DE60120634T2 - A method of producing a recombinant yeast S. cerevisiae by the use of essential and regulatory genes of mycobacteria - Google Patents

A method of producing a recombinant yeast S. cerevisiae by the use of essential and regulatory genes of mycobacteria Download PDF

Info

Publication number
DE60120634T2
DE60120634T2 DE2001620634 DE60120634T DE60120634T2 DE 60120634 T2 DE60120634 T2 DE 60120634T2 DE 2001620634 DE2001620634 DE 2001620634 DE 60120634 T DE60120634 T DE 60120634T DE 60120634 T2 DE60120634 T2 DE 60120634T2
Authority
DE
Germany
Prior art keywords
mycobacterium
whib
genes
gene
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Lifetime
Application number
DE2001620634
Other languages
German (de)
Other versions
DE60120634D1 (en
Inventor
Vishal Soni
Lakshami Pathi Khandrika
Pushpa Agrawal
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Council of Scientific and Industrial Research CSIR
Original Assignee
Council of Scientific and Industrial Research CSIR
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Council of Scientific and Industrial Research CSIR filed Critical Council of Scientific and Industrial Research CSIR
Priority claimed from EP01302991A external-priority patent/EP1245683B1/en
Publication of DE60120634D1 publication Critical patent/DE60120634D1/en
Application granted granted Critical
Publication of DE60120634T2 publication Critical patent/DE60120634T2/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Description

GEBIET DER ERFINDUNGAREA OF INVENTION

Die vorliegende Erfindung betrifft ein Verfahren zum Herstellen einer rekombinanten S. cerevisiae. Es kann in einem Reportergen-basierenden Arzneimittelscreeningsystem gegen Tuberkulose durch Verwendung essentieller regulatorischer Gene von Mycobacterium tuberculosis H37Rv als Ziel verwendet werden. Eine solche Verwendung ist nicht Teil der Erfindung. Solche regulatorischen Gene sind die whiB-Gene von Mykobakterien, deren Funktionen für das Überleben und das normale Wachstum von Mykobakterien essentiell sind.The The present invention relates to a method for producing a recombinant S. cerevisiae. It can be in a reporter gene-based Drug screening system for tuberculosis by using more essential regulatory genes of Mycobacterium tuberculosis H37Rv as target be used. Such use is not part of the invention. Such regulatory genes are the whiB genes of mycobacteria, their functions for the survival and the normal growth of mycobacteria are essential.

HINTERGRUND DER ERFINDUNGBACKGROUND THE INVENTION

Die Streptomyceten sind dimorphe Organismen. Nach Erreichen der späten Log-Phase des Wachstums differenzieren sich die Substratmyzelien in die Luftmyzelien. Die Spitze des Luftmyzeliums differenziert sich dann in eine Kette von Sporen. Jede Spore stellt eine einzelne Zelle dar und ist durch ein Septum abgetrennt. 1992 berichteten Davis und Chater (Davis, N. K. und Chater, K. F., 1992, Mol. Gen. Genet. 232: 352–358), dass jegliche Mutation in dem whiB-Gen von Streptomyces coelicolor A3(2) zu einem nicht sporulierenden Organismus führt. Die Farbe dieser Mutanten war auch weiß, weil sie die Fähigkeit verloren hatten, ein tief rötlichblaues Pigment zu erzeugen, das ein Merkmal des Wildtypstamms von Streptomyces coelicolor A3(2) ist. Es wurde weiterhin bestätigt, dass ein vollständig funktionales whiB-Gen essentiell für die Sporulation des Streptomyces coelicolor A3(2) ist und das whiB-Gen ein Transkriptionsaktivator sein kann. Ein whiB-Homolog wurde auch von Streptoverticillium sps, Streptomyces aurofaciens und Rhodococcus opacus berichtet (Kormanec und Homerova, 1993 Nucl. Acid Res. 21: 2512; Seibert, V., Kourbatova, E. M., Golovvela, L. M. und M. Schlomann, 1998, 180: 3503–3508; Soliveri, J. E., Vijgenboom, E., Granozzi, C., Plaskitt, K. A. und K. F. Chater, 1993, J. Gen. Microbiol. 139: 2569–2578). Die Genomsequenz von Mycobacterium tuberculosis H37Rv zeigte jedoch unerwartet die Anwesenheit von vier Genen, nämlich whiB1/Rv3219-254bp, whiB2/Rv3260c-269bp, whiB3/Rv3416-308bp und whiB4/Rv3681c-302bp, deren abgeleitete Aminosäureprodukte dem whiB-Gen von Steptomyces coelicolor A3(2) ähnlich waren. Die Aminosäuresequenzen von whiB-Genen von M. tuberculosis H37Rv zeigen 32–35 Prozent Homologie zu den Aminosäuresequenzen von Streptomyces whiB-Genen. Obwohl die Homologie relativ niedrig ist, bleibt die allgemeine Eigenschaft des vorhergesagten Proteins erhalten. Anders als die Spezies von Streptomyzeten, die filamentös sind, ist die allgemeine Morphologie von Mykobakterien Bazillus. Bisher ist eine Sporulation von Mykobakterien nicht berichtet worden. Daher ist die Anwesenheit von whiB-artigen Genen, die die Sporulation steuern, in einem nicht-sporulierenden Organismus sehr faszinierend. Die vorhergesagte Aminosäuresequenz des whiB-Gens deutet darauf hin, dass das whiB-Gen für einen Transkriptionsaktivator kodieren kann. Wenn dies so wäre, wären whiB-Gene ein regulatorisches Gen. Bisher wurde jedoch nicht berichtet, dass die whiB-Gene tatsächlich für einen Transkriptionsaktivator kodieren. Wenn die whiB-Gene tatsächlich ein Satz regulatorischer Gene sind, ist die Frage, welche Art von Genen sie steuern. Kürzlich haben Gomez und Bishai (Gomez, J. E. und Bishai, W. R., 2000 Proc. Natl. Acad. Sci 97: 8554–8559) gezeigt, dass ein whiB2-Homologes von Mycobacterium tuberculosis H37Rv in Mycobacterium smegmatis vorhanden und essentiell für sein Überleben ist. Mycobacterium smegmatis ist ein schnell wachsender und nicht pathogener Organismus. Es konnte jedoch kein Bericht oder Patent gefunden werden, die die in dieser Anmeldung beschriebene Erfindung betreffen.The Streptomycetes are dimorphic organisms. After reaching the late log phase of growth, the substrate mycelia differentiate into the aerial mycelia. The tip of the aerial mycelium then differentiates into a chain of spores. Each spore represents a single cell and is through a septum is severed. In 1992, Davis and Chater (Davis, N.K. and Chater, K.F., 1992, Mol. Genet. 232: 352-358) that any mutation in the whiB gene of Streptomyces coelicolor A3 (2) leads to a non-sporulating organism. The color of these mutants was also white because they have the ability had lost a deep reddish blue Producing a pigment which is a feature of the wild-type strain of Streptomyces coelicolor A3 (2). It was further confirmed that a fully functional whiB gene essential for is the sporulation of Streptomyces coelicolor A3 (2) and the whiB gene may be a transcriptional activator. A whiB homolog was also of Streptoverticillium sps, Streptomyces aurofaciens and Rhodococcus opacus reports (Kormanec and Homerova, 1993 Nucl. Acid Res. 21: 2512; Seibert, V., Kourbatova, E.M., Golovvela, L.M. and M. Schlomann, 1998, 180: 3503-3508; Soliveri, J.E., Vijgenboom, E., Granozzi, C., Plaskitt, K.A. and K.F. Chater, 1993, J. Gen. Microbiol. 139: 2569-2578). The genome sequence of Mycobacterium tuberculosis H37Rv, however, unexpectedly showed the presence of four genes, viz whiB1 / Rv3219-254bp, whiB2 / Rv3260c-269bp, whiB3 / Rv3416-308bp and whiB4 / Rv3681c-302bp, whose deduced amino acid products belong to the whiB gene of Steptomyces coelicolor A3 (2) similar were. The amino acid sequences of whiB genes from M. tuberculosis H37Rv show 32-35 percent Homology to the amino acid sequences of Streptomyces whiB genes. Although homology is relatively low, the general property of the predicted protein is retained. Unlike the species of streptomycetes that are filamentous, is the general morphology of mycobacteria bacillus. So far Sporulation of mycobacteria has not been reported. Therefore is the presence of whiB-like genes that cause sporulation control, very intriguing in a non-sporulating organism. The predicted amino acid sequence of the whiB gene indicates that the whiB gene is responsible for a Transcriptional activator can encode. If so, whiB genes would be a regulatory gene. So far, however, it has not been reported that the whiB genes actually for one Code transcriptional activator. When the whiB genes are actually a Set of regulatory genes are, the question is what kind of genes they control. Recently Gomez and Bishai (Gomez, J.E. and Bishai, W.R., 2000 Proc. Natl. Acad. Sci 97: 8554-8559) demonstrated that a whiB2 homologue of Mycobacterium tuberculosis H37Rv in Mycobacterium smegmatis available and essential for his survival is. Mycobacterium smegmatis is a fast growing and not pathogenic organism. However, there could be no report or patent found that the invention described in this application affect.

Das vorliegende Patent beschreibt, dass aus den vier whiB-Genen, die ursprünglich in der Genomsequenz von Mycobacterium tuberculosis H37Rv beschrieben wurden, das whiBI/Rv3219 essentiell für das Überleben des Mycobacterium bovis BCG ist und es scheint, dass whiB3/Rv3416 die Septumsbildung während der Zellteilung steuert. Über die Eigenschaften dieser Gene wurde in der Genomsequenz von Mycobacterium tuberculosis H37Rv nicht berichtet, noch wurden sie in der Literatur veröffentlicht (Cole et al. Nature 1998 393: 537–544).The This patent describes that out of the four whiB genes, the originally in the genomic sequence of Mycobacterium tuberculosis H37Rv whiBI / Rv3219 were essential for the survival of Mycobacterium bovis BCG is and it seems that whiB3 / Rv3416 septate while the cell division controls. about the properties of these genes was in the genomic sequence of Mycobacterium tuberculosis H37Rv not reported, nor were they in the literature released (Cole et al, Nature 1998 393: 537-544).

Tuberkulose ist immer noch eine der Hauptursachen des Verlusts von Menschenleben in Indien und den meisten Entwicklungsländern. Die Verbreitung von HIV hat die Probleme von Tuberkulose verschlimmert, weil gefunden wurde, dass mehrere Spezies von Mykobakterien, von denen ansonsten bekannt war, dass sie Menschen nicht infizieren, mit den HIV-infizierten Patienten assoziiert sind. Diese neuen Pathogene sind sehr oft unempfindlich gegen die herkömmliche Tuberkulosetherapie. Weiterhin nimmt das Auftreten von Tuberkulose, die durch medikamentenresistente Mykobakterien verursacht wird, auch mit einer alarmierenden Rate zu. Diese resistenten Bakterien sprechen nicht auf herkömmliche Therapie an. Es besteht daher ein Bedarf, entweder neue Medikamente zu finden oder zuerst neue Medikamentenziele zu finden, die noch nicht die Fähigkeit entwickelt haben, sich zu modifi zieren, und dann nach einem Medikament zu suchen, das ein bestimmten Ziel angreifen würde.tuberculosis is still one of the main causes of loss of life in India and most developing countries. The spread of HIV has made the problems of tuberculosis worse because found was that several species of mycobacteria, of which otherwise It was known that they did not infect people with HIV-infected people Patients are associated. These new pathogens are very often insensitive against the conventional ones Tuberculosis therapy. Furthermore, the occurrence of tuberculosis, which is caused by drug-resistant mycobacteria, too at an alarming rate too. These resistant bacteria do not speak traditional Therapy. There is therefore a need, either new drugs to find or to first find new drug targets that still not the ability have developed to modify themselves, and then for a drug to seek that would attack a particular target.

Die Suche nach einem neuen Medikament ohne bestimmtes Ziel führt üblicherweise zur Wiederentdeckung von bekannten Medikamenten. Zweitens ist die Wirkungsweise des durch zufällige Suche entdeckten neuen Medikaments üblicherweise nicht bekannt, so dass das Studium der Pharmakokinetik ein mühsamer Prozess sein kann. Wenn der Organismus auch gegen das neue Arzneimittel Resistenz entwickelt, wäre darüber hinaus die Modifikation dieser Medikamente, die zu dem Ziel des resistenten Organismus passen würden, sehr schwierig. Mit dem Fortschritt in Computersimulationsstudien und Modelliersoftware ist es möglich, ein Medikament zu entwerfen, wenn das Ziel bekannt ist.The Finding a new drug without a specific goal usually results for the rediscovery of known drugs. Second, that is Effect of by accidental Search discovered new drug usually not known so the study of pharmacokinetics can be a tedious process. If the organism also developed resistance to the new drug, would be beyond the modification of these drugs leading to the goal of resistant Organism would fit, very much difficult. With the progress in computer simulation studies and Modeling software it is possible to design a drug if the target is known.

Die vorliegende Erfindung betrifft ein Verfahren zum Herstellen von rekombinanter S. cerevisiae. Die DNA-bindende Eigenschaft der whiB-Gene von Mycobacterium tuberculosis H37Rv wurde in dieser Erfindung zum ersten Mal gezeigt. Das hierin beschriebene Verfahren basiert auf der Aktivierung des Reportergens lacZ, das das Enzym β-Galaktosidase produziert. Unter normalen Umständen bleibt die β-Galaktosidaseaktivität unterdrückt, weil sich die whiB-Gene, die für ein DNA-bindendes Protein kodieren, an die lexA-Operatoren binden können, die in bestimmten Stämmen von Saccharomyces cerevisiae sowie auch in Reporterplasmiden vorhanden sind. Das Binden der whiB-Genprodukte mit der Sequenz des Operators führt zur Unterdrückung der Transkription des lacZ-Gens, das β-Galaktosidaseenzym produziert. Wenn sich ein Medikament jedoch an die whiB-Gene bindet, sind seine Produkte nicht für das Binden an die Operatoren verfügbar, und die lacZ-Transkription setzt sich fort. Aktivierung oder Unterdrückung von β-Galaktosidase kann entweder durch Zugabe von 5-Brom-4-Chlor-3-indolyl β-D-Galaktopyranosid (X-gal), das eine blaue Farbe erzeugt, oder durch Zugabe von o-Nitrophenol β-D-Galaktopyranosid (ONPG), das in Anwesenheit von β-Galaktosidase eine gelbe Farbe erzeugt, in das Wachstumsmedium überwacht werden. Die Intensität der Farberzeugung ist direkt mit der Aktivierung von β-Galaktosidaseenzym verknüpft und wäre daher direkt mit der Bindungsfähigkeit eines Medikaments verknüpft. Mit anderen Worten erlaubt ein starker Binder an das Ziel eine starke Aktivierung von β-Galaktosidase; ein schlechter Binder an das Ziel würde jedoch eine niedrige Aktivierung von β-Galaktosidaseenzym zulassen. Das beschriebene Verfahren ist mit jedem automatisierten Screeningsystem mit hohem Durchsatz oder jedem anderen automatisierten oder nicht-automatisierten Screeningsystem vollständig kompatibel.The The present invention relates to a method for producing recombinant S. cerevisiae. The DNA-binding property of the whiB genes of Mycobacterium tuberculosis H37Rv was used in this invention for first shown. The method described herein is based on the activation of the reporter gene lacZ, which is the enzyme β-galactosidase produced. Under normal circumstances the β-galactosidase activity remains suppressed because the whiB genes responsible for encode a DNA-binding protein to which lexA operators can bind in certain tribes of Saccharomyces cerevisiae as well as in reporter plasmids are. The binding of the whiB gene products with the sequence of the operator leads to suppression transcription of the lacZ gene producing β-galactosidase enzyme. However, when a drug binds to the whiB genes, its Products not for binding to the operators available, and lacZ transcription continues. Activation or suppression of β-galactosidase can either by addition of 5-bromo-4-chloro-3-indolyl β-D-galactopyranoside (X-gal), which produces a blue color or by the addition of o-nitrophenol β-D-galactopyranoside (ONPG), which in the presence of β-galactosidase produces a yellow color, monitored in the growth medium become. The intensity the color production is directly linked to the activation of β-galactosidase enzyme connected and would be therefore directly with the binding ability linked to a drug. In other words, a strong binder on the target allows a strong Activation of β-galactosidase; one bad binder to the target would however, allow low activation of β-galactosidase enzyme. The procedure described is with any automated screening system high throughput or any other automated or non-automated screening system Completely compatible.

Die vorliegende Erfindung basiert daher auf der Notwendigkeit, ein neues Medikamentenziel in Mycobacterium tuberculosis H37Rv zu finden und basierend auf dem identifizierten Ziel ein Medikamenten-Screeningsystem zu entwickeln. Um der sich schnell entwickelnden Technologie und der dringenden Notwendigkeit, ein besseres Heilmittel zu finden, gerecht zu werden, wird gewünscht, dass das hier beschriebene Screeningsystem mit jedem automatisierten Screening mit hohem Durchsatz oder jedem anderen mechanisierten Screeningverfahren kompatibel ist.The The present invention is therefore based on the need for a new one To find drug target in Mycobacterium tuberculosis H37Rv and Based on the identified goal, a drug screening system to develop. To meet the rapidly evolving technology and the urgent need to find a better remedy to be fair is desired that the screening system described here with every automated High throughput screening or any other mechanized Screening method is compatible.

AUFGABEN DER ERFINDUNGTASKS OF INVENTION

Es ist das Ziel der vorliegenden Erfindung, ein Verfahren zum Herstellen einer rekombinanten S. cerevisiae bereitzustellen, das das zielspezifische Screening von Antituberkulosemedikamtenten erleichtert.It the object of the present invention is a method of manufacturing to provide a recombinant S. cerevisiae which is the target specific Screening of antituberkulosemedikamtenten easier.

Es ist auch die Entwicklung eines Medikamentenscreeningsystems beschrieben, das schnell ist und die Eigenschaften des Zielgens verwendet.It also describes the development of a drug screening system that is fast and uses the properties of the target gene.

ZUSAMMENFASSUNG DER ERFINDUNGSUMMARY THE INVENTION

Die vorliegenden Erfindung betrifft ein Verfahren zum Herstellen einer rekombinanten S. cerevisiae durch Transformation mit den whiB-Genen von Mykobakterien, die die Sequenzen Seq. ID Nr. 1, 3, 5 und 7 aufweisen. Weiterhin ist ein Medikamtentenscreeningverfahren beschrieben, dass Vorteil aus dem in der Literatur bekannten Hefe-Zweihybridsystem zieht. Das Patent beschreibt auch, dass die whiB-Gene essentielle regulatorische Gene von Mycobacterium tuberculosis H37Rv sind und es scheint, dass sie unter den pathogenen und langsam wachsenden Mykobakterien konserviert werden. Daher ist es das Neue an dem beschriebenen Verfahren, die whiB-Gene, die regulatorische Gene von Mykobakterien sind, über deren Funktionen bisher nicht berichtet wurde, durch Verwendung der Hefe Saccharomyces cerevisiae als Ersatzwirt als Medikamentenziel zu benutzen.The The present invention relates to a method for producing a recombinant S. cerevisiae by transformation with the whiB genes of mycobacteria containing the sequences Seq. ID Nos. 1, 3, 5 and 7 have. Furthermore, a medicament screening method is described that Advantage from the yeast two-hybrid system known in the literature draws. The patent also describes that the whiB genes are essential regulatory Genes of Mycobacterium tuberculosis H37Rv are and it seems that they are conserved among the pathogenic and slow-growing mycobacteria become. Therefore, it is the novelty of the described method that whiB genes, which are regulatory genes of mycobacteria, via their Features not previously reported, by using the yeast Saccharomyces cerevisiae as a replacement host as a drug target to use.

DETAILLIERTE BESCHREIBUNG DER ERFINDUNGDETAILED DESCRIPTION OF THE INVENTION

Um das vorgenannte Ziel zu erreichen, ist es wesentlich zu zeigen, dass ein funktionales Zielgen essentiell für das Überleben des Mycobacterium tuberculosis H37Rv ist. Es wurde gefunden, dass das Sporulationsgenhomologe von Streptomyces coelicolor A3(2) in Mycobacterium tuberculosis H37Rv vorhanden ist. Da nicht bekannt ist, dass Mykobakterien sporulieren, wurde angenommen, dass diese Sporulationshomologe eine bisher unbekannte, aber wichtige Funktion haben. Es wurde angenommen, dass die whiB-Gene als Transkriptionsaktivator agieren können und daher eine regulatorische Funktion haben. Es wird weiter angenommen, dass ein regulatorisches Gen, das die Sporulation steuert, aber trotzdem in einem nicht-sporulierenden Organismus vorhanden ist, tatsächlich ein essentielles Gen sein kann.To achieve the above goal, it is essential to demonstrate that a functional target gene is essential for the survival of Mycobacterium tuberculosis H37Rv. It has been found that the sporulation gene homologue of Streptomyces coelicolor A3 (2) is present in Mycobacterium tuberculosis H37Rv. Since it is not known that mycobacteria sporulate, it was assumed that these sporulation homologues have a previously unknown but important function. It was assumed that the whiB genes can act as transcriptional activators and therefore have a regulatory function. It is further believed that a regulatory gene that controls sporulation but is nevertheless present in a non-sporulating organism may indeed be an essential gene.

Das in diesem Patent beschriebene Medikamentenscreeningverfahren zieht Vorteil aus dem in der Literatur bekannten Hefe-Zweihybridsystem. Das Patent beschreibt auch, dass die whiB-Gene essentielle regulatorische Gene von Mycobacterium tuberculosis H37Rv sind und es scheint, dass sie unter den pathogenen und langsam wachsenden Mykobakterien konserviert werden. Daher ist das Neue an dem beschriebenen Verfahren, die whiB-Gene, die regulatorische Gene von Mykobakterien sind, über deren Funktionen bisher nicht berichtet wurde, durch Verwendung der Hefe Saccharomyces cerevisiae als Ersatzwirt als Medikamentenziel zu benutzen.The drug screening process described in this patent Advantage from the yeast two-hybrid system known in the literature. The patent also describes that the whiB genes are essential regulatory genes of Mycobacterium tuberculosis H37Rv are and it seems they are conserved among the pathogenic and slow-growing mycobacteria become. Therefore, the novelty of the described method, the whiB genes, the regulatory genes of mycobacteria are, beyond their functions so far was not reported by using the yeast Saccharomyces cerevisiae as a substitute host to use as a drug target.

Mycobacterium tuberculosis H37Rv ist ein langsam wachsender Organismus und ist sehr ansteckend. Daher stellt die Verwendung von lebenden Organismen eine schwere Gesundheitsgefährdung dar. Es war deshalb wichtig, ein Screeningsystem in einem anderen Wirtsorganismus zu entwickeln, der nicht pathogen und schnell wachsend ist, und außerdem ein Verfahren bereitzustellen, das an ein Screening mit hohem Durchsatz oder andere automatisierte Screeningsysteme angepasst werden kann.Mycobacterium tuberculosis H37Rv is a slow growing organism and is very contagious. Therefore, the use of living organisms a serious health hazard It was therefore important to have one screening system in another To develop a host organism that is non-pathogenic and fast-growing is, and besides to provide a method of high throughput screening or other automated screening systems can be customized.

Entsprechend wird ein Reportergen-basierendes Verfahren für das Screening von Antituberkulosemedikamenten beschrieben, das die Verwendung von whiB-artigen Genen (whiB1, whiB2, whiB3, whiB4), die in Mycobacterium tuberculosis H37Rv, Mycobacterium bovis BCG und Mycobacterium leprae vorhanden sind, die eine DNA- und Proteinsequenz wie in Sequenz ID 1 bis 4 gezeigt aufweisen, als Medikamentenziel für das Screening und Antituberkulose- und Antilepramedikamente umfasst.Corresponding becomes a reporter gene-based method for the screening of antituberculosis drugs described the use of whiB-like genes (whiB1, whiB2, whiB3, whiB4) present in Mycobacterium tuberculosis H37Rv, Mycobacterium bovis BCG and Mycobacterium leprae are present, which is a DNA and protein sequence as shown in Sequence ID 1 to 4, as a drug target for screening and antituberculosis and anti-lex drugs.

Das whiB3-Gen von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG kann zum Screening von Antituberkulosemedikamenten verwendet werden. Die Anwesenheit des funktionalen whiB4-Gens von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG ist wichtig für ihr normales Wachstum. Das whiB4-Gen von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG kodieren für ein DNA-bindendes Protein. Die Medikamente gegen whiB2 und die whiB4-Gene von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG sind dort besonders nützlich, wo sich Medikamentenresistenz gegen die whiB1- und whiB3-Gene entwickelt hat oder wo die Anti-whiB1- und Anti-whiB3-Medikamente allergen oder toxisch sind. Die Quelle von whiB-artigen Genen können Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis und Mycobacterium xenopi und verwandte Organismen sein.The whiB3 gene from Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG can be used to screen antituberculosis drugs become. The presence of the functional whiB4 gene of Mycobacterium Tuberculosis H37Rv and Mycobacterium bovis BCG is important for their normal Growth. The whiB4 gene of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG encode a DNA-binding protein. The drugs against whiB2 and the whiB4 genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG are particularly useful there, where drug resistance develops against the whiB1 and whiB3 genes has or where the anti whiB1 and anti-whiB3 drugs are allergenic or toxic. The source from whiB-like ones Genes can Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis and Mycobacterium xenopi and related organisms.

Die vorliegende Erfindung betrifft ein Verfahren zur Herstellung einer rekombinanten Saccharomyces cerevisiae, wobei das Verfahren die folgenden Schritte umfasst:

  • a) Amplifizieren der whiB-artigen Gene von Mycobacteria durch die Polymerase-Kettenreaktion (polymerase chain reaction, PCR), wobei die whiB-artigen Gene aus der Gruppe ausgewählt sind, die aus whiB1 (SEQ ID NR: 1), whiB2 (SEQ ID NR: 3), whiB3 (SEC ID NR: 5) und whiB4 (SEQ ID NR: 7) besteht, und die Mykobakterien aus der Gruppe ausgewählt sind, die aus Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis und Mycobacterium xenopi besteht, und wobei die whiB-Gene mit Primern amplifiziert werden, die an ihrem 5'-Ende entweder EcoRI- oder BamHI-Restriktionsenzymstellen und an dem 3'-Ende eine XhoI-Restriktionsenzymstelle tragen;
  • b) Verdauen des in Schritt a) erhaltenen Fragments mit geeigneten Restriktionsenzymen und anschließendes Klonieren des Fragments in einen E. coli/ Saccharomyces cerevisiae-Shuttlevektor pEG202, um das klonierte Gen als ein LexA-Fusionsprotein herzustellen und den Klon in E. coli zu transformieren; und
  • c) Amplifizieren des Klons und anschließendes Transformieren der rekombinanten whiB1, whiB2, whiB3 und whiB4/pEG202 in einen Stamm Saccharomyces cerevisiae, der LexA-Operatoren aufweist.
The present invention relates to a method for producing a recombinant Saccharomyces cerevisiae, the method comprising the following steps:
  • a) amplifying the whiB-like genes of Mycobacteria by the polymerase chain reaction (PCR), wherein the whiB-like genes are selected from the group consisting of whiB1 (SEQ ID NO: 1), whiB2 (SEQ ID NR: 3), whiB3 (SEC ID NO: 5) and whiB4 (SEQ ID NO: 7), and the mycobacteria are selected from the group consisting of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis and Mycobacterium xenopi, and wherein the whiB genes are amplified with primers which at their 5 'end either EcoRI or BamHI restriction enzyme sites and at the 3 'end carry an XhoI restriction enzyme site;
  • b) digesting the fragment obtained in step a) with appropriate restriction enzymes and then cloning the fragment into an E. coli / Saccharomyces cerevisiae shuttle vector pEG202 to produce the cloned gene as a LexA fusion protein and to transform the clone into E. coli; and
  • c) amplifying the clone and then transforming the recombinant whiB1, whiB2, whiB3 and whiB4 / pEG202 into a Saccharomyces cerevisiae strain having LexA operators.

Weiterhin ist ein auf einem Reportergen basierendes Verfahren zum Screening von Antituberkoulosemedikamenten durch Verwendung essentieller und regulatorischer Gene von Mykobakterien als Medikamentenziel beschrieben und umfasst die folgenden Schritte:

  • (a) Amplifizieren der whiB-Gene von Mycobacterium tuberculosis H37Rv durch Polymerase-Kettenreaktion (PCR);
  • (b) Klonieren der in Schritt (a) erhaltenen Produkte in Plasmidvektoren wie z.B. pUC19 oder pBluescript SK+ oder SK– und Transformation in E. coli;
  • (c) Amplifizieren der whiB-Gene von Mycobacterium bovis BCG durch Verwendung der Oligonukleotidprimer von Mycobacterium tuberculosis H37Rv;
  • (d) Klonieren des in Schritt (c) erhaltenen Produkts in einen Plasmidvektor pUC19 oder pBluescript SK+ oder SK; und Sequenzieren der Produkte, um die Sequenz des klonierten Fragments zu bestätigen;
  • (e) Konstruieren eines integrativen Genzerstörungsvektors durch Einfügen einer Kanamycinkassette zwischen die whiB-Gensequenzen von Mycobacterium tuberculosis H37Rv;
  • (f) Konstruieren eines integrativen Genzerstörungsvektors durch Einfügen einer Kanamycinkassette zwischen die whiB-Gensequenzen von Mycobacterium bovis BCG;
  • (g) Amplifizieren der whiB-Gene von Mycobacterium tuberculosis H37Rv durch Verwendung der Oligonukleotidprimer, die am 5-Ende entweder EcoRI oder BamHI-Restriktionsenzymstellen und am 3-Ende eine XhoI-Restriktionsenzymstelle tragen;
  • (h) Verdauen des in Schritt (g) erhaltenen Fragments mit geeigneten Restriktionsenzymen und anschließendes Klonieren des Fragments in einen E. coli/Saccharomyces cerevisiae-Shuttlevektor pEG202, um das klonierte Gen als LexA-Fusionsprotein zu erzeugen, und Transformieren des rekombinanten Plasmids in E. coli;
  • (i) Herstellen einer großen Menge des gewünschten rekombinanten Plasmids und anschließendes Transformieren des rekombinanten whiB1, whiB2, whiB3 und whiB4/pEG202 in die Saccharomyces cerevisiae-Stämme EGY48 und EGY191,
  • (j) Co-transformieren der pJK101-, pSH18-34-, pSH17-4-, pJG4-5- und pRFHM-Vektoren in die Saccharomyces cerevisiae-Stämme EGY48 und EGY191, die bereits whiB-Gene im pEG202-Vektor beherbergen, und anschließendes Auswählen der Klone, die Uracil- und Histidin + Uracil- oder Histidin + Uracil + Tryptophan-Auxotrophie komplementieren;
  • (k) Züchten der Saccharomyces cerevisiae-Transformanten im Hefe-Stickstoff-Basismedium enthaltend: Galaktose/Raffinose+, ura–, BU-Salz+, X-gal+; his–, ura–, BU-Salz+, X-gal+, Glukose; Galaktose/Raffinose+, ura–, his–, leu–, Glukose+, ura–, his–, leu–; Galaktose/Raffinose+, ura–, his–, trp–, leu– und Glukose+, ura–, his–, trp–, leu–-Platten, und
  • (l) Verwendung der DNA-bindenden Eigenschaft von whiB1, whiB2 und whiB3 zum Screenen der Antituberkulosemedikamente.
Furthermore, a method based on a reporter gene for the screening of antituberculosis drugs by using essential and regulatory genes of mycobacteria as a drug target is described and comprises the following steps:
  • (a) amplifying the whiB genes of Mycobacterium tuberculosis H37Rv by polymerase chain reaction (PCR);
  • (b) cloning the products obtained in step (a) into plasmid vectors such as pUC19 or pBluescript SK + or SK - and transformation in E. coli;
  • (c) amplifying the whiB genes of Mycobacterium bovis BCG by using the oligonucleotide primers of Mycobacterium tuberculosis H37Rv;
  • (d) cloning the product obtained in step (c) into a plasmid vector pUC19 or pBluescript SK + or SK; and sequencing the products to confirm the sequence of the cloned fragment;
  • (e) constructing an integrative gene disruption vector by inserting a kanamycin cassette between the whiB gene sequences of Mycobacterium tuberculosis H37Rv;
  • (f) constructing an integrative gene disruption vector by inserting a kanamycin cassette between the whiB gene sequences of Mycobacterium bovis BCG;
  • (g) amplifying the whiB genes of Mycobacterium tuberculosis H37Rv by using the oligonucleotide primers carrying either EcoRI or BamHI restriction enzyme sites at the 5 'end and an XhoI restriction enzyme site at the 3'end;
  • (h) digesting the fragment obtained in step (g) with appropriate restriction enzymes and then cloning the fragment into an E. coli / Saccharomyces cerevisiae shuttle vector pEG202 to generate the cloned gene as a LexA fusion protein and transforming the recombinant plasmid into E coli;
  • (i) preparing a large amount of the desired recombinant plasmid and then transforming the recombinant whiB1, whiB2, whiB3 and whiB4 / pEG202 into the Saccharomyces cerevisiae strains EGY48 and EGY191,
  • (j) co-transforming the pJK101, pSH18-34, pSH17-4, pJG4-5 and pRFHM vectors into the Saccharomyces cerevisiae strains EGY48 and EGY191, which already harbor whiB genes in the pEG202 vector, and then selecting the clones that complement uracil and histidine + uracil or histidine + uracil + tryptophan auxotrophy;
  • (k) culturing the Saccharomyces cerevisiae transformants in the yeast nitrogen base medium containing: galactose / raffinose +, ura-, BU-salt +, X-gal +; his-, ura-, BU-salt +, X-gal +, glucose; Galactose / raffinose +, ura-, his-, leu-, glucose +, ura-, his-, leu-; Galactose / raffinose +, ura-, his-, trp-, leu- and glucose +, ura-, his-, trp-, leu- plates, and
  • (l) Use of the DNA-binding property of whiB1, whiB2 and whiB3 for screening the antituberculosis drugs.

In einer Ausführungsform sind die Restriktionsenzyme aus EcoRI, XmaI, BamHI, SalI, NcoI, NotI, XhoI, SalI und PstI ausgewählt.In an embodiment are the restriction enzymes from EcoRI, XmaI, BamHI, SalI, NcoI, NotI, XhoI, SalI and PstI selected.

Das whiB1-Gen ist essentiell für das Überleben von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG.The whiB1 gene is essential for the survival of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

Das whiB2-Gen ist essentiell für das normale Wachstum von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG.The whiB2 gene is essential for the normal growth of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

Das whiB3-Gen ist essentiell für die Zellteilung eines Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG.The whiB3 gene is essential for the cell division of a Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

Das whiB4-Gen ist essentiell für das normale Wachstum von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG.The whiB4 gene is essential for the normal growth of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG.

Das whiB4-Gen von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG ist ein Transkriptionsaktivator.The whiB4 gene from Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG is a transcriptional activator.

Die whiB3-, whiB2- und whiB3-Gene von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG kodieren für ein DNA-bindendes Protein.The whiB3, whiB2 and whiB3 genes from Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG encode a DNA-binding protein.

Die whiB3-, whiB2- und whiB3-Gene von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG unterdrücken die Aktivierung von β-Galaktosidasegenen nach dem Binden an den LexA-Operator oder beliebige andere ähnliche Operatoren.The whiB3, whiB2 and whiB3 genes from Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG suppress the activation of β-galactosidase genes after binding to the LexA operator or any other similar Operators.

Die DNA-bindende Domäne der whiB-Gene befindet sich in den 15 Aminosäuren am Carboxyende des Proteins.The DNA-binding domain the whiB gene is located in the 15 amino acids at the carboxy terminus of the protein.

Die DNA-bindende Eigenschaft der whiB-Gene wurde verwendet, um solche Antituberkulosemedikamente zu screenen, die die whiB-Gene angreifen. Das beschriebene Verfahren kann für ein beliebiges Gen verwendet werden, das für ein DNA-bindendes Protein kodiert. Das Verfahren ist mit jedem Hochdurchsatz- oder automatisierten Screeningsystem kompatibel.The DNA-binding property of the whiB genes has been used to screen such antituberculosis drugs that attack the whiB genes. The method described may be for any gene which codes for a DNA-binding protein. The method is compatible with any high throughput or automated screening system.

Die Genomsequenz Mycobacterium tuberculosis H37Rv wurde von der Intersetseite http://www.sanger.ac.uk erhalten, und die Sequenz der whiB-Gene wurde wiedergewonnen. Die Autoren (Cole et al., Nature, 1998: 393, 537–543) haben diese Gene als whiB1/Rv3219 (255bp), whiB2/Rv3260c (270bp), whiB3/Rv3416 (309bp) und whiB4/Rv3681c (303bp) annotiert. Die Sequenzen von Oligonukleotidprimern, die konstruiert wurden, um die whiB-Gene zu amplifizieren, waren wie folgt:
F 5 acccgttaccagccaagaag 3' und R 5' gggacggttgatgctgtag 3' für whiBB1
F 5' ggccgggtcagatgatc 3' und R 5' accgcatctgagtttgg 3' für whiBB2
F 5' atgccacagccggagcagctac 3' und R 5' ttaagctgtgcggcggatcgg 3' für whiBB3
F 5' ctatccggcggtgccggtgcg 3' und R 5' gtggtacgcagcgtagacgcg 3' für whiBB4The genome sequence Mycobacterium tuberculosis H37Rv was obtained from the Interset site http://www.sanger.ac.uk and the sequence of the whiB genes was recovered. The authors (Cole et al., Nature, 1998: 393, 537-543) have annotated these genes as whiB1 / Rv3219 (255bp), whiB2 / Rv3260c (270bp), whiB3 / Rv3416 (309bp), and whiB4 / Rv3681c (303bp) , The sequences of oligonucleotide primers designed to amplify the whiB genes were as follows:
F 5 acccgttaccagccaagaag 3 'and R 5' gggacggttgatgctgtag 3 'for whiBB1
F 5 'ggccgggtcagatgatc 3' and R 5 'accgcatctgagtttgg 3' for whiBB2
F 5 'atgccacagccggagcagctac 3' and R 5 'ttaagctgtgcggcggatcgg 3' for whiBB3
F 5 'ctatccggcggtgccggtgcg 3' and R 5 'gtggtacgcagcgtagacgcg 3' for whiBB4

Die Sequenzen der Gene sind getrennt als Sequenzen ID 1 bis 4 gezeigt.The Sequences of the genes are shown separately as sequences ID 1 to 4.

Die PCR wurde nach Standardverfahren durchgeführt. Die PCR-Produkte wurden auf 1% Agarosegel getrennt, und die amplifizierten Banden wurden durch Schneiden des Gels entfernt. Die PCR-amplifizierte DNA wurde durch Verwendung einer kommerziell erhältlichen Reinigungsausrüstung gereinigt. Klonieren und anschließende Transformation der PCR-Fragmente wurden nach Standardverfahren durchgeführt. Die Sequenz der klonierten Fragmente wurde nach Standardverfahren bestätigt.The PCR was performed according to standard procedures. The PCR products were separated on 1% agarose gel, and the amplified bands were removed by cutting the gel. The PCR amplified DNA was purified by using commercially available cleaning equipment. Cloning and subsequent Transformation of the PCR fragments were performed according to standard procedures. The Sequence of the cloned fragments was confirmed by standard methods.

Sobald die Identität der klonierten Fragmente bestätigt war, wurden die Mycobacterium tuberculosis H37Rv-Gene als Sonde verwendet, um zu prüfen, ob ähnliche Gene in dem Mycobacterium bovis BCG enthalten waren oder nicht. Die Mycobacterium bovis BCG-chromosomale DNA wurde nach einem veröffentlichen Verfahren hergestellt (G. P. S. Raghava, R. Solanki, V. Soni und P. Agrawal, Biotechniques, 2000, 29: 108–116). Um die Anwesenheit von whiB-Genen auch in Mycobacterium bovis BCG zu bestätigen, wurde ein Standardhybridisierungsprotokoll von Southern befolgt.As soon as the identity the cloned fragments confirmed was Mycobacterium tuberculosis H37Rv genes as a probe used to check whether similar Genes in the Mycobacterium bovis BCG were or were not included. The Mycobacterium bovis BCG-chromosomal DNA was released after one Methods (G.P.S. Raghava, R. Solanki, V. Soni and P. Agrawal, Biotechniques, 2000, 29: 108-116). To the presence of whiB genes were also confirmed in Mycobacterium bovis BCG followed a standard hybridization protocol by Southern.

Wie für das Mycobacterium tuberculosis H37Rv beschrieben, wurden auch alle vier whiB-Gene in Mycobacterium bovis BCG PCR-amplifiziert. Die Oligonukleotidprimer und PCR-Bedingungen waren in beiden Fällen identisch. Die PCR-Produkte wurden, wie im Fall von Mycobacterium tuberculosis H37Rv beschrieben, in einem Agarosegel getrennt, gereinigt, kloniert und sequenziert.As for the Mycobacterium tuberculosis H37Rv, were also all four whiB genes in Mycobacterium bovis BCG PCR amplified. The oligonucleotide primers and PCR conditions were in both cases identical. The PCR products were as in the case of Mycobacterium tuberculosis H37Rv, separated in an agarose gel, purified, cloned and sequenced.

Die Sequenzanordnung unter Verwendung kommerzieller Computersoftware bestätigte, dass die whiB-Gensequenzen von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG identisch sind.The Sequence arrangement using commercial computer software confirmed that the whiB gene sequences of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG are identical.

Durch Verwendung der kommerziell erhältlichen Computersoftware Gene-Runner wurden Restriktionsenzymstellen in den whiB-Sequenzen gefunden. Basierend auf den Sequenzanalyseergebnissen wurden die folgenden Enzymstellen ausgewählt, um durch das Verfahren der homologen Rekombination Vektoren zu erzeugen, die zur Genzerstörung in Mycobacterium bovis BCG verwendet werden können. Um einen Vektor zu erzeugen, der zur Genzerstörung verwendet werden könnte, wurden die folgenden Konstrukte erzeugt:

  • (a) für whiB1 wurde eine Kanamycinkassette an der PvuII-Stelle eingefügt;
  • (b) für whiB2 wurden zwei unabhängige Konstrukte an den MluI und HaeIII-Stellen gemacht;
  • (c) für whiB3 wurden ebenfalls zwei Konstrukte an der EcoRI-Stelle und an der ClaI-Stelle gemacht;
  • (d) für whiB4 an der SacII-Stelle.
Restriction enzyme sites were found in the whiB sequences using the commercially available Gene-Runner computer software. Based on the sequence analysis results, the following enzyme sites were selected to generate vectors which can be used for gene disruption in Mycobacterium bovis BCG by the method of homologous recombination. To create a vector that could be used for gene disruption, the following constructs were generated:
  • (a) for whiB1, a kanamycin cassette was inserted at the PvuII site;
  • (b) for whiB2, two independent constructs were made at the MluI and HaeIII sites;
  • (c) for whiB3, two constructs were also made at the EcoRI site and at the ClaI site;
  • (d) for whiB4 at the SacII site.

Die whiB-rekombinanten Klone wurden mit Restriktionsenzymen verdaut. Wann immer der rekombinante Klon jedoch mehr als eine Stelle für ein bestimmtes Enzym aufwies, wurden die gereinigten whiB-Fragmente verdaut und dann mit der Kanamycinkassette ligiert, die für Kanamycinresistenz kodiert. Der E. coli-Stamm wurde transformiert, und Klone wurden nach Ampizillin- und Kanamycinresistenz ausgewählt. Da diese Klone keinen mykobakteriellen Replikationsursprung aufweisen, überleben sie in den Mykobakterien nicht, wenn sie nicht in das Mykobakteriengenom integriert sind. Elektrokompetente Mycobacterium bovis BCG-Zellen wurden unter Verwendung des in der Literatur bekannten Standes der Technik hergestellt und mit 1 μg gereinigter Vektor-DNA transfomiert. In jedem Röhrchen wurde 1 ml 7H9 Middlebrook-Medium hinzugefügt und bei 37°C 48 Stunden inkubiert. Die Kultur wurde dann auf einem 7H10-Middlebrook-Medium enthaltend sowohl Ampizillin als auch Kanamycin plattiert und bei 37°C inkubiert. Nach drei Wochen Wachstum wurden die Kolonien wieder auf Kanamycinplatten plattiert und bei 37°C wachsen gelassen. In den Kanamycinplatten konnten die Kolonien nach nur 6 Wochen Inkubation beobachtet werden, was darauf hindeutet, dass die whiB-Zerstörung schädlich für das Wachstum von Mycobacterium bovis BCG ist. Die Zerstörung der individuellen whiB-Gene hatte die folgenden Effekte auf das Wachstum und das Überleben von Mycobacterium bovis BCG:

  • 1. Die whiB1-Zerstörung ist tödlich.
  • 2. Die whiB2-Zerstörung lässt die Zellen sehr langsam wachsen, und die Kolonien weisen eine sehr geringe Größe auf.
  • 3. Die whiB3-Zerstörung lässt die Zellen myzelial werden, was klar darauf hin deutet, dass diese Zerstörung die Septenbildung steuert.
  • 4. Die whiB4-Zerstörung hatte einen ähnlichen Effekt wie auch die whiB2-Zerstörung.
The whiB recombinant clones were digested with restriction enzymes. However, whenever the recombinant clone had more than one site for a particular enzyme, the purified whiB fragments were digested and then ligated to the kanamycin cassette, which encodes kanamycin resistance. The E. coli strain was transformed and clones were selected for ampicillin and kanamycin resistance. Since these clones have no mycobacterial origin of replication, they do not survive in the mycobacteria unless they are integrated into the mycobacterial genome. Mycobacterium bovis electrocompetent BCG cells were prepared using the prior art known in the literature and transformed with 1 μg of purified vector DNA. In each tube, 1 ml of 7H9 Middlebrook's medium was added and incubated at 37 ° C for 48 hours. The culture was then plated on a 7H10 Middlebrook medium containing both ampicillin and kanamycin and incubated at 37 ° C. After three weeks of growth, the colonies were plated again on kanamycin plates and grown at 37 ° C. In the kanamycin plates, colonies could be observed after only 6 weeks of incubation, suggesting that whiB destruction is detrimental to the growth of Mycobacterium bovis BCG. The destruction of the individual whiB genes had the following effects on the growth and survival of Mycobacterium bovis BCG:
  • 1. The whiB1 destruction is deadly.
  • 2. The destruction of whiB2 causes the cells to grow very slowly and the colonies are very small in size.
  • 3. The destruction of whiB3 causes the cells to become mycelial, which clearly indicates that this destruction controls septation.
  • 4. The whiB4 destruction had a similar effect as the whiB2 destruction.

Um die Natur des whiB-Gens zu zeigen, wurde das Hefe-Zweihybridsystem verwendet. Dieser Stand der Technik ist in der Literatur wohlbekannt. Im Prinzip wurde das System so entwickelt, dass sich die Transaktivierungsdomäne und die DNA-bindenden Domänen in zwei verschiedenen Plasmiden befinden. Wenn die beiden Domänen nicht zusammen kommen, findet keine Protein-Protein-Interaktion statt, und daher wird ein Gen nicht aktiviert. Das System erlaubt jedoch zu prüfen, ob das fragliche Gen für DNA-bindendes Protein oder einen Transkriptionsaktivator kodiert.Around to demonstrate the nature of the whiB gene became the yeast two-hybrid system used. This prior art is well known in the literature. In principle, the system has been designed so that the transactivation domain and the DNA-binding domains located in two different plasmids. If the two domains are not come together, there is no protein-protein interaction, and therefore a gene is not activated. The system, however, allows to consider, whether the gene in question for DNA binding protein or a transcriptional activator.

Die whiB1-, whiB2- und whiB4-Gene wurden unter Verwendung von Oligonukleotidprimern amplifiziert, die eine EcoRI-Stelle an ihrem 5-Ende und eine XhoI-Stelle an ihrem 3-Ende aufwiesen. Das whiB3-Gen wurde mit den Primern mit einer BamHI-Stelle an dem 5-Ende und einer XhoI-Stelle an dem 3-Ende amplifiziert. Nach dem Verdauen mit den geeigneten Restriktionsenzymen wurden diese Gene in den E. coli/Saccharomyces cerevisiae-Shuttlevektor pEG202 kloniert. Nach Auswählen ampizillinresistenter Kolonien wurden die rekombinanten Klone nach his-Kolonien in Saccharomyces cerevisiae EGY 48 und EGY191 ausgewählt. Die his–-Klone wurden dann mit den Plasmiden pJk101, pSH18-34, pJG4-5 und pRFHM entweder einzeln oder in Kombinationen transformiert. Die Klone, die entweder Uracil, Uracil + Histidin oder Uracil + Histidin + Tryptophan komplementierten, wurden ausgewählt. Diese Klone wurden dann entweder auf Aktivierung oder Unterdrückung von β-Galaktosidaseaktivität getestet, indem sie in den Platten enthaltend Hefe-Stickstoff-basierendes Medium und folgende Zusätze gezüchtet wurden:

  • 1. Glukose+, ura–-BU-Salz + X-gal (keine Farbe)
  • 2. Galaktose/Raffinose+, ura– + BU-Salz+ + X-gal (keine Farbe durch alle vier whiB-Gene, nur wenn pJK101 vorhanden ist, aber pJK101 erzeugte eine leuchtende blaue Farbe, was darauf hindeutet, dass whiB-Gene in der Saccharomyces cerevisiae exprimiert werden und die Aktivierung des lacZ-Gens unterdrücken.)
  • 3. Glukose+, ura–, his–, leu– (kein Wachstum)
  • 4. Galaktose/Raffinose+, ura–, his–, leu– (kein Wachstum von whiB1, whiB2 und whiB3, aber in Anwesenheit von pSH18-34 wurde ein gewisses Wachstum von whiB4 beobachtet)
  • 5. Galaktose/Raffinose+, ura–, his–, tryp–, leu– (nur whiB4 zeigte nach drei Tagen Inkubation bei Anwesenheit von pSH18-34 und pJG4-5 ein gewisses Wachstum, was darauf hindeutet, dass das whiB4-Gen ein schwacher Transkriptionsaktivator ist)
  • 6. Glukose+, ura–, his–, tryp–, leu– (kein Wachstum).
The whiB1, whiB2 and whiB4 genes were amplified using oligonucleotide primers that had an EcoRI site at their 5-end and an XhoI site at their 3-terminus. The whiB3 gene was amplified with the primers with a BamHI site at the 5 'end and a XhoI site at the 3' end. After digestion with the appropriate restriction enzymes, these genes were cloned into the E. coli / Saccharomyces cerevisiae shuttle vector pEG202. After selecting ampicillin-resistant colonies, the recombinant clones were selected for his colonies in Saccharomyces cerevisiae EGY 48 and EGY191. The his - clones were then transformed with the plasmids pJk101, pSH18-34, pJG4-5 and pRFHM either singly or in combinations. The clones that complemented either uracil, uracil + histidine or uracil + histidine + tryptophan were selected. These clones were then tested for either activation or suppression of β-galactosidase activity by growing them in plates containing yeast nitrogen-based medium and following additions:
  • 1. Glucose + , ura - -BU salt + X-gal (no color)
  • 2. galactose / raffinose + , ura - + BU salt + + X-gal (no color through all four whiB genes, only if pJK101 is present, but pJK101 produced a bright blue color, suggesting that whiB genes in the Saccharomyces cerevisiae and suppress activation of the lacZ gene.)
  • 3. glucose + , ura - , his - , leu - (no growth)
  • 4. galactose / raffinose +, ura -, his -, leu - (no growth of whiB1, whiB2 and some growth of whiB4 whiB3, but in the presence of pSH18-34 was observed)
  • Galactose / raffinose + , ura - , his - , tryp - , leu - (only whiB4 showed some growth after three days of incubation in the presence of pSH18-34 and pJG4-5, suggesting that the whiB4 gene was present weak transcriptional activator is)
  • 6. Glucose + , ura - , his - , tryp - , leu - (no growth).

Das Verfahren der vorliegenden Erfindung ist in den unten stehenden Beispielen veranschaulicht, die jedoch nicht als den Umfang der vorliegenden Erfindung begrenzend aufgefasst werden sollten.The Process of the present invention is shown below Examples illustrate, but not as the scope of should be construed limiting the present invention.

Beispiel 1example 1

Die Mycobacterium tuberculosis H37Rv-chromosomale DNA wurde unter Befolgen eines veröffentlichten Verfahrens (G. P. S. Raghav, R. J. Solanki, V. Soni und P. Agrawal, Biotechniques, 2000, 29: 108–116) hergestellt.The Mycobacterium tuberculosis H37Rv chromosomal DNA was followed of a published Method (G.P.S. Raghav, R.J. Solanki, V. Soni and P. Agrawal, Biotechniques, 2000, 29: 108-116) produced.

Alle vier whiB-Gene von Mycobacterium tuberculosis H37Rv wurden unter Verwendung eines Standardprotokolls amplifiziert. Die Oligonukleotidprimer und PCR-Bedingungen waren wie folgt:
F 5 acccgttaccagccaagaag 3' und R 5' gggacggttgatgctgtag 3' für whiB1
F 5' ggccgggtcagatgatc 3' und R 5' accgcatctgagtttgg 3' für whiB2
F 5' atgccacagccggagcagctac 3' und R 5' ttaagctgtgcggcggatgcc 3' für whiB3
F 5' ctatccggcggtgccggtgcg 3' und R 5' gtggtacgcagcgtagacgcg 3' für whiB4All four whiB genes from Mycobacterium tuberculosis H37Rv were amplified using a standard protocol. The oligonucleotide primers and PCR conditions were as follows:
F 5 acccgttaccagccaagaag 3 'and R 5' gggacggttgatgctgtag 3 'for whiB1
F 5 'ggccgggtcagatgatc 3' and R 5 'accgcatctgagtttgg 3' for whiB2
F 5 'atgccacagccggagcagctac 3' and R 5 'ttaagctgtgcggcggatgcc 3' for whiB3
F 5 'ctatccggcggtgccggtgcg 3' and R 5 'gtggtacgcagcgtagacgcg 3' for whiB4

Die PCR-Produkte wurden auf 1% Agarosegel getrennt, und die amplifizierten Banden wurden durch Schneiden des Gels entfernt. Die PCR-amplifizierte DNA wurde durch Verwendung einer kommerziell erhältlichen Reinigungsausrüstung gereinigt.The PCR products were separated on 1% agarose gel, and the amplified Bands were removed by cutting the gel. The PCR amplified DNA was purified by using commercially available cleaning equipment.

Die Enden der gereinigten DNA wurden unter Verwendung von T4 Pol-Kinase phosphoryliert und dann in die SmaI-Stelle des dephosphorylierten pUC19-Vektors kloniert. Die rekombinanten Plasmide wurden in einen E. coli-Stamm transformiert und die Kolonien ausgewählt, die keine blaue Farbe erzeugten. Die weißen Kolonien wurden von den Platten zurückgewonnen und auf einem frischen Medium enthaltend 100 μg/ml Ampizillin und 25 μg/ml Kanamycin als Selektionsmarker gezüchtet. Die Klone wurden unter Verwendung eines Standardverfahrens sequenziert, das im Stand der Technik wohlbekannt ist. Daher etabliert dieses Beispiel das Klonieren und die Bestätigung der vier whiB-Gene von Mycobacterium tuberculosis H37Rv.The ends of the purified DNA were phosphorylated using T4 Pol kinase and then cloned into the SmaI site of the dephosphorylated pUC19 vector. The recombinant plasmids were transformed into an E. coli strain and the colonies that did not produce blue color were selected. The white ones Colonies were recovered from the plates and cultured on a fresh medium containing 100 μg / ml ampicillin and 25 μg / ml kanamycin as a selection marker. The clones were sequenced using a standard procedure well known in the art. Therefore, this example establishes the cloning and confirmation of the four whiB genes of Mycobacterium tuberculosis H37Rv.

Beispiel 2Example 2

Das Mycobacterium tuberculosis H37Rv ist ein hochgradig virulenter Stamm. Um ein geeignetes Arbeitssystem zu finden, wurde daher ein nicht virulenter, sondern Vakzin-Stamm von Mycobacterium bovis BCG auf die Anwesenheit von whiB-Homologen geprüft. Genomische DNA von Mycobacterium bovis BCG wurde mit SacI und BamHI-Restriktionsenzymen verdaut, und die DNA-Fragmente wurden auf einem 1 Prozent Agarosegel getrennt. Die DNA wurde unter Verwendung des veröffentlichten Protokolls auf eine Hybond-Nylonmembran transferiert, und dann wurde die DNA 30 Minuten bei 80°C in der Membran fixiert. Die klonierten whiB-Fragmente aus pUC19 wurden durch XbaI- und KpnI-Verdauung entfernt, und die DNA wurde unter Verwendung einer Gelextraktionsausrüstung gereinigt.The Mycobacterium tuberculosis H37Rv is a highly virulent strain. To find a suitable work system, therefore, was not one virulent, but vaccine strain of Mycobacterium bovis BCG on tested the presence of whiB homologs. Genomic DNA of Mycobacterium bovis BCG was digested with SacI and BamHI restriction enzymes, and the DNA fragments were separated on a 1 percent agarose gel. The DNA was generated using the published protocol a Hybond nylon membrane and then the DNA was incubated at 80 ° C for 30 minutes in the Membrane fixed. The cloned whiB fragments from pUC19 were removed by XbaI and KpnI digestion, and the DNA was submerged Using a gel extraction equipment cleaned.

Die gereinigten Fragmente wurden dann durch eine Zufallsprimingausrüstung, die kommerziell erhältlich ist, zum 32p dCTP-Labeling verwendet. Unter Verwendung des Standardprotokolls der Southern-Hybridisierung wurde bestätigt, dass die vier whiB-Gen-Homologe von Mycobacterium tuberculosis H37Rv in Mycobacterium bovis BCG vorhanden sind. Die vier whiB-Gene von Mycobacterium bovis BCG wurden unter Verwendung von Oligonukleotidprimern von Mycobacterium tuberculosis H37Rv PCR-amplifiziert. Das PCR-Fragment wurde kloniert und in einen E. coli-Stamm transformiert, wie für Mycobacterium tuberculosis H37Rv beschrieben. Die DNA-Sequenz des klonierten Fragments und Sequenzanordnung unter Verwendung von kommerzieller Computersoftware bestätigte, dass die whiB-Gensequenz von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG identisch sind.The Purified fragments were then purified by random priming equipment commercially available is used for 32p dCTP labeling. Using the standard protocol Southern hybridization was confirmed to be the four whiB gene homologs of Mycobacterium tuberculosis H37Rv are present in Mycobacterium bovis BCG. The Four whiB genes from Mycobacterium bovis BCG were used of oligonucleotide primers of Mycobacterium tuberculosis H37Rv PCR amplified. The PCR fragment was cloned and transformed into an E. coli strain as for Mycobacterium tuberculosis H37Rv. The DNA sequence of the cloned fragment and sequence ordering using commercial computer software confirmed that the whiB gene sequence of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG are identical.

Beispiel 3Example 3

Um die Funktion von whiB-Genen im Lebenszyklus von Mykobakterien zu demonstrieren, wurden die vier whiB-Homologe in Mycobacterium bovis BCG zerstört. Durch Verwendung der kommerziell erhältlichen Computersoftware Gene-Runner wurden Restriktionsenzymstellen in den whiB-Sequenzen gefunden. Basierend auf den Sequenzanalyseergebnissen wurden die folgenden Restriktionsenzymstellen ausgewählt, um durch das Verfahren der homologen Rekombination Vektoren zu erzeugen, die zur Genzerstörung in Mycobacterium bovis BCG verwendet werden können. Um einen Vektor zu erzeugen, der für die Genzerstörung verwendet werden könnte, wurden die folgenden Konstrukte erzeugt:

  • (a) für whiB1 wurde eine Kanamycinkassette an der PvuII-Stelle an der Position 143 eingefügt;
  • (b) für whiB2 wurden zwei unabhängige Konstrukte an MluI an der Position 138 und an HaeIII an der Position 133 gemacht;
  • (c) für whiB3 wurden ebenfalls zwei Konstrukte an der EcoRI-Stelle an der Position 52 und an der ClaI-Stelle an der Position 85 gemacht;
  • (d) für whiB4 erfolgte die Einfügung an der SacII-Stelle an Position 192.
To demonstrate the function of whiB genes in the life cycle of mycobacteria, the four whiB homologs in Mycobacterium bovis BCG were disrupted. Restriction enzyme sites were found in the whiB sequences using the commercially available Gene-Runner computer software. Based on the sequence analysis results, the following restriction enzyme sites were selected to generate, by the homologous recombination method, vectors that can be used for gene disruption in Mycobacterium bovis BCG. To create a vector that could be used for gene disruption, the following constructs were generated:
  • (a) for whiB1, a kanamycin cassette was inserted at the PvuII site at position 143;
  • (b) for whiB2, two independent constructs were made to MluI at position 138 and to HaeIII at position 133;
  • (c) for whiB3, two constructs were also made at the EcoRI site at position 52 and at the ClaI site at position 85;
  • (d) for whiB4, insertion was made at the SacII site at position 192.

Die whiB-rekombinanten Klone wurden mit den Restriktionsenzymen verdaut, wann immer der rekombinante Klon jedoch mehr als eine Stelle für ein bestimmtes Enzym aufwies, wurden die gereinigten whiB-Fragmente verdaut und dann mit der Kanamycinkassette ligiert, die für Kanamycinresistenz kodiert. Der E. coli-Stamm wurde transformiert, und Klone wurden nach Ampizillin- und Kanamycinresistenz ausgewählt. Da diese Klone keinen mykobakteriellen Replikationsursprung aufweisen, überleben sie in den Mykobakterien nicht, wenn sie nicht in das Mykobakteriengenom integriert sind. Elektrokompetente Mycobacterium bovis BCG-Zellen wurden unter Verwendung des in der Literatur bekannten Standes der Technik hergestellt und mit 1 μg gereinigter Vektor-DNA transfomiert. In jedem Röhrchen wurde 1 ml 7H9 Middlebrook-Medium hinzugefügt und bei 37°C 48 Stunden inkubiert. Die Kultur wurde dann auf einem 7H10-Middlebrook-Medium enthaltend sowohl Ampizillin als auch Kanamycin plattiert und bei 37°C inkubiert. Nach drei Wochen Wachstum wurden die Kolonien wieder auf reinen Kanamycinplatten plattiert und bei 37°C wachsen gelassen. In den Kanamycinplatten konnten die Kolonien nach nur 6 Wochen Inkubation beobachtet werden, was darauf hindeutet, dass die whiB-Zerstörung schädlich für das Wachstum von Mycobacterium bovis BCG ist. Die Zerstörung der individuellen whiB-Gene hatte die gleichen Effekte auf das Wachstum und das Überleben von Mycobacterium bovis BCG.The whiB recombinant clones were digested with the restriction enzymes, however, whenever the recombinant clone has more than one site for a given one Had enzyme, the purified whiB fragments were digested and then ligated with the kanamycin cassette encoding kanamycin resistance. The E. coli strain was transformed and clones were transformed into ampicillin. and kanamycin resistance. Since these clones have no mycobacterial origin of replication, they survive they are not in the mycobacteria if they are not in the mycobacterial genome are integrated. Electrocompetent Mycobacterium bovis BCG cells were prepared using the known in the literature Technique and with 1 μg purified vector DNA is transformed. In each tube was added 1 ml of 7H9 Middlebrook's medium added and at 37 ° C Incubated for 48 hours. The culture was then grown on a 7H10 Middlebrook medium containing both ampicillin and kanamycin plated and at Incubated at 37 ° C. After three weeks of growth, the colonies were returned to clean Kanamycin plates and grown at 37 ° C. In the kanamycin plates could the colonies are observed after only 6 weeks of incubation, which suggesting that the whiB destruction is detrimental to the growth of Mycobacterium bovis BCG is. The destruction of the individual whiB genes had the same effects on growth and survival of Mycobacterium bovis BCG.

Beispiel 4Example 4

Um die Natur des whiB-Gens zu zeigen, wurde das Hefe-Zweihybridsystem verwendet. Dieser Stand der Technik ist in der Literatur wohlbekannt. Im Prinzip wurde ein System entwickelt, in dem sich die Transaktivierungsdomäne und die DNA-bindenden Domänen in zwei verschiedenen Plasmiden befinden. Wenn die beiden Domänen nicht zusammen kommen, findet keine Protein-Protein-Interaktion statt, und daher wird ein Gen nicht aktiviert. Das System erlaubt jedoch auch zu prüfen, ob das fragliche Gen für DNA-bindendes Protein oder einen Transkriptionsaktivator kodiert.Around to demonstrate the nature of the whiB gene became the yeast two-hybrid system used. This prior art is well known in the literature. In principle, a system was developed in which the transactivation domain and the DNA-binding domains located in two different plasmids. If the two domains are not come together, there is no protein-protein interaction, and therefore a gene is not activated. The system, however, allows also to consider whether the gene in question for DNA binding protein or a transcriptional activator.

Die drei whiB-Gene whiB1, whiB2 und whiB4 wurden mit Oligonukleotidprimern amplifiziert, die eine EcoRI-Stellensequenz an ihrem 5-Ende und eine XhoI-Stellensequenz an ihrem 3-Ende aufwiesen. Das whiB3-Gen wurde unter Verwendung der BamHI-Stelle an seinem 5-Ende amplifiziert, weil das whiB3-Gen eine innere EcoRI-Stelle aufweist. Die PCR-Bedingungen waren wie vorstehend beschrieben. Die PCR-Produkte wurden unter Verwendung einer kommerziellen Reinigungsausrüstung gereinigt und entweder mit EcoRI- und XhoI- oder BamHI- und XhoI-Restriktionsenzymen verdaut. Der E. coli/Saccharomyces cerevisiae-Shuttlevektor pEG202 wurde ebenfalls geeignetermaßen verdaut, dephosphory liert, und die PCR-Fragmente wurden durch das in der Literatur wohlbekannte Verfahren in den Vektor ligiert. Die Rekombinanten wurden auf einer Amipizillinplatte ausgewählt. Die ampizillinpositiven Klone wurden unter Verwendung der whiB-Gene als Sonden durch das in der Literatur wohl etablierte Verfahren hybridisiert. Von den Klonen wurden unter Verwendung eines veröffentlichen Verfahrens Plasmide zurückgewonnen, die ein positives Signal gaben. Um weiterhin zu beweisen, dass das richtige Gen kloniert wurde, wurden die Plasmide wie oben beschrieben mit geeigneten Restriktionsenzymen verdaut und auf einem Agarosegel auf das Fragment mit der richtigen Größe geprüft.The three whiB genes whiB1, whiB2 and whiB4 were primed with oligonucleotides amplified having an EcoRI site sequence at its 5-end and had an XhoI site sequence at its 3-terminus. The whiB3 gene was amplified using the BamHI site at its 5-terminal, because the whiB3 gene has an internal EcoRI site. The PCR conditions were as described above. The PCR products were under Using a commercial cleaning equipment cleaned and either with EcoRI and XhoI or BamHI and XhoI restriction enzymes digested. The E. coli / Saccharomyces cerevisiae shuttle vector pEG202 was also appropriately digested, dephosphorylated, and the PCR fragments were characterized by that in the Literature well-known method ligated into the vector. The recombinants were selected on an amipicillin plate. The ampicillin-positive Clones were probed by using the whiB genes as probes hybridized in the literature well-established method. Of the Cloning was done using a published plasmid procedure recovered which gave a positive signal. To continue to prove that gene was cloned, the plasmids were as described above digested appropriate restriction enzymes and on an agarose gel checked for the fragment of the correct size.

Unter Verwendung einer kommerziell erhältlichen Reinigungsausrüstung wurde eine Plasmidherstellung des rekombinanten Klons in großem Maßstab durchgeführt. Unter Verwendung eines veröffentlichten Protokolls wurde 1 μg des rekombinanten Plasmids in Saccharomyces cerevisiae EGY48- und EGY191-Stämme transformiert und nach der Komplementierung von Histidinauxotrophie ausgewählt. Die Klone wurden auf eine Histidin-negative Platte gepatcht. Die Saccharomyces cerevisiae EGY48- und EGY191-Stämme, die rekombinante whiB-Gene tragen, wurden unter Verwendung verschiedener Kombinationen folgender Plasmide co-transformiert:

  • (a) rekombinantes pEG202 + pSH18-34 + jPG4-5 (ausgewählt für Histidin-, Uracil- und Tryptophanauxotrophie)
  • (b) pSH17-4 + pSH18-34 + pJG4-5 (ausgewählt für Uracil- und Tryptophanauxotrophie)
  • (c) pRFHM1 + pSH18-34 + pJG4-5 (ausgewählt für Uracil- und Tryptophanauxotrophie)
  • (d) rekombinantes pEG202 + pJk101 (ausgewählt für Histidin- und Uracilauxotrophie)
  • (e) pRFHM1 + pJK101 (ausgewählt für Uracilauxotrophie)
  • (f) pJK101 (ausgewählt für Uracilauxotrophie)
  • (g) rekombinantes pEG202 + pSH18-34 + pJG4-5 (ausgewählt für Histidin-, Uracil- und Tryptophanauxotrophie)
Using a commercially available purification equipment, plasmid production of the recombinant clone was conducted on a large scale. Using a published protocol, 1 μg of the recombinant plasmid was transformed into Saccharomyces cerevisiae EGY48 and EGY191 strains and selected after complementation of histidine auxotrophy. The clones were patched onto a histidine-negative plate. The Saccharomyces cerevisiae EGY48 and EGY191 strains carrying recombinant whiB genes were co-transformed using various combinations of the following plasmids:
  • (a) recombinant pEG202 + pSH18-34 + jPG4-5 (selected for histidine, uracil and tryptophan auxotrophy)
  • (b) pSH17-4 + pSH18-34 + pJG4-5 (selected for uracil and tryptophan auxotrophy)
  • (c) pRFHM1 + pSH18-34 + pJG4-5 (selected for uracil and tryptophan auxotrophy)
  • (d) recombinant pEG202 + pJk101 (selected for histidine and uracil auxotrophy)
  • (e) pRFHM1 + pJK101 (selected for uracil auxotrophy)
  • (f) pJK101 (selected for uracil auxotrophy)
  • (g) recombinant pEG202 + pSH18-34 + pJG4-5 (selected for histidine, uracil and tryptophan auxotrophy)

Sobald die Transformanten, die die richtige Auxotrophie komplementieren, erhalten worden waren, wurden diese Klone auf einem selektiven Medium subkultiviert, in dem die Aminosäuren fehlten, die durch die Plasmide kodiert waren. Sechs verschiedene zufällig ausgewählte Klone wurden dann mit folgenden Kombinationen auf das Medium gestrichen:

  • (1) Glukose+, ura–-BU-Salz+ + X-gal
  • (2) Galaktose/Raffinose+, ura– + BU-Salz+ + X-gal
  • (3) Glukose+, ura–, his–, leu–
  • (4) Galaktose/Raffinose+, ura–, his–, leu–
  • (5) Galaktose/Raffinose+, ura–, his–, tryp–, leu–
  • (6) Glukose+, ura–, his–, tryp–, leu–.
Once the transformants completing the correct auxotrophy were obtained, these clones were subcultured on a selective medium lacking the amino acids encoded by the plasmids. Six different randomly selected clones were then streaked onto the medium with the following combinations:
  • (1) glucose + , ura - -BU salt + + X-gal
  • (2) galactose / raffinose + , ura - + BU salt + + X-gal
  • (3) glucose + , ura - , his - , leu -
  • (4) galactose / raffinose + , ura - , his - , leu -
  • (5) galactose / raffinose + , ura - , his - , tryp - , leu -
  • (6) glucose + , ura - , his - , tryp - , leu - .

Die X-gal enthaltenden Platten wurden mit Aluminiumfolie bedeckt, um sie vor Licht zu schützen, und 18–24 Stunden bei 30°C inkubiert.The X-gal containing plates were covered with aluminum foil to to protect them from light, and 18-24 Hours at 30 ° C incubated.

Die whiB1-, whiB2- und whiB3-Gene in der Kombination Nummer (g) erzeugten keine blaue Farbe in X-gal+, Galaktose/Raffinose+, ura–, BU+-Platten, noch wuchs sie auf Galaktose/Raffinose+, ura–, his–, tryp–, leu–-Platten. Diese Kombinationen induzierten auch keine Leucinprototrophie. Im Gegensatz dazu unterdrückte die Kombination (d) die lacZ-Induktion, wenn sie auf ura–, Galaktose/Raffinose+, BU+, X-gal+-Platten gezüchtet wurde, weil sie keine blaue Farbe erzeugte; das pJk101 allein (Kombination f) erzeugte jedoch eine blaue Farbe. Diese Ergebnisse bestätigten, dass die whiB1-, whiB2- und whiB3-Gene für ein DNA-bindendes Protein kodieren, aber nicht für einen Transkriptionsaktivator.The whiB1, whiB2 and whiB3 genes in combination number (g) did not produce blue color in X-gal +, galactose / raffinose +, ura, BU + plates, nor did they grow on galactose / raffinose +, ura-, his- , tryp, leu - plates. These combinations also did not induce leucine prototrophy. In contrast, combination (d) suppressed lacZ induction when grown on ura, galactose / raffinose +, BU +, X-gal + plates because it did not produce a blue color; however, the pJk101 alone (combination f) produced one blue colour. These results confirmed that the whiB1, whiB2 and whiB3 genes encode a DNA-binding protein but not a transcriptional activator.

Das whiB4-Gen ist ein schwacher Transkriptionsaktivator, weil das rekombinante whiB4 in der Kombination Nummer (g) anders als die rekombinanten whiB1, whiB2 und whiB3 in X-gal+, Galaktose/Raffinose+, ura–, BU+-Platten eine helle blaue Farbe erzeugte und auch eine schwache Aktivierung der Leucinprototrophie zeigte. Dieses Beispiel etabliert, dass die Mykobakterien-regulatorischen Gene in einem eukaryotischen System erforscht werden können – das heißt Hefe –, und die whiB-Gene des Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG entweder für DNA-bindendes Protein oder einen Transkriptionsaktivator kodieren.The whiB4 gene is a weak transcriptional activator because the recombinant whiB4 in the combination number (g) other than the recombinant whiB1, whiB2 and whiB3 in X-gal +, Galactose / raffinose +, ura-, BU + panels produced a bright blue color and also a faint one Activation of leucine prototrophy showed. Established this example, that the mycobacteria regulatory genes in a eukaryotic System can be researched - that is yeast -, and the whiB genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG for either Code DNA binding protein or a transcriptional activator.

Beispiel 5Example 5

Um zu prüfen, ob whiB-artige Gene in anderen Spezies von Mykobakterien vorhanden sind oder nicht, wurden die folgenden Spezies der Mykobakterien unter Verwendung von Standard- und veröffentlichten Informationen auf die Anwesenheit von whiB-artigen Genen getestet: Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis und Mycobacterium xenopi. Außer in Mykobakterium fortuitum, das nur whiB1-Homologe aufzuweisen scheint, sind die whiB-Genhomologe in allen aufgeführten Spezies vorhanden. Die Ergebnisse lassen darauf schließen, dass man die whiB-Gene der obigen Spezies ebenfalls verwenden kann, um ein Medikamentenziel zu entwickeln.Around to consider, whether whiB-like genes are present in other species of mycobacteria or not, became the following species of mycobacteria using standard and published information tested for the presence of whiB-like genes: Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis and Mycobacterium xenopi. Except in Mycobacterium fortuitum, which seems to have only whiB1 homologues, the whiB gene homologues are present in all listed species. The Results suggest that that one can also use the whiB genes of the above species, to develop a drug target.

Zusammenfassend:In summary:

  • 1. Die whiB-Gene von Mycobacterium tuberculosis H37Rv und Mycobacterium bovis BCG sind regulatorische Gene.1. The whiB genes of Mycobacterium tuberculosis H37Rv and Mycobacterium bovis BCG are regulatory genes.
  • 2. Die Zerstörung von whiB-Genen ist für das Überleben von Mykobakterien entweder tödlich oder schädlich.2. The destruction of whiB genes is for the survival of mycobacteria either deadly or harmful.
  • 3. Die whiB-Gene werden als Medikamentenziel verwendet, um nach Antituberkulosemedikamenten zu suchen.3. The whiB genes are used as a drug target to after To look for antituberculosis drugs.
  • 4. Das Hefe-Zweihybridsystem kann verwendet werden, um die mykobakteriellen regulatorischen Gene zu erforschen und dann zu erforschen, wozu Gene durch diese regulatorischen Gene gesteuert werden.4. The yeast two-hybrid system can be used to treat the mycobacterial investigate regulatory genes and then explore what Genes are controlled by these regulatory genes.
  • 5. Dies ist der erste Bericht, in dem das Hefe-Zweihybridsystem verwendet wurde, um die Natur eines Proteins von Mycobacterium tuberculosis zu untersuchen, das bisher nur vorhergesagte Funktion aufwies.5. This is the first report in which the yeast two-hybrid system was used to study the nature of a protein of Mycobacterium tuberculosis to investigate that previously had only predicted function.
  • 6. Ein Verfahren wird beschrieben, wobei auch alle genetisch manipulierten, aber trunkierten regulatorischen Gene erforscht werden können. Diese Studien werden durchgeführt, um die Funktion von unterschiedlichen Regionen der regulatorischen Gene zu beschreiben.6. A procedure is described, whereby also all genetically manipulated but truncated regulatory genes are being explored can. These studies are done to the function of different regions of the regulatory To describe genes.
  • 7. Die Erfindung stellt auch Mittel bereit, um Protein-Protein-Interaktionen von mykobakteriellen Genen in einem heterologen Wirt zu erforschen, der nicht infektiös ist und daher keine Gesundheitsgefährdung darstellt oder einen besonderen Laboraufbau erfordert.7. The invention also provides means for protein-protein interactions to explore mycobacterial genes in a heterologous host, the non-infectious is therefore not a health hazard or one requires special laboratory setup.
  • 8. Außerdem ist hierin eine Reportergen-basierende Prüfung beschrieben, die ein wohlcharakterisiertes Gen lacZ verwendet. Das lacZ-Gen kodiert für die β-Galaktosidase. Die Prüfung des β-Galaktosidaseenzyms ist einfach, daher ist das Verfahren auch HTS-kompatibel.8. Besides herein is described a reporter gene-based assay that is a well-characterized gene lacZ used. The lacZ gene encodes β-galactosidase. Testing of β-galactosidase enzyme is simple, so the method is also HTS compatible.

SEQUENZAUFLISTUNG

Figure 00190001
SEQUENCE LISTING
Figure 00190001

Figure 00200001
Figure 00200001

Figure 00210001
Figure 00210001

Figure 00220001
Figure 00220001

Figure 00230001
Figure 00230001

Figure 00240001
Figure 00240001

Figure 00250001
Figure 00250001

Claims (7)

Verfahren zur Herstellung einer rekombinanten Saccharomyces cerevisiae, wobei das Verfahren die folgenden Schritte umfasst: a) Amplifizieren der whiB-artigen Gene von Mycobacteria durch die Polymerase-Kettenreaktion (polymerase chain reaction, PCR), wobei die whiB-artigen Gene aus der Gruppe ausgewählt sind, die aus whiB1 (SEQ ID NR: 1), whiB2 (SEQ ID NR: 3), whiB3 (SEC ID NR: 5) und whiB4 (SEQ ID NR: 7) besteht, und die Mykobakterien aus der Gruppe ausgewählt sind, die aus Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis und Mycobacterium xenopi besteht, und wobei die whiB-Gene mit Primern amplifiziert werden, die an ihrem 5'-Ende entweder EcoRI- oder BamHI-Restriktionsenzymstellen und an dem 3'-Ende eine XhoI-Restriktionsenzymstelle tragen; b) Verdauen des wie in Schritt a) erhaltenen Fragments mit geeigneten Restriktionsenzymen und anschließendes Klonieren des Fragments in einen E. coli/Saccharomyces cerevisiae-Shuttlevektor pEG202, um das klonierte Gen als ein LexA-Fusionsprotein herzustellen und den Klon in E. coli zu transformieren; und c) Vervielfältigen des Klons und anschließendes Transformieren der rekombinanten whiB1, whiB2, whiB3 und whiB4/pEG202 in einen Stamm Saccharomyces cerevisiae, der LexA-Operatoren aufweist.A method of producing a recombinant Saccharomyces cerevisiae, the method comprising the steps of: a) amplifying the whiB-like genes of Mycobacteria by the polymerase chain reaction (PCR), wherein the whiB-like genes are selected from the group which consists of whiB1 (SEQ ID NO: 1), whiB2 (SEQ ID NO: 3), whiB3 (SEC ID NO: 5) and whiB4 (SEQ ID NO: 7), and the mycobacteria are selected from the group consisting of from Mycobacterium tuberculosis, Mycobacterium bovis, Mycobac terium avium, Mycobacterium fortuitum, Mycobacterium gastri, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium microti, Mycobacterium phlei, Mycobacterium scrofulaceum, Mycobacterium smegmatis and Mycobacterium xenopi, and wherein the whiB genes are amplified with primers attached to their 5 ' End carry either EcoRI or BamHI restriction enzyme sites and at the 3 'end an XhoI restriction enzyme site; b) digesting the fragment obtained as in step a) with appropriate restriction enzymes and then cloning the fragment into an E. coli / Saccharomyces cerevisiae shuttle vector pEG202 to produce the cloned gene as a LexA fusion protein and to transform the clone into E. coli ; and c) amplifying the clone and then transforming the recombinant whiB1, whiB2, whiB3 and whiB4 / pEG202 into a strain Saccharomyces cerevisiae having LexA operators. Verfahren nach Anspruch 1, wobei das Saccharomyces cerevisiae ein aus EGY48 oder EGY191 ausgewählter Stamm ist.The method of claim 1, wherein the Saccharomyces cerevisiae is a strain selected from EGY48 or EGY191. Verfahren nach Anspruch 1, wobei das whiB1-Gen durch Verwendung von Primern F 5' acccgttaccagccaagaag 3' (SEQ ID NR: 9) und R 5' gggacggttgatgctgtag 3' (SEQ ID NR: 10) vervielfältigt wird.The method of claim 1, wherein the whiB1 gene is characterized by Use of primers F 5 'acccgttaccagccaagaag 3 '(SEQ ID NO: 9) and R 5 'gggacggttgatgctgtag 3 '(SEQ ID NO: 10) duplicated becomes. Verfahren nach Anspruch 1, wobei das whiB2-Gen durch Verwendung von Primern F 5' ggccgggtcagatgatc 3' (SEQ ID NR: 11) und R 5' accgcatctgagtttgg 3' (SEQ ID NR: 12) vervielfältigt wird.The method of claim 1, wherein the whiB2 gene is characterized by Use of Primers F 5 'ggccgggtcagatgatc 3 '(SEQ ID NO: 11) and R 5 'accgcatctgagtttgg 3 '(SEQ ID NO: 12) duplicated becomes. Verfahren nach Anspruch 1, wobei das whiB3-Gen durch Verwendung von Primern F 5' atgccacagccggagcagctac 3' (SEC ID NR: 13) und R 5' ttaagctgtgcggcggatgcc 3' (SEQ ID NR: 14) vervielfältigt wird.The method of claim 1, wherein the whiB3 gene is characterized by Use of primers F 5 'atgccacagccggagcagctac 3 '(SEC ID NO: 13) and R 5 'ttaagctgtgcggcggatgcc 3 '(SEQ ID NO: 14) duplicated becomes. Verfahren nach Anspruch 1, wobei das whiB4-Gen durch Verwendung von Primern F 5' ctatccggcggtgccggtgcg 3' (SEQ ID NR: 15) und R 5' gtggtacgcagcgtagacgcg 3' (SEQ ID NR: 16) vervielfältigt wird.The method of claim 1, wherein the whiB4 gene is characterized by Use of primers F 5 'ctatccggcggtgccggtgcg 3 '(SEQ ID NO: 15) and R 5 'gtggtacgcagcgtagacgcg 3 '(SEQ ID NO: 16) duplicated becomes. Verfahren nach Anspruch 1, wobei die Restriktionsenzyme, die in Schritt b) verwendet werden, aus der Gruppe ausgewählt werden, die aus EcoRI, XmaI BamHI, SaiI, NcoI, NotI, XhoI, SaII und PstI besteht.The method of claim 1, wherein the restriction enzymes, that are used in step b) are selected from the group those from EcoRI, XmaI BamHI, SaiI, NcoI, NotI, XhoI, SaII and PstI consists.
DE2001620634 2001-03-29 2001-03-29 A method of producing a recombinant yeast S. cerevisiae by the use of essential and regulatory genes of mycobacteria Expired - Lifetime DE60120634T2 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP01302991A EP1245683B1 (en) 2001-03-27 2001-03-29 Method for making a recombinant S. cerevisiae by using essential and regulatory genes of mycobacteria

Publications (2)

Publication Number Publication Date
DE60120634D1 DE60120634D1 (en) 2006-07-27
DE60120634T2 true DE60120634T2 (en) 2007-05-31

Family

ID=36650848

Family Applications (1)

Application Number Title Priority Date Filing Date
DE2001620634 Expired - Lifetime DE60120634T2 (en) 2001-03-29 2001-03-29 A method of producing a recombinant yeast S. cerevisiae by the use of essential and regulatory genes of mycobacteria

Country Status (2)

Country Link
AT (1) ATE330036T1 (en)
DE (1) DE60120634T2 (en)

Also Published As

Publication number Publication date
DE60120634D1 (en) 2006-07-27
ATE330036T1 (en) 2006-07-15

Similar Documents

Publication Publication Date Title
DE68929507T2 (en) RECOMBINANT MYCOBACTERIAL EXPRESSION CARRIERS AND THEIR USE
DE69434663T2 (en) NUCLEOTIDE SEQUENCES FOR EXPRESSION CONTROL OF DNA SEQUENCES IN A HOST CELL
DE3588253T2 (en) Recombinant proteins of viruses associated with lymphadenopathy syndrome and / or acquired immunodeficiency syndrome
DE69836588T2 (en) TUBERCULOSIS VACCINE
DE69839426T2 (en) NUCLEOTIDE SEQUENCES CODING FOR SECRETATED POLYPEPTIDES FROM MYCOBACTERIUM, VECTORS CONTAINING THEM, AND APPLICATIONS FOR DIAGNOSIS AND PREVENTION OF TUBERCULOSIS
DE69838510T2 (en) MUTATIONS IN ATP-DEPENDENT TRANSPOSITION PROTEINS THAT REDUCE THE DESTINATION SPECIFICITY
DE60315636T2 (en) BACTERIOPHAGES SUITABLE FOR THE THERAPY AND PROPHYLAXIS OF BACTERIAL INFECTIONS
DE19505262C2 (en) Retrovirus from the HIV group and its use
EP1520860B1 (en) Recombinant protein PilC, method for its production and use thereof
DE60023501T2 (en) UNIVERSAL ALLEL EXCHANGE IN MYCOBACTERIUM BY CONDITIONALLY TRANSDUCATING PHAGEN
DE69434196T3 (en) An inserted promoter containing recombinant lactic acid bacterium
DE69936867T2 (en) DNS SEQUENCE, METHOD FOR DETECTION AND MANUFACTURE AND USE
DE69535705T2 (en) FUNCTIONAL SURVEYS AND / OR EXPRESSION VECTORS IN MYCOBACTERIA
DE69333534T2 (en) THERMOSENSITIVE PLASMIDE
DE60120634T2 (en) A method of producing a recombinant yeast S. cerevisiae by the use of essential and regulatory genes of mycobacteria
Sanderson et al. Mycobacterial diseases of the gut: some impact from molecular biology.
DE60023158T2 (en) PHAGENRESISTENT STREPTOCOCCUS THERMOPHILUS
EP1362125B8 (en) METHOD FOR IDENTIFYING of BIOLOGICALLY ACTIVE STRUCTURES OF MICROBIAL PATHOGENS
DE69916081T2 (en) NON-HOMOLOGUES YARROWIA LIPOLYTICA TRANSFORMATION PROCESS
Alam et al. Analysis of genomic diversity and evolution of the low-level antiseptic resistance gene smr in Staphylococcus aureus
EP1245683B1 (en) Method for making a recombinant S. cerevisiae by using essential and regulatory genes of mycobacteria
DE69531539T2 (en) Phage resistant streptococcus
DE69735885T2 (en) DETECTION OF PYRAZINAMIDE RESISTANT MYCOBACTERIA AND METHOD FOR THE TREATMENT OF MYCOBACTERIAL INFECTIONS
DE60023854T2 (en) POLYNUCLEOTIDES FOR MUTAGENESIS IN MUSHROOMS CONTAINING A FUNCTIONAL MAGNAPORTHE GENE AND AN IMPALA TRANSPOSON
DE19530336C2 (en) Sequential hybridization of fungal cell DNA and methods for detecting and identifying fungal cells in clinical material

Legal Events

Date Code Title Description
8364 No opposition during term of opposition