al., 1986; Perkus et al., 1990) within flanking Copenhagen vaccinia arms, replacing the ATI region (ORFs A25L, A26L, Goebel et al. 1990a, b). pSD553 was constructed as follows.

left and right flanking vaccinia arms were polymerase chain reaction (PCR) using pSD414, a pUC8-based clone of Vaccinia SalI B (Goebel et al., 1990a, b) constructed as a template. The left arm was made using the synthetic deoxyoligonucleotides MPSYN267 (SEQ ID NO: 94) (5'-GGGCTGAAGCTTGCTGGCCGCTCATTAGACAAGCGAATGAGGGAC-3 ') and MPSYN268 (SEQ. ID. No. 95) (5'-AGATCTCCCGGGCTCGAGTAATTAATTAATTTTTATTACACCAGAAAAGACGGCTTGAGATTC-3 ') as a primer. The right arm was made using the synthetic deoxyoligonucleotides MPSYN269 (SEQ ID NO: 96) (5'-TAATTACTCGAGCCCGGGAGATCTAATTTAATTTAATTTATATAACTCATTTTTTGAATATACT-3 ') and MPSYN270 (SEQ. ID. No .: 97) (5'-TATCTCGAATTCCCGCGGCTTTAAATGGACGGAACTCTTTTCCCCC-3 ') as a primer. The two PCR-derived DNA fragments containing the left and right Arms were combined in another PCR reaction. The resulting product was cut with EcoRI / HindIII, and a 0.9 kb big Fragment was isolated. The 0.9 kb fragment was digested with pUC8, which was cut with EcoRI / HindIII, ligated resulting in the plasmid pSD541 led. The polylinker region located at the vaccinia ATI deletion locus was expanded as follows. pSD541 was cut with BglII / XhoI and with the annealing complementary synthetic oligonucleotides MPSYN333 (SEQ ID NO: 98) (5'-GATCTTTTGTTAACAAAACTAATCAGCTATCGCGAATCGATTCCCGGGGGATCCGGTACCC-3 ') and MPSYN334 (SEQ. ID. No. 99) (5'-TCGAGGGTACCGGATCCCCCGGGAATCGATTCGCGATAGCTGATTAGTTTTTGTTAACAAA-3 '), whereby the plasmid pSD552 was generated. The K1L host range gene was as a 1 kb big one BglII (partial) / HpaI fragment from plasmid pSD452 (Perkus et al., 1990). pSD552 was cut with BglII / HpaI and ligated with the K1L-containing fragment to generate pSD553 has been.

A HindIII fragment from SP131CMVgB (containing the HCMVgB gene under the control of the H6 promoter) was filled in with the Klenow fragment of DNA polymerase I and ligated into plasmid pSD553, which was digested with SmaI and treated with alkaline phosphatase was. The resulting NYVAC donor plasmid (in which the H6 promoter-driven gB is in the same orientation as K1L) was designated 553H6CMVgB. The DNA sequence of the CMVgB gene plus additional flanking DNA sequences in plasmid 553H6CMVgB are reported in 16A and B (SEQ ID NO: 41).

The sequence of CMVgB whose transmembrane region has been deleted is in 17 (SEQ ID NO: 42). The nucleotides encoding the transmembrane region became as follows deleted. Oligonucleotides SPgB3 (SEQ ID NO: 100) (5'-GATCCATGGACTCGACAGCGGCGTCTCTGCATGCAGCCGCTGCAGA-3 ') and SPgB4 (SEQ ID NO: 101) (5'-AGCTTCTGCAGCGGCTGCATGCAGAGACGCCGCTGTCGAGTCCATG-3') were kinased, annealed and probed with BamHI / HindIII digested and alkaline phosphatase treated IBI24 to generate plasmid SPCMVgB2. Oligonucleotides SPgB1 (SEQ ID NO: 102) (5'-TACGAATTCTGCAGTTCACCATGACACGTTGC-3 ') and SPgB2 (SEQ ID NO: 103) (5'-ATAGGATCCATGGTCGGTCGTCCAGACCCTTGAGGTAGGCC-3') were amplified in a PCR with the plasmid Used SP131CMVgB as template to generate a 0.7 kb fragment. This fragment was digested with EcoRI / BamHI and cloned into EcoRI / BamHI digested and alkaline phosphatase treated IBI24 to generate plasmid SPCMVgB1. A 0.7 kb EcoRI / NcoI fragment from SPCMVgB1 was ligated to EcoRI / NcoI digested and phosphatase treated SPCMVgB2 to generate plasmid SPCMVgB3. The unique NcoI site in SPCMVgB3 was deleted by mutagenesis (Mandecki, 1986) using oligonucleotide SPgB5 (SEQ ID NO: 104) (5'-GCCCTACCTCAAGGGTCTGGACGACACTCGACAGCGGCGTCTCTGCAT-3 ') to generate plasmid SPCMVgB4. A 0.7 kb PstI fragment from SPCMVgB4 was ligated to a 6.6 kb PstI fragment from 553H6CMVgB, whereby the NYVAC donor plasmid 553H6CMVgBTM ^- was generated. This plasmid contains the gB gene under the control of the H6 promoter with its transmembrane region deleted (amino acids 715-772: Spaete et al., 1988). The DNA sequence of the transmembrane deleted CMVgB gene plus additional flanking DNA sequences in plasmid 553H6CMVgBTM ^- are identified in 18A and B (SEQ ID NO: 43).

Cloning of the HCMVgB gene whose transmembrane region is deleted and which contains an altered cleavage site into the NYVAC donor plasmid pSD553. The sequence of CMVgB whose transmembrane region has been deleted and which contains an altered cleavage site is described in U.S. Pat 19 (SEQ ID NO: 44). The change of the cleavage site was accomplished in the following manner. Oligonucleotides SPgB8 (SEQ ID NO: 105) (5'-AATTGGTGACCG-3 ') and SPgB9 (SEQ ID NO: 106) (5'-GATCCGGTCACC-3') were kinased, annealed and ligated into the EcoRI / BamHI digested and alkaline phosphatase treated IBI24, generating the plasmid BstIBI. A 1.4 kb BstEII / SpHI fragment from 553H6CMVgBTM ^- was cloned into BstEII / SpHI digested and alkaline phosphatase treated BstIBI generating plasmid SPCMVgB5.

Oligonucleotides SPgB10 (SEQ ID NO: 107) (5'-TGAAAGACCGAATTCTGCGT-3 ') plus SPgB11 (SEQ ID NO: 108) (5'-TGCGATTCATCGGTTTGTTGTAGAT-3') and SPgB12 (SEQ. ID. No. 109) (5'-GACCCTTGAGGTAGGGCGGC-3 ') plus SPgB13 (SEQ ID NO: 110) (5'-ACTCATAATAGAACCATAAGATCTACAGATGGCAACAAT-3') were used in a PCR with the plasmid 553H6CMVgBTM ^- to obtain 0.7 and generate 0.8 kb fragments. These two fragments were combined in a PCR with the oligonucleotides SPgB10 plus SPgB 12 to generate a 1.2 kb fragment. The 1.2 kb fragment was digested with EcoRI and PstI, and a 0.5 kb fragment was isolated and cloned into EcoRI / PstI digested and alkaline phosphatase treated IBI24 to generate plasmid SPCMVgB6. The 0.5 kb EcoRI / PstI fragment from SPCMVgB6 was used to replace the corresponding fragment in SPCMVgB5, producing plasmid SPCMVgB7. A 1.4 kb Bst EII / SpHI fragment from SPCMVgB7 was used to replace the corresponding fragment in 553H6CMVgB, whereby the NYVAC donor plasmid 553H6gBC ^- TM ^- was generated. This plasmid contains the gB gene, under the control of the H6 promoter, with a deletion of its transmembrane region (amino acids 715-772) and an alteration at the cleavage site (RTKR * ST, modified to RTIRST, where the asterisk indicates where the cleavage is normally occurs (Spaete et al., 1988) with the S-codon modified to generate a BglII restriction site). The DNA sequence of the cleavage site altered and transmembrane deleted CMVgB gene plus additional flanking DNA sequences in the plasmid 553H6gBC ^- TM ^- are in the 20A and B (SEQ ID NO: 45).

EXAMPLE 13 - CONSTRUCTION OF RECOMBINANT POCKET VIRUSES WHICH INCLUDE HCMVgB

Methods for transfecting recombinant donor plasmids into tissue culture cells infected with a rescue poxvirus and for identifying recombinants by in situ hybridization to nitrocellulose filters have been described (Guo et al., 1989, Panicali and Paoletti, 1982: Piccini et al., 1987; Perkus et al., 1993). The plasmid 542CMVgB was transfected into NYVAC (vP866) infected Vero cells (ATCC CCL # 81) to generate the recombinant vP1001 (NYVAC-gB). The plasmid CP3LCMVgB was infected in ALVAC-infected primary chick embryo fibroblast (CEF) cells to produce the recombinant vCP139 (ALVAC-gB). Plasmids 553H6CMVgB, 553H6CMVgBTM ^- and 553H6gBC ^- TM ^- were transfected into NYVAC-transfected Vero cells to produce the recombinants vP1126, Create vP1128 or vP1145. The plasmid 22CMVgB was transfected into Vero cells which had been infected with the WR-L variant vaccinia virus (Panicali et al., 1981) to produce the recombinant vP992.

EXAMPLE 14 - IMMUNOPRECIPITATION OF HCMVgB, WHICH EXPRESSED BY POCKENVIRUS RECOMBINANT

Immunoprecipitation assays were like before (Taylor et al., 1990) using gB specific polyclonal guinea pig serum (Gönczöl et al., 1990). The apparent molecular weights of the gB specific bands the sooner published Results (Britt and Auger, 1986; Britt and Vugler, 1989; Reis et al., 1993). The intracellular Fraction from vP992, vP1001, vCP139, vP1126, vP1128 and vP1145 a major band with an apparent molecular weight of 130-140 kDa, which is identifiable as the glycosylated, uncleaved gB precursor was. weaker Gangs at about 110 kDa and 55 kDa, which processed the N-terminal and C-terminal Fragments represented, were also observed in the cell fractions. The extracellular medium cells infected with vP1128 and vP1145 contained the uncleaved precursor and N-terminal and C-terminal processed fragments.

EXAMPLE 15 - HUMORAL RESPONSE OF LABORATORY ANIMALS, THAT WERE INCLUDED WITH ALVAC-gB AND NYVAC-gB

in the Following a single immunization of CBA mice with vP1001 (NYVAC-gB), neutralizing antibody titers of the inoculated sera Mice (Gönczöl et al., 1986). Antibodies which capable of Neutralizing HCMV were (Table 21) in the sera of mice 14-21 days later (geometric mean titers of 1:16) and between 28-60 days after immunization (gmt = 1:26). A single one Immunization of CBA mice with vCP139 (ALVAC-gB) produced HCMV neutralizing anti-body titer of 1:64 gmt (14-21 Days pi) and 1: 111 gmt (between 28 and 60 days pi). Thus called the immunization of mice antibodies with NYVAC and ALVAC recombinants expressing HCMV gB, which were able to neutralize the infectivity of HCMV.

ALVAC-gB (vCP139) was evaluated for safety and immunogenicity in human volunteers. After two inoculations with 10 ^6,3 TCID _{50 of} these recombinates, no severe reactions were noted. Table 21 HCMV neutralizing antibodies in CBA mice Immunization. Days after immunization 14-21 21-28 28-60 NYVAC-gB 16 16 32 24 32 24 ALVAC-gB 32 64 128 64 64 128 128 96

• The immunization was carried out ip with 2-4 x 10 ⁸ PFU recombinant viruses.

Guinea pigs were immunized twice with ALVAC-gB (days 0 and 28) and the sera were tested for the presence of HCMV neutralizing antibody. HCMV neutralizing antibody was detected (Table 22) in the sera on day 34 (gmt = 60), day 42 (gmt = 60) and day 56 (gmt = 60). Thus immunization of guinea pigs with ALVAC-gB elicited antibodies capable of neutralizing the infectivity of HCMV. Table 22 HCMV neutralizing antibodies in guinea pigs inoculated with ALVAC gB Guinea pig No. days 0 14 28 34 42 56 19 <4 <4 <4 64 64 64 20 <4 <4 <4 32 64 64 21 <4 <4 <4 12 32 64 22 <4 <4 <4 48 48 32 23 <4 <4 4 96 46 46 24 <4 <4 <4 46 46 32

• Guinea pigs were inoculated intramuscularly on days 0 and 28 with 10 ^6,3 TCID ₅₀ .

EXAMPLE 16 - CLONING OF HCMV-gH in SMALLPOX VIRUS VECTORS

cloning of the HCMVgH gene into the NYVAC donor plasmid pSD550. The HCMVgH gene was made from genomic DNA (Towne strain) by PCR using oligonucleotide SPgH1 (SEQ ID NO: 111) (5'-TATCTGCAGATGCGGCCAGGCCTCCCCTCCTAC-3 ') and SPgH2 (SEQ. ID. No .: 112) (5'-CCGAAGCTTTCAGCATGTCTTGAGCATGC-3 ').

The resulting 2.3 kb fragment was digested with PstI (5'-end site of SpgH1) and HindIII (5'-end site of SpgH2) and cloned into PstI / HindIII digested and alkaline phosphatase-treated IBI24 to give the plasmid SPgH1 was generated. The sequence of CMVgH is in the 21 (SEQ ID NO: 46).

The 3 'end of the gH gene in SPgH1 was modified to provide an early transcription termination signal of Vaccinia virus (Yuen and Moss, 1987) and a unique XhoI restriction site to contain, in the following manner. SPgH1 was within of the 3 'end of the gH gene digested with SpHI and within IBI24 with HindIII, and the gH containing fragment was purified and attached to the kinased and annealed oligonucleotides SPgH16 (SEQ ID NO: 113) (5'-CTCAAGACATGCTGATTTTTATCTCGAGA-3 ') and SPgH17 (SEQ. ID. No. 114) (5'-AGCTTCTCGAGATAAAAATCAGCATGTCTTGAGCATG-3 '), whereby the Plasmid SPgH2 was generated.

wurden an EcoRI/BamHI-verdautes und mit alkalischer Phosphatase behandeltes IBI24 ligiert, wodurch das Plasmid SPgH3 erzeugt wurde, welches eine einmalige XhoI-Stelle, den Entomopox-42K-Promotor und Nukleotidsequenzen enthält, welche die ersten vier Aminosäuren von HCMVgH codieren (unterstrichene Basen in den Codons drei und vier in den Oligonukleotiden SPgH13 (SEQ. ID. Nr.: 116) und SPgH14 (SEQ. ID. Nr.: 117) wurden modifiziert, um eine SmaI-Stelle zu erzeugen, ohne die Aminosäuresequenz zu verändern). Die Oligonukleotide SPgH18 (SEQ. ID. Nr.: 119)

wurden in einer PCR mit dem Plasmid SPgH1 als Matrize verwendet, um ein 0,4 kb großes Fragment abzuleiten. Dieses Fragment wurde mit SmaI- und PstI verdaut und in mit SmaI/PstI verdautes und mit alkalischer Phosphatase behandeltes SPgH3 kloniert, wodurch das Plasmid SPgH5 erzeugt wurde, welches eine einmalige XhoI-Stelle, den 42K-Promotor und die 5' gelegenen 15% des HCMVgH-Gens enthält. Ein 0,4 kb großes EcoRI/BglII-Fragment aus SPgH5 wurde an ein 4,7 kb großes EcoRI/BglII-Fragment aus SPgH3 ligiert, wodurch das Plasmid SPgH6 erzeugt wurde, welches das 42K-promotorgesteuerte gH-Gen, flankiert von XhoI-Stellen, enthält.The kinased and annealed oligonucleotides SPgH12 (SEQ ID NO: 115)

EcoRI / BamHI digested and alkaline phosphatase treated IBI24 were ligated to generate plasmid SPgH3 containing a unique XhoI site, the entomopox 42K promoter and nucleotide sequences encoding the first four amino acids of HCMVgH (underlined bases in codons three and four in the oligonucleotides SPgH13 (SEQ ID NO: 116) and SPgH14 (SEQ ID NO: 117) were modified to generate a SmaI site without altering the amino acid sequence). Oligonucleotides SPgH18 (SEQ ID NO: 119)

were used in a PCR with the plasmid SPgH1 as template to derive a 0.4 kb fragment. This fragment was digested with SmaI and PstI and cloned into SmaI / PstI digested and alkaline phosphatase treated SPgH3 to generate the plasmid SPgH5, which has a unique XhoI site, the 42K promoter and the 5 '15% of the Contains HCMVgH gene. A 0.4 kb EcoRI / BglII fragment from SPgH5 was ligated to a 4.7 kb EcoRI / BglII fragment from SPgH3 generating the plasmid SPgH6, which blocks the 42K promoter-gH gene flanked by XhoI. Bodies, contains.

Plasmid pSD550 (an I4L locus donor plasmid) was derived from plasmid pSD548 (Tartaglia et al., 1992). The polylinker region in pSD548 was modified by cleavage with BglII and SmaI and ligating to the annealed synthetic oligonucleotides 539A (SEQ ID NO: 121) (5'-AGAAAAATCAGTTAGCTAAGATCTCCCGGGCTCGAGGGTACCGGATCCTGATTAGTTAATTTTTGT-3 ') and 539B (SEQ ID NO: 122 ) (5'-GATCACAAAAATTAACTAATCAGGATCCGGTACCCTCGAGCCCGGGAGATCTTAGCTAACTGATTTTTCT-3 ') resulting in the plasmid pSD550. The 2.3kb XhoI fragment from SPgH6 was cloned into XhoI digested alkaline phosphatase treated pSD550 to generate the NYVAC donor plasmid I4L42KgH in which the orientation of gH is in the same direction as the replaced I4L gene. The DNA sequence of CMVgH plus additional flanking DNA sequences in the plasmid I4L42KgH are in the 22A and B (SEQ ID NO: 47).

Cloning of the HCMVgH gene into the ALVAC donor plasmid NVQC5LSP. A C5 insertion vector containing 1535 bp upstream [sequence] of C5, a polylinker with KpnI / SmaI / XbaI and NotI sites and 404 bp canarypox DNA (31 base pairs of C5 coding sequence and 373 bp of downstream sequence) was derived in the following manner. A genomic library of canarypox DNA was constructed in the cosmid vector puK102 (Knauf and Nester, 1982) with pRW764.5 (a PuC9-based plasmid containing an 880 bp canarypox PvuII fragment containing the C5 ORF nucleotides 1372 until 2251 in 8th (SEQ ID NO: 27)) and a clone containing a 29 kb insert was identified (pHCOS1). A 3.3 kb ClaI fragment from pHCOS1 containing the C5 region was identified. The open C5 reading frame starts at position 1537 and ends at position 1857 in the 8th shown sequence (SEQ ID NO: 27).

Of the C5 insertion vector was constructed in two steps. The 1535th bp upstream sequence was through PCR amplification using the oligonucleotides C5A (SEQ. ID. No. 123) (5'-ATCATCGAATTCTGAATGTTAAATGTTACTACTTG-3 ') and C5B (SEQ ID. No .: 124) (5'-GGGGGTACCTTTGAGAGTACCACTTCAG-3 ') and purified Genomic canarypox DNA generated as a template. This fragment was digested with EcoRI (within OligoC5A) and digested in EcoRI / SmaI pUC8, generating C5LAB. The 404 bp arm became by PCR amplification using the oligonucleotides C5C (SEQ ID NO: 125) (5'-GGGTCTAGAGCGGCCGCTTATAAAGATCTAAAATGCATAATTTC-3 ') and C5DA (SEQ. ID. No .: 126) (5'-ATCATCCTGCAGGTATTCTAAACTAGGAATAGATG-3 '). This fragment was digested with PstI (within oligoC5DA) and digested into SmaI / PstI C5LAB cloned, producing pC5L.

pC5L was digested with Asp718 and NotI within the polylinker, treated with alkaline phosphatase and ligated to the kinased and annealed oligonucleotides CP26 (SEQ ID NO: 127) (5'-GTACGTGACTAATTAGCTATAAAAAGGATCCGATCCGGTACCCTCGAGTCTAGAATCGATCCCGGGTTTTTATGACTAGTTAATCAC-3 ') and CP27 (SEQ ID NO: 127) .: 128) (5'-GGCCGTGATTAACTAGTCATAAAACCCGGGATCGATTCTAGACTCGAGGGTACCGGATCCTTTTTATAGCTAATTAGTCAC-3 ') (containing a deactivated Asp718 site, translation stop codons in six reading frames, Early transcription termination signal of vaccinia (Yuen and Moss, 1987), BamHI, KpnI, XhoI , XbaI, ClaI and SmaI restriction sites, vaccinia early transcription termination signal, translation stop codons in six reading frames, and a NotI site disabled) to generate plasmid C5LSP. The polylinker region in C5LSP was further purified by digesting with BamHI and ligating to annealed oligonucleotides CP32 (SEQ ID NO: 129) 5'-GATCTTAATTAATTAGTCATCAGGCAGGGCGAGAACGAGACTATCTGCTCGTTAATTAATTAGGTCGACG-3 ') and CP33 (SEQ ID NO: 130) (5'). -GATCCGTCGACCTAATTAATTAACGAGCAGATAGTCTCGTTCTCGCCCTGCCTGATGACT AATTAATTAA-3 ') to generate the plasmid VQC5LSP. VQC5LSP was digested with EcoRI, treated with alkaline phosphatase, ligated with the kinased and annealed oligonucleotide CP29 (SEQ ID NO: 131) (5'-AATTGCGGCCGC-3 ') and digested with NotI. The linearized plasmid was ge purified and ligated with itself to generate the plasmid NVQC5LSP. The 2.3kb XhoI fragment from SPgH6 was cloned into XhoI digested alkaline phosphatase treated NVQC5LSP to generate the ALVAC donor plasmid NVQC5L42KgH, in which the orientation of gH is in the same direction as the deleted C5 gene , The DNA sequence of CMVgH plus additional flanking DNA sequences in the plasmid NVQC5L42KgH are in the 23A and B (SEQ ID NO: 27).

Cloning of the HCMVgH gene into the vaccinia donor plasmid pSDI57K1LINS. The plasmid pHK (containing the WR vaccinia HindIII K fragment cloned into pBR322) was digested with HindIII / BglII and a 1.2 kb fragment was isolated and digested in BamHI / HindIII digested pBS-SK ⁺ cloned to yield the plasmid pBS-HKARM. pBS-HKARM was digested with Asp718 in the polylinker region, blunt-ended with the Klenow fragment of E. coli DNA polymerase and digested with HindIII at the pBS / vaccinia junction. The resulting 4.1 kb vector fragment was ligated to a 2.0 kb NruI / HindIII fragment from pHM-1 (pHM-1 contains the WR vaccinia virus HindIII-M fragment cloned into pBR322) led to the plasmid pMPWRMK. pMPWRMK was cut with HpaI and with the annealed synthetic oligonucleotides MPSYN527 (SEQ. ID. No .: 132) (5'-ATAAAAATTAGCTACTCAGGTACCCTGCAGTCGCGAGGATCCGAATTCCCCGGGCTCGAGTGATTAATTAGTTTTTAT-3 ') and MPSYN528 (SEQ. ID. No .: 133) (5'-ATAAAAACTAATTAATCACTCGAGCCCGGGGAATTCGGATCCTCGCGACTGCAGGGTACCTGAGTAGCTAATTTTTAT-3 ') ligated. The resulting plasmid is pSD157K1LINS. pSD157K1LINS was digested with XhoI within its polylinker region, treated with alkaline phosphatase, and ligated to the 2.3 kb XhoI fragment from SPgH6, yielding plasmid MP804-42KgH (containing the HCMVgH gene and the vaccinia K1L gene, both in the same orientation). The DNA sequence of CMVgH plus additional flanking DNA sequences in plasmid MP804-42KgH are in the 24 (SEQ ID NO: 49).

EXAMPLE 17 - CONSTRUCTION OF RECOMBINANT POCKET VIRUSES WHICH INCLUDE HCMVgH

The Plasmid I4L42kgH was transfected into NYVAC-infected CEF cells, to generate the recombinant vP1173 (containing HCMVgH). The same plasmid was infected in vP1001 Vero cells are transfected to generate the recombinant vP1183 (which contains HCMVgB and -gH).

The Plasmid NVQC5L42KgH was transfected into ALVAC-infected CEF cells, to generate the recombinant vCP236 (which contains HCMVgH). The same plasmid was transfected into vCP139-infected CEF cells, to generate the recombinant vCP233 (which contains HCMVgB and gH). The vaccinia virus vP1170 (which Ecogpt under the transcriptional Control of the entomopox virus 42K promoter in place of the deleted Contains K1L gene) was used to transfect Vero cells transfected with the plasmid MP804-42KgH to generate the recombinant vP1205B.

EXAMPLE 18 - IMMUNOPRECIPITATION OF HCMVgH, WHICH EXPRESSED BY POCKENVIRUS RECOMBINANT

A immunoprecipitation, which with a for HCMVgH specific monoclonal antibody was performed, showed the expression of an 86 kDa gH protein (Pachl et al., 1989) by the recombinants vP1173, vP1183, vP1205B, vCP233 and vCP236.

The immunoprecipitation with the gB-specific polyclonal guinea pig serum the correct expression of gB by the recombinants vP1183 and vCP233.

The 72 kDa Immediate Early -1 (IE1) protein of HCMV is a target for cytotoxic CD8 ⁺ T cells in humans (Borysiewicz et al., 1988) and is recognized by CD4 ⁺ T cells (Alp et al., 1991). For one individual, the peptide specificities of the proliferative and MHC class I-restricted cytotoxic determinants on IE1 were determined and found to be spatially distinct segments of the exon 4 coding region (Alp et al., 1991).

The IE1 protein has been shown to express the expression of its own promoter (Cherrington and Mocarski, 1989), as well as the expression of HIV-LTR (Biegalke and Geballe, 1991, Ghazal et al., 1991) and expression up-regulated by the promoters for the cellular genes c-myc, c-fos and hsp70 (Hagemeier et al., 1992, Santomenna and Colberg-Poley, 1990, Colberg-Poley et al., 1992). Lafemina et al. (1989) reported that the IE1 protein expressed in stable cell lines preferentially associates with metaphase chromosomes and suggested that this protein be involved in the maintenance of a ver plasmid state for HCMV DNA during latency.

In the following Examples 19-30, the development of poxvirus recombinants containing the entire IE1 gene, IE1, in which amino acids 2-32 are deleted, is IE1, in which amino acids 292-319 or the exon 4 segment IE1 are deleted. These studies were performed to develop a form of the IE1 gene product which is unable to translocate to the nucleus thereby reducing its potential to act as a transactivator while its ability to be recognized by cytotoxic CD8 ⁺ T cells. maintained. Example 45 demonstrates that an ALVAC recombinant expressing an altered form of the IE1 protein (deletion of amino acids 2-32) which, unlike the full-length gene product, is found in both the nucleus and the cytoplasm of infected cells, is cytotoxic Effector cells from HCMV seropositive individuals can restimulate.

EXAMPLE 19 - CLONING OF THE WHOLE HCMV IE1 GENE IN POCKET VIRUS VECTORS

Cloning of the HCMV IE1 gene into the vaccinia donor plasmid pSD22-H. The entire HCMV IE1 gene (AD169 strain) was derived as a 1.5 kb fragment by PCR, using the plasmid pJD083 as template (Akrigg et al., 1985) together with the oligonucleotides IE3 (SEQ ID NO .: 134) (5'-ACGGATCCATAAAATTACTGGTCAGCCTTGCTTC-3 ') and IE5 (SEQ ID NO: 135) (5'-ATCCGTTAAGTTTGTATCGTAATGGAGTCCTCTGCCAAGAGA-3'). The DNA sequence of CMV-IE1 is in the 25 (SEQ ID NO: 50). The plasmid pSD486H6340 (containing an irrelevant gene in precise association with the H6 promoter) was digested (within the H6 promoter) with NruI and (at the 3 'end of the irrelevant gene) with BamHI and ligated to the BamHI digested 1, 5 kb PCR fragment (BamHI site located at the 5 'end of the oligonucleotide IE3) to generate the plasmid pSD486H6HCMVIE1.

The H6 promoter-driven IE1 gene was obtained from pSD486H6HCMVIE1 as a 1.6 kb fragment by digestion with BamHI followed by partial BglII digestion and ligated to BamHI-digested pSD22-H to obtain the plasmid pSD22-HCMVIE1 , The DNA sequence of CMV-IE1 plus additional flanking DNA sequences in plasmid pSD22-HCMVIE1 are in the 26 (SEQ ID NO: 51).

cloning of the HCMVIE1 gene into the vaccinia donor plasmid pSD554. The oligonucleotides GAME (SEQ ID NO: 136) (5'-CGCGAATTCTCGCGATATCCGTTAAGTTTGTATCGTAATGGAGT-3 ') and SPIE2 (SEQ. ID. No .: 137) (5'-GCCTCTAGAGTTAACCTCCTTCCTCAACAT-3 ') were in a PCR with the plasmid pSD486H6HCMVIE1 as template used to 181 bp big To generate a fragment. This fragment was digested with EcoRI and XbaI and EcoRI / XbaI-digested and alkaline phosphatase-treated IBI24 cloned, creating the plasmid SPIE1, which has a Part of the H6 promoter and the first 135 bp of the IE1 gene. Oligonucleotides SPIE3 (SEQ ID NO: 138) (5'-CGGTCTAGAGGTTATCAGTGTAATGAAGC-3 ') and SPIE4 (SEQ. ID. No .: 139) (5'-CCGAAGCTTCTCGAGATAAAAATTACTGGTCAGCCTTGCTTCTAGT-3 ') were in a PCR with the plasmid pSD486H6HCMVIE1 as template used to 506 bp large To generate a fragment. This fragment was labeled with XbaI and HindIII digested and in XbaI / HindIII-digested and with alkaline phosphatase cloned IBI24 to produce the plasmid SPIE2, which is the 3'-end of the IE1 gene, a vaccinia "early" transcription termination signal and contained an XhoI site. GAME was at the 3'-end of the inserted fragment of the IE1 gene with HindII and within the IBI24 polylinker with HindIII digested, treated with alkaline phosphatase and added to a 903 bp great HindIII-BglII fragment from pSD486H6HCMVIE1 and a 464 bp BglII-HindIII fragment from SPIE2, thereby producing the plasmid SPIE3, which the entire IE1 gene linked to a part of the H6 promoter.

Plasmid pSD553 was digested with NruI and ligated with a SmaI / NruI fragment containing the synthetic H6 promoter (Perkus et al., 1989) upstream of the NruI site, which is at -26 relative to the translation initiation codon. The resulting plasmid pMP553H6 was digested with NruI and BamHI and ligated to the annealed oligonucleotides MPSYN347 (SEQ ID NO: 140) (5'-CGATATCCGTTAAGTTTGTATCGTAATCTGCAGCCCGGGGGGG-3 ') and MPSYN348 (SEQ ID NO: 141) (5'). -GATCCCCCGGGCTGCAGATTACGATACAAACTTAACGGATATCG-3 '). The resulting plasmid pSD554 contains the entire H6 promoter region to [inclusive] nucleotide -1 relative to the initiation codon, followed by a polylinker region. pSD554 was digested with NruI and XhoI and ligated to a 1.5 kb NruI / XhoI fragment from SPIE3 to generate the plasmid COPAKH6IE. The DNA sequence of CMV-IE1 plus flanking DNA sequences in the plasmid COPAKH6IE are in the 27A and B (SEQ ID NO: 52).

EXAMPLE 20 - CONSTRUCTION OF RECOMBINANT POCKET VIRUS CONTAINING THE WHOLE HCMVIE1 GENE

The Plasmid pSD22-HCMVIE1 was infected with the WR-L variant Vero cells are transfected to generate the recombinant vP893. The plasmid COPAKH6IE was transfected into NYVAC-infected Vero cells, to generate the recombinant vP1161.

EXAMPLE 21 - EXPRESSION OF THE WHOLE IE1 GENE BY POCKET VIRUS RECOMBINANT

Immunoprecipitation studies, which with a for HCMVIE1 specific monoclonal antibody has been performed were expression of a 72 kDa IE1 protein (Blanton and Tevethia, 1981; Cameron and Preston, 1981) by the recombinants vP893 and vP1161. Immunofluorescence studies (performed as described in Taylor et al., 1990) the nuclear localization of the IE1 gene product.

EXAMPLE 22 - CLONING OF THE HCMVIE1 GENE (WITHOUT AMINO ACIDS 292-319) IN THE VACCINIA DONORPLASMID pSD554

The DNA sequence of CMVIE1 without the amino acids 292-319 is in 28 (SEQ ID NO: 53). This deletion was made in the following manner. Plasmid SPIE3 was digested with SpeI and a 4239 bp fragment isolated (which lacks nucleotides 868-958 encoding amino acids 292-319). This fragment was self-ligated to generate plasmid SPIE4. A 1.4 kb NruI / XhoI fragment from SPIE4 was ligated to NruI / XhoI digested pSD554 to generate the plasmid COPAKH6IEN ^- . The DNA sequence of CMVIE1 without the amino acids 292-319 plus flanking DNA sequences in the plasmid COPAKH6IEN ^- are in 29A and B (SEQ ID NO: 54).

EXAMPLE 23 - CONSTRUCTION OF A RECOMBINANT POCKENVIRUS, CONTAINING THE HCMV IE1 GENE WITHOUT THE AMINO ACIDS 292-319

The plasmid COPAKH6IEN ^- was transfected into NYVAC-infected Vero cells to produce the recombinant vP1160.

EXAMPLE 24 - EXPRESSION OF THE HCMVIE1 GENE WITHOUT THE AMINO ACIDS 292-319

Immunoprecipitation assays showed the expression of a 69 kDa protein in with vP1160 infected cells, resulting in agreement with the deletion of the amino acids 292-319 stood. Immunofluorescence studies revealed the Nuclear localization of this gene product.

EXAMPLE 25 - CLONING EXON 4 SEGMENT OF HCMVIE1 IN POCKET VIRUS VECTORS

Cloning of the exon 4 segment of HCMVIE1 into NYVAC donor plasmid SPI4LH6. The DNA sequence of the exon 4 segment of HCMVIE1 is in 30 (SEQ ID NO: 55). This segment of the gene was obtained in the following manner. Oligonucleotides SPIE5 (SEQ ID NO: 142) (5'-CGCGAATTCTCGCGATATCCGTTAAGTTTGTATCGTAATGAAACAGATTAAGGTTCGAGT-3 ') and SPIE6 (SEQ ID NO: 143) (5'-GCCTCTAGATGCCGCCATGGCCTGACT-3') were amplified in a PCR with the plasmid pSD486H6HCMVIE1 was used to generate a 0.5 kb fragment. This fragment was digested with EcoRI and XbaI and cloned into EcoRI / XbaI digested and alkaline phosphatase treated IBI24 to generate plasmid SPIE5. Plasmid SPIE3 was digested with EcoRI and NcoI, and a 3.6 kb fragment was purified and ligated to a 0.47 kb EcoRI-NcoI fragment from SPIE5 to generate plasmid SPIE6, which was the exon 4 Segment of IE1 linked to part of the H6 promoter contained.

The Early / Late H6 vaccinia virus promoter (Guo et al., 1989; Perkus et al., 1989) was amplified by PCR using PRW823 as a template (a plasmid containing the H6 promoter linked to an irrelevant gene and oligonucleotides CP30 (SEQ ID NO: 144) (5'-TCGGGATCCGGGTTAATTAATTAGTCATCAGGCAGGGCG-3 ') and CP31 (SEQ ID NO: 145) (5'-TAGCTCGAGGGTACCTACGATACAAACTTAACGGATATCG-3'). The PCR product was digested with BamHI and XhoI (sites present at the 5 'end of CP30 and CP31 respectively) and ligated to BamHI / XhoI digested C5LSP to generate the plasmid VQH6C5LSP. This plasmid was used as a template in a PCR with oligonucleotides CP31 and RUB1 (SEQ ID NO: 146) (5'-TCGGGATCCTTCTTTATTCTATACTTA-3 '). The PCR Pro was digested with BamHI and XhoI (site present at the 5 'ends of RUB1 and CP31, respectively) and ligated to BamHI / XhoI digested pSD550 to generate plasmid SPI4LH6. A 1.3 kb NruI / XhoI fragment isolated from SPIE6 was cloned into NruI / XhoI digested and alkaline phosphatase treated SPI4LH6 to generate plasmid I4LH6IE-Ex4 (in which the H6 promoter-directed IE1 exon -4 gene in the same orientation as the replaced I4L gene). The DNA sequence of the exon 4 segment of HCMVIE1 plus flanking DNA sequences in the plasmid I4LH6IE-Ex4 are in the 31 (SEQ ID NO: 56).

Cloning of the exon 4 fragment of HCMVIE1 in the ALVAC donor plasmid NVQH6C5LSP. The plasmid VQH6C5LSP was digested with EcoRI, treated with alkaline phosphatase, ligated with kinased and annealed oligonucleotide CP29 and digested with NotI. The linearized plasmid was purified and self-ligated to generate the plasmid NVQH6C5LSP. The 1.3 kb NruI / XhoI fragment from SPIE6 was cloned into NruI / XhoI digested and alkaline phosphatase-treated NVQH6C5LSP to generate the plasmid NVQH6IE-Ex4 (in which the H6 promoter-directed IE1 exon 4 Gene in the same orientation as the replaced C5 gene). The DNA sequence of the exon 4 segment of HCMVIE1 plus flanking DNA sequences in the plasmid NVQH6IE-Ex4 are in 32A and B (SEQ ID NO: 57).

EXAMPLE 26 - CONSTRUCTION OF RECOMBINANT POCKET VIRUSES CONTAINING IE1'S EXON 4 SEGMENT

The Plasmid I4LH6IE-Ex4 was transfected into NYVAC-infected CEF cells, to generate the recombinant vP1186. The plasmid NVQH6IE-Ex4 was in ALVAC-infected CEF cells transfected to produce the recombinant vCP244.

EXAMPLE 27 EXPRESSION OF THE EXON 4 SEGMENT OF HCMVIE1 BY POCKET VIRUS RECOMBINANT

Immunofluorescence experiments revealed the cytoplasmic localization of the IE exon 4 protein derived from the recombinants vP1186 and vCP244 are expressed. Immunoprecipitation experiments with one for IE exon 4-specific monoclonal antibodies showed expression a 60 kDa large Protein in cells infected with vCP244, what with the predicted Size of the exon 4 segment was consistent. An immunoprecipitation with a polyclonal rabbit serum against a bacterial Exon-4 fusion protein was used revealed the Expression of a 60 kDa large Protein in cells infected with vP1186 and VCP244.

EXAMPLE 28 - CLONING OF THE HCMVIE1 GENE (WITHOUT THE AMINO ACIDS 2-32) IN POCKET VIRUS VECTORS

Cloning of the HCMVIE1 gene (without amino acids 2-32) into the NYVAC donor plasmid SPI4LH6. The DNA sequence of HCMVIE1 without amino acids 2-32 is in the 33 (SEQ ID NO: 58). This segment was obtained in the following manner. The oligonucleotides SPIE9 (SEQ. 147) (5'-AATTCTCGCGATATCCGTTAAGTTTGTATCGTAATGACGACGTTCCTGCAGACTATGTTGAGGAAGGAGGTT-3 ') (. SEQ. ID NO .: 148) and SPIE10 (5'-AACCTCCTTCCTCAACATAGTCTGCAGGAACGTCGTCATTACGATACAAACTTAACGGATATCGCGAG-3') were kinased, annealed and large on a 4.2 kb HindIII / EcoRI digested and alkaline phosphatase treated fragment from SPIE3 to generate plasmid SPIE8. A 1.4 kb NruI / XhoI fragment from SPIE8 (containing part of the H6 promoter and IE1 without amino acids 2-32) was ligated to NruI / XhoI digested and alkaline phosphatase treated SPI4LH6 to generate the plasmid I4LH6IEd32 has been. The DNA sequence of HCMVIE1 without the amino acids 2-32 plus flanking DNA sequences in the plasmid I4LH6IEd32 is in the 34 (SEQ ID NO: 59).

Cloning of the HCMVIE1 gene (without amino acids 2-32) into the ALVAC donor plasmid NVQH6C5LSP. The 1.4 kb NruI / XhoI fragment from SPIE8 was cloned into NruI / XhoI digested and alkaline phosphatase treated NVQH6C5LSP to generate the plasmid NVQH6IEd32. The DNA sequence of HCMVIE1 without the amino acids 2-32 plus flanking DNA sequences in the plasmid NVQH6IEd32 are in the 35A and B (SEQ ID NO: 60).

EXAMPLE 29 - CONSTRUCTION OF POCKET VIRUS RECOMBINANT, CONTAINING THE IE1 GENE WITHOUT THE AMINO ACIDS 2-32

The Plasmid I4LH6IEd32 was transfected into NYVAC-infected CEF cells, to generate the recombinant vP1201. The plasmid NVQH6IEd32 was in ALVAC-infected CEF cells transfected to produce the recombinant vCP256.

EXAMPLE 30 - EXPRESSION OF IE1 WITHOUT THE AMINO ACIDS 2-32 BY POCKET VIRUS RECOMBINANT

Immunofluorescence experiments showed both nuclear and cytoplasmic localization of the IE1 protein without the amino acids 2-32 for the recombinants vP 1201 and vCP256. Immunoprecipitation with a polyclonal rabbit serum raised against a bacterial exon-4 fusion protein was used revealed the expression of a 68 kDa large Protein in cells infected with vP1201, what with the predicted Size matches.

EXAMPLE 31 - CLONING OF HCMV pp65 GENE IN POCKET VIRUS VECTORS

cloning of the HCMV pp65 gene into the NYVAC donor plasmid SPHA-H6. pSD456 is a subclone of Copenhagen vaccinia DNA containing the HA gene (A56R; Goebel et al., 1990a, b) and surrounding regions. pSD456 was named as a template in a PCR for the synthesis of left and right vaccinia arms, flanking the A56R ORF. The left arm was synthesized below Use of oligonucleotides MPSYN279 (SEQ ID NO: 149) (5'-CCCCCCGAATTCGTCGACGATTGTTCATGATGGCAAGAT-3 ') and MPSYN280 (SEQ. ID. No .: 150) (5'-CCCGGGGGATCCCTCGAGGGTACCAAGCTTAATTAATTAAATATTAGTATAAAAAGTGATTTATTTTT-3 '). The right arm was constructed using oligonucleotides MPSYN281 (SEQ ID NO: 151) (5'-AAGCTTGGTACCCTCGAGGGATCCCCCGGGTAGCTAGCTAATTTTTCTTTTACGTATTATATATGTAATAAACGTTC-3 ') and MSYN312 (SEQ. ID. No. 152) (5'-TTTTTTCTGCAGGTAAGTATTTTTAAAACTTCTAACACC-3 '). The purified PCR fragments for the left and right arms were in another PCR reaction united. The resulting product was digested with EcoRI / HindIII. The resulting 0.9 kb Fragment was cloned into EcoRI / HindIII digested pUC8 resulting in the Plasmid pSD544 resulted.

pSD544 was digested with XhoI within his polylinker, with Klenow filled and treated with alkaline phosphatase. The plasmid SP126 (equivalent to SP131) was digested with HindIII, treated with Klenow, and the H6 promoter was isolated by digestion with SmaI. The ligation of the H6 promoter fragments on pSD544 produced SPHA-H6.

The HCMV pp65 gene was PCR amplified using genomic HCMV DNA template (Towne strain) and oligonucleotides pp651 (SEQ ID NO: 153) (5'-GATTATCGCGATATCCGTTAAGTTTGTATCGTAATGGCATCCGTACTGGGTCCCATTTCGGG-3 ') and pp651R (SEQ ID No.: 154) (5'-GCATAGGTACCGGATCCATAAAAATCAACCTCGGTGCTTTTGGGCG-3 '). The DNA sequence of CMVpp65 is in 36 (SEQ ID NO: 61). The 1.6 kb product was digested with NruI and BamHI (site present at the 5 'end of oligonucleotides pp651 and pp651R, respectively) and cloned into NruI / BamHI digested SPHA-H6 producing plasmid CMV65.1. This plasmid contained the pp65 gene linked to the H6 promoter but lacked the first 30 bp of the pp65 gene.

To derive a plasmid containing the first 30 bp of the pp65 gene, the oligonucleotides RNApp65I (SEQ ID NO: 155) (5'-TAGTTCGGATCCCCGCTCAGTCGCCTACA-3 ') and pp65R4 (SEQ ID NO: 156 ) (5'-ATCAAGGGATCCATCGAAAAAGAAGAGCG-3 ') in a PCR with genomic DNA. The resulting 1 kb fragment was digested with BamHI (BamHI sites present at the 5 'ends of both oligonucleotides) and cloned into BamHI-digested IBI24 to generate plasmid pp65.7. Plasmid pp65.7 was isolated in a PCR with oligonucleotides pp651B (SEQ ID NO: 157) (5'-GATTATCGCGATATCCGTTAAGTTTGTATCGTAATGGAGTCGCGCGGTCGCCGTTGTCCCG-3 ') and pp65BstXI (SEQ ID NO: 158) (5'-ACCTGCATCTTGGTTGC- 3 ') is used to generate a 0.5 kb fragment. This fragment was digested with NruI and BstXI (sites at the 5 'ends of oligonucleotides pp651B and pp65BstXI, respectively) and ligated to a 4.8 kb NruI / BstXI fragment of CMV65.1 to generate plasmid pCMV65.2 , This plasmid contains the entire pp65 gene, which is precisely linked to the H6 promoter, oriented in the same direction as the replaced HA gene. The DNA sequence of CMVpp65 plus flanking DNA sequences in plasmid pCMV65.2 are in 37 (SEQ ID NO: 62).

Cloning of the HCMV pp65 gene into the ALVAC donor plasmid pMPC616E6VO. 38A and B (SEQ ID NO: 63) show the sequence of a 3.7 kb segment of canarypox DNA. Analysis of the sequence revealed a reading frame designated C6L starting at position 377 and ending at position 2254. A C6 insertion vector containing 370 bp upstream [sequence] of C6, a polylinker with SmaI, PstI, XhoI and EcoRI sites and 1156 bp downstream sequence was derived in the following manner. The 0.4 bp upstream sequence was amplified by PCR amplification of a cosmid clone derived from purified caninepox genomic DNA using oligonucleotides C6A1SG (SEQ ID NO: 159) (5'-ATCATCGAGCTCGCGGCCGCCTATCAAAAGTCTTAATGAGTT-3 ' ) and C6B1SG (SEQ ID NO: 160) (5'-GAATTCCTCGAGCTGCAGCCCGGGTTTTTATAGCTAATTAGTCATTTTTTCGTAAGTAAGTATTTTATTTAA-3 '). The 1.2 kb downstream arm was amplified by PCR amplification of the same template using oligonucleotides C6C1SG (SEQ ID NO: 161) (5'-CCCGGGCTGCAGCTCGAGGAATTCTTTTTATTGATTAACTAGTCAAATGAGTATATATAATTGAAAAAGTAA-3 ') and C6D1SG (SEQ ID NO: 161). : 162) (5'-GATGATGGTACCTTCATAAATACAAGTTTGATTAAACTTAAGTTG-3 '). These fragments were fused by a third PCR using gel-purified 0.4 and 1.2 kb fragments as template for primers C6A1SG (SEQ ID NO: 159) and C6D1SG (SEQ ID NO: 162) , The resulting 1.6 kb fragment was isolated from an agarose gel, digested with SacI and KpnI, and ligated to a similarly digested pBS to generate the C6 insertion plasmid pC6L.

The plasmid pMPC616E6VQ was derived by cloning a HpaI-XhoI fragment containing the H6 promoter tightly linked to an irrelevant gene into Sma-XhoI digested pC6L. pMPC6I6E6VQ was digested with NruI and BamHI and the 4kb vector fragment (NruI-BamHI) and the 0.6kb fragment of the C6 flanking arm (BamHI-BamHI) were isolated. These two fragments were combined in a ligation with a 1.7 kb NruI-BamHI fragment from pCMV65.2 (containing part of the H6 promoter linked to the p65 gene) to produce the plasmid CMV65C6.1, which contained a C6 flanking arm, the H6 promoter and the pp65 gene but lacked the 0.6 kb C6 flanking arm. CMV65C6.1 was digested with BamHI, treated with alkaline phosphatase, and ligated to the 0.6 kb C6 flanking arm to produce the plasmid CMV65C6.2, in which C6 flanking arms on either side of H6-pp65 Inserts were present. The DNA sequence of CMVpp65 plus flanking DNA sequences in plasmid CMV65C6.2 are in the 39A and B (SEQ ID NO: 64).

Cloning of the HCMVpp65 gene into the vaccine donor plasmid pSD157 K1LINS. The plasmid pCMV65.2 was digested with KpnI, treated with mung bean nuclease and digested with BamHI to generate a 1.7 kb fragment containing H6-pp65. PSD157K1LINS was digested with BamHI and Sinai and ligated to the 1.7 kb fragment to generate the plasmid CMV65.WR. The DNA sequence of CMVpp65 plus flanking DNA sequences in the plasmid CMV65.WR are in the 40 (SEQ ID NO: 65).

EXAMPLE 32 - CONSTRUCTION OF RECOMBINANT POCKET VIRUSES CONTAINING HCMVpp65

The Plasmid pCMV65.2 was generated in NYVAC-infected Vero cells the recombinant vP1184 (containing HCMVpp65), infected in vP1001 Vero cells to generate the recombinant vP1196 (containing HCMVgB and -pp65) and in vP1183-infected Vero cells to produce the Recombinant vP1210 (containing HCMVgB, -gH and -pp65) transfected.

The Plasmid CMV65C6.2 was transfected into ALVAC-infected CEF cells, to generate the recombinant vCP260 (containing HCMVpp65).

The Plasmid CMV65.WR was transfected into vP1170-infected Vero cells, to generate the recombinant vP1214 (WR-pp65).

EXAMPLE 33 - EXPRESSION OF HCMVpp65 BY SMALLPOX VIRUS RECOMBINANT

immunoprecipitation with a for HCMV-pp65 specific monoclonal antibodies showed expression a 65 kDa large Protein (Pande et al., 1991) by the recombinants vP1184, vP1214, vCP260, vP1196 and vP1210. About that In addition, immunoprecipitation showed with gB-specific polyclonal guinea pig serums the correct Expression of gB by the recombinants vP1196 and vP1210, and an immunoprecipitation with a gH-specific monoclonal antibody showed the correct expression of gH by the recombinant vP1210.

EXAMPLE 34 - CLONING OF HCMV pp150 GENE IN POCKET VIRUS VECTORS

Cloning of the pp150 gene into the NYVAC donor plasmid pSD541. The DNA sequence of CMVpp150 is in 41 (SEQ ID NO: 66). Oligonucleotides pp150.1B (SEQ ID NO: 163) (5'-TTCGGATCCGGTTCTGGAGAAAAGCC-3 ') and pp150R6 (SEQ ID NO: 164) (5'-GCTTCCAAGCTTTCCTGAAGGGATTGTAAGCC-3') were used in a PCR genomic Towne DNA was used to generate a 2 kb fragment from the 5 'end of pp150. This fragment was digested with BamHI and HindIII and cloned into BamHI / HindIII digested and alkaline phosphatase-treated IBI24 to generate plasmid pp150.5.

The Oligonucleotides pp150.9 (SEQ ID NO: 165) (5'-TTCGGATCCGGCTTTCAGTCTCGTCTCC-3 ') and pp150END2 (SEQ. ID. No .: 166) (5'-TTCGGATCCATGCAATTGCCCGCGGACAAC-3 ') were used in a PCR used with Towne DNA to generate a 1.8 kb fragment which the 3'-end of the Includes gene. This fragment was digested with BamHI and digested in BamHI and cloned with alkaline phosphatase treated PUC8 resulting in pp150.3 was obtained.

The Oligonucleotides SP150-3 (SEQ ID NO: 167) (5'-TTCGAATTCGCTAGCTTTATTGGGAAGAATATGATAATATTTTGGGATTTCAAATATGAAATATATAATTACAATATAAAATGAGTTTGCAGTTTATC-3 ') and SP150-4 (SEQ. ID. No .: 168) (5'-TTCTCTAGATGAGCTCGTTGAACAGCAC-3 ') were in a PCR using plasmid pp150.5 as template to give a 259 bp great Produce fragment. This fragment was digested with EcoRI and XbaI digested and in EcoRI / XbaI-digested and with alkaline phosphatase treated IBI24, generating the plasmid 150.5MP has been. This plasmid contains an NheI site, 65 bp of the entomopox virus 42K promoter and the Bases 1-170 off the 5'-end of the pp150 gene. The underlined base in the sequence of oligonucleotide SP150-3 (position -53 of the promoter) is missing in this clone.

Oligonucleotides SP150-1 (SEQ ID NO: 169) (5'-CCGAAGCTTGCTAGCAATAAAAACTATTCCTCCGTGTTCTTAAT-3 ') and SP150-2 (SEQ ID NO: 170) (5'-GCCTCTAGATACGTAAAGCTAAGTTATC-3') were used in one PCR with plasmid pp150.3 was used as template to generate a 907 bp fragment. This fragment was digested with XbaI and HindIII and cloned into XbaI / HindIII-digested and alkaline phosphatase-treated IBI24 to give the plasmid 150.3MP. This plasmid contains nucleotides 2273-3141 from pp150, followed by an early transcriptional termination signal from vaccinia (T ₅ ATT) (Yuen and Moss, 1987) and a NheI site. The pp150 nucleotide 2748 ( 41 ; SEQ. ID. No .: 66) in this clone is an A and not a C, as in pp150.3, this change being mute.

Plasmid pp150.3 was digested with SnaBI and HindIII and a 3451 bp fragment was isolated. The plasmid 150.3MP was digested with SnaBI and HindIII and an 873 bp fragment was isolated. Ligation of these two fragments yielded plasmid 150.3MC, which contains pp150 nucleotides 1473-3141, followed by T ₅ ATT and a NheI site.

The Plasmid 150.5MP was digested with SacI and HindIII, and a 3056 bp big Fragment was isolated. Plasmid pp150.5 was probed with SacI and HindIII digested and a 1816 bp fragment was isolated. The ligation of these two fragments gave the plasmid 150.5MC, which a NheI site, 65 bp of the 42K promoter and the pp150 nucleotides 1-1981 contains.

The plasmid 150.5MC was digested with HpaI and HindIII and a 4634 bp fragment was isolated. The plasmid 150.3MC was digested with HpaI and HindIII and a 1412 bp fragment was isolated. Ligation of these two fragments gave plasmid 150.1, which contains a NheI site, 65 bp of the 42K promoter, nucleotides 1-3141 of pp150, T ₅ ATT, and a NheI site.

The plasmid pSD541 is a vaccinia insertion plasmid in which the vaccinia sequences, including the A25L and A26L ORFs (Goebel et al., 1990a, b), are deleted. The deletion interface consists of a polylinker region containing XhoI, SmaI and BglII restriction sites, flanked on both sides by stop codons and early vaccinia transcription terminators (Yuen and Moss, 1987). pSD541 was cloned by polymerase chain reaction (PCR) using cloned vaccinia SalI E plasmid pSD414 as template. Synthetic oligonucleotides MPSYN267 (SEQ ID NO: 94) (5'-GGGCTCAAGCTTGCGGCCGCTCATTAGACAAGCGAATGAGGGAC-3 ') and MPSYN268 (SEQ ID NO: 95) (5'-AGATCTCCCGGGCTCGAGTAATTAATTAATTTTTATTACACCAGAAAAGACGGCTTGAGATC-3') were used as primers to to generate the left vaccinia arm, and the synthetic oligonucleotides MPSYN269 (SEQ ID NO: 96) (5'-TAATTACTCGAGCCCGGGAGATCTAATTTAATTTAATTTATATAACTCATTTTTTGAATATACT-3 ') and MPSYN270 (SEQ ID NO: 97) (5'-TATCTCGAATTCCCGCGGCTTTAAATG GACGGAACTCTTTTCCCC-3 ') were used to create the right vaccinia arm. PCR products consisting of the left and right vaccinia arms were pooled and subjected to PCR amplification. The PCR product was digested with EcoRI and HindIII and electrophoresed on an agarose gel. The 0.8 kb fragment was isolated and ligated into pUC8, which had been cut with EcoRI / HindIII, resulting in plasmid pSD541.

The plasmid pSD541 was digested with SmaI in its polylinker region and treated with alkaline phosphatase. Plasmid 150.1 was digested with NheI, treated with Klenow, and a 3224bp fragment (containing 42K-pp150) was isolated. Ligation of these two fragments yielded plasmid 150.7. The DNA sequence of CMVpp150 plus flanking DNA sequences in plasmid 150.7 are in the 42A and B (SEQ ID NO: 68).

Cloning of the pp150 gene into the ALVAC donor plasmid PMM117. The plasmid PMM117 is a derivative of pC6L with a modified polylinker region. PMM117 was digested with EcoRI in its polylinker, filled in with Klenow and treated with alkaline phosphatase. Plasmid 150.1 was digested with NheI, treated with Klenow, and a 3224 bp fragment (containing 42K pp150) was isolated. Ligation of these two fragments produced plasmid 150.6. The DNA sequence of CMVpp150 plus flanking DNA sequences in plasmid 150.6 are in 43A and B (SEQ ID NO: 68).

Cloning of the pp150 gene into the vaccinia donor plasmid pSD157K1LINS. The plasmid pSD1571LINS was digested with SmaI in its polylinker region and treated with alkaline phosphatase. Plasmid 150.1 was digested with NheI, treated with Klenow, and a 3224 bp fragment (containing 42K pp150) was isolated. Ligation of these two fragments produced plasmid 150.4. The DNA sequence of CMVpp150 plus flanking DNA sequences in plasmid 150.4 are in 44A and B (SEQ ID NO: 69).

EXAMPLE 35 - CONSTRUCTION OF RECOMBINANT POCKET VIRUSES, WHICH INCLUDE HCMVpp150

The Plasmid 150.4 was transfected into vP1170-infected CEF cells, to generate the recombinant vP1238 (WR-pp150).

The Plasmid 150.7 was transfected into NYVAC-infected CEF cells, to generate the recombinant vP1247 (NYVAC-pp150).

The Plasmid 150.6 was transfected into ALVAC-infected CEF cells, to generate the recombinant vCP284 (ALVAC-pp150).

EXAMPLE 36 - EXPRESSION OF HCMVpp150 BY POCKET VIRUS RECOMBINANT

One Western blood (Harlow and Lane, 1988) with a monoclonal antibody, the specific for HCMVpp150 was the expression of a 150 kDa protein in with vP1238 infected cells infected with a protein that is infected in HCMV Cells were present, Comigrierte. Expression of a 150 kDa protein was in immunoprecipitation in vP1247- and vCP284-infected cells with the for pp150 specific monoclonal antibody.

EXAMPLE 37 - DEVELOPMENT OF A NYVAC DONORPLASMIDE, THAT CONTAINS THE HCMVgH AND IE1 EXON 4 GENES

The plasmid I4LH6IE-Ex4 was linearized with BamHI, filled in with Klenow and treated with alkaline phosphatase to give a 4.9 kb fragment. Plasmid gH6-3 was digested with XhoI, filled in with Klenow, and a 2.3 kb fragment (containing 42K gH) was isolated. These two fragments were ligated to generate the plasmid I4L42KgHH6IE-Ex4. The DNA sequence of CMVgH and IE-exon4 plus additional flanking sequences in the plasmid I4L42KgHH6IE-Ex4 are described in U.S. Pat 45A and B (SEQ ID NO: 70).

EXAMPLE 38 - CONSTRUCTION OF NYVAC RECOMBINANT, CONTAINING HCMVgB. ⁺ gH. ⁺ pp65. ⁺ IE-EXON 4, HCMVgB. ⁺ gh. ⁺ pp65. ⁺ pp150 OR HCMVgB. ⁺ gh. ⁺ pp65. ⁺ IE-EXON 4 and pp150

The plasmid I4L42KgHH6IE-Ex4 was transfected into vP1196-infected Vero cells to produce the recombi nante vP1216 (containing HCMVgB, -gH, -pp65, -IE exon 4). Plasmid 150.7 was transfected into vP1216 infected CEF cells to generate the recombinant vP1251 (containing HCMVgB, gH, IE exon 4, -pp65, -pp150). Plasmid 150.7 was transfected into vP1210-infected Vero cells to generate the recombinant vP1262 (which contained HCMV gB, gH, -pp65, -pp150).

EXAMPLE 39 - EXPRESSION OF HCMV GENES IN vP1216, vP1251, vP1262

The immunoprecipitation with monoclonal antibodies, which specific for gB, gH, pp65 and IE exon 4 showed the correct expression of all four genes by the recombinant vP 1216. Immunoprecipitation with for gB, gH, pp65 and IE exon 4 specific monoclonal antibodies the correct expression of these four genes by the recombinant vP1251. Immunoprecipitation with for gB, gH and pp65 specific monoclonal antibodies showed the correct expression of these three genes by the recombinant vP1262. A western blot with one for pp 150 specific monoclonal antibody showed the correct expression these genes by the recombinants vP1251 and vP1262.

EXAMPLE 40 - DEVELOPMENT OF AN ALVAC DONORPLASMIDE, WHICH CONTAINS THE HCMV PP65 AND PP150 GENES

Plasmid CMV65C6.2 was linearized with Eco RI, filled in with Klenow and treated with alkaline phosphatase to generate a 6.3 kb fragment. Plasmid 150.1 was digested with NheI, filled in with Klenow, and a 3.2 kb fragment (42K-pp150) was isolated. Ligation of these two fragments gave plasmid 150.8. The DNA sequence of CMVpp65 and -pp150 plus additional flanking sequences in plasmid 150.8 are in 46A to C (SEQ ID NO: 71).

EXAMPLE 41 - CONSTRUCTION OF AN ALVAC RECOMBINANT, THE HCMVgB, -2H, -pp65 AND -pp150 CONTAINS

The Plasmid 150.8 was transfected into vPC233-infected CEF cells, to generate an ALVAC gB, gH, pp65, pp150 recombinant (vCP280).

EXAMPLE 42 - EXPRESSION OF HCMV GENES IN vCP280

A immunoprecipitation with for gB, gH and pp65 specific monoclonal antibodies showed the correct expression of these three genes by the recombinant vCP280.

EXAMPLE 43 - CLONING OF HCMVgL IN POCKET VIRUS VECTORS THAT ARE OF A gB AND gL CONTAINING NYVAC DONORPLASMID COME

Oligonucleotides UL115A (SEQ ID NO: 171) (5'-GCCTCTAGAATGTGCCGCCGCCCGGATTGC-3 ') and UL115B (SEQ ID NO: 172) (5'-CGCAAGCTTAGCGAGCATCCACTGCTTGAGGGC-3') were amplified in a PCR with Towne. DNA was used as template to generate a 853 bp fragment. This fragment was digested with XbaI and HindIII and cloned into XbaI / HindIII digested and alkaline phosphatase treated IBI24 to generate plasmid UL115.1. The sequence of CMVgL is in 47 (SEQ ID NO: 72).

The Oligonucleotides UL115M (SEQ ID NO: 173) (5'-TCCAAGCTTAGATCTATAAAAATTAGCGAGCATCCACTGCTTGAGGGCCATAGC-3 ') and UL115N (SEQ. ID. No .: 174) (5'-GCCTCTAGATGCTGACGCTGTTGAGCTCGGAC-3 ') were in a PCR with the plasmid UL115.1 as template used to give a 498 bp great To generate a fragment. This fragment was digested with HindIII and XbaI digested and HindIII / XbaI-digested and with alkaline phosphatase treated IBI24, generating the plasmid UL115.2.

The Oligonucleotides UL115G2 (SEQ ID NO: 175) (5'-CGCGAATTCTCGCGATATCCGTTAAGTTTGTATCGTAATGTGCCGCCGCCCGGATTGC-3 ') and UL115H2 (SEQ. ID. No: 176) (5'-GCCTCTAGATTCCAGCGCGGCGCTGTGTCCGAGC-3 ') were in a PCR with the plasmid UL115.1 as template used to give a 450 bp great To generate a fragment. This fragment was digested with EcoRI and XbaI and in EcoRI / XbaI-digested and alkaline phosphatase treated IBI24, thereby one generated the plasmid UL115.3.

Plasmid UL115.3 was digested with HindIII and SacI to become a 3226 bp fragment isolated. Plasmid UL115.2 was digested with HindIII and SacI and a 469 bp fragment was isolated. Ligation of these two fragments gave the plasmid UL115.4.

The Plasmid UL115.4 was digested with NruI and BglII, and a 865 bp great Fragment was isolated. The plasmid I4LH6 was digested with NruI and BglII digested, and a 3683 bp large Fragment was isolated. Ligation of these two fragments resulted the plasmid I4LH6gL.

Around to correct a one-base deletion in the H6 promoter in I4LH6gL, This plasmid was digested with EcoRV, with alkaline phosphatase treated, and a 3805 bp large Fragment was isolated. The plasmid I4LH6 was digested with EcoRV, and a 736 bp big one Fragment was isolated. Ligation of these two fragments resulted the plasmid I4LH6CgL.

The plasmid 542CMVgB was linearized with BamHI and treated with alkaline phosphatase. The plasmid I4LH6CgL was digested with BamHI and BglII, and a 968 bp fragment (containing the H6 promoter-driven gL gene) was isolated. Ligation of these two fragments produced plasmid 542CMVgBgL. The DNA sequence of CMVgL and CMVgB plus additional flanking DNA sequences in plasmid 542CMVgBgL are described in 48A and B (SEQ ID NO: 73).

EXAMPLE 44 - DEVELOPMENT OF A NYVAC RECOMBINANT, GB, gH, gL, pp65, pp150, IE1 exon 4 OR gB, gH, gL, pp65, pp150 CONTAINS

The Plasmid 542CMVgBgL was transfected into vP1251-infected CEF cells, a NYVAC gB, gH, gL, pp65, pp150, IE1 exon 4 recombinant [n] (NYVAC-CMV6: vP1302 and vP1302B).

The Plasmid 542CMVgBgL is transfected into vP1262-infected cells, to the NYVAC recombinant vP1312 (NYVAC-CMV5).

Example 45 - Human Cytotoxic T-Lymphocyte Responses ON HCMV PROTEINS

Lymphocytes, which make up the antigen-specific segment of the immune system, can functionally respond to antigen by producing antibodies (B lymphocytes) or by becoming cytotoxic T lymphocytes (CD8 ⁺ T lymphocytes). HCVV-expressing ALVAC recombinants known to be recognized by human cytotoxic T lymphocytes (CTLs) are capable of re-stimulating human cellular immune responses with features of classical CTLs.

Thirteen Individuals, for which previously used EBV-transformed B cell lines (LBCL) for use CTL objectives had been established with regard to the CTL responses screened for HCMV-gB, -IE1 and -pp65. Although only One of these volunteer blood donors has a clinical history had HCMV infection, seven became HCMV seropositive to the effect that their sera contained antibodies which HCMV neutralized.

Stimulation of HCMV-IE1 CTLs by ALVAC-IE1 (vCP256): whole blood was drawn into heparinized vacutainer tubes by venipuncture from each volunteer donor. The mononuclear cell fraction was separated from the rest of the blood components by centrifugation on Leucoprep gradient, several times by centrifugation in Stim medium (MEM, containing 5% fetal bovine serum [FBS], 2 mM L-glutamine, 10 ^-4 M 2-mercaptoethanol, 100 IU / ml penicillin and 100 μg / ml streptomycin), counted for viable cells with trypan blue and resuspended at 5 x 10 ⁶ cells / ml in Stim medium (responder cells). A portion of the mononuclear cells were resuspended at 10 ⁷ cells / ml in MEM containing 2% FBS and infected with recombinant ALVAC expressing HCMV-IE1 (vCP256) at a multiplicity of infection of 25 for approximately 1 hour at 37 ° C , Following incubation, sufficient Stim medium was added to dilute the infected cells to 5 x 10 ⁵ cells / ml (stimulator cells). Equal volumes of responder cells and stimulator cells were added to upright 25 cm ² tissue culture flasks or to the wells of 24-well tissue culture plates and incubated in 5% CO ₂ /95% air at 37 ° C for 6 days. Target cells were prepared by infecting LBCLs with recombinant WR vaccinia virus expressing HCMV IE1 (vP893), similar to infection of stimulator cells, except that the target cells overnight at 4 x 10 ⁵ cells / ml in RPMI 1640 medium with 20% FBS. Following incubation, the mononuclear cells and the target cells were purified by centrifugation in assay medium (RPMI 1640 medium containing 10% FBS, 2 mM L-glutamine, ^{5x10 -5} M 2-mercaptoethanol, 100 IU / ml penicillin, and 100 μg / ml streptomycin). The target cells were incubated in Na ₂ CrO ₄ ^5I for 1 hour, washed in assay medium at 10 cells / ml in assay medium Resus panned and kept on ice until use. Following centrifugation, the mononuclear cells were diluted in assay medium to 2 x 10 ⁶ cells / ml. One tenth ml of mononuclear cells and 0.1 ml of ^5I Cr-labeled, infected target cells were added to the wells of 96-well round bottom tissue culture plates. These volumes and cell densities resulted in an effector-to-target ratio (E: T) of 20: 1. The tissue culture plates were centrifuged at 250 g for 2 minutes and incubated at 37 ° C in 5% CO ₂ /95% air for 4 to 5 hours. Following incubation, 0.1 ml of supernatant fluid was withdrawn from each well using Skatron filter wick and counted for released radioactivity. Percent cytotoxicity was calculated as:

Maximum release was determined by the addition of 5% sodium dodecyl sulfate to the target cells, while spontaneous release was determined by incubating target cells in the absence of effector cells. In none of the experiments presented did the spontaneous release of ^5I Cr from target cells exceed 20% of the maximum ^5I Cr release.

Following in vitro stimulation with ALVAC recombinants expressing a single HCMV protein, mononuclear cells from four of the seven seropositive volunteer donors lysed the autologous targets expressing HCMV IE1 ( 49 ) and mononuclear cells from six of the seven seropositive donors lysed autologous targets expressing HCMV pp65 ( 50 ). Restimulated mononuclear cells from any of the HCMV seropositive donors lysed autologous targets expressing HCMV gB.

The mononuclear cells from HCMV seronegative volunteer donors failed to lyse autologous target cells expressing HCMV IE1 or HCMV pp65 with similar restimulation as the mononuclear cells of HCMV seropositive donors. 49 respectively. 50 ).

In in all cases, except one, the cytotoxic effector cells lysed only autologous, but not non-autologous, target cells containing the appropriate HCMV protein expressed. The only exception, mononuclear cells from the Donors 7C, were following restimulation with ALVAC-pp65 (vCP260) able to lyse non-autologous target cells containing HCMVpp65 expressed. However, it became later demonstrates that the donor 7C and the donor for the non-autologous Target cell line common to HLA-B7 of the human major histocompatibility complex (MHC) had.

Stimulation of HCMV-IE1 CTLs by ALVAC-IE1 (VCP256):

Human CTLs were stimulated in vitro and assayed for HCMV-IEI CTLs, using a similar methodology as in 49 with the exception that following 6 days of incubation for restimulation, the responder mononuclear cells were incubated with immunomagnetic beads coupled to monoclonal anti-human CD3, CD4 or CD8. Following the incubation, the beads were, and therefore the CD3 ⁺ - CD4 ^- - CD8 ⁺ cells, or removed by means of a magnet. The cells which adhered to the magnetic beads were decoupled, washed and used in the cytotoxicity assay.

Representative of the phenotype of the cytotoxic responses of this HCMV seropositive test group, the ALVAC-IE1 (vCP256) restimulated mononuclear cells from donor 2A failed therein following depletion of lymphocytes expressing CD3 and CD8, but not CD4, IE1 to lyse expressing targets ( 51 ). In addition, restimulated mononuclear cells that had been enriched for CD8, but not CD4, retained cytotoxic activity.

Consequently were the cytotoxic effector cells derived from HCMV seropositive Volunteer donors by in vitro re-stimulation with ALVAC recombinants, the HCMV IE1 (vCP256) or HCMV-pp65 (vCP260), antigen specific, MHC-restricted and expressed CD3 and CD8. These features are consistent with those of classical cytotoxic T lymphocytes (CTLs).

These results demonstrate that ALVAC recombinants expressing HCMV proteins can serve as vaccines for the production of human cytotoxic T lymphocytes capable of mediating the destruction of HCMV-infected human cells. In addition, these data also show that these recombinant viruses are used as reagents for ex vivo stimulation and vaccination tion of cytotoxic T-lymphocyte clones for the purpose of immunotherapeutic applications (Riddell et al., 1992).

As earlier discussed, HCMV-gB can serve as a protective immunity in humans because 1) the HCMV neutralizing antibody titer is significantly reduced when gB-specific antibody human sera is absorbed (Gönczöl et al., 1991; Marshall et al., 1992) and 2) evidence for the activation of helper T cells by the gB protein in seropositive individuals (Liu et al., 1991). Gönczöl et al. (1990) reported that immunoaffinity purified gB in human Volunteer was immunogenic. In this study was a single injection of the purified gB able to neutralize high titers of HCMV antibodies and lymphocyte proliferation in naturally seropositive individuals induce. In seronegative individuals induced three injections the gB preparation transient HCMV neutralizing Antibody, a fourth injection induced a rapid recurrence and an increase in terms of the titer of HCMV neutralizing Antibodies.

These Studies show the use of purified gB as a subunit vaccine. additionally Purified gB can also be used in combination with Prime / Boost protocols with NYVAC or ALVAC gB recombinants. recent Research has shown that a prime / boost protocol, at which is based on immunization with a poxvirus recombinant, which expresses a foreign gene product, a boost with a purified Form of this gene product follows, an increased immune response in the relationship to the answer that comes with each product alone becomes. For example, humans infected with a vaccinia recombinant, which is the HIV-1 envelope glycoprotein expressed, immunized and purified with HIV-1 envelope glycoprotein from a baculovirus recombinant, higher levels of HIV-1 neutralizing antibody titers as individuals, those with the vaccinia recombinant or purified Envelope glycoprotein alone (Graham et al., 1993; Cooney et al., 1993). People immunized with two injections of ALVAC-HIV (vCP125) beat failed to develop HIV-specific antibodies. A booster with purified rgp160 from a vaccinia virus recombinant detectable HIV-1 neutralizing antibodies. In addition, the specific lymphocyte T cell proliferation was across from rgp160 increased significantly by boosting with rgp160. Envelope specific cytotoxic lymphocyte activity was also demonstrated with this vaccination schedule (Pialoux et al., 1995). Macaques immunized with a vaccinia recombinant were the envelope glycoprotein of monkey immunodeficiency virus (SIV), and those with SIV envelope glycoprotein from a baculovirus recombinant are protected from an SIV challenge (Hu et al., 1991; 1992).

EXAMPLE 46 - PURIFICATION OF HCMV GLYCOPROTEIN B

This Example illustrates the purification of CMV glycoprotein B prepared by a vaccinia recombinant, and testing its immunogenicity in experimental animals in combination with ALVAC-CMV gB (vCP139).

The COPAK recombinants vP1126, vP1128 and vP1145, each one express different forms of gB, call CMV neutralizing antibody in mice (Table 23) and therefore express gB in an immunogenic Shape. To a virus and cell system, and an immunological reagent for CMV-gB cleaning, select gB expression was by the three COPAK recombinants using an immunoprecipitation assay using 5 different gB-specific monoclonal antibodies were. Based on the assay results, a scheme for Purify gB from the medium developed by vP1145-infected VERO cells.

Immunoaffinity column bed material was prepared by cross-linking CMV-gB specific monoclonal antibodies (mAb) CH380 on protein A agarose. This material was used to clean gB in a one-step procedure. Approaches of gB were prepared and evaluated for purity, such as it is described in section 111.

Immunoprecipitation assay. Vero and HeLa cell monolayers in 60 mm dishes were infected with vP1126, vP1128, vP1145 or vP993 (described below) at a moi of 5 pfu / cell in serum-free medium. The medium and cells were harvested separately 24 hours after infection. Immunoprecipitation (IP) assays were performed (Taylor et al., 1990) using the reagents described below, with rat anti-mouse IgG as a bridge to protein A for the monoclonal [antibodies]. Virus: vP1126: COPAK-CMV gB (complete). Full-length wild-type gB VP1128: COPAK-CMV gB (TM ^- ). Transmembrane region is missing vP1145: COPAK-CMV gB (TM ^- , Cl ^- ). Transmembrane region is missing, and presence of an altered cleavage site. vP993: COPAK control reagents: Guinea pig anti-CMV gB: Received by Eva Gönczöl (Wistar Institute) Monoclonal CH380: Obtained by PMs & v (Pereria and Hoffman, 1986) Monoclonal 13-127 Advanced Biotechnologies, Inc. Monoclonal 13-128 Advanced Biotechnologies, Inc., neutralizing, conformational Monoclonal HCMV-34 Cogent Diagnostics, neutralizing Monoclonal HCMV-37 Cogent Diagnostics, neutralizing Rabbit Anti-p25 (Vaccinia E3L) (obtained from Bert Jacobs, U. Arizona)

manufacturing of immunoaffinity chromatography bed material. One ml of immunoaffinity column bedding consisting out of about 2.4 mg mAb CH380 coupled to protein A agarose with the crosslinker Dimethylpimelimidate was provided by Stephan Cockle, Connaught Laboratories, Limited (Willowdale, Ontario, Canada). The mAb CH380 (Pereria and Hoffman, 1986) was previously used to make CMV-gB from a CMV virus envelopes preparation to clean (Gönczöl et al., 1990). The material of S. Cockle was in preliminary experiments used to its usefulness continue to be determined during gB cleaning. To the scale of gB production was to increase additional Bedding material by the same method as applied by S. Cockle was prepared as described below.

Preparation of monoclonal ch380. Four vials of lyophilized monoclonal CH380 (lot S1705, obtained from PMsv) were transformed into PBS (137 mM NaCl, 2.7 mM KCl, 1.5 mM KH ₂ PO ₄ , 8.1 mM Na ₂ HPO ₄ , pH 7.4 ) (1 ml each) and dialyzed overnight against PBS (final volume 3.5 ml). The protein concentration was determined to be 4.9 mg / ml by the bicinchoninic acid assay (BCA assay, reagents obtained from Pierce, Rockford, IL). This preparation was then resuspended in an equal volume of MAPS binding buffer (Bio-Rad Cat. # 153-6161; 31.4% w / v in Milli-Q water adjusted to pH 9 and filtered through a 22 mm. Membrane). To remove particulate matter, the antibody preparation was centrifuged in MAPS buffer at 16,000 x g for 30 minutes, and the protein concentration of the supernatant was calculated from the absorbance at 280 nm, using 1.44 as the extinction coefficient for IgG.

manufacturing of protein A agarose beads. Three ml of protein A agarose beads (Bio-Rad, cat. # 153-6153) were run four times with 2 volumes of MAPS-binding buffer by careful mixing in a closed tube and 5-minute Centrifugation at 1000 × g (1400 rpm in Beckman GPKR centrifuge, GH 3.7 rotor). The supernatant was discarded after the last washing step.

binding of monoclonal antibody to the beads. The whole of the mAb antibody from step 1 became the washed beads given from step 2, and the mixture was in a closed tube at 4 ° C rotates. The amount of to the beads bound mAb was pelleted at 6-12 hour intervals the beads (1000 g / 5 min) and determine the concentration of IgG in the supernatant by reading the OD at 280 nm as described above. Approximately 48 hours incubation at 4 ° C were required to show a 90% depletion of IgG from the supernatant to achieve.

Covalent cross-linking of monoclonal antibody to the beads. After the binding was 90% complete, the beads were washed four times with 6 ml (2 volumes) of 50 mM borate, 3 M NaCl, pH 9. The beads were then resuspended in 30 ml (10 volumes) of 200 mM borate, 3 M NaCl, pH 9, and the pH was adjusted to 9 ± 0.1. A sample of beads (100 μl) was taken for later evaluation of crosslinking. The cross-linking reagent dimethylpimelimidate (DMP) was prepared immediately before use at a concentration of 500 mM in 200 mM borate, 3 M NaCl, pH 9. DMP was added to the beads to make a final concentration of 20 mM, and the beads were mixed in a closed tube, end-over-end, for 30 minutes at room temperature. Another Sample of beads (100 μl) was taken for evaluation of crosslinking. To quench remaining cross-linking reagent, the beads were washed twice with 6 ml (2 volumes) of 200 mM ethanolamine, pH 8, and then in 30 ml (10 volumes) of 200 mM ethanolamine, pH 8, by end-over-end mixing for 2 hours Room temperature incubated. Finally, the beads were washed four times with 6 ml (2 volumes) PBS and stored in 6 ml PBS with 0.01% NaN ₃ .

Around the extent of Crosslinking was determined before and after DMP incubation taken from gel bead samples pelleted, the supernatants were discarded, and the beads were mixed with 2x SDS-PAGE sample buffer, which reducing agent contained mixed. These samples were boiled up and electrophoresed on a 10% polyacrylamide gel separated. After dyeing with Coomassie blue, the IgG heavy and light chains in proved the "before" samples be, but not in the "after" samples, what a indicates good efficiency of networking.

Based on the protein concentration before and after incubation of the antibody with the beads became estimated, the resulting bed material contains about 5 mg of monoclonal antibody per ml of protein A agarose beads contains.

Purification of CMV gB by immunoaffinity column chromatography.

Column buffer. PBS (137 mM NaCl, 2.7 mM KCl, 1.5 mM KH ₂ PO ₄ , 8.1 mM Na ₂ HPO ₄ ), pH 7 (mixture 1), pH 7.4 (mixtures 2-5) or pH 6.8 (batches 2-5); 0.1 M glycine, pH 2.5; 1 M Tris, pH 8.5.

Columns. The column sizes varied from 0.3 to 4 ml volumes. When a new column was cast, it was stripped with 10 bed volumes (bv) 0.1 M glycine, pH 2.5 followed by 10-20 bv PBS, pH 7 or 7.4. At the end of each column run, the column was washed with at least 10 bv of PBS, pH 7. At the beginning of each run, it was washed again with at least 10 bv PBS, pH7. The columns were run at room temperature and, when not in use, stored at 4 ° C in PBS + 0.01% NaN ₃ .

Make the impure gB sample. Roller bottles (850 cm ² ) were inoculated with Vero cells in MEM + 10% FBS. The medium was changed to serum-free MEM 2-12 hours prior to infection. The cells were infected with vP1145 at a MOI of 5 pfu / cell in a volume of 10 ml / RB serum-free MEM. Virus was absorbed at 37 ° C for 60 minutes, and then 30 ml of serum-free MEM was added to each roller bottle, and incubation was continued at 37 ° C. Medium was harvested 16-24 hours after infection. The medium was clarified by centrifugation at 3000 rpm (Beckman GPKR centrifuge, rotor GH 3.7) for 15 minutes. The supernatant was collected and further clarified by centrifugation at 20,000 rpm in a Beckman SW28 rotor for 60 minutes. The clarified medium was then concentrated (10 to 40 fold) by ultrafiltration with buffer change to PBS, pH 7.4, using one or more of the following ultrafiltration devices with molecular weight cutoff or MWCO of 30,000: Centricell-60 (Polysciences # 19182-6), Centriprep-30 (Amicon # 4306) or submergible polysulfone filter units (Polysciences # 2250). This material was applied to the column as described below.

Column Procedure. The impure gB sample was applied to the column at a flow rate of 0.03-0.09 ml / min applied, which by a stopcock or a peristaltic Pump was controlled. After application of the sample, the column was at a flow rate from 0.2-0.6 ml / minute with 10 bv PBS, pH 7 (mixture 1) or 20 bv PBS, pH 7.4, followed by 20 bv PBS, pH 6.8, (batches 2-5). Tied material was eluted with 10 bv 0.1 M glycine, pH 2.5, using 500 μl (batch 1, 3) or 1 ml (batch 2, 4, 5) collected large fractions in tubes which were 50 μl (Batch 1, 3) or 100 μl (Batch 2, 4, 5) 1.0 M Tris, pH 8.5. A pillar (# 28) was eluted with 0.1 N glycine + 0.1 M Tris, pH7. CMV gB fractions were reduced by SDS-PAGE on a 10% gel Conditions followed by silver staining (Bio-Rad Kit # 161-0443).

treatment of eluted gb. After identification by SDS-PAGE and silver staining were The CMV-gB fractions pooled and concentrated in one of two ways: 1) Dialysis against 0.1 × PBS and 10-fold vacuum concentration (majority of batch 1), or 2) precipitation with 70% ammonium sulfate and resuspension in PBS. The protein concentration gB samples were analyzed by bicinchoninic acid microplate assay (BCA reagents from Pierce, Rockford, IL). Five approaches of gB were made and frozen in aliquots at -70 ° C.

Evaluation of purified gB. Slot blot. Slot blot analysis was used to measure the relative amounts of CMV-gB in crude preparations, flow-through fractions and elution fractions from affinity column purification. Serial 2-fold dilutions in PBS were made from each test sample and these were applied to nitrocellulose paper using the Schleicher and Scheull Manifold II slot blotting apparatus. Each assay included serially diluted samples of purified gB with a known protein concentration (determined by BCA microplate assay) as a standard. CMV-gB was detected diluted with monoclonal CH380, diluted 1: 100, followed by ¹²⁵ I-goat anti-mouse (NEN # NEX159, at 0.1 Ci / ml). Autoradiography slot blot signals were scanned and analyzed by densitometry (PDI, Inc., Huntington Station, NY, "Quantity One" densitometer program). The amount of CMV-gB in each test sample was determined by linear regression analysis as compared to a gB calibration curve.

Western blot. Test samples were electrophoretically separated on a 10% gel under reducing conditions and blotted onto nitrocellulose paper (Harlow and Lane, 1988). The blot was probed for the presence of CMVgB, mouse IgG, vaccinia and Vero cell proteins with the following reagents: ANTIGEN PRIMARY ANTIBODY PROOF CMV gB Monoclonal CH380, diluted 1: 100 ¹²⁵ I-goat anti-mouse (NEN # NEX 159), 0.1 μ Ci / ml Mouse IgG ¹²⁵ I-goat anti-mouse (NEN # NEX 159), at 0.1 μ Ci / ml (see primary antibody) Vaccinia proteins Rabbit anti-vP410, rabbit # W29, week 39, 9/13/91, pre-absorbed against Vero cells and diluted 1: 100 ¹²⁵ 1-protein A (NEN # NEX-146), 0.1 μ Ci / ml Vero cell proteins Rabbit anti-vero cells obtained from B. Meignier, PMsv, pre-absorbed against ALVAC-infected CEF and diluted 1: 100 ¹²⁵ I protein A (NEN # NEX-146), 0.1 μCi / ml

Immunoprecipitation-Western blot assay. A combination IP / Western blot was performed on batch 1 gB using the selection of monoclonal antibodies. Unlabeled impure and purified gB was subjected to immunoprecipitation followed by SDS-PAGE, the gel was blotted onto nitrocellulose, and gB-specific proteins were diluted with guinea pig anti-CMV gB (ex Eva Gönczöl), diluted 1: 1000, and ¹²⁵ I-protein A (NEN # NEX-146), 0.1 μ Ci / ml.

analysis the purity of the gB product. Samples from each batch of gB were by electrophoretic separation on a 10% gel under reducing Conditions followed by staining with Coomassie blue, analyzed. The dried gel was scanned and analyzed by densitometry (PDI, Inc., Huntington Station, N.Y., "Quantity One "densitometer program).

Immunoprecipitation assay for comparing the expression of CMV gB by three vaccinia COPAK recombinants. To select a suitable recombinant, cell substrate and antibody for the production and immunoaffinity purification of CMV-gB, COPAK recombinants expressing 3 different forms of gB were screened by immunoprecipitation assay using guinea pig anti-gB and selection compared to monoclonal antibodies. The recombinants vP1126, vP1128 and vP1145 elicit CMV-neutralizing antibodies in mice and therefore express gB in an immunogenic form (Table 23). All of the CMV gB antibodies tested elicited similar IP results. A representative assay, with guinea pig serum using both medium and cell fractions from HeLa and Vero cell infections, is described in U.S. Pat 52A to D shown. As expected, CMV-gB specific material was precipitated from both the cell and medium fractions of cells infected with vP1128 and vP1145, but only in the cell fraction in vP1126-infected cells. The apparent molecular weights of the gB specific bands are consistent with previously published results (Britt and Auger, 1986, Britt and Vugler, 1989, Reis et al., 1993). The cell fractions of all three CMV gB recombinants contained a major band with an apparent molecular weight of 130-140 kDa, consistent with the apparent molecular weight of the glycosylated, uncleaved gB precursor. Less intense protein species with apparent MW of 110 kDa and 55 kDa were observed in the cell fractions and are consistent with the proteolytically processed mature protein species. It has previously been reported that the N-terminal product is 90-110 kDa and the C-terminal product is 55-58 kDa in size (Britt and Auger, 1986). HeLa cells also contained a protein species with a seemingly higher molecular mass (approximately 150 kDa) (eg 52D , Lane 4). This species probably also represents an uncleaved precursor form which is more glycosylated. In the medium fractions, three gB bands were precipitated from vP1128 and vP1145 infected cells, representing the uncleaved precursor and N-terminal and C-terminal processed polypeptides. In sitometric analysis, more gB-specific material was precipitated from the medium fractions of Vero cells compared to HeLa, with the recombinant vP1145 producing more gb-specific material than vP1128. This difference can be explained by the observation that more vaccinia E3L was precipitated from the cell fraction of vP1145 than the vP1128 cell fraction, indicating a higher overall level of vaccinia expression in this sample ( 53A and B). In vP1145, more gB-specific material was precipitated from the medium fraction than from the cell fraction in both HeLa and Vero cells (cf. 52A , B versus C, D).

The three different sizes of gB precipitated from the medium of infected HeLa cells appear to have higher molecular weights than the three species produced in Vero cells (cf. 52A across from 52B ). These differences may be due to different levels of glycosylation in HeLa cells compared to Vero, but this hypothesis has not been further investigated. In order to determine whether the higher molecular weight gB-specific proteins are also produced by another human cell line, MRC-5, a Western blot assay was performed which amplified the gB proteins in the medium of vP1145-infected HeLa, Compared MRC-5 and Vero cells using monoclonal CH380 ( 54 ). The result shows that the two gB bands detectable in this assay, gB precursor (approximately 140 kDa) and C-terminal processing fragment (55-58 kDa), appear to have higher molecular weights in HeLa and MRC-5 than in VERO cells. The N-terminal processing fragment is not detectable by Western blot using either monoclonal CH380 or guinea pig anti-CMV gB serum.

The MAb-CH380 was chosen for use in immunoaffinity purification of gB since a large amount was readily available and no apparent differences were observed in the gB-specific proteins detected by the five different monoclonal [antibodies] in the IP assay ( 55 ). Based on IP analysis and the considerations that purification of secreted gB from the medium of infected cells eliminates the need to solubilize gB from cell membranes and purify it from cellular proteins, purification of CMV gB was done using the medium fraction vP1145-infected Vero cells started. The infection was carried out in serum-free medium, further reducing contaminating proteins in the raw material.

Purification of CMV-gB. Fifteen separate immunoaffinity chromatography column runs giving a total of 3.1 mg of gB are summarized in Table 24. Some of the material was used for further assays and the remainder was pooled into 5 separate batches of purified product, totaling 2.6 mg (Table 25). Column runs 7, 8, 10 and 11 were sequential runs in the same column. The bed material from columns 19A, 19B, 19C, 21A, 21B and 21C was pooled to make the column used for runs 28, 29 and 32, from which the largest amount of gB was obtained. Table 24 lists the impure gB material applied to each column, expressed as the number of vP1145 infected Vero roller bottles (1 x 10 ⁸ cells per RB) from which the crude was derived and the amount of total protein and gB specific protein in the raw material. Based on the analysis of 8 samples, the total protein content of the crude preparations ranged from 1.2 to 3.7 mg / RB with an average of 2.4 mg / RB (24 μg per 10 ⁶ cells). Using a purified gB standard slot blot assay, the amount of gB present in the raw material was measured for 7 of the preparations: the values ranged from 50 to 350 μg / RB with a mean of 153 μg / RB (1 , 5 μg / 10 ⁶ cells). Taken together, these calculations indicate that the protein in the crude preparations consisted of about 6% gb. CMV gB yields ranged from 8 to 29 μg / RB with a mean of 20 μg / RB (0.2 μg / 10 ⁶ cells) (Table 24). About fifty roller bottles (1 x 10 ⁹ cells) were required to make 1 mg of CMV gB.

The capacity of the immunoabsorbent gel for gB has not been fully evaluated. The 4 ml bed stock used for column runs 28, 29 and 32 were initially divided into 0.6 ml mini-columns (column runs 19A, 19B, 19C, 21A, 21B and 21C) and varying amounts of crude gB were applied to each Column applied to determine where the saturation of the bond would take place. Unfortunately, the amount of gB in the raw material applied to the columns was overestimated and saturation was not demonstrated. The highest binding score (from column 19C) was used as an estimate of column capacity (300 μg / ml bed material). The amount of gB eluted from the mini-columns represented 8 to 25% of the gB protein applied to the columns (Table 24). Therefore, when the capacity of the 4 ml column is at least 1.2 mg, and 25% of the applied gB is recovered It is estimated that 4.9 mg crude gB (from about 33 RB) must be applied to the column to obtain 1.2 mg purified gB. The result from column 28 is close to this estimate: material from 36 roller bottles was applied to column # 28 and 1 mg of gB was eluted.

The gB applied to the columns but not eluted as purified material has not been taken into account quantitatively. Since only 8-25% of the gB applied to the column was recovered as purified gB, the remainder of the gB must be present in flow-through fractions, wash fractions, eluted fractions not associated with the product, or bound to the column. CMV gB could be detected by Western blot in the flow through fractions (eg. 56 , Lane 6). However, when the amount of gB in the flow through fractions was estimated by slot blot analysis, it did not account for more than 20% of the plotted gB. The washing fractions have not been evaluated. The pooled fractions chosen for the final gB product were only peak fractions, and therefore trace amounts of gB in adjacent fractions could account for some of the missing gB.

57 shows, for example, successive fractions eluted from column 8. Fractions 8.17-8.21 were pooled for the gB product, but trace amounts remained in fractions 8.16 and 8.22. There is also evidence for the retention of gB in the immunoabsorbent gel. Gel material taken from columns 11 and 19C after elution and washes contains gB-specific material which is detectable by Western blot ( 56 , Lanes 2 and 3). The amount of gB remaining on the column has not been quantitatively evaluated.

again Application of flow material to the column was attempted as a flow material from the column run # 7 on the pillar # 10 (Table 24). The amount of gB coming out of the Column 10 (4.5 μg) eluted was only 4% of that obtained from column 7 was (110 μg). It was not possible, to evaluate this result, since the capacity of the bed material for gB and the amounts of gB applied to the column and into the Flow fractions were present, were not known. On reason the low yield was not reapplied.

evaluation of purified gB. After uniting gB-containing, eluted Fractions consisted of evaluation of purified gB 1) Determine total protein concentration, 2) SDS-PAGE analysis to identify gB-specific and non-specific bands, and 3) confirm this Bands with immunological reagents. In addition, the cleaned up gB regarding the degree of purity by densitometer scanning, and regarding the native conformation of the assets analyzed a selection of monoclonal CMV antibodies.

Fractions eluted from each column containing CMV-gB were initially analyzed by SDS-PAGE and silver staining, and gB fractions for each run were identified and pooled. A typical elution profile is used in the 57 shown. One part of eluted gB was used for the analysis and the remainder of the material was pooled in 5 separate runs (Table 25). Each batch was analyzed by SDS-PAGE on a 10% gel under reducing conditions and stained with Coomassie blue ( 58 ). The stained gel was scanned on a densitometer and the molecular weight and relative amount of each band was calculated: a typical scan is performed in 59 . 59A and the analysis of the 5 approaches is summarized in Table 26. In SDS-PAGE analysis, approaches 1-5 appear very similar ( 58 ). The two major bands, which have apparent molecular weights of 120-130 and 51-59 kDa, represent the precursor gB protein and the C-terminal processing fragment. The broad diffuse appearance of these bands is probably due to a variable glycosylation of this normally highly glycosylated protein. The identity of these bands as gB specific is supported by results from Western blot analysis with monoclonal CH380 ( 60B ). The bands with an apparent molecular weight of 77-100 kDa, which appear as doublets in batches 2-5 ( 58 ) are the correct size for the N-terminal gB processing fragment identified in the medium of vP1145-infected cells by IP analysis ( 52A and B). These bands could not be detected by Western blot analysis ( 60B ) still a combination immunoprecipitation / Western blot assay ( 61A and B) are confirmed to be gB specific, but the possibility should not be ruled out since neither the guinea pig anti-gB serum nor the monoclonal [antibody] CH380 are capable of detecting N-terminal processing fragments in the Western blot. A contaminating protein of approximately 39-45 kDa is present in each batch at a level of 6-15% of the total protein ( 58 and Table 26). Two other potential gB protein bands, one larger than 200 kDa and the other 30-35 kDa in size, are present in each approach ( 58 . 59 and 59A ; Table 26). Evidence that the large (~ 200 kDa) protein is gB is derived from Western blot analysis with monoclonal CH380, which detects two proteins with molecular weights greater than 200 kDa ( 60B , Tracks 2 & 3). It is possible that the protein of about 30-35 kDa is also gB specific ( 58 ). In the IP analysis of medium from vP1145-infected cells, a protein of approximately 35 kDa was isolated by 3 monoclonal [antibodies] (13-128, HCMV 34 and HCMV 37) ( 55 ) and guinea pig serum ( 52A and B). A protein of this size has been reported by Reis et al. (1993) as a degradation product of gB.

Assuming that contaminating proteins in the gB preparation were from the cell substrate, virus vector or immunoabsorbent bed material, the preparation was probed for the presence of mouse IgG, Vero cell proteins and vaccinia proteins. Proteins derived from Vero cells or mouse IgG could not be detected by Western blot analysis ( 60A and 62A ). However, contaminating vaccinia-specific proteins with molecular weights of approximately 35 and 20 kDa have been detected in trace amounts ( 62B , Lane 5).

To determine whether the eluted gB retains its native conformation, a combination immunoprecipitation / Western blot assay was performed with a panel of monoclonal antibodies that included 3 neutralizing and one conformationally-dependent antibody. Each monoclonal antibody precipitated the precursor and the C-terminal fragment from purified gB ( 61 ), suggesting that the gB eluted from the immunoaffinity column retained its native conformation.

In summary, analysis of eluted gB in runs 1-5 shows that the product contains at least two known gB-specific proteins, the precursor gB and the C-terminal fragment, which together account for about 50% of the protein content ( 58 and Table 26). Three other protein species responsible for 20-25% of total protein content (Table 26) could also be GB-specific, although direct evidence has not been provided.

Immunogenicity of purified gB. The five CMV gB approaches were pooled and the final concentration was determined. Several Amounts of purified gB were mixed with either alum or QS21 Adjuvant and used to inoculate mice. Serum from the mice was for the presence of HCMV neutralizing antibody evaluated. Table 27 shows that all of the quantities tested of purified gB with both adjuvants were able to neutralize HCMV antibody cause.

• ¹ Mäuse wurden mit 1 × 10⁸ PFU rekombinanten Viren (ip.) am Tag 0 und Tag 49 immunisiert.
• ² HMCV-neutralisierender Titer

Tabelle 24. ZUSAMMENFASSUNG VON IMMUNAFFINITÄTS-REINIGUNGS-SÄULEN Säulen-Lauf Anzahl an VERO-Rollerflaschen^a Auf die Säule aufetragenes Rohmaterial gB-spezifisches Protein^c gB-Ausbeute (% Auftrag) Säulengröße Gesamtprotein^b 7 4 1 ml 13.3 mg nd^d 110 ug^b 8 6 1 ml 14.4 mg 2.2 mg 84 μg^b 10 Säule 7 Durchfluss 1 ml nd nd 4.8 ug^b 11 4 1 ml nd nd 100 ug^b 13 1 0.3 ml nd nd 12 ug^d 19A 1 0.6 ml 2.9 mg 240 μg 41 μg^c (17%) 19B 2 0.6 ml 5.8 mg 480 μg 93 μg^c (19%) 19C 3 0.6 ml 8.7 mg 720 μg 185 μg^c (25%) 21A 3 0.6 ml 5.7 mg 300 μg 29 μg^c (8%) 21B 5 0.6 ml 9.5 mg 500 μg 120 μg^c (13%) 21C 7 0.6 ml 13.3 mg 700 μg 150 μg^c (19%) 23 3 6 ml 5.7 mg 300 μg 25 μg^c (8%) 28 36 4 ml 64.8 mg nd 1000 μg^b 29 24 4 ml 30 mg nd 480 μg^b 32 24 4 ml nd nd 700 μg^b

• ^a Zelldichte: 1 × 10⁸ Zellen pro Rollerflasche
• ^b Proteinkonzentration, welche durch Pierce-BCA-Assay bestimmt wurde
• ^c Abgeschätzt durch Slot-Blot-Analyse unter Verwendung von gereinigtem gB als Standard
• ^d Nicht bestimmt

TABELLE 25. CMV-gB-Ansätze ANSATZ # GESAMT gB VOLUMEN KONZENTRATION SÄULENLAUF 1 0,16 mg 0,55 ml 0,29 mg/ml 7 8 10 11 13 2 1,0 mg 1,0 ml 1,0 mg/ml 28 3 0,26 mg 0,5 ml 0,52 mg/ml 21A 21B 21C 23 4 0,48 mg 0,5 ml 0,96 mg/ml 29 5 0,7 mg 0,5 ml 1,4 mg/ml 32 TABELLE 26. DENSITOMETRIE-ANALYSE VON 5 ANSÄTZEN VON CMV-gB PROTEIN-BANDE SCHEINBARES MOLEKULARGEWICHT (kDa)^a RELATIVE MENGE (%)^b B1 B2 B3 B4 B5 B1 B2 B3 B4 B5 > 200 kDa (gB?) 222 192 208 221 225 217 10,6 8 6,7 7,5 8,3 7,4 Vorläufer-gB 128 120 124 128 134 39 30 36,1 30 27,4 N-Fragment (?) 83 94 77 99 84 101 88 100 89 9,6 3,6 9,7 3,2 6,3 4,5 6,6 3,5 6,3 C-Fragment 55 51 55,4 56,4 59 21 15,6 13,7 22,6 21 Unbekannte Kontaminante 42 39 42 44 45 6,1 12 15,4 14,3 15,8 gB-Abbauprodukt (?) 32 30 35 35 37 4,3 9,7 11,3 8,6 10

• ^a berechnet aus Densitometer-Abtastung unter Verwendung von Molekulargewichtsmarkern als Standards (vergleiche 59, 59A)
• ^b Die Dichte jeder Bande wird aus einer 2-dimensionalen Abtastungs-Linie durch die Bande berechnet: Die durchschnittliche Pixel-OD quer über die Probenbreite wird unter der Kurve zur Basislinie integriert, um die Dichte (OD_xcm) zu erhalten. Die relative Menge ist der Prozentanteil [an] der Gesamtdichte von allen Banden in der Spur (vergleiche 59, 59A).

Tabelle 27. HCMV-neutralisierende Antikörper, hervorgerufen durch gereinigtes gB-Protein in CBA-Mäusen¹ Maus Dosis³ Adiuvans³ NT² 4w NT² 6w NT² 8w NT² 9w 201 2.5 Alum 32 256 256 256 203 8 64 128 128 204 8 12 16 16 206 5.0 Alum 48 512 192 192 207 12 192 512 512 208 16 192 192 192 209 16 128 256 256 210 8 128 256 256 211 10.0 Alum 32 256 213 32 96 256 256 214 32 256 256 216 20.0 Alum 64 128 128 128 217 64 256 256 256 218 32 128 512 256 219 16 128 256 256 220 32 192 512 256 222 2.5 QS21 8 192 512 223 32 > 4096 > 4096 2048 224 16 1536 225 64 1024 1024 1024 226 5.0 QS21 64 > 4096 1024 1024 227 96 > 4096 238 64 > 4096 > 4096 > 4096 229 64 > 256 > 4096 230 32 > 4096 1536 2048 231 10.0 QS21 64 2048 2048 > 4096 232 96 1536 2048 233 96 > 4096 234 64 2048 2048 1024 236 20.0 QS21 128 3072 239 96 > 4096 > 4096 > 4096

• ¹ Mäuse wurden S. C. an den Wochen 0 und 4 inokuliert.
• ² Seren wurden 4, 6, 8 oder 9 Wochen nach der Erstimpfung erhalten.
• ³ μg gB in entweder 15 μg QS21 oder 25 μl Alum, verwendet für jede Inokulation.

Tabelle 28. Zusammenfassung des Prime/Boost-Experiments Mäuse NT Tag 0 ^Antigen Adj. NT Tag 29 Antigen Adj. NT Tag 42 NT Tag 56 381 4 ALV 32 gB + Alu 384 768 382 < 4 ALV 8 gB + Alu 192 192 383 4 ALV 4 gB + Alu 192 256 384 < 4 ALV 48 gB + Alu 512 512 385 4 ALV 16 gB + Alu 256 ND 397 4 ALV 8 gB + Alu 128 192 G. m. 4 13.5 248 326 392 < 4 ALV < 4 gB + QS 128 128 393 < 4 ALV 4 gB + QS > 1024 > 1024 394 < 4 ALV 8 gB + QS > 1024 > 1024 395 < 4 ALV 16 gB + QS 512 384 396 < 4 ALV 4 gB + QS 256 384 398 4 ALV 8 gB + QS > 1024 > 1024 G. m. 4 6.3 > 512 > 522 373 4 ALV 16 ALV 128 96 376 4 ALV 4 ALV 8 12 378 8 ALV 4 ALV 8 4 379 4 ALV 8 ALV 128 128 380 4 ALV 16 ALV 64 64 399 4 ALV 4 ALV 96 192 400 < 4 ALV 4 ALV 64 128 G. m. 4 6.5 45.6 51.2

• 5 × 10⁵ TCD₅₀ an ALVAC-gB (vCP139), 5 μg gB + Alu, 1 μg gB + QS21 wurden subkutan verabreicht.
• G. m. = geometrischer Mittelwert.

Purified gB was used in a prime / boost protocol in combination with ALVAC-gB (vCP139) in mice. Table 28 shows that mice receiving ALVAC-gB (vCP139) on day 0 and boosted on day 29 with purified gB adjuvanted with QS21 or alum developed higher levels of HCMV-neutralizing antibody than mice receiving a second dose of ALVAC gB (vCP1319). Table 23. Induction of HCMV Neutralizing Antibody in Mice Immunogen ¹ Days after immunization 30 48 135 vP1126 16 ² 8th 256 vP1128 16 8th 106 vP1145 16 8th 106

• ¹ mice were immunized with 1 x 10 ⁸ PFU of recombinant viruses (ip.) On day 0 and day 49.
• ² HMCV-neutralizing titers

Table 24. SUMMARY OF IMMUNAFFINITY CLEANING COLUMNS Columns run Number of VERO roller bottles ^a Raw material applied to the column gB-specific protein ^c gB yield (% order) column size Total protein ^b 7 4 1 ml 13.3 mg nd ^d 110 μg ^b 8th 6 1 ml 14.4 mg 2.2 mg 84 μg ^b 10 Column 7 flow 1 ml nd nd 4.8 μg ^b 11 4 1 ml nd nd 100 μg ^b 13 1 0.3 ml nd nd 12 ug ^d 19A 1 0.6 ml 2.9 mg 240 μg 41 μg ^c (17%) 19B 2 0.6 ml 5.8 mg 480 μg 93 μg ^c (19%) 19C 3 0.6 ml 8.7 mg 720 μg 185 μg ^c (25%) 21A 3 0.6 ml 5.7 mg 300 μg 29 μg ^c (8%) 21B 5 0.6 ml 9.5 mg 500 μg 120 μg ^c (13%) 21C 7 0.6 ml 13.3 mg 700 μg 150 μg ^c (19%) 23 3 6 ml 5.7 mg 300 μg 25 μg ^c (8%) 28 36 4 ml 64.8 mg nd 1000 μg ^b 29 24 4 ml 30 mg nd 480 μg ^b 32 24 4 ml nd nd 700 μg ^b

• ^a cell density: 1 × 10 ⁸ cells per roller bottle
• ^b Protein concentration determined by Pierce BCA assay
• ^c Estimated by slot blot analysis using purified gB as standard
• ^d Not determined

TABLE 25. CMV gB Approaches APPROACH # TOTAL gB VOLUME CONCENTRATION COLUMN RUN 1 0.16 mg 0.55 ml 0.29 mg / ml 7 8 10 11 13 2 1.0 mg 1.0 ml 1.0 mg / ml 28 3 0.26 mg 0.5 ml 0.52 mg / ml 21A 21B 21C 23 4 0.48 mg 0.5 ml 0.96 mg / ml 29 5 0.7 mg 0.5 ml 1.4 mg / ml 32 TABLE 26. DENSITOMETRY ANALYSIS OF 5 APPROACHES OF CMV-gB PROTEIN BAND APPLICABLE MOLECULAR WEIGHT (kDa) ^a RELATIVE QUANTITY (%) ^b B1 B2 B3 B4 B5 B1 B2 B3 B4 B5 > 200 kDa (gB?) 222 192 208 221 225 217 10,6 8 6.7 7.5 8.3 7.4 Precursor gB 128 120 124 128 134 39 30 36.1 30 27.4 N fragment (?) 83 94 77 99 84 101 88 100 89 9.6 3.6 9.7 3.2 6.3 4.5 6.6 3.5 6.3 C fragment 55 51 55.4 56.4 59 21 15.6 13.7 22.6 21 Unknown contaminant 42 39 42 44 45 6.1 12 15.4 14.3 15.8 gB degradation product (?) 32 30 35 35 37 4.3 9.7 11.3 8.6 10

• ^a calculated from densitometer scanning using molecular weight markers as standards (cf. 59 . 59A )
• ^b The density of each band is calculated from a 2-dimensional scan line through the band: The average pixel OD across the sample width is integrated below the curve to the baseline to obtain the density (OD _xcm ). The relative amount is the percentage of the total density of all bands in the track (compare 59 . 59A ).

Table 27. HCMV neutralizing antibodies elicited by purified gB protein in CBA mice ¹ mouse Dose ³ Adiuvans ³ NT ² 4w NT ² 6w NT ² 8w NT ² 9w 201 2.5 Alum 32 256 256 256 203 8th 64 128 128 204 8th 12 16 16 206 5.0 Alum 48 512 192 192 207 12 192 512 512 208 16 192 192 192 209 16 128 256 256 210 8th 128 256 256 211 10.0 Alum 32 256 213 32 96 256 256 214 32 256 256 216 20.0 Alum 64 128 128 128 217 64 256 256 256 218 32 128 512 256 219 16 128 256 256 220 32 192 512 256 222 2.5 QS21 8th 192 512 223 32 > 4096 > 4096 2048 224 16 1536 225 64 1024 1024 1024 226 5.0 QS21 64 > 4096 1024 1024 227 96 > 4096 238 64 > 4096 > 4096 > 4096 229 64 > 256 > 4096 230 32 > 4096 1536 2048 231 10.0 QS21 64 2048 2048 > 4096 232 96 1536 2048 233 96 > 4096 234 64 2048 2048 1024 236 20.0 QS21 128 3072 239 96 > 4096 > 4096 > 4096

• ¹ mice were inoculated SC at weeks 0 and 4.
• ^Two sera were obtained 4, 6, 8 or 9 weeks after the first vaccination.
• ³ μg gB in either 15 μg QS21 or 25 μl alum used for each inoculation.

Table 28. Summary of the Prime / Boost Experiment mice NT day 0 ^Antigen Adj. NT day 29 Antigen Adj. NT day 42 NT day 56 381 4 ALV 32 gB + aluminum 384 768 382 <4 ALV 8th gB + aluminum 192 192 383 4 ALV 4 gB + aluminum 192 256 384 <4 ALV 48 gB + aluminum 512 512 385 4 ALV 16 gB + aluminum 256 ND 397 4 ALV 8th gB + aluminum 128 192 G. m. 4 13.5 248 326 392 <4 ALV <4 gB + QS 128 128 393 <4 ALV 4 gB + QS > 1024 > 1024 394 <4 ALV 8th gB + QS > 1024 > 1024 395 <4 ALV 16 gB + QS 512 384 396 <4 ALV 4 gB + QS 256 384 398 4 ALV 8th gB + QS > 1024 > 1024 G. m. 4 6.3 > 512 > 522 373 4 ALV 16 ALV 128 96 376 4 ALV 4 ALV 8th 12 378 8th ALV 4 ALV 8th 4 379 4 ALV 8th ALV 128 128 380 4 ALV 16 ALV 64 64 399 4 ALV 4 ALV 96 192 400 <4 ALV 4 ALV 64 128 G. m. 4 6.5 45.6 51.2

• 5 x 10 ⁵ TCD ₅₀ of ALVAC gB (vCP139), 5 μg gB + Alu, 1 μg gB + QS21 were administered subcutaneously.
• G. m. = geometric mean.

The Results presented here demonstrate the ability of the NYVAC and ALVAC-HCMV recombinants and products thereof, in the aforementioned compositions and Applications, for example immunological, antigenic or vaccine compositions, or for use in the production of antigens or antibodies for assays, Kits or test, and for example, as appropriate, for applications in vaccine or immunization strategies used to prevent an infection with HCMV are able; and that the DNA of Recombinants useful for probes or for the production of PCR primers is.

EXAMPLE 47 - EXPRESSION OF CMV GENES IN NYVAC-CMV6 and NYVAC-CMV5

The immunoprecipitation with for gB, gH, pp65, pp150 and IE1-Exon4 specific monoclonal antibodies the correct expression of these five Genes by NYVAC-CMV6. A FACScan analysis (Becton-Dickinson) showed the surface expression of gH in vP1302B-infected Cells, but not in Cells Containing Its Root Form (vP1251) were infected, indicating that a functional gL gene product is expressed in vP1302B.

The immunoprecipitation with for gB, gH, pp65 and pp150 specific monoclonal antibodies showed the correct expression of these four genes by NYVAC-CMV. The FACScan analysis showed the surface expression of gH in vP1312-infected cells but not in cells which had been infected with its parent form (vP1262), indicating it indicates that a functional gL gene product is expressed in vP1312 becomes.

EXAMPLE 48 - DEVELOPMENT OF AN ALVAC DONORPLASMIDE, Containing the HCMV pp65 ANDpp150 GENES

Plasmid CMV65C6.2 was linearized with Eco RI, filled in with Klenow and treated with alkaline phosphatase to generate a 6.3 kb fragment. Plasmid 150.1 was digested with NheI, filled in with Klenow, and a 3.2 kb fragment (42K-pp150) was isolated. The ligation of these two fragments gave the plasmid 150.8R1, in which the transcription of pp65 and pp150 in the same direction, and pp150 from the plasmid 150.8 in Example 40 is reversed. The DNA sequence of CMVpp65 and CMVpp150 as well as additional flanking sequences in the plasmid 150.8R1 are in the 63 AC shown (SEQ ID NO: 177).

EXAMPLE 49 - CONSTRUCTION OF ALVAC-CMV4 (gB, gH, pp65, pp150)

The Plasmid 150.8R1 was transfected into vCP233-infected CEF cells, to generate ALVAC-CMV4 (vP1360).

EXAMPLE 50 - EXPRESSION OF CMV GENES IN ALVAC-CMV4

The immunoprecipitation with for gB, gH, pp65 and pp150 specific monoclonal antibodies showed the correct expression of all four genes by ALVAC-CMV4 (VP1360).

EXAMPLE 51 DEVELOPMENT OF ALVAC DONORPLASMIDES, CONTAINING HCMV-gL OR -gL PLUS-IE1-EXON4

64A and B (SEQ ID NO: 178) show the sequence of a 5.8 kd [kb] segment of canarypox DNA contained in the plasmid pCPtk. The canarypox thymidine kinase gene (tk) is encoded within this segment starting at nucleotide 4412 and ending at nucleotide 4951. A tk (C7) insert vector containing 2085 bp upstream [sequence] of C7, a polylinker with SmaI, NruI- , EcoRI, XhoI and StuI sites and 812 bp downstream [sequence] of C7 was derived in the following manner. A 3450 bp PstI / NsiI fragment from pCPtk was cloned into the blunt ended Asp718 / XbaI sites of pBS-SK + to generate plasmid pEU1. To delete the tk ORF and replace it with a polylinker, two PCR fragments from pCPtk were prepared using oligonucleotides RG578 (SEQ ID NO: 179) (5'-GTACATAAGCTTTTGCATG-3 ') plus RG581 (SEQ ID No.: 180) (5'-TATGAATTCCTCGAGGGATCCAGGCCTTTTTATTGACTAGTTAATCAGTCTAATATACGTACTAAATAC-3 ') and RG 579 (SEQ ID NO: 181) (5'-CTAATTTCGAATGTCCGACG-3') plus RG580 (SEQ ID NO: 182 ) (5'-TTAGAATTCTCGCGACCCGGGTTTTTATAGCTAATTAGTACTTATTACAAATACTATAATATTTAG-3 '). These fragments were purified, digested with HindIII / EcoRI or BstBI / EcoRI and ligated to pEU1 which had been cut with HindIII / BstBI resulting in plasmid pC7.

The Polylinker region in pC7 was modified in the following manner. pC7 was digested with EcoRI and StuI, purified and annealed Oligonucleotides SDSYN154 (SEQ ID NO: 183) (5'-AATTCGTCGACGGATCCCTCGAGGGTACCGCATGC-3 ') and SDSYN155 (SEQ. ID. No .: 184) (5'-GCATGCGGTACCCTCGAGGGATCCGTCGACG-3 '). ligated, causing one generated the plasmid pC7 +.

The plasmid pC7 ⁺ was digested with BamHI and treated with alkaline phosphatase. The plasmid I4LH6CgL was digested with BamHI and BglII, and a 968 bp fragment (containing the H6 promoter-driven gL gene) was isolated. The ligation of these two fragments produced the plasmid C7gL, in which the transcription of gL occurs in the same direction as the deleted tk gene. The DNA sequence of HCMV-gL plus additional flanking sequences in plasmid C7gL are described in 65A and B shown.

The plasmid C7gL was digested with BamHI and PspAI and treated with alkaline phosphatase. The plasmid I4LH6IEEX4 was digested with BamHI and PspAI and a 1363 bp fragment (containing the H6 promoter driven IE1 exon4 gene) was isolated. Ligation of these two fragments yielded plasmid C7gLIES2. The DNA sequence of HCMV-gL and IE1-exon4 plus additional flanking sequences in plasmid C7gLIES2 are described in U.S. Pat 66A and B shown.

EXAMPLE 52 - CONSTRUCTION OF ALVAC-CMV6 (gB, gH, gL, pp65, pp150, IE1-Exon4) AND ALVAC-CMV5 (gB, gH, gL, pp65, pp150)

The Plasmid C7gLIES2 is transfected into vP1360 infected cells, to generate ALVAC-CMV6 (gB, gH, gL, pp65, pp150, IE1-exon4).

The Plasmid C7gL is transfected into vP1360-infected cells to give ALVAC-CMV5 (gB, gH, gL, pp65, pp 150).

EXAMPLE 53 - CLONING OF HCMV-gL AND A -gH WITHOUT HIS TRANSMEMBRANREGION AND CYTOPLASMATIC TAIL IN NYVAC DONORPLASMID pSD553

The sequence of HCMV-gH without its transmembrane region and cytoplasmic tail becomes in 67 (SEQ ID NO: 1). Plasmid SPgH1 was amplified in a PCR with oligonucleotides SPgHS1 (SEQ ID NO: 185) (5'-CCGAAGCTTCTCGAGATAAAAATCAACGACTGTCGGTAGCGTCCACGACGAC-3 ') and SPgH8 (SEQ ID NO: 186) (5'-TCCACTCCATGCTAGT-3' ) was used to generate a 756 bp fragment. This fragment was digested with NsiI and HindIII and a 275 bp fragment was isolated. The plasmid SPgH6 was digested with NsiI and HindIII and a 4779 bp fragment was isolated. Ligation of these two fragments gave the plasmid SPgH7, which contains the 42K promoter-driven gH gene without its transmembrane region and cytoplasmic tail.

The NYVAC insertion plasmid pSD553VC was digested with BamHI and incubated with treated alkaline phosphatase. The plasmid I4LH6CgL was used with BamHI and BglII digested, and a 970 bp fragment (containing the H6 promoter and the gL gene) was isolated. The ligation of this two fragments generated the plasmid COPAKgL-24.

The plasmid gH7 was digested with XhoI and ScaI and a 2239 bp fragment was isolated (which contained the 42K promoter and the truncated gH gene). The plasmid COPAKgL-24 was digested with XhoI, treated with alkaline phosphatase and ligated to the 2239 bp fragment to generate the plasmid COPAKHL-15. The DNA sequence of gL and the truncated gH plus additional flanking DNA sequences in the plasmid COPAKHL-15 are in 68A and B (SEQ ID NO: 187).

EXAMPLE 54 - CONSTRUCTION OF A POCKETVIRUS RECOMBINANT, Containing gL AND gH WITHOUT THE TRANSMEMBRANE REGION AND CYTOPLASMIC TAIL

The Plasmid COPAKHL-15 was transfected into NYVAC-infected CEF cells, to generate the recombinant vP 1399.

EXAMPLE 55 - EXPRESSION OF gH BY THE RECOMBINANT vP1399

The immunoprecipitation with a for gH specific monoclonal antibody showed the expression of a secreted gH protein of approximately 97 kDa by the recombinant vP1399.

REFERENCES

• 1. Akrigg, A., Wilkinson, G.W.G. and Oram, J.D., Virus Res. 2: 107-121 (1985).
• 2. Albrecht, T. and Rapp, F., Virology 55: 53-61 (1973).
• 3. Alp, N.J., Allport, T.D., Zanten, J. Van, Rodgers, B., Patrick Sissons, J.G. and Borysiewicz, L.K., J. Virol. 65: 4812-4820 (1991).
• 4. Altenburger, W., C-P. Suter and J. Altenburger, Archives Virol. 105: 15-27 (1989).
• 5. Aulitzky, W., Schulz, T., Tilg, H. et al., J. Infect. Dis. 163: 1344-1347 (1991).
• 6. Baboonian, C., Blake, K., Booth, J.C. and Wiblin, C.N., J. Med. Virol. 29: 139-145 (1989).
• 7. Behbehani, A.M., Microbiological Reviews 47: 455-509 (1983).
• 8. Beninga, J., Kropff, B. and Mach, M., J. Gen. Virol. 76: 153-160 (1995).
• 9. Bergoin, M. and Dales, S., Comparative Virology, eds. K. Maramorosch and E. Kurstak, (Academic Press, NY) pp. 169-205 (1971).
• 10. Bertholet, C., Drillien, R. and Wittek, R., Proc. Natl. Acad. Sci. USA 82: 2096-2100 (1985).
• 11. Biegalke, B.J. and Geballe, A.P., Virology 183: 381-385 (1991).
• 12. Blanton, R. and Tevethia, M., Virology 112: 262-273 (1981).
• 13. Borysiewicz, L.K., Hickling, J.K., Graham, S., Sinclair, Cranage, M.P., Smith, G.L. and Sissons, J.G.P., J. Exp. Med. 268: 919-931 (1988).
• 14. Britt, W.J., Virology 135: 369-378 (1984).
• 15. Britt, W.J. and Auger, D., J. Virol. 58: 185-191 (1986).
• 16. Britt, W.J. and Vugler, L.G., J. Virol. 63: 403-410 (1989).
• 17. Brockmeier, S., Lager, K., Tartaglia, J., Riviere, M., Paoletti, E. and Mengeling, W., Veterinary Microbiology 38: 41-58 (1993).
• 18. Buller, R.M.L., G.L. Smith, Cremer, K., Notkins, A.L. and Moss, B., Nature 317: 813-815 (1985).
• 19. Buller, R.M.L., Chakrabarti, S., Cooper, J.A., Twardzik, D.R. and Moss, B., J. Virol. 62: 866-874 (1988).
• 20. Cadoz, M., A. Strady, B. Meignier, J. Taylor, J. Tartaglia, E. Paoletti and S. Plotkin, The Lancet, 339: 1429-1432 (1992).
• 21. Cameron, J. and Preston, C., J. Gen. Virol. 54: 421-424 (1981).
• 22. Charpentier, B., Michelson, S. and Martin, B., J. of Immunology 137: 330-336 (1986).
• 23. Cherrington, J.M. and Mocarski, E.S., J. Virol. 63: 1435-1440 (1989).
• 24. Child, S.J., Palumbo, G.J., Buller, R.M.L. and Hruby, D.E. Virology 174: 625-629 (1990).
• 25. Clewell, D.B. and D.R. Helinski, Proc. Natl. Acad. Sci. USA 62: 1159-1166 (1969).
• 26. Clewell, D.B., J. Bacteriol 110: 667-676 (1972).
• 27. Colberg-Poley, A.M., Santomenna, L.D., Harlow, P.P., Benfield, P.A. and Tenney, D.J., J. Virol. 66: 95-105 (1992).
• 28. Colinas, R.J., R.C. Condit, and E. Paoletti, Virus Research 18: 49-70 (1990).
• 29. Cooney, E.L., Corrier, A.C., Greenberg, P.O., et al., Lancet 337: 567-572 (1991).
• 30. Cooney, E., McElrath, M., Corey, L., Hu, S., Collier, A., Arditti, D., Hoffman, M., Coombs, R., Smith, G. and Greenberg, P., Proc. Natl. Acad. Sci. USA 90: 1882-1886 (1993).
• 31. Cranage, M.P., Smith, G.L., Bell, S.E., Hart, H., Brown, C., Bankier, A.T., Tomlinson, P., Barrell, B.G. and Minson, T. C., J. Virol. 62: 1416-1422 (1988).
• 32. Cranage, M.P., Kouzarides, T., Bankier, A., Satchwell, S., Weston, K., Tomlinson, P. and Barrell, B., EMBO J. 5: 3057-3063 (1986).
• 33. DeMarchi, J.M., Schmidt, C.A. and Kaplan, A.S., J. Virol. 35: 277-286 (1980).
• 34. Dreyfus, G., Adam, S.A. and Choi, Y.D., Mol. Cell. Biol. 4: 415-423 (1984).
• 35. Drilliem, R., Koehren, F. and Kirn, A., Virology 111: 448-499 (1981).
• 36. Edbauer, C., R. Weinberg, J. Taylor, A. Rey-Senelonge, J. Bouquet, P. Desmettre, E. Paoletti, Virology 179: 901-904 (1990).
• 37. Ehrlich, P.H., Moustafa, Z.A., Justice, J.C., Harfeldt, K. E. and Ostberg, L., Hybridoma 7: 385-395 (1988).
• 38. Engelke, D.R., Hoener, P.A. and Collins, F.S., Proc. Natl. Acad. Sci. 85: 544-548 (1988).
• 39. Etinger, H.M. and Altenburger, W., Vaccine 9: 470-472 (1991).
• 40. Fenner, F., Virology 5: 502-529 (1958).
• 41. Flexner, C., Hugen, A. and Moss, B., Nature 330: 259-262 (1987).
• 42. Forman, S.J., Zaia, J.A., Clark, B.R., Wright, C.L., Mills, B.J., Pottathil, R., Racklin, B.C., Gallagher, M.T., Welte, K. and Blume, K.G., J. Immunol. 134: 3391-3395 (1985).
• 43. Fries et al., 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, CA (October 1992).
• 44. Funahashi, S., T. Sato and H. Shida, J. Gen. Virol. 69: 35-47 (1988).
• 45. Gallant, J.E., Moore, R.D., Richman, D.D. et al., J. Infect. Dis. 166: 1223-1227 (1992).
• 46. Galloway, D.A., Buonaguro, F.M., Brandt, C.R. and McDougall, J.K., In Cancer Cells, DNA Tumor Viruses: Control of Gene Expression and Replication, eds. Botchan, M., Grodzicker, T., and Sharp, P. A. (Cold Spring Harbor Laboratory) 4: 355-361 (1986).
• 47. Ghazal, P., Young, J., Giuletti, E., DeMattei, C., Garcia, J., Gaynor, J., Stenberg, R.M. and Nelson, J.A., J. Virol. 65: 6735-6742 (1991).
• 48. Ghendon, Y. Z., and Chernos, V. I., Acta Virol. 8: 359-368 (1964).
• 49. Gilbert, M.J., Riddell, S.R., Li, C.R. and Greenberg, P.D., J. Virol. 67: 3461-3469 (1993).
• 50. Gillard, S., Spehner, D., Drillien, R. and Kirn, A., Proc. Natl. Acad. Sci. USA 83: 5573-5577 (1986).
• 51. Glenn, J., Rev. Infect. Dis. 3: 1151-1178 (1981).
• 52. Goebel, S.J., Johnson, G.P., Perkus, M.E., Davis, S. W., Winslow, J.P., Paoletti, E., Virology 179: 247-266 (1990a).
• 53. Goebel, S.J., G.P. Johnson, M.E. Perkus, S.W. Davis, J. P. Winslow and E. Paoletti, Virology 179: 517-563 (1990).
• 54. Goldstein, D.J. and S.K. Weller, Virology 166: 41-51 (1988).
• 55. Gönczöl, E., Ianacone, W.H.O., Starr, S., Meignier, B. and Plotkin, S.A., Vaccine 8: 130-136 (1990).
• 56. Gönczöl, E., De Taisne, C, Hirka, G., Berencsi, K., Lin, W., Paoletti, E. and Plotkin, S., Vaccine 9: 631-637 (1991).
• 57. Gönczöl E., Furlini, G., Janacone, J. and Plotkin, S., J. Virol. Meth. 14: 37-41 (1986).
• 58. Graham, B, Mathes, T., Belshe, R., Clements, M., Dolin, R., Wright, P., Gorse, G., Schwartz, D., Keefer, M., Bolognesi, D., Corey, L., Stablein, D., Esterlitz, J., Hu, S.-L., Smith, G., Fast, P., Koff, W. and the HIAID AIDS Vaccine Clinical Trials Network, J. Infect. Dis. 167: 533-537 (1993).
• 59. Gretch, D.R., Karl, B., Gehrz, R.C. and Stinski, M.F., J. Virol. 62: 1956-1962 (1988a).
• 60. Gretch, D.R., Kari, B., Rasmussen, L., Gehrz, R.C. Stinski, M.F., J. Virol. 62: 875-881 (1988b).
• 61. Gross, J.G., Bozzette, S.A., Mathews, W.C. et al., Ophthalmology 97: 681-686 (1990).
• 62. Guo et al., J. Virol. 64: 2399-2406 (1990).
• 63. Guo, P., Goebel, S., Davis, S., Perkus, M.E., Languet, B., Desmettre, P., Allen, G. and Paoletti, E., J. Virol. 63: 4189-4198 (1989).
• 64. Hagemeier, C., Walker, S.M., Sissons, P.J.G. and Sinclair, J.H., J.Gen. Virol. 73: 2385-2393 (1992).
• 65. Harlow, E. and Lane D., In Antibodies: A Laboratory Manual (Cold Spring Harbor University, Cold Spring Harbor, NY) (1988).
• 66. Hruby, D.E. and L.A. Ball, J. Virol. 43: 403-409 (1982).
• 67. Hruby, D.E., R.A. Maki, D.B. Miller and L.A. Ball, Proc. Natl. Acad. Sci. USA 80: 3411-3415 (1983).
• 68. Hu, S.- L., Klaniecki, J., Dykers, T., Sridhar, P. and Travis, B., AIDS RES. Hum. Retroviruses 3: 615-620 (1991).
• 69. Hu, S.-L., Abrams, K., Barber, G., Moran, P., Zarling, J., Langlois, A., Kuller, L., Morton, W. and Benveniste, R., Science 255: 456-459 (1992).
• 70. Ichihashi, Y. and Dales, S., Virology 46: 533-543 (1971).
• 71. Itamura, S., H. Iinuma, H. Shida, Y. Morikawa, K. Nerome and A. Oya, J. Gen. Virol. 71: 2859-2865 (1990).
• 72. Jacobson, J.G., D.A. Leib, D.J. Goldstein, C.L. Bogard, P.A. Schaffer, S.K. Weller and D.M. Coen, Virology 173: 276-283 (1989).
• 73. Jahn, G., Scholl, B.-C., Traupe, B. and Fleckenstein, B., J. Gen. Virol. 68: 1327-1337 (1987).
• 74. Jamieson, A.T., G.A. Gentry and J.H. Subak-Sharpe, J. Gene. Virol. 24: 465-480 (1974).
• 75. Jonjic, S., del Val, M., Keil, G.M., Reddehasse, M.J. and Koszinowski, U.H., J. Virol. 62: 1653-1658 (1988).
• 76. Kari, B. and Gehrz, R., Arch. Virol. 114: 213-228 (1990).
• 77. Kari, B., Lussenhop, N., Goertz, R., Wabuke-Bunoti, M., Radeke, R. and Gehrz, R., J. Virol. 60: 345-352 (1986).
• 78. Kari, B., Liu, Y.-N. C., Goertz, R., Lussenshop, N. and Stinski, M.F., J. Gen. Virol. 71: 2673-2680 (1990).
• 79. Kato, S., M. Takahashi, S. Kameyama and J. Kamahora, Biken's 2: 353-363 (1959).
• 80. Kaye, J.F., Gompels, U.A. and Minson, A.C., J.Gen. Virol. 72: 2693-2698 (1992).
• 81. Kieny, M.P., Lathe, R., Drillien, R., Spehner, D., Skory, S., Schmitt, D., Wiktor, T., Koprowski, H. and Lecocq, J.P., Nature (London) 312: 163-166 (1984).
• 82. Kleitman, W., Schottle, A., Kleitmann, B., et al., Cell Culture Rabies Vaccines and Their Protective Effect in Man., Eds. Kuwert / Wiktor / Koprowski (International Green Cross-Geneva) pp. 330-337 (1981).
• 83. Knauf, V.C. and Nester, E.W., Plasmid 8: 45-54 (1982).
• 84. Konishi, E., Pincus, S., Paoletti, E., Laegreid, W.W., Shope, R.E. and Mason, P.W., Virology 190: 454-458 (1992).
• 85. Kotwal, G.J. and Moss, B., Nature (London) 335: 176-178 (1988a).
• 86. Kotwal, G.J. and Moss, B., Virology 167: 524-537 (1988b).
• 87. Kotwal, G.J., S.N. Isaacs, R. McKenzie, M.M. Frank, and B. Moss, Science 250: 827-830 (1990).
• 88. Kotwal, G.J., A.W. Hugin and B. Moss, Virology 171: 579-587 (1989a).
• 89. Kotwal, G.J. and B. Moss, J. Virol. 63: 600-606 (1989b).
• 90. Kunkel, T.A., Proc. Natl. Acad. Sci. USA 82: 488-492 (1985).
• 91. Kuwert, E.K., Barsenbach, C., Werner, J., et al., In Cell Culture Rabies Vaccines and Their Protective Effect in Man., Eds. Kuwert / Witkor / Koprowski (International Green Cross-Geneva) pp 160-167 (1981).
• 92. Lafemina, R., Pizzorno, M.C., Mosca, J.D. and Hayward, G.S., Virology 172: 564-600 (1989).
• 93. Lai, C.-K. and B.G.T., Pogo Virus Res. 12: 239-250 (1989).
• 94. Liu, Y.-N. C. Klaus, A., Kari, B., Stinski, M.F., Eckhardt, J. and Gehrz, R.C., J. Virology 65: 1644-1648 (1991).
• 95. Mandecki, W., Proc. Natl. Acad. Sci. USA 83: 7177-7182 (1986).
• 96. Maniatis, T., Fritsch, E.F., and Sambrook, J., In Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY) (1982).
• 97. Marshall, G.S., Rabalais, G.P., Stout, G.G. and Waldeyer, S.L., J. Infect. Dis. 165: 381-384 (1992).
• 98. Masuho, Y., Matsumoto, Y.-I., Sugano, T., Fujnaga, S. and Minamishima, Y., J. Gen. Virol. 68: 1357-1461 (1987).
• 99. Matthews, R.E.F., Intervirology 17: 42-44 (1982).
• 100. McDonough, S. and Spector, D., Virology 125: 31-46 (1933).
• 101. Morgan, A.J., M. Mackett, S. Finerty, J.R. Arrand, F. T. Scullion and M.A. Epstein, J. Med. Virol. 25: 189-195 (1988).
• 102. Moss, B., E. Winters and J.A. Cooper, J. Virol. 40: 387-395 (1981).
• 103. Pachl, C., Probert, W.S., Hermsen, K.M., Masiarz, F. R., Rasmussen, L., Merigan, T.C., and Spaete, R.C., Virology 169: 418-426 (1989).
• 104. Paez, E., Dallo, S. and Esteban, M., Proc. Natl. Acad. Sci. USA 82: 3365-3369 (1985).
• 105. Palumbo, G.J., Pickup, D.J., Fredrickson, T.N., Mcintyre, L.J. and Buller, R.M.L., Virology 172: 262-273 (1989).
• 106. Pande, H., Campo, K., Tanamachi, B. and Zaia, J.A., Virology 182: 220-228 (1991).
• 107. Panicali, D. and E. Paoletti, Proc. Natl. Acad. Sci. USA 79: 4927-4931 (1982).
• 108. Panicali, D., Davis, S.W., Mercer, S.R. and Paoletti, E., J. Virol. 37: 1000-1010 (1981).
• 109. Patel, D.D., Ray, C.A., Drucker, R.P. and Pickup, D. J., Proc. Natl. Acad. Sci. USA 85: 9431-9435 (1988).
• 110. Patel, D.D. and Pickup, D.J., EMBO 6: 3787-3794 (1987).
• 111. Pereira, L., Hoffman, M., Tatsuno, M. and Dondero, D., Virology 139: 73-86 (1984).
• 112. Pereira, L. and Hoffman, M., In Human Herpesvirus Infections: Pathogenesis, Diagnosis and Treatments, eds. Lopez, C. and Roizman, Second International Conference on Immunobiology and Prophyaxis of Human Herpes Virus Infections Oct. 13-16, 1985 (Raven Press, New York) pp. 69-92 (1986).
• 113. Perkus, M.E., D. Panicali, S. Mercer and E. Paoletti, Virology 152: 285-297 (1986).
• 114. Perkus, M.E., Limbach, K. and Paoletti, E., J. Virol. 63: 3829-3836 (1989).
• 115. Perkus, M.E., Taylor, J., Tartaglia, J., Pincus, S., Kauffman, E. B., Tine, J.A. and Paoletti, E., In Combined Vaccines and Simultaneous Administration: Current Issues and Perspective (Annals of the New York Academy of Sciences) in press (1994).
• 116. Perkus, M.E., Goebel, S.J., Davis, S.W., Johnson, G. P., Limbach, K., Norton, E.K. and Paoletti, E., Virology 179: 276-286 (1990).
• 117. Perkus, M.E., Kauffman, E.B., Taylor, J., Mercer, S., Smith, D., Van der Hoeven, J. and Paoletti, E., J. Tiss. Cult. Meth. 18: 72-81 (1993).
• 118. Perkus, M.E., S.J. Goebel, S.W. Davis, G.P. Johnson, E.K. Norton and E. Paoletti, Virology 180: 406-410 (1991).
• 119. Perkus, M.E., A. Piccini, B.R. Lipinskas and E. Paoletti, Science 229: 981-984 (1985).
• 120. Pialoux, G., Excler, J.-L., Riviere, Y. et al., AIDS Research and Human Retroviruses 11: 373-381 (1995).
• 121. Piccini, A., M.E. Perkus and E. Paoletti, Methods in Enzymology 153: 545-563 (1987).
• 122. Pickup, D.J., B.S. Ink, B.L. Parsons, W.Hu and W.K. Joklik, Proc. Natl. Acad. Sci. USA 81: 6817-6821 (1984).
• 123. Pickup, D.J., B.S. Ink, W.Hu, C.A. Ray, and W.K. Joklik, Proc. Natl. Acad. Sci. USA 83: 7698-7702 (1986).
• 124. Plachter, B., Kiages, S., Hagelmann, S., Britt, W., Landini, M.P. and Jahn, G., J. Clin. Microbiol. 28: 1229-1235 (1990).
• 125. Plotkin, S.A., Smiley, M.L., Friedman, H.M., Starr, S.E., Fleisher, G.R. and Wrodaver, C., Lancet 1: 528-530 (1984).
• 126. Plotkin, S.A., Starr, S.E., Friedman, H.M., Gönczöl, E., and Weibel, R.E., J. Infect. Dis. 159: 860-865 (1989).
• 127. Plotkin, S.A., Farquhar, J. and Hornberger, E., J. Infect. Dis. 134: 470-475 (1976).
• 128. Rasmussen, L., Nelson, M., Neff, M. and Merigan, Jr., T. C., Virology 163: 308-318 (1988).
• 129. Rasmussen, L., Matkin, C., Spaete, R., Pachl., C. and Merigan, T.C., J. Infect. Dis. 164: 835-842 (1991).
• 130. Rasmussen, L., Nelson, R.M., Kelsall, D.C. and Merigan, T.C., Proc. Natl. Acad. Sci. USA 81: 876-880 (1984).
• 131. Reed, J. and Muench, H., Am. J. Hyg. 27: 493-497 (1938).
• 132. Reis, B., Bogner, E., Reschke, M., Richter, A., Mockenhaupt, T. and Radsak, K., J. Gen. Virol. 74: 1371-1379 (1993).
• 133. Riddell, S.R., Rabin, M., Geballe, A.P., Britt, W.J. and Greenberg, P.D., J. Immunol. 146: 2795-2804 (1991).
• 134. Riddell, S.R., Watanabe, K.S., Goodrich, J.M., Li, C. R., Agha, M.E. and Greenberg, P.D., Science 257: 238-241 (1992).
• 135. Roarty J.D., Fisher, E.J., and Nussbaum, J.J., Ophthalmology 100: 1685-1688 (1993).
• 136. Sanger, F., Nickel, S. Coulson, A.R., Proc. Natl. Acad. Sci. 74: 5463-5467 (1977).
• 137. Santomenna, L.D. and Colberg-Poley, A.M., J. Virol. 64: 2033-2040 (1990).
• 138. Schmidtt, J.F.C. and H.G. Stunnenberg, J. Virol. 62: 1889-1897 (1988).
• 139. Seligmann, E.B., In Laboratory Techniques in Rabies, eds. M. Kaplan and H. Koprowski, (World Health Organization, Geneva) pp. 279-285 (1973).
• 140. Shapira, S.K., Chou, J., Richaud, F.V. and Casadaban, M.J., Gene 25: 71-82 (1983).
• 141. Shida, H., Virology 150: 451-462 (1986).
• 142. Shida, H., Hinuma, Y., Hatanaka, M., Morita, M., Kidokoro, M., Suzuki, K., Maruyzam, T., Takahashi-Nishimaki, F., Sugimoto, M., Kitamura, R., Miyazawa, T. and Hayami, M., J. Virol. 62: 4474-4480 (1988).
• 143. Shida, H., T. Tochikura, T. Sato, T. Konno, K. Hirayoshi, H. Seki, Y. Ito, M. Hatanaka, Y. Hinuma, M. Sugimoto, F. Takahashi-Nishimaki, T. Maruyama, K. Miki, K. Suzuki, M. Morita, H. Sashiyama and M. Hayami, EMBO 6: 3379-3384 (1987).
• 144. Slabaugh, M., N. Roseman, R. Davis and C. Mathews, J. Virol. 62: 519-527 (1988).
• 145. Smith, J.S., P.A. Yager and G.M. Baer, In Laboratory Techniques in Rabies, eds. M. Kaplan and H. Koprowski (WHO Geneva) pp. 354-357 (1973).
• 146. Spaete, R.R., Gehrz, R.C. and Landini, M.P., J. Gen. Virol. 75: 3287-3308 (1994).
• 147. Spaete, R.R., Thayer, R.M., Probert, W.S., Masiarz, F.R., Chamberlain, S.H., Rasmussen, L., Merigan, T.C. and Pachl, C., Virology 167: 207-225 (1988).
• 148. Spaete, R.R., Perot, K., Scott, P.I., Nelson, J.A., Stinski, M.F. and Pachl, C., Virology 193: 853-861 (1993).
• 149. Spaete, R.R., Perot, K., Scott, P.I., Bauer, D., Lee, A. S., Scott, M.H., Rasmussen, L., Britt, W.J., and Pachl, C., In Progress in cytomegalovirus research, ed. M.P. Landini, pp. 133-136 (1991).
• 150. Speir, E., Modali, R., Huang, E.-S et al., Science 265: 391-394 (1994).
• 151. Stagno, S., Pass, R.F., Dworsky, M.E. and Alford, C. A., Semin. Perinatol 7: 31-42 (1983).
• 152. Stanberry, L.R., Kit, S., Myers, M.G., J. Virol. 55: 322-328 (1985).
• 153. Tabor, S. and C.C. Richardson, Proc. Natl. Acad. Sci. USA 84: 4767-4771 (1987).
• 154. Tartaglia, J., Perkus, M.E., Taylor, J., Norton, E.K., Audonnet, J-C., Cox, W.I., Davis, S.W., Van der Hoeven, J., Meignier, B., Riviere, M., Languet, B., Paoletti, E., Virology 188: 217-232 (1992).
• 155. Tartaglia, J., R. Gettig & E. Paoletti, Virology (In press).
• 156. Tartaglia, J. and Paoletti, E., In Immunochemistry of Viruses, II, eds. M.H.V. van Regenmortel & A.R. Neurath, (Elsevier Science Publishers, Amsterdam) pp. 125-151 (1990b).
• 157. Tartaglia, J., Perkus, M.E., Taylor, J., Norton, E.K., Audonnet, J.-C., Cox, W.I., Davis, S.W., Van Der Hoeven, J., Meignier, B., Riviere, M., Languet, B., Paoletti, L., Virology 188: 217-232 (1992).
• 158. Tartaglia, J., J. Taylor, W.I. Cox, J.-C. Audonnet, M. E. Perkus, A. Radaelli, C. de Giuli Morghen, B. Meignier, M. Riviere, K. Weinhold & E. Paoletti, In AIDS Research Reviews, eds. W. Koff, F. Wong-Staal & R. C. Kenedy, Vol. 3, (Marcel Dekker, NY) pp. 361-378 (1993a).
• 159. Tartaglia, J., Jarrett, O., Neil, J.C., Desmettre, P., Paoletti, E., J. Virol. 67: 2370-2375 (1993b).
• 160. Tartaglia, J., Pincus, S., Paoletti, E., Critical Reviews in Immunology 10: 13-30 (1990a).
• 161. Taylor, J., R. Weinberg, J. Tartaglia, C. Richardson, G. Alkhatib, D. Briedis, M. Appel, E. Norton & E. Paoletti, Virology 187: 321-328 (1992).
• 162. Taylor, J., Tartaglia, J., Moran, T., Webster, R.G., Boquet, J.-F., Quimby, F., Holmes, D., Laplace, E., Mickle, T. and Paoletti, E., In Proceedings of the Third International Symposium on Avian Influenza, Univ of Wisconsin-Madison, Madison, Wisconsin, pp. 311-335 (1993).
• 163. Taylor, J., Edbauer, C., Rey-Senelonge, A., Bouquet, J.-F. Norton, E., Goebel, S., Desmettre, P., Paoletti, E., J. Virol. 64: 1441-1450 (1990).
• 164. Taylor, J., R. Weinberg, B. Lanquet, P. Desmettre and E. Paoletti, Vaccine 6: 497-503 (1988b).
• 165. Taylor, J., Weinberg, R., Kawaoka, Y., Webster, R.G. Paoletti, E., Vaccine 6: 504-508 (1988a).
• 166. Taylor, G., E.J. Stott, G. Wertz and A. Ball, J.Gen. Virol. 72: 125-130 (1991a).
• 167. Taylor, J., C. Trimarchi, R. Weinberg, B. Languet, F. Guillemin, P. Desmettre and E. Paoletti, Vaccine 9: 190-193 (1991b).
• 168. Wathen, M.W., Thomsen, D.R. and Stinski, M.F., J. Virol. 38: 446-459 (1981).
• 169. Weir, J.P. and B. Moss, J. Virol. 46: 530-537 (1983).
• 170. Weller, T.H., N. Engl. J. of Med. 285: 203-214 (1971).
• 171. Yuen, L. and Moss, B., Proc. Natl. Acad. Sci. USA 84: 6417-6421 (1987).
• 172. Zhou, J., L. Crawford, L. McLean, X. Sun, M. Stanley, N. Almond and G.L. Smith, J. Gen. Virol. 71: 2185-2190 (1990).

SEQUENCE LISTING

Claims (23)

Recombinant poxvirus, the exogenous DNA in a non-essential region of the poxvirus genome, wherein the DNA is an HCMV protein as shown in SEQ. ID. No .: 42 shown or gB in which amino acids 715-772 deleted therefrom and where the cleavage site of Arg Thr Lys Arg Ser Thr to Arg Thr Ile Arg Ser Thr was modified as described in the SEQ. ID. No .: 44 shown encoded. A recombinant poxvirus according to claim 1, which is a modified recombinant virus, wherein in the modified recombinant Virus virus-encoded genetic functions are thus inactivated that the virus is a weakened Virulence, however, has retained efficiency. A recombinant poxvirus according to claim 1 or 2, wherein the poxvirus an avipox virus is. A recombinant poxvirus according to claim 1 or 2, wherein the poxvirus is a vaccinia virus is. A recombinant virus according to claim 2 or 4 which is a vaccinia virus and in which genetic functions are inactivated are by deleting at least one open reading frame. A recombinant poxvirus according to claim 5, wherein the deleted genetic functions an open C7L K1L reading frame or a Include host range region. A recombinant poxvirus according to claim 6, wherein at least an additional one open reading frame is deleted; and the additional open reading frame chosen by the group which consists of: J2R, B13R + B14R, A26L, A56R and I4l. A recombinant poxvirus according to claim 6, wherein at least an additional one open reading frame is deleted, and the additional open reading frame chosen by the group which consists of: a thymidine kinase gene, one haemorrhagic Region, an inclusion body region Type A, a hemagglutinin and a big one Ribonucleotide reductase subunit. Recombinant pox virus according to claim 7, wherein J2R, B13R + B14R, A26L, A56R, C7L-KIL and I4L were deleted from the virus. A recombinant poxvirus according to claim 8, wherein a thymidine kinase gene, a hemorrhagic region, an inclusion body region Type A, a hemagglutinin, a host range region and a large ribonucleotide reductase subunit deleted from the virus. Recombinant poxvirus according to claim 9, which is a recombinant NYVAC virus is. A recombinant poxvirus according to claim 10, which is a recombinant NYVAC virus. A recombinant poxvirus according to claim 1, which is a modified recombinant avipox virus which has been modified so that it a weakened Having virulence in a host. A recombinant poxvirus according to claim 13, wherein the virus a canarypox virus is. A recombinant poxvirus according to claim 14, wherein the canarypox virus is in reindeer vaccine strain, which by more than 200 serial Passengers on chick embryo fibroblasts attenuated was taking a master seed of which four consecutive plaque cleanings was subjected to agar, resulting in a plaque clone by five additional Passengers was amplified. A recombinant poxvirus according to claim 15, which is a recombinant ALVAC virus. A recombinant poxvirus according to claim 4, which is a recombinant NYVAC virus is. Use of a virus, as in at least one the claims 1, 2, 3, 4, 11, 13, 14, 15 or 16 in the manufacture a medicament for use in immunological treatment from an individual or animal or to induce an immunological one Response in an individual or animal. Composition for inducing an immunological A response region comprising a virus as found in at least one of claims 1, 2, 3, 4, 11, 13, 14, 15 or 16 in admixture with a suitable carrier. Process for the expression of a gene product in a Cell cultured in vitro comprising the introduction of a A virus as claimed in at least one of claims 1, 2, 3, 4, 11, 13, 14, 15 or 16 in the cell. HCMV antigen caused by in vitro expression a virus as claimed in at least one of claims 1, 2, 3, 4, 11, 13, 14, 15 or 16. Use of an HCMV antigen containing an HCMV protein, as defined in claim 1, in the manufacture of a medicament for use in the immunological treatment of an individual or Animal or to induce an immunological response in an individual or animal. Use according to claim 22, wherein the antigen is derived from the in vitro expression of a recombinant avipox virus or vaccinia virus is derived.