DE69009744T3 - Probes, equipment and methods for detection and differentiation of mycobacteria - Google Patents

Description

AREA OF EXPERTISE

The The present invention relates to gene probes, kits and methods for Detection and differentiation of mycobacteria. In particular, the Present invention Gene probes, sets and methods for diagnosis tuberculosis and / or epidemiological Investigation tools to study the development of infections, caused by components of the M. tuberculosis complex become.

RELATED AREAS

In some industrialized countries, i.a. Britain, is tuberculosis in number one the most common Infectious diseases, and yet is little about the Mechanism of pathogenicity known by M. tuberculosis. In developing countries or the "third world" is this disease an endemic health problem for large parts of the population, and the treatment includes long-term treatments with combinations of antibiotics. It is well known that one of the main problems in the Fight against tuberculosis the lack of a simple, reliable and stable Serodiagnostik or a gene probe test is. These are necessary because current diagnostic tests, even those in technological advanced countries are available, are hardly specific and insensitive and on a combination from relatively superficial Symptomology and radiography and staining for the detection of acid-resistant bacilli and bacterial cultures. The first two are widespread variable Characteristics, and the second two are obviously unreliable. Especially at present available Tests can possibly several Weeks are required to get a final result, and the detection of a small number of M. tuberculosis bacteria in highly contaminated Samples are often difficult. The specific identification of mycobacteria is also difficult, and in particular the distinction between the members of the M. tuberculosis complex: M. tuberculosis itself, the bovine strain M. bovis, M. africanum, M. microti and the vaccine strain BCG (the immunocompromised Lead people to diseases can). Numerous attempts have been made to introduce new laboratory tests for tuberculosis but all these attempts proved inadequate specificity and / or sensitivity. Gene probes for specific DNA sequences of the organism reliably detect small amounts of mycobacterial genome by means of procedures, which does not require extensive cultivation or labor intensive work Examination by trained staff of dyed sputum smears require. Gene probe analysis provides a sensitive procedure for rapid detection of small numbers of specific bacteria in the presence other organisms.

nevertheless they pose a significant health problem for people Infections caused by mycobacteria, also a significant health problem for livestock, deer, sheep and Badgers, and the probes provided herein are also for instruments for diagnostic / epidemiological Studies useful for use in relation to these species.

gene probes for identification of strains of the M. tuberculosis complex are commercially available but are dependent on detection ribosomal DNA and require that the bacteria in a first Step cultivated. Although these gene probes are capable of To identify the M. tuberculosis complex they are not to Detection of bacteria in a sputum pattern suitable. The cultivation step elevated also the test duration, which is disadvantageous.

Here in described is the isolation and cloning of a fragment M. tuberculosis DNA, which contains a repetitive element, that for the M. tuberculosis complex is specific. This fragment hybridizes to numerous polymorphs Restriction fragments in various isolates of M. tuberculosis and is therefore able to transfer isolates for studies tuberculosis with a fingerprint. Only a few hybridizing bands are detected in digestions of M. bovis or BCG DNA, and The probe therefore has the unique ability to intervene quickly different components of the M. tuberculosis complex.

Some repetitive elements have been from mycobacterial species already isolated, comprising one of M. leprae (J.E. Clark-Curtiss & G. P. Walsh, Journal of Bacteriology 171, 4844-4851 (1989); J.E. Clark-Curtiss & M.A. Docherty, Journal of Infectious Diseases 159, 7-15 (1989); and C.M. Grosskinsky, W.R. Jacobs, J.E. Clark-Curtiss & B.R. Bloom, Infection and Immunity 57, 1535-1541 (1989)) and the insertion sequence IS900 from M. paratuberculosis (E.P. Green, M. L. M. Tizard, M. T. Moss, J. Thompson, D.J. Winterbourne, J.J. McFadden & J. Hermon-Taylor, Nucleic Acids Research 17, 9063-9072 (1989)). However, these repetitive elements are both species-specific and appear to have a constant hybridization pattern with strains various sources.

This application describes the characterization and sequence analysis of a repetitive element that identifies it as a member of the IS3 family of insertion sequences, some of which already characterized from species of Enterobacteriaceae.

Now It has been found that DNA probes with potential applications in the general diagnosis of mycobacteria and in the specific Diagnosis of tuberculosis derived from deoxyribonucleotide sequences can be the capable are, with those in a natural hybridize existing plasmid existing sequences.

in the The scope of an antibiotic resistance study was the Presence of plasmids in M. tuberculosis by hybridizing the Total DNA from three clinical isolates with DNA from a naturally occurring one Researching plasmid known to exist in M. fortuitum (A. Labidi, C. Dauguet, K.S. Goh & H.L. David, Plasmid profiles of mycobacterium fortuitum complex isolates. Current Microbiology 11, 235-240 (1984)). Plasmids have not yet been found in M. tuberculosis, and hoped that by using the M. fortuitum plasmid DNA as one Probe would be disclosed. Surprisingly showed them, even if they were not the presence of any plasmid in M. tuberculosis revealed that there are M. tuberculosis chromosomal DNA fragments which can hybridize with the plasmid DNA. In addition, total DNA was present of the three clinical isolates with restriction endonucleases BamHI or PvuII were digested, the size of the hybridizing fragments not for every tribe the same.

gene probes to detect mycobacterial infection, depending on the uniqueness the gene sequences that they detect in a bacterial genome, for one certain family, genus, species or a particular strain, different degrees of specificity exhibit. Probes of different specificity may be required be of clinical benefit. So a probe could be a sequence pattern detected in many different species (e.g. tuberculosis and M. bovis) within a particular genus (e.g. Mycobacterium) can be found. In other cases, gene probes may be for a given Species, and even for different tribes of this species, to be specific.

These varying specificity of gene probes has a practical value. For example, it may be for a first Diagnostic line be better to use a probe, the general mycobacterial infection, and subsequently, if necessary to use probes for fine-tuning to diagnose, which species of mycobacteria are involved.

EPIPHANY THE INVENTION

The The present invention provides a nucleotide probe for diagnosis and / or epidemiological investigation of mycobacterial infection ready which hybridizes with genomic M. tuberculosis DNA by screening a genomic M. tuberculosis library with a DNA Plasmids from M. fortuitum available is.

The The present invention also provides a nucleotide probe for diagnosis and / or epidemiological investigation of mycobacterial infection, those with genomic DNA from M. tuberculosis and with DNA from a plasmid hybridized by M. fortuitum.

The inventors disclose a nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection, which are as described herein 2 or comprises or hybridizes with a nucleotide sequence or its complementary sequence, which comprises a genomic library of an organism of the M. tuberculosis complex by hybridization with that described herein 2 and which is capable of distinguishing and characterizing bacterial components of the M. tuberculosis complex either from each other or from other non-complex bacteria.

Also the invention provides a nucleotide probe for diagnosis and / or epidemiological Examination of mycobacterial infection ready, wherein the genomic Library from the M. tuberculosis strain 50410 is available.

The inventors also disclose a nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection, which are either in 2 or 4 The nucleotide sequence shown in the drawings or its complementary sequence comprises or hybridizes with it, in part or in its entirety.

The nucleotide probe may comprise or partially or fully hybridize to an insertion element nucleotide sequence which is linked in the genome of M. tuberculosis strain 50410 by two inverted repeat sequences and the nucleotide coding sequence includes those described in U.S. Pat 2 the drawings is identified.

Also, the present invention provides a nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection comprising or hybridizing to a flanking nucleotide sequence found in the genome of M. tuberculosis strain 50410 adjacent to an insert onselement nucleotide sequence occurs, is bound by two inverted repeats, and contains the nucleotide coding sequence described in U.S. Pat 2 the drawings is identified.

For example, the nucleotide probe may comprise, or partially or wholly hybridize to, the flanking nucleotide sequence downstream from the 3'-end of the 896 base 2 the drawings occurs.

The present invention also provides a nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection comprising, or partially or entirely hybridizing to a 1.9 kb nucleotide sequence present in the genome of M. tuberculosis strain 50410 immediately downstream from the 3 'end of the in 2 The sequence shown in the drawings occurs.

The inventors also disclose a nucleotide probe for the diagnosis and / or epidemiological investigation of mycobacterial infection which comprises or partially or entirely strongly hybridizes to a nucleotide sequence that occurs in the genome of M. tuberculosis strain 50410 and the restriction map as described in U.S. Pat 1 of the drawings is characterized.

The Nucleotide probe disclosed herein may be used for diagnosis and / or epidemiological Examination of mycobacterial infection can be used. The Nucleotide probes can to be able to between different strains of M. tuberculosis too differ. The nucleotide probes may be capable of being between M. tuberculosis, M. bovis and BCG. The nucleotide probes may possibly no significant hybridization with M. paratuberculosis, M. intracellulare, M. scrofulaceum, M. phlei, M. fortuitum, M. chelonei, M. kansasii, M. avium, M. malnioense, M. flavescens and M. gordonae.

The Nucleotide probes of the present invention can be used to detect mycobacteria in clinical samples by dot-blot analysis, liquid hybridization, Southern blot analysis or polymerase chain reaction can be used. The clinical samples can Sputum, urine, cerebrospinal fluid, Tissue samples, blood and other body fluids include.

The The present invention also includes diagnostic kits comprising the nucleotide probes according to the enclosed Claims.

The The present invention also provides a method for detection, discrimination and / or characterization of mycobacteria in clinical samples ready for epidemiological inquiry into the use of Nucleotide probes claimed herein.

The The present invention also provides methods for making the Nucleotide probes ready.

The The present invention also provides a method of discrimination bacterial constituents of the M. tuberculosis complex with each other as well as other bacteria that do not belong to the complex, and to characterize this ready, the method being the following includes: i) digesting DNA from a bacterial sample with a certain restriction enzyme; and ii) performing hybridization analysis using a nucleotide probe according to the claims.

The the nucleotide sequence comprising the gene probe does not necessarily have to a restriction site for contain the restriction enzyme.

SUMMARY THE DRAWINGS

Around to more clearly illustrate the present invention the embodiments now, by way of example only, in detail and with reference to the drawings set forth herein Figures described in which:

1 shows a restriction map of probe 5;

2 the DNA sequence of fragment 5C from probe 5 and the translation product of the large open reading frame;

3 shows a comparison of primary DNA structure of part of 5C with the insertion sequences IS3 and IS3411 of E. coli;

4 showing the DNA sequence overlapping part of fragment 5B and part of fragment 5C of probe 5, namely the insertion sequence (IS986) of the M. tuberculosis 5kb DNA fragment;

5 shows the position of designated open reading frame;

6 shows the alignment of a potential translated product of IS986 ORFb with putative transposases of other IS3-like elements;

7 shows the alignment of potential translated products of ORFa1 and ORFa2 with corresponding regions of other IS3-like elements;

8th a comparison of the inverted Wie showing the recovery of ISTB and IS3411;

9 shows the alignment of the potential translated products of the large open reading frames of 5C and IS3411;

10 shows the alignment of the potential translated products of the large open reading frames of 5C and IS3;

11 shows the alignment of the potential translated products of the large open reading frames of 5C, IS3411 and IS3;

12 shows the alignment of the potential translated products of the large open reading frames of the insertion sequence (IS986) from the 5 kb DNA fragment of M. tuberculosis with those of IS3411 and IS3;

13 showing the alignment of the potential translated large open reading frame proteins of the insertion sequence (IS986) from the 5kb DNA fragment of M. tuberculosis with those of IS3411 and IS3, wherein the C-terminal region of the IS3411 sequence (IS3411 ') from -1 raster is read with respect to the rest of the IS3411 sequence;

14 shows a restriction map of probe 9; and

15 in the form of a diagram shows the relationship between the probes 5 and 12J-B.

TYPES OF IMPLEMENTATION OF INVENTION

Probes 9 and 5

When part of a study regarding the possible presence of plasmids in clinical isolates of M. tuberculosis was total DNA of three such isolates were subjected to Southern blotting and using a Naturally occurring plasmid probed by M. fortuitum. This plasmid, termed pUS300 was obtained from M. fortuitum strain CIPT 14-041-0003 in the Collection de I'Institut Pasteur, Tuberculose, Paris, France (deposited February 21, 1990 at the National Collection of Type Cultures, Colindale, London, UK NW9 5HT, below the traffic NCTC 12381). The results showed that in the strains of M. tuberculosis chromosomal DNA fragments were present, the were able to hybridize to this M. fortuitum plasmid, and they also showed that in material using BamHI or PvuII digested, the size of the hybridization fragments not the same in every tribe.

Around To isolate these hybridization fragments became a total DNA library from a clinical isolate of M. tuberculosis (strain 50410) from the Public Health Laboratory, Dulwich, London, England) in the lambda phage vector EMBL4 by ligation of a partial Sau3Al digest of M. tuberculosis DNA with BamHI-digested EMBL4 constructed. The library was probed with a DNA probe Labeling a recombinant plasmid pUS301 was derived, screened. This plasmid was constructed by ligating an EcoRI digest of plasmid pUS300 with an EcoRI digest of the E. coli plasmid vector constructed pUC19. Positive plaques were confirmed by further rounds of plaque screening cleaned. The probes described below were obtained from the recombinant Phage, called the EMBL4 / A-3 clone filed on February 21, 1990 at the National Collection of Type Culture, Colindale, London, UK NW9 5HT, under the access number NCTC 12380), from one of the positive, in this Obtained method obtained plaques.

The DNA from this recombinant phage EMBL4 / A-3 clone was extracted and digested with EcoRI. Agarose gel electrophoresis and Southern blotting showed that EcoRI-digested EMBL4 / A-3 contains a number of fragments comprising one of about the size of 9,000 base pairs (9 kb) and one of about the size of 5,000 Base pairs (5 kb) that hybridized with the plasmid pUS300. These Fragments were each separated from the gel and used as probe 9 (the 9 kb fragment) or probe 5 (the 5 kb fragment). The Isolate probe 5 by hybridization with M. fortuitum plasmid pUS300 is in Zainuddin and Dale, J. Gen. Micro. 135, 2347-2355 (1989), in more detail described.

The 5 kb EcoRI fragment from lambda clone A3 (ZF Zainuddin & JW Dale, Journal of General Microbiology 135, 2347-2355 (1989)) was cloned using plasmid vector pAT153 to generate plasmid pRP5000. Digestion of the insert fragment of pRP5000 with Pvull generated three fragments, designated 5A, 5B and 5C ( 1 ), which were converted to blunt-ended fragments and ligated with PvuII-digested pAT153, resulting in plasmids pRP5100, pRP5200 and pRP5300, respectively.

Specific subfragments of pRP5000, pRP5200, and pRP5300 prepared using BamHI, Xhol, HindIII, and Sa1I ( 1 ) were cloned into M13mp18 and M13mp19 using the M13 cloning kit (New England Biolabs). The smaller EcoRI-BamHI fragment from pRP5000 was cloned into Bluescript pKS and nested deletions were performed using the Erase a base (Promega) method. Sequencing was done with Taq and T7 polymerases (Promega) and Sequena Version 2 (US Biochemicals) using the 370 Automated Sequencer (Applied Biosystems). Fragments with overlaps of at least 50 bp were sequenced in both directions.

Search were used in GenBank, EMBL, NBRF and SwissProt databases of the SEQ-NET node at the SERC facility in Daresbury the UWGCG package and the WordSearch program (J. Devereux, P. Haeberli & O. Smithies, Nucleic Acids Research 12, 387-395 (1984); and W.J. Wilbur & D.J. Lipman, Proceedings of the National Academy of Sciences USA 80, 726-730 (1983)) and the NAQ program performed by the Protein Identification Resource. sequence analysis were with the Staden Plus package (Amersham) using DIAGON (R. Staden, Nucleic Acids Research 10, 2951-2961 (1982)) for sequence comparison and by Positional Base Preference (R. Staden, Nucleic Acids Research 12, 551-567 (1984)) and Shepherd RNY (J.C.W. Shepherd, Proceedings of the National Academy of Sciences USA 78, 1596-1600 (1981)) Method of identification conducted by reading frames, supplemented by the use of codon preference analysis (R. Staden & A.D. McLachlan, Nucleic Acids Research 10, 141-156 (1982)) a table over preferred codon usage in M. tuberculosis (J.W. Dale and A. Patki, in: The Molecular Biology of Mycobacteria (J.J. McFadden Ed.), In press (1990)). Multiple sequence matches were made with the CLUSTAL software (D.C. Higgins & P. M. Sharp, Gene 73, 237-244 (1988)), supplemented by manual Attitude, performed.

Probe 9

Probe 9 was radiolabeled with ³² P using the "Multiprime Random Primer Extension" method (Amersham) and Southern blots of PvuII-digested total DNA from eight clinical isolates of M. tuberculosis (isolate numbers 50,410, 60,925, 61,066, 61,104, 61,125, 61,267, 61,377, 61,513) as well as M. bovis (field strain, Central Veterinary Laboratory) and BCG (NCTC 5,692) After agarose gel electrophoresis, the DNA fragments were transferred to a Hybond-N filter and by baking for one hour at 80 ° C. The filter was prehybridized in hybridization buffer at 68 ° C. Hybridization with the probe was carried out in the same buffer at 68 ° C. overnight.

The hybridization buffer consisted of 5X Denhardt's solution, 5X SSPE buffer, 0.2% sodium dodecyl sulfate (SDS) and 100 μg / ml sonicated salmon sperm DNA. Denhardt's solution and SSPE buffer were prepared as stock solutions as follows:
50X Denhardt's solution: 0.5 g of FicoII ^™ (MW 400,000), 0.5 g of polyvinylpyrrolidone (MW 40,000), 0.5 g of bovine serum albumin were dissolved in sterile, deionized, distilled water to a final volume of 50 ml, which was divided into aliquots and stored at -20 ° C.
20X SSPE Buffer: 3.6 M NaCl, 20 mM ethylenediaminetetraacetic acid (EDTA), 0.2 M NaH ₂ PO ₄ / Na ₂ HPO ₄ , pH 7.7 were dissolved in deionized, distilled water and autoclaved.

The Filter was then washed twice with 2X SSC, once with 2X SSC, containing 0.1% SDS and once with 0.1X SSC containing 0.1% SDS. All washes were at 68 ° C. The SSC was considered as a stock solution produced: 20X SSC: 3M NaCl, 0.3M sodium citrate were distilled in disbanded and autoclaved after the pH was adjusted to 7.0.

The Filter was made with Saran shell covered and X-ray film for 16 hours at room temperature (RX, Fuji) exposed.

Everyone Strain of M. tuberculosis hybridizing to probe 9 several hybridization bands; some elements of this structure varied from tribe to tribe while others remained constant. M. bovis and BCG also hybridized Probe 9 with a structure showing the conserved properties the M. tuberculosis structure maintained.

The following species of mycobacteria (one strain each, if not otherwise stated) did not hybridize with probe to any significant extent 9: M. paratuberculosis, M. intracellulare, M. scrofulaceum, M. phlei, M. fortuitum (three strains), M. kansasii, M. avium, M. malnioense, M. flavescens, M. gordonae and M. chelonei (two strains).

A restriction map of probe 9 is in 14 displayed. The probe is linked by two EcoRI sites and divided by four Pvull internal sites into fragments of about 3.5 kb, 1 kb, 4 kb and 0.5 kb.

Probe 5

studies to probe 5 showed that it comprises a sequence that is responsible for an insertion element (referred to as IS986) encoded in a variable number Copies (up to about 15) in M. tuberculosis, M. bovis, M. africanum, M. microti and M. bovis BCG of the M. tuberculosis complex are present seems to be. The insertion element was designed with the previously described compared to insertion elements IS 3 and IS 3411 found in E. coli. The insertion element of probe 5 has a close homology to IS 3411, that may be for one Transposase encoded.

A restriction map of probe 5 is in 1 gezeig. The probe can be split at two PvuII sites into fragments 5A, 5B and 5C as shown.

The sequence of 5C is in 2 shown. Useful restriction sites are boxed and a 29/40 identity sequence with the right-inverted repeat (IR) of IS 3411 and 20/40 with the inverted repeat of IS 3 is underlined (Ishiguro & Sato, J. Bacteriology 170, 1902-1906 (1988); Timmerman & Yu, Nucl. Acids Res. 13, 2127-2139 (1985)). Line charts comparing the primary DNA structure of part of 5C with IS 3 and IS 3411 are in 3 shown.

4 shows a DNA sequence that overlaps a portion of fragment 5B and a portion of fragment 5C of probe 5. As in 2 useful restriction sites are boxed. The PvuII restriction site defines a junction between fragments 5B and 5C. This DNA sequence comprises two inverted repeat sequences (27/30 base alignment), which are described in U.S. Pat 4 underlined. The left-inverted repeat sequence CCTGAACCGCCCCGG CATGTCCGGAGACTC is located within fragment 5B to the 5 'site of a first Acc III site, while the right-inverted repeat sequence GAGTCTCCGGACTCACCGGGGCGGTTCAGG within fragment 5C to the 3' site of a second Acc III site is arranged. The sequence between these inverted repeat sequences comprises the insertion element IS986 (of about 1,358 bp) present in a variable number of copies in components of the M. tuberculosis complex.

Examination of the insertion element revealed a long open reading frame (ORFb: bases 274 to 1311) with a potential translation start codon (GUG) at position 478 and another (ORFc) in the reverse direction (1.107 to 622) ( 5 ). Analyzes to determine the preferred base position have shown that both of these, along with parts of two shorter ORFs (6 to 275 and 164 to 376), are potentially translated regions. (For the reasons explained below, the last two are mentioned together and referred to as ORFa1 and ORFa2 respectively, the regions that tend to be translated are in ( 5 specified. The codon usage of ORFb, and to a lesser extent ORFc, is consistent with the high degree of codon preference normally exhibited by mycobacterial genes (JW Dale and A. Patki, in: The Molecular Biology of Mycobacteria (JJ McFadden, ed .) in print (1990)). This was also true for the indicated regions of ORFa1 and ORFa2 5 ), which did not apply to the remainder of this ORF (see below).) The sequence of the hypothetical translation product of ORFb was screened against the databases NBRF and SwissProt. A sequence was identified with homology distinctly different from the background; this was the putative transposase protein of the E. coli insertion sequence IS3411 (Ishiguro and Sato, J. Bacteriology 170, 1902-1906 (1988)); a lesser degree of similarity was found in hypothetical proteins translated from the sequences of two other insertion sequences, IS600 and IS629, both from Shigella sonnei (S. Matsutani, H. Ohtsubo, Y. Maeda & E. Ohtsubo, Journal of Molecular Biology 196, 445-455 (1987)). All of these sequences belong to the IS3 family.

A multiple alignment of these sequences and that of the IS3 transposase (KP Timmerman & CP.D Tu, Nucleic Acids Research 13, 2127-2139 (1985)) shows a marked degree of similarity, except for the C-terminal portion of the IS3411 protein. protein. The distinct structure of this region of IS3411 also clearly stems from the matching of the putative transposases (proteins that allow the DNA segment comprising the insertion element bound by inverted repeats to excise and insert elsewhere in the genome) IS3 and IS3411 as shown by Ishiguro & Sato (1988). However, a comparison of the products of all three reading frames of the complete sequences of IS3, IS3411 and IS986 showed homology of the C-terminal portion of the IS986 ORFb with the -1-raster of IS3411. A multiple match involving an IS3411 product with a suspected frame shift ( 6 ) were used (the sequences were split at the point corresponding to the putative frame shift in IS3411, the two sections were separately aligned and manually recombined IS3411 'is read from the -1 raster with respect to the first part of the sequence) 27% of the amino acid residues of the IS986 ORFb product are also present in at least two of the other three sequences used for comparison, with approximately one half of these residues being identical in all four sequences. Clusters of identical residues can be recognized in three regions containing the conserved motifs L / VWV / AADLTYV, IHHT / SDRGSQY and C / SYDNA. The conservation level of these regions suggests that they are essential for the function of this protein.

The sequence before the potential start codon in ORFb (GUG ₄₇₈ ) has little similarity to a consensus Shine-Dalgarno sequence, which may not be significant. Therefore, the nature of the possible Translati On the beginning of ORFb researched by means of an investigation of the upstream region. The three-grid comparison of the translation product of IS3, IS3411 and IS986 indicated further similarities in this region. In both IS3 and IS3411, the putative transposase gene (ORFb) is preceded by an open reading frame of about 300 base pairs with good translation start signals (Ishiguro N. & G. Sato, Journal of Bacteriology 170, 1902-1906 (1988); Matsutani, N. Ohtsubo, Y. Maeda & E. Ohtsubo, Journal of Molecular Biology 196, 445-455 (1987)). The presumed products of the relevant regions of this ORF align well with those of ORFa1 and ORFa ( 7 ) (the translated products of ORFa1 and ORFa2, up to and starting at the position of the assumed frame shift, were aligned with the products of the corresponding reading frame of the other elements.) All sequences shown, except ORFa2, started at the assumed AUG start codon) refers to a possible grid shift in the IS986 sequence. Alternatively, there is a potential start codon (GUG ₂₀₀ ) of five amino acids in the sequence that can be found in 7 is shown; thus, it is acceptable that ORFa2 is independently translated. In the combined ORFa1 and ORFa2 products, 29% of the residues appear in two of the other three sequences shown. Pairwise comparisons confirm the match; For example, 50% of the residues are consistent with the IS3411 ORFa product. In the 7 The comparison shown is in stark contrast to the discovery by Schwanz et al. (E. Schwartz, M. Kroger & B. Rak, Nucleic Acids Research 13, 2127-2139 (1988)) that the ORFa products of several elements of the IS3 family had only marginal homology.

The IS986 ORFa1 has a potential start codon (AUG) at position 54, the one purin-rich region with several possible assignments of sequences precedes, the five of seven bases that agree with the consensus Shine-Dalgarno sequence. It is believed that translation of the putative transposase (ORFb) with several other members of the IS3 family by reading through ORFa occurs. In both IS3411 and IS3, the translation stop signal tail overlaps ORFa the suspected Start codon for ORFb with the sequence AULA. A ribosome that ends up at this point could therefore overlapping Re-initiate the AUG codon. Although ORFa2 overlaps ORFb, there is no potential start codon in the overlapping one in IS986 Region of ORFb.

It was shown to be ribosomal frameshift that is a fusion protein generated in IS1 (Y. Sekine & E. Ohtsubo, Proceedings of the National Academy of Sciences USA 86, 4609-4613 (1989)) occurs in a region where two ORFs, possibly at the sequence UUUAAAAAC, overlap. IS3411, IS3 and IS600 contain all series of 5-7 A residues in the overlap region between the two ORF. The overlapping region between ORFa2 and ORFb in IS986 does not contain such a long adenine series, the sequence UUUUAAAG (324-331) however, a candidate for be such a raster shift event. Translational frameshift in the -1 direction occurs in other prokaryotic genes, the have no common sequence (J.F. Atkins, R.F. Gesteland, B.R. Reid & C.W. Anderson, Cell 18, 1119-1131 (1979)).

The importance of ORFc on the reverse strand is not clearly determined. The first potential start codon (AUG ₁₀₀₂ ) is not preceded by anything similar to a Shine-Dalgarno sequence. Although the analysis of ORFc confirms that it is a translated sequence, it agrees with ORFb at the other strand, and the analytical procedures on the two strands are not independent. Schwartz et al. (Schwartz, M. Kroger & B. Rak, Nucleic Acids Research 14, 6789-6802 (1988)) identified a similar ORF in E. coli element IS150, which appears to have a coding function. The presence of ORF on the reverse strand is a common feature of other IS elements, and it is considered that they may be involved in the regulation of transposition by the requirement for both proteins, thereby ensuring that the IS element is not groundless External transcription can be activated (DJ Galas and M. Chandler in Mobile DNA (DE Berg and MM Howe, Ed.), 109-162, American Society for Microbiology, Washington (1989)). Further investigation is needed to define the true nature of the translational (and transcriptional) control signals that act in M. tuberculosis.

The base composition of IS986 with 64% G + C is typical of M. tuberculosis. Therefore, it is not surprising that the homology with the other members of the IS3 family, which is so pronounced in protein terms, is much less conspicuous with DNA (data not shown). However, there is a marked degree of similarity of the inverted repeat sequence terminals with the other members of the IS3 family, particularly IS3411 ( 8th ), where the IR ends are 78% identical to those of IS986.

9 shows that the translation of the large open reading frame of 5C with the large open reading frame of insertion element IS3411 of E. coli is highly homologous. It is also homologous with IS3 of E. coli. 10 ). The alignment of all three sequences is in 11 shown.

The matching of the potential Translati The open reading frames of the insertion sequence of the 5 kb DNA fragment of M. tuberculosis (IS986) with those of IS3411 and IS3 are in 12 shown. In 13 a similar comparison is made, but here the C-terminal region of the IS3411 sequence (IS3411 ') is read from the -1-raster with respect to the rest of the IS3411 sequence.

probe 5 was determined by hybridization experiments, essentially those for probe 9 experiments, with 22 isolates of M. tuberculosis and M. bovis and BCG. The conditions were the same as before for probe 9 described, except, autoradiography was performed at room temperature for 6.5 hours.

Everyone M. tuberculosis strain had between five and fifteen strongly hybridizing Fragments as well as numerous weaker ones Gangs up. The number of bands and the strength of the signal as well as the variation between the tribes gave the presence of a random inserted repetitive DNA element in the chromosome of these strains.

M. bovis and BCG had a simpler structure of two and three, respectively Main gangs on. These organisms could therefore be easily affected by M. tuberculosis and be differentiated among themselves.

The following species of mycobacteria (one strain each, if not otherwise stated) did not hybridize with probe 5: M. paratuberculosis, M. intracellulare, M. scrofulaceum, M. phlei, M. fortuitum (three strains), M. kansasii, M. avium, M. malnioense, M. flavescens, M. gordonae and M. chelonei (two strains).

probe 5 was therefore specific to the M. tuberculosis complex and was also able to intervene M. tuberculosis, M. bovis and BCG and between the strains of M. tuberculosis to distinguish.

Fragment 5A on the Southern blot hybridizes strongly and specifically with DNA from M. tuberculosis H ₃₇ Rv and H ₃₇ Ra and M. bovis BCG, resulting in identical bands of 2.1 and 0.65 kpb each, although not necessarily arise at every strain of M. tuberculosis bands of this size.

COMMERCIAL APPLICABILITY

One Part or all of the sequences that have been identified and parts the or the entire probe 5 may be used as gene probes become. In particular, you can all or part of the sequences representing the insertion element in Figs. 5C and 5B were identified as being used as gene probes. If such Probes in hybridization studies on cleaved genomic DNA used from bacterial samples of the M. tuberculosis complex become characteristic band patterns are generated, and therefore Such probes are diagnostic or epidemiological instruments useful. Not only different species, but also different strains within one Species produce characteristic band patterns. This is special useful for to Distinction of M. bovis and M. bovis BCG from other species, and also M. bovis of M. bovis BCG. Probe 5A could be considered a generic probe for the detection of all components of the M. tuberculosis complex be used.

• a) Das Insertionselement wurde nur in Bestandteilen des M.-tuberculosis-Komplexes (M. tuberculosis, M. bovis, M. africanum und M. microti) und weder in nicht-pathogenen, umgebenden Mycobakterien noch in M. leprae gefunden.
• b) Unter Verwendung von Southern-Blot-Analyse mit Sonde 5 (oder einem Teil des Insertionselements in 5) als eine Sonde wird bei jedem getesteten M.-tuberculosis-Isolat (22 bis heute) eine andere Bandenstruktur sichtbar. Dies könnte ein äußerst effizientes Instrument für epidemiologische Studien zur Erforschung von Tuberkulose-Übertragung sein.
• c) Sie ist eine der ersten Sonden, die Unterschiede zwischen M. tuberculosis und M. bovis und, was möglicherweise noch wichtiger ist, zwischen M. bovis und M. bovis BCG aufzeigt.
• d) Die Verwendung des Insertionselements als eine Sonde zur Unterscheidung von M. bovis BCG von M. bovis und M. tuberculosis ist bei Patienten mit verbreiteter BCG-Infektion nach einer Impfung oder Schwächung des Immunsystems nützlich.
• e) Insertionselemente (durch zwei Insertionselemente flankiert) sind nützliche genetische Instrumente zur Charakterisierung unbekannter Gene.

The utility of probe 5 or a fragment thereof as a diagnostic tool is largely due to the following properties.

• a) The insertion element was found only in components of the M. tuberculosis complex (M. tuberculosis, M. bovis, M. africanum and M. microti) and neither in non-pathogenic, surrounding mycobacteria nor in M. leprae.
• b) Using Southern blot analysis with probe 5 (or part of the insertion element in Figure 5) as a probe, a different band structure is seen in each M. tuberculosis isolate tested (22 to date). This could be a very efficient tool for epidemiological studies on tuberculosis transmission research.
• c) It is one of the first probes to show differences between M. tuberculosis and M. bovis and, perhaps more importantly, between M. bovis and M. bovis BCG.
• d) The use of the insertion element as a probe to distinguish M. bovis BCG from M. bovis and M. tuberculosis is useful in patients with widespread BCG infection following vaccination or weakening of the immune system.
• e) Insertion elements (flanked by two insertion elements) are useful genetic tools for the characterization of unknown genes.

Consequently The inventors herein provide numerous possibilities for distinction bacterial constituents of the M. tuberculosis complex with each other as well as other bacteria that do not belong to the complex, and to characterize this ready.

For example, DNA from a bacterial sample can be digested with a particular restriction enzyme and hybridization analysis performed (according to conventional methods) using as a probe a fragment of the DNA disclosed herein, which fragment does not contain the restriction site required for cleavage the sample DNA is used. For example, a BamHI-> Xho I fragment (or portion thereof) of probe 5 / 5C (see 1 and bases 420 to 810 of 2 ), which is located within the insertion element and does not contain any PvuII sites, is used to probe for PvuII digestion of M. bovis BCG DNA. After this step, strong hybridization to a single band was observed, indicating that in the M. bovis BCG strain tested, the insertion element is present as a single copy.

Of the Using a probe containing the restriction site, the used to cleave the sample DNA results in multiple band hybridization, which also occurs when the sample DNA has multiple copies, e.g. of Insertion element, as is the case for most components M. tuberculosis complex seems to be the case. Nevertheless, the Banding hybridization structures can be used to differentiate between different strains Species and between different species of the M. tuberculosis complex to distinguish. A generic probe for the detection of all components The M. tuberculosis complex does not need DNA from the insertion sequence could contain however exclusively derived from the flanking DNA, such as the PvuII-EcoRI fragment 5A, as previously explained.

The Existence of an insertion sequence in M. tuberculosis that is so close with the characterized IS elements of the Enterobacteriaceae is significant in many aspects. The detected, multiple restriction fragment length polymorphisms (Z. F. Zainuddin & J.W. Dale, Journal of General Microbiology 135, 2347-2355 (1989)) There are numerous copies of IS986 in different places are inserted in different isolates of M. tuberculosis. In this aspect, it differs from others, most recently described Mycobacterial Repetitive Elements (J.E. Clark-Curtiss & G. P. Walsh, Journal of Bacteriology 171, 4844-4851 (1989); J.E. Clark-Curtiss & M.A. Docherty, Journal of Infectious Diseases 159, 7-15 (1989); and E.P. Green, M.L.V. Tizard, M.T. Moss, J. Thompson, D.J. Winterbourne, J.J. McFadden & J. Hermon-Taylor, Nucleic Acids Research 17, 9063-9072 (1989)), the identical Southern blot structures with different isolates result. This leaves conclude that IS986 a functional, transposable element in mycobacteria is the significant value for Transposon mutagenesis of mycobacterial species could have. The Transponibilität of IS986 may be due to ribosomal frame shift in the overlap between ORFa and ORFb are regulated as demonstrated for IS1 (Y. Sekine & E. Ohtsubo, Proceedings of the National Academy of Sciences USA 86, 4609-4613 (1989)).

The Presence of IS986 in clinically isolated strains of M. tuberculosis numerous sources (Z.F. Zainuddin & J.W. Dale, Journal of General Microbiology 135, 2347-2355 (1989)) and the relationship with the IS elements of E. coli and Sh. sonnei suggest the possibility of genetic To transfer material under M. tuberculosis strains as well to get this from gram-negative bacteria. It was on it Z. Zainuddin & J.W. Dale, Tubercle 71, in press (1990)) that at least some clinical strains of M. tuberculosis carry plasmids in themselves and that this one Play a role in the dissemination of such elements; the Ability of some E. coli plasmids to multiply into mycobacteria (Z. Zainuddin, Z. Kunze & J.W. Dale, Molecular Microbiology, 29-34 (1989)), may include insertion sequences possibly the ability conferred by E. coli on M. tuberculosis. However, this compound has not yet been definitively proven in M. tuberculosis and the organism usually has a single existence, apart from random Meeting other organisms, e.g. in the gut. Therefore, the transfer would of plasmids carrying insertion sequences to be a rare event. The composition of the IS element with high G + C content indicates that its uptake by M. tuberculosis is not a newly occurring event. These questions could be answered by a Investigation of the behavior of this insertion sequence in laboratory strains and clinical isolates are answered.

IS986 occurs in all species of the M. tuberculosis complex, though the copy number varies, and it is different in mycobacterial Species not found (Z.F. Zainuddin & J.W. Dale, Journal of General Microbiology 135, 2347-2355 (1989)). Therefore, probes based on IS986 are pathogenic Mycobacteria highly specific. In conjunction with the use of the Polymerase chain reaction (PCR) makes this an exceptionally sensitive System for the detection and specification of M. tuberculosis in clinical Patterns ready. The extensive polymorphism of this probe M. tuberculosis isolates tested (Z. F. Zainuddin & J.W. Dale, Journal of General Microbiology 135, 2347-2355 (1989)) allows the Carrying out extremely precise epidemiological Examinations by fingerprinting of clinical isolates. With In this system, all but the most closely related, Isolates different structures of hybridizing restriction fragments, and that makes it possible be the distribution of different strains of M. tuberculosis within to locate a community.

Probe 12

"Probe 12" is an approximately 25.2 kb EcoRI fragment from M. tuberculosis NCTC 7416 H ₃₇ Rv obtained by screening a library of Eco RI digested H ₃₇ Rv under stringent conditions with H ₃₇ Rv DNA and isolating a strongly hybridizing clones was obtained.

The 25.2 kb EcoRI fragment is transformed by PvuII into fragments of about 8.9 kb, 3.8 kb, 3.5 kb, 3.0 kb (fragment 12J), 1.8 kb (fragment 12B), 1.6 kb, 1.4 kb and 1.2 kb (fragment 12A) digested. The 1.2 kb 12A fragment is M. tuberculosis complex-specific and not related to probes 5 or 9. 15 Figure 12 shows the arrangement of the 12J and 12B fragments relative to probe 5. The DNA flanking the insertion sequence is shown by a wavy line since it is not identical to the flanking DNA in probe 5, due to the fact that the insertion element inserted at numerous sites of the genome. The flanking DNA of probe 12J hybridizes with many different species of mycobacteria. Fragment 12J could be valuable as a diagnostic probe for the detection of a variety of mycobacteria.

Probe 8

This describes an Eco RV fragment of about 16.1 kb isolated by hybridization screening of an Eco RV library of H ₃₇ Rv.

Becomes as a probe on Southern blot with M. tuberculosis DNA used, it binds to numerous fragments. When PvuII digestion brings they are fragments of a size of about 5.6 kb, 4.8 kb, 2.1 kb, 2.0 kb, 0.9 kb and 0.7 kb. it seems not related to probes 5 and 12.

Claims (13)

Nucleotide probe for diagnosis and / or epidemiological Examination of mycobacterial infection with genomic Mycobacterium tuberculosis DNA hybridized by screening a genomic Mycobacterium tuberculosis library with DNA of a plasmid pUS300 of Mycobacterium fortuitum, wherein the nucleotide probe is capable of hybridization testing, bacterial components of the Mycobacterium complex either from each other or from other non-complex bacteria distinguish and characterize, and wherein the probe a other than the plasmid. Nucleotide probe for diagnosis and / or epidemiological Examination of mycobacterial infection with genomic DNA of Mycobacterium tuberculosis and with a plasmid pUS300 of Mycobacterium fortuitum hybridizes, the nucleotide probe in the Hybridization test capable is bacterial components of the Mycobacterium complex either from each other or from other non-complex bacteria distinguish and characterize, and wherein the probe a other than the plasmid. A nucleotide probe according to claim 1, wherein the probe is a Nucleotide sequence comprising a part of the available by screening Includes DNA, and those with a repetitive insertion element in the Chromosome of Mycobacterium tuberculosis strains hybridized. A nucleotide probe according to claim 1, wherein the genomic Library of Mycobacterium tuberculosis strain 50410 is obtained. A nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection which comprises or hybridizes to part or all of the flanking sequence of nucleotides which occur in the genome of Mycobacterium tuberculosis strain 50410 adjacent to an insertion element nucleotide sequence upstream of the 5 ' End of base 896 in 2 the drawings occurs. A nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection which comprises or hybridizes to part or all of the flanking sequence of nucleotides downstream from the 3'-end of the 896 base 2 the drawings occurs. A nucleotide probe for the diagnosis and / or epidemiological study of mycobacterial infection which comprises or hybridizes with part or all of a nucleotide sequence of approximately 1.9 kb in the genome of Mycobacterium tuberculosis strain 50410 immediately downstream of the 3 'end the in 2 the nucleotide sequence shown in the drawings. Nucleotide probe according to one of claims 1 to 5, between Mycobacterium tuberculosis, Mycobacterium bovis and BCG can differ. Nucleotide probe according to one of claims 1 to 5, between different tribes or isolates of Mycobacterium tuberculosis. Nucleotide probe according to one of claims 1 to 5, which does not substantially hybridize to nucleic acids of Mycobacterium paratuberculosis, Mycobacterium intracellulare, Mycobacterium phlei, Mycobacterium fortuitum and Mycobacterium malmoen se shows. Set comprising a nucleotide probe according to any one of claims 1 to 10 includes. Method for detecting, distinguishing and / or Characterize mycobacteria in clinical samples for the purpose epidemiological study, wel ches the use of a nucleotide probe according to one of the claims 1 to 5. Method to bacterial components of Mycobacterium tuberculosis complex either from each other or from other bacteria that are not part of the complex belong, to distinguish and characterize, comprising: the digestion DNA from a bacterial sample with a particular restriction enzyme; and the implementation hybridization analysis using a nucleotide probe according to one of the claims 1 to 5.