DE4318450A1

DE4318450A1 - New primers for PCR detection of Listeria - including individual species, also new peptide(s) for raising antibodies for immunochemical detection

Info

Publication number: DE4318450A1
Application number: DE19934318450
Authority: DE
Inventors: Peter Dr Schubert; Siegfried Dr Neumann; Martina Dr Pawelzik; Winfried Dr Linxweiler; Christa Dr Burger; Gottfried Dr Hofmann; Andreas Bubert; Werner Prof Dr Goebel; Stefan Dr Koehler
Original assignee: Merck Patent GmbH
Current assignee: Merck Patent GmbH
Priority date: 1992-06-11
Filing date: 1993-06-03
Publication date: 1993-12-16

Abstract

New primers from the iap (invasion-associated protein) gene for amplification of nucleic acid are of formulae (Va)-(Vh) and/or their complementary sequences. X1AATATGAAAAAAGCX2 (Va) X1TAACAGCAATTCAAEX2 (Ve) X1GCTTCGGTCGCGTAX2 (Vb) X1CTGAGGTAGCEAGCX2 (Vf) X1ACAGCTGGATTGCX2 (Vc) X1AGCACTCCAGTTGTTAX2 (Vg) X1ACTGCTAACACAGCTX2 (Vd) X1GCAGTTTCTAAACCTX2 (Vh) X1 and X2 = H or 1-20 nucleotide residues. USE - The primers are used to detect listeria by gene amplification and the Ab to detect them by usual immunoassay methods (partic. ELISA). By appropriate choice of reagents partic. species can be detected (esp. L. monocytogenes).

Description

Die Erfindung betrifft Mittel und Verfahren zum Nachweis von Bakterien der Gattung Listeria, insbesondere von L. monocytogenes.The invention relates to means and methods for the detection of Bacteria of the genus Listeria, especially L. monocytogenes.

Die Mitglieder der Gattung Listeria sind grampositive stäbchen förmige Bakterien, die ubiquitär vorkommen. Zu dieser Gattung gehören sieben verschiedene Arten: L. monocytogenes, L. ivanovii, L. seeligeri, L. welshimeri, L. innocua, L. murrayi und L. grayi. Von diesen ist nur L. monocytogenes pathogen für Menschen, gefähr det sind insbesondere Neugeborene, Schwangere und Ältere, sowie Patienten unter Immunsuppression. Häufig verlaufen Infektionen mit L. monocytogenes tödlich.The members of the genus Listeria are gram-positive sticks shaped bacteria that are ubiquitous. To this genus belong to seven different species: L. monocytogenes, L. ivanovii, L. seeligeri, L. welshimeri, L. innocua, L. murrayi and L. grayi. Of these, only L. monocytogenes is pathogenic to humans Det are especially newborns, pregnant women and the elderly, as well Patients on immunosuppression. Infections often run along L. monocytogenes fatal.

Die Ursache für Infektionen mit Listerien sind häufig kontaminierte Lebensmittel, in denen sich die Keime selbst bei niedrigen Tempera turen (um 4°C) vermehren können. So wurden verschiedene Listerien- Epidemien auf den Verzehr von kontaminierten Nahrungsmitteln, wie z. B. Rohmilch, Käse oder Krautsalat, zurückgeführt. Schnelle Nach weisverfahren für den Nachweis von Listerien, insbesondere in Lebensmitteln oder klinischen Proben, sind also dringend erforder lich. Diese Verfahren müssen zudem zwischen L. monocytogenes und den nicht-humanpathogenen Arten unterscheiden können. Weiterhin ist erforderlich, daß alle Varianten der humanpathogenen Art L. monocytogenes nachgewiesen werden können.The cause of infections with listeria are often contaminated Food in which the germs are found even at low temperatures doors can increase (by 4 ° C). So different Listeria Epidemics on the consumption of contaminated food, such as e.g. B. raw milk, cheese or coleslaw, returned. Fast after method for the detection of Listeria, especially in Food or clinical samples are urgently needed Lich. These procedures must also be between L. monocytogenes and differentiate between the non-human pathogenic species. Still is required that all variants of the human pathogenic type L. monocytogenes can be detected.

In jüngster Zeit wird in der Fachwelt diskutiert, ob die Listerienart L. innocua als Leitkeim für das mögliche Vorkommen von L. monocytogenes sinnvoll eingesetzt werden könnte. Deswegen wäre auch ein Nachweis von L. innocua nützlich. Recently, experts have been discussing whether the Listeria species L. innocua as a key germ for the possible occurrence of L. monocytogenes could be used sensibly. That’s why evidence of L. innocua is also useful.

Der Nachweis von L. monocytogenes erfolgt bisher mittels Verfahren, die auf der Kultur der Mikroorganismen beruhen. Das in Int. J. Food Microbiol. 4 (1987), 249-256 beschriebene Verfahren dauert zwei Wochen. Ein etwas schnelleres Verfahren wird von der International Dairy Foundation (IDF) empfohlen; es dauert aber mindestens 6-8 Tage. Beide Verfahren sind wegen ihrer Dauer für eine schnelle Identifizierung ungeeignet. Beide Verfahren sind zudem arbeitsintensiv, da für die Gewinnung von Einzelkolonien Nährmedien mehrfach inokuliert werden müssen, und da anschließend die Isolate mittels biochemischer und serologischer Untersuchungsmethoden charakterisiert werden müssen.L. monocytogenes has so far been detected using methods based on the culture of the microorganisms. The int. J. Food Microbiol. 4 (1987), 249-256, method takes two Weeks. A slightly faster procedure is used by the International Dairy Foundation (IDF) recommended; but it takes at least 6-8 Days. Both procedures are quick for their duration Identification unsuitable. Both procedures are also labor-intensive, since nutrient media are used to obtain individual colonies have to be inoculated several times, and then the isolates using biochemical and serological examination methods must be characterized.

Die bisher auf dem Markt befindlichen immunologischen Tests dauern zwar nur wenige Stunden, erlauben jedoch nicht die wichtige Unterscheidung zwischen verschiedenen Arten von Listerien. Auch bei diesen Verfahren wird eine zweitägige Voranreicherungskultur benötigt.The immunological tests that have been on the market to date are ongoing only a few hours, but do not allow the important one Differentiate between different types of listeria. Also at this process becomes a two-day pre-enrichment culture needed.

In Appl. Environ. Microbiol. 54 (1988), 2933-2937 ist eine Methode beschrieben, bei der L. monocytogenes mit Hilfe von synthetischen Oligodesoxyribonukleotid-Sonden spezifisch nachgewiesen wird. Jedoch sind die verwendeten Sonden nicht ausreichend spezifisch, da sie auch mit der nicht human-pathogenen Art L. seeligeri reagieren. Auch für dieses Verfahren ist eine vorherige Vermehrung der Keime notwendig: Lebensmittelproben bzw. deren Verdünnungen werden auf Agarplatten ausgestrichen, die beimpften Platten werden bebrütet und anschließend mit einer radioaktiv markierten DNS-Sonde im colony Hybridisierungsverfahren untersucht. Der Nachweis erfolgt durch Autoradiographie. Auch diese Methode ist arbeits- und zeitaufwendig.In Appl. Environ. Microbiol. 54 (1988), 2933-2937 is a method described in the L. monocytogenes with the help of synthetic Oligodeoxyribonucleotide probes is specifically detected. However, the probes used are not sufficiently specific because they also react with the non-human pathogenic L. seeligeri. For this procedure, too, there is a prior multiplication of the germs necessary: Food samples or their dilutions are opened Spread out agar plates, the inoculated plates are incubated and then with a radiolabelled DNA probe in the colony hybridization method examined. Evidence is provided by autoradiography. This method is also labor and time consuming.

In Infect. Immun. 58, 1943-1950 (1990) wird die DNA-Sequenz des iap-Gens (invasion-associated protein) von L. monocytogenes beschrieben. Dieses Gen kodiert ein Protein, das auch unter der Bezeichnung p60 bekannt ist, und das in Varianten in allen Listeria Arten vorkommt. Bei L. monocytogenes ist dieses Protein für die Fähigkeit der Bakterien, in tierische Zellen einzudringen, verantwortlich. Ein Polynukleotid (400 Basen) mit einer Teilsequenz aus diesem Gen ist als DNA-Sonde geeignet, um L. monocytogenes von anderen Organismen zu unterscheiden.In Infect. Immune. 58, 1943-1950 (1990) the DNA sequence of L. monocytogenes iap (invasion-associated protein) gene described. This gene encodes a protein that is also under the Designation p60 is known, and in variants in all Listeria Species occurs. In L. monocytogenes this protein is for the Ability of bacteria to enter animal cells, responsible. A polynucleotide (400 bases) with a partial sequence from this gene is suitable as a DNA probe for L. monocytogenes from distinguish other organisms.

Die Polymerase-Ketten-Reaktion (Polymerase-Chain-Reaction: PCR) erlaubt die in-vitro Vermehrung von Nukleinsäuren, eine Vorkultur ist bei diesem Verfahren im allgemeinen nicht notwendig. Damit die Reaktion gestartet werden kann, werden kurze Nukleinsäurestücke (primer) benötigt, die den zu vermehrenden Genomabschnitt ein grenzen. Üblicherweise werden zwei Primer benutzt, die mit jeweils einem Nukleinsäurestrang hybridisieren. Einer der Primer besitzt deswegen die Komplementärsequenz des jeweiligen Genabschnittes. Die Auswahl dieser Primer bestimmt die Spezifität der Nachweisreaktion. Für den Nachweis von L. monocytogenes ist dieses Verfahren in Appl. Environmental Microbiology 57, 606-609 (1991), in Letters Appl. Microbiol. 11, 158-162 (1990) und in J. Appl. Bact. 70, 372-379 (1991) beschrieben. Dort finden sich nähere Angaben zu den Einzelheiten dieser Verfahren. Die DNA-Primer binden an das Gen für Listeriolysin, dem Listeria- Hämolysin. Die Spezifität dieser Primer ist, wie aus Anmerkungen in J. Appl. Bact. 70 hervorgeht, zumindestens unsicher: L. seeligeri läßt sich nicht sicher von L. monocytogenes unterscheiden. Mit Hilfe der bisher beschriebenen Primer in der PCR-Technik ist somit der sichere Nachweis von L. monocytogenes bisher nicht möglich. The polymerase chain reaction (PCR) allows the in vitro multiplication of nucleic acids, a preculture is generally not necessary in this process. So that Reaction can be started, short pieces of nucleic acid (primer) needed, the genome section to be propagated limit. Usually two primers are used, each with hybridize to a nucleic acid strand. One of the primers owns therefore the complementary sequence of the respective gene segment. The Selection of these primers determines the specificity of the detection reaction. For the detection of L. monocytogenes, this method is described in Appl. Environmental Microbiology 57, 606-609 (1991), in Letters Appl. Microbiol. 11, 158-162 (1990) and in J. Appl. Bact. 70, 372-379 (1991). There you will find more information on the Details of these procedures. The DNA primers bind to the gene for Listeriolysin, the Listeria hemolysin. The specificity of this Primer is, as from comments in J. Appl. Bact. 70 shows at least insecure: L. seeligeri is not safe from L. distinguish monocytogenes. With the help of those described so far Primer in PCR technology is therefore the reliable detection of L. monocytogenes not yet possible.

Polyklonale Antikörper gegen L. monocytogenes p60 reagieren auch mit dem Protein p60 von anderen, apathogenen Listerienarten. Derartige Antikörper sind deswegen ungeeignet, L. monocytogenes durch immunologische Verfahren spezifisch nachzuweisen. Es ist zwar prinzipiell möglich, ein derartiges polyvalentes Antiserum durch spezifische Absorption von störenden Antikörperfraktionen zu reinigen: Dazu müßte gegebenenfalls Protein p60 von allen anderen Listeria-Arten an Träger kovalent gebunden werden. Die nicht erwünschten Antikörperfraktionen lassen sich spezifisch absorbieren; übrig bleibt ein Antiserum, das nur noch mit Protein p60 aus L. monocytogenes reagiert. Diese Methode zur Gewinnung eines für L. monocytogenes spezifischen Serums ist aufwendig: Man benötigt erhebliche Mengen von dem polyvalenten Antiserum als Ausgangsmaterial, sowie zusätzlich die iap-Genprodukte p60 von verschiedenen Listerienarten. Bei der Gewinnung von monoklonalen Antikörpern gegen Protein p60 würde dieser hohe Materialbedarf nicht auftreten, jedoch ist die Entstehung von Antikörpern gegen bestimmte Epitope zufallsbedingt: Zunächst muß eine große Zahl von antikörperproduzierenden Zellklonen hergestellt werden, aus denen dann Klone mit geeigneten Antikörpern ausgewählt werden müssen. Es ist bisher nicht möglich, gezielt Antikörper gegen Epitope zu gewinnen, die für L. monocytogenes spezifisch sind. Ähnliches gilt für Antikörper gegen Epitope, die für L. innocua spezifisch sind.Polyclonal antibodies against L. monocytogenes p60 also react with the p60 protein from other apathogenic listeria species. Antibodies of this type are therefore unsuitable, L. monocytogenes specifically detected by immunological methods. It is in principle possible through such a polyvalent antiserum specific absorption of interfering antibody fractions clean: To do this, protein p60 would have to be removed from all others Listeria species are covalently bound to carriers. They don't desired antibody fractions can be specific absorb; what remains is an antiserum that only has protein p60 from L. monocytogenes reacts. This method of extraction a serum specific for L. monocytogenes is expensive: Man requires significant amounts of the polyvalent antiserum Starting material, as well as the iap gene products p60 from different types of Listeria. When obtaining monoclonal Antibodies to protein p60 would cause this high material requirement does not occur, however, the formation of antibodies against certain epitopes are random: First, a large number of antibody-producing cell clones are made from which then clones with suitable antibodies must be selected. It So far it has not been possible to target antibodies against epitopes which are specific for L. monocytogenes. The same applies for antibodies against epitopes specific for L. innocua.

Aufgabe der vorliegenden Erfindung ist es, verbesserte Mittel und Methoden für die Differenzierung von Bakterien der Gattung Listeria, insbesondere für den Nachweis von Bakterien der Art L. monocytogenes bereitzustellen. Insbesondere werden erfindungsgemäß für die PCR-Technik geeignete Primer-Sequenzen, sowie Peptide zur gezielten Erzeugung von spezifischen Antikörpern, die für den artspezifischen immunologischen Nachweis von Bakterien der Arten L. monocytogenes und L. innocua geeignet sind, bereitgestellt. The object of the present invention is to provide improved means and Methods for the differentiation of bacteria of the genus Listeria, especially for the detection of bacteria of type L. to provide monocytogenes. In particular, according to the invention primer sequences suitable for the PCR technique, and peptides for targeted production of specific antibodies for the species-specific immunological detection of bacteria of the species L. monocytogenes and L. innocua are provided.

Gegenstand der Erfindung sind Primer, ausgewählt aus dem iap-Gen, für die Amplifikation von Nukleinsäuren, beispielsweise mittels der Polymerase-Ketten-Reaktion, dadurch gekennzeichnet, daß die Primer als Teilsequenz mindestens eine Sequenz nach einer der Formeln Ia bis Ib und/oder eine zugehörige Komplementärsequenz enthalten, wobei vor und/oder hinter dieser Teilsequenz bis zu 20 weitere Nukleotidbausteine gebunden vorliegen können. Derartige Primer sind geeignet für den Nachweis und die Differenzierung von Bakterien der Gattung Listeria, insbesondere auch der Art L. monocytogenes mittels PCR.The invention relates to primers selected from the iap gene, for the amplification of nucleic acids, for example by means of the Polymerase chain reaction, characterized in that the primers as a partial sequence at least one sequence according to one of the formulas Ia up to Ib and / or an associated complementary sequence, with up to 20 more before and / or after this partial sequence Nucleotide building blocks can be bound. Such primers are suitable for the detection and differentiation of bacteria from the Genus Listeria, especially of the species L. monocytogenes using PCR.

AATATGAAAAAAGC (Ia)AATATGAAAAAAGC (Ia)

GCTTCGGTCGCGTA (Ib)GCTTCGGTCGCGTA (Ib)

ACAGCTGGGATTGC (Ic)ACAGCTGGGATTGC (Ic)

ACTGCTAACACAGCT (Id)ACTGCTAACACAGCT (Id)

TAACAGCAATTCAAG (Ie)TAACAGCAATTCAAG (Ie)

CTGAGGTAGCGAGC (If)CTGAGGTAGCGAGC (If)

AGCACTCCAGTTGTTA (Ig)AGCACTCCAGTTGTTA (Ig)

GCAGTTTCTAAACCT (Ih)GCAGTTTCTAAACCT (Ih)

Besonders bevorzugt sind dabei Primer, die eine Sequenz nach einer der Formeln IIa bis IIh und/oder eine zugehörige Komplementarsequenz enthalten.Primers which have a sequence after a of the formulas IIa to IIh and / or an associated complementary sequence contain.

GTCGACTGAATATGAAAAAAGCAAC (IIa)GTCGACTGAATATGAAAAAAGCAAC (IIa)

TTGGCTTCGGTCGCGTAGAATTCATA (IIb)TTGGCTTCGGTCGCGTAGAATTCATA (IIb)

GCTACAGCTGGGATTGCGGT (IIc)GCTACAGCTGGGATTGCGGT (IIc)

CAAACTGCTAACACAGCTACT (IId)CAAACTGCTAACACAGCTACT (IId)

CAATAACAGCAATTCAAGTGC (IIe)CAATAACAGCAATTCAAGTGC (IIe)

TAACTGAGGTAGCGAGCGAA (IIf)TAACTGAGGTAGCGAGCGAA (IIf)

ACTAGCACTCCAGTTGTTAAAC (IIg)ACTAGCACTCCAGTTGTTAAAC (IIg)

CCAGCAGTTTCTAAACCTGCT (IIh)CCAGCAGTTTCTAAACCTGCT (IIh)

Gegenstand der Erfindung sind weiterhin Peptide, die als Teil sequenz mindestens eine Sequenz nach einer der Formeln IIIa bis IIIi enthalten, wobei vor und/oder hinter dieser Teilsequenz bis zu jeweils sieben Aminosäuren peptidisch gebunden vorliegen können.The invention further relates to peptides which are part of sequence at least one sequence according to one of the formulas IIIa to IIIi included, with up to and / or behind this partial sequence each seven amino acids can be peptide-bound.

ProValAlaProThrGln (IIIa)ProValAlaProThrGln (IIIa)

ThrGlnAlaThrThrProAla (IIIb)ThrGlnAlaThrThrProAla (IIIb)

AlaIleLysGlnThrAlaAsnThrAla (IIIc)AlaIleLysGlnThrAlaAsnThrAla (IIIc)

GlnGlnThrAlaProLysAlaProThr (IIId)GlnGlnThrAlaProLysAlaProThr (IIId)

ValAsnAsnGluValAlaAlaAlaGluLysThrGlu (IIIe)ValAsnAsnGluValAlaAlaAlaGluLysThrGlu (IIIe)

ThrProValValLysGlnGluValLys (IIIf)ThrProValValLysGlnGluValLys (IIIf)

ValLysGlnProThrThrGlnGlnThrAlaPro (IIIg)ValLysGlnProThrThrGlnGlnThrAlaPro (IIIg)

IleLysGlnProThrLysThrValAlaPro (IIIh)IleLysGlnProThrLysThrValAlaPro (IIIh)

GlnGlnThrThrThrLysAlaProThr (IIIi)GlnGlnThrThrThrLysAlaProThr (IIIi)

Besonders bevorzugt sind dabei Peptide mit einer Sequenz nach einer der Abb. 2a-i, sowie nach einer der Abb. 5a-d.Peptides with a sequence according to one of FIGS. 2a-i and one of FIGS. 5a-d are particularly preferred.

Gegenstand der Erfindung ist auch die Verwendung eines der genann ten Peptide mit einer Teilsequenz nach einer der Formeln IIIa bis IIIi zur Herstellung von immunogenen Konjugaten. Besonders bevorzugt sind für diesen Verwendungszweck Peptide mit einer Sequenz nach einer der Abb. 2a-i, sowie nach einer der Abbildungen 5a-d.The invention also relates to the use of one of the peptides mentioned with a partial sequence according to one of the formulas IIIa to IIIi for the preparation of immunogenic conjugates. Peptides with a sequence according to one of FIGS. 2a-i and according to one of FIGS. 5a-d are particularly preferred for this purpose.

Gegenstand der Erfindung ist auch ein Antikörper, der ein Epitop bindet, das von dem Polypeptid nach Abbildung 3 gebildet wird, oder das ein Peptid nach einer der Formeln IIIa-IIIi, bevorzugt nach einer der Abb. 2a-i, sowie nach einer der Abb. 5a- d, enthält. The invention also relates to an antibody which binds an epitope which is formed by the polypeptide according to Figure 3, or which is a peptide according to one of the formulas IIIa-IIIi, preferably according to one of Figs. 2a-i, and according to one of Fig . 5a-d, contains.

Gegenstand der Erfindung ist ferner ein Antikörper, herstellbar durch Immunisierung eines Versuchstieres mit einem Polypeptid nach Fig. 3 oder mit einem immunogenen Konjugat, welches ein Peptid mit 7 bis 24 Aminosäuren ausgewählt aus dem Polypeptid nach Fig. 3 enthält.The invention further relates to an antibody which can be prepared by immunizing a test animal with a polypeptide according to FIG. 3 or with an immunogenic conjugate which contains a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3.

Gegenstand der Erfindung ist auch ein Verfahren zur Herstellung eines Antikörpers gerichtet gegen das Protein p60 aus Listerien, indem man ein Versuchstier mit einem Immunogen immunisiert und die Antikörper isoliert, dadurch gekennzeichnet, daß man als Immunogen ein Polypeptid nach Fig. 3 oder ein immunogenes Konjugat, das ein Polypeptid nach Fig. 3 enthält, verwendet. Bevorzugt sind dabei immunogene Konjugate, die ein Peptid mit 7 bis 24 Aminosäuren ausgewählt aus dem Polypeptid nach Fig. 3 enthalten, oder die ein Peptid nach einer der Formeln IVa-IVi enthalten, worin X³ und X⁴ jeweils unabhängig voneinander Wasserstoff, eine beliebige Aminosäure oder ein beliebiges Oligopeptid mit bis zu 7 Aminosäuren bedeuten.The invention also relates to a method for producing an antibody directed against the protein p60 from Listeria by immunizing a test animal with an immunogen and isolating the antibodies, characterized in that a polypeptide according to FIG. 3 or an immunogenic conjugate is used as the immunogen, which contains a polypeptide according to FIG. 3. Immunogenic conjugates which contain a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3 or which contain a peptide according to one of the formulas IVa-IVi are preferred, wherein X ³ and X ⁴ each independently of one another are hydrogen, any one Amino acid or any oligopeptide with up to 7 amino acids.

X³ProValAlaProThrGlnX⁴ (IVa)X³ProValAlaProThrGlnX⁴ (IVa)

X³ThrGlnAlaThrThrProAlaX⁴ (IVb)X³ThrGlnAlaThrThrProAlaX⁴ (IVb)

X³AlaIleLysGlnThrAlaAsnThrAlaX⁴ (IVc)X³AlaIleLysGlnThrAlaAsnThrAlaX⁴ (IVc)

X³GlnGlnThrAlaProLysAlaProThrX⁴ (IVd)X³GlnGlnThrAlaProLysAlaProThrX⁴ (IVd)

X³ValAsnAsnGluValAlaAlaAlaGluLysThrGluX⁴ (IVe)X³ValAsnAsnGluValAlaAlaAlaGluLysThrGluX⁴ (IVe)

X³ThrProValValLysGlnGluValLysX⁴ (IVf)X³ThrProValValLysGlnGluValLysX⁴ (IVf)

X³ValLysGlnProThrThrGlnGlnThrAlaProX⁴ (IVg)X³ValLysGlnProThrThrGlnGlnThrAlaProX⁴ (IVg)

X³IleLysGlnProThrLysThrValAlaProX⁴ (IVh)X³IleLysGlnProThrLysThrValAlaProX⁴ (IVh)

X³GlnGlnThrThrThrLysAlaProThrX⁴ (IVi)X³GlnGlnThrThrThrLysAlaProThrX⁴ (IVi)

Besonders bevorzugt sind dabei Peptide mit einer Sequenz nach einer der Abb. 2a-i, sowie nach einer der Abb. 5a-d. Peptides with a sequence according to one of FIGS. 2a-i and one of FIGS. 5a-d are particularly preferred.

Gegenstand der Erfindung ist schließlich die Verwendung eines Primers, der eine Teilsequenz nach einer der Formeln Ia-Ih oder bevorzugt eine Sequenz nach einer der Formeln IIa-IIh oder eine zugehörige Komplementärsequenz enthält, für den Nachweis von Bakterien der Gattung Listeria.The invention finally relates to the use of a Primers, which is a partial sequence according to one of the formulas Ia-Ih or preferably a sequence according to one of the formulas IIa-IIh or one contains associated complementary sequence for the detection of Bacteria of the genus Listeria.

Gegenstand der Erfindung sind auch Verfahren zum Nachweis von Bakterien der Gattung Listeria mittels eines Primers, der eine Teilsequenz nach einer der Formeln Ia-Ib oder bevorzugt eine Sequenz nach einer der Formeln IIa-IIh oder eine zugehörige Komplementärsequenz enthält.The invention also relates to methods for the detection of Bacteria of the genus Listeria using a primer, the one Partial sequence according to one of the formulas Ia-Ib or preferably one Sequence according to one of the formulas IIa-IIh or an associated one Contains complementary sequence.

Gegenstand der Erfindung ist weiterhin die Verwendung eines Anti körpers, der gegen ein Epitop aus der Polypeptidsequenz nach Fig. 3 gerichtet ist, oder der gegen eines der Epitope mit einer Aminosäuresequenz nach einer der Abb. 2a-i oder 5a-d gerichtet ist, für den Nachweis von Bakterien der Gattung Listeria.The invention furthermore relates to the use of an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or which is directed against one of the epitopes with an amino acid sequence according to one of FIGS. 2a-i or 5a-d for the detection of bacteria of the genus Listeria.

Gegenstand der Erfindung sind auch Verfahren zum Nachweis von Bakterien der Gattung Listeria mittels eines Antikörpers, der gegen ein Epitop aus der Polypeptidsequenz nach Fig. 3 gerichtet ist, oder der gegen eines der Epitope mit einer Aminosäuresequenz nach einer der Abb. 2a-i oder 5a-d gerichtet ist.The invention also relates to methods for the detection of bacteria of the genus Listeria by means of an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or against one of the epitopes with an amino acid sequence according to one of FIGS. 2a-i or 5a -d is directed.

Gegenstand der Erfindung sind schließlich Testzusammenstellungen zum Nachweis von Bakterien der Gattung Listeria, insbesondere der Art L. monocytogenes, mittels Amplifikation von Nukleinsäuren, beispielsweise mittels der Polymerase-Ketten-Reaktion, die einen Primer mit einer Teilsequenz nach einer der Formeln Ia-Ih oder bevorzugt mit einer Sequenz nach einer der Formeln IIa-IIh oder eine zugehörige Komplementärsequenz enthalten.Finally, the invention relates to test compilations for the detection of bacteria of the genus Listeria, in particular the Art L. monocytogenes, by means of amplification of nucleic acids, for example by means of the polymerase chain reaction, the one Primer with a partial sequence according to one of the formulas Ia-Ih or preferably with a sequence according to one of the formulas IIa-IIh or contain an associated complementary sequence.

Gegenstand der Erfindung sind ferner Testzusammenstellungen zum immunologischen Nachweis von Bakterien der Art Listeria monocytogenes, in denen ein Antikörper, der gegen ein Epitop aus der Polypeptidsequenz nach Fig. 3 gerichtet ist, oder der gegen eines der Epitope mit einer Aminosäuresequenz nach einer der Abb. 2a-i gerichtet ist, enthalten ist, sowie Testzusammen stellungen zum immunologischen Nachweis von Bakterien der Art Listeria innocua, in denen ein Antikörper, der gegen eines der Epitope mit einer Aminosäuresequenz nach einer der Abb. 5a- d gerichtet ist, enthalten ist.The invention also relates to test compositions for the immunological detection of bacteria of the Listeria monocytogenes type, in which an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or against one of the epitopes with an amino acid sequence according to one of FIG. 2a -i is directed, is included, as well as test compositions for the immunological detection of bacteria of the Listeria innocua type, in which an antibody which is directed against one of the epitopes with an amino acid sequence according to one of FIGS. 5a-d is contained.

Fig. 1 zeigt das Ergebnis der elektrophoretischen Auftrennung von Amplifikationsprodukten; die experimentellen Einzelheiten sind in Beispiel 8 dargestellt. Fig. 1 shows the result of electrophoretic separation of amplification products; the experimental details are shown in Example 8.

Fig. 2a-i zeigen die Aminosäuresequenzen der besonders bevor zugten immunogenen Peptide ausgewählt aus der Sequenz des Proteins p60 aus Listeria monocytogenes. FIGS. 2a-i show the amino acid sequences of particularly before ferred immunogenic peptides selected from the sequence of the protein p60 from Listeria monocytogenes.

Fig. 3 zeigt die Aminosäuresequenz des Polypeptides ausgewählt aus der Sequenz des Proteins p60 aus Listeria monocytogenes, dessen Epitope für den immunologischen Nachweis von Bakterien der Gattung Listeria geeignet sind. Fig. 3 shows the amino acid sequence of the polypeptide selected from the sequence of the protein p60 from Listeria monocytogenes, whose epitopes are suitable for the immunological detection of bacteria of the genus Listeria.

Fig. 4 zeigt für Vergleichszwecke die Aminosäuresequenz des Proteins p60 aus Listeria monocytogenes, die in zwei Teilabbildun gen a und b dargestellt ist. FIG. 4 shows the amino acid sequence of the p60 protein from Listeria monocytogenes for comparison purposes, which is shown in two partial images a and b.

Fig. 5a-d zeigen die Aminosäuresequenzen der besonders bevor zugten immunogenen Peptide ausgewählt aus der Sequenz des Proteins p60 aus Listeria innocua. FIG. 5a-d show the amino acid sequences of the immunogenic peptides is particularly ferred before selected from the sequence of the protein p60 from Listeria innocua.

Die Erfindung wird im folgenden näher beschrieben. Dabei wird in der Regel auf Einzelheiten von biochemischen, immunologischen und molekularbiologischen Verfahren, die dem Fachmann bekannt sind, und deren Einzelheiten in der Literatur beschrieben sind, nicht näher eingegangen. Bei diesen Verfahren kann man auch von an sich bekannten, hier nicht näher beschriebenen Varianten Gebrauch machen.The invention is described in more detail below. Thereby in usually on details of biochemical, immunological and molecular biological methods known to those skilled in the art, and the details of which are described in the literature received. With these methods one can also do it by itself known, not described variants use do.

Die erfindungsgemäßen Oligonukleotide nach den Formeln Ia-Ih und IIa-IIh sind als Primer für Nukleinsäureamplifikationsmethoden und somit zum spezifischen Nachweis von Bakterien der Gattung Listeria geeignet. Ihre Sequenzen sind in üblicher Weise vom 5′- Ende zum 3′-Ende geschrieben dargestellt. In Abhängigkeit von den Erfordernissen des jeweils verwendeten Amplifikationssystems werden entweder Desoxyribonukleotide oder auch Ribonukleotide mit den erfindungsgemäßen Sequenzen eingesetzt. Im letzteren Fall sind die Thymidinbausteine jeweils durch Uridinbausteine ersetzt. Dem Fachmann ist weiterhin bekannt, daß häufig der Austausch von einer oder weniger Basen in einer Nukleotidsequenz deren biologische Eigenschaften nicht verändert. Deswegen umfassen die erfindungsgemäßen Nukleotidsequenzen auch solche, die durch Basenaustausch aus den Sequenzen Ia-Ih und IIa-IIh abgeleitet sind, und die biologisch dieselbe Wirkung wie der jeweilige Primer mit der Ursprungssequenz zeigen. Da üblicherweise je ein Primer mit jeweils einem der DNA-Stränge reagieren soll, wird einer der Primer in der komplementären Sequenz eingesetzt. Die komplementäre Sequenz ergibt sich in bekannter Weise nach den Regeln der Basenpaarung.The oligonucleotides according to the formulas Ia-Ih and IIa-IIh are primers for nucleic acid amplification methods and thus for the specific detection of bacteria of the genus Listeria suitable. Their sequences are in the usual way from 5'- End written to the 3′-end. Depending on the Requirements of the amplification system used in each case either deoxyribonucleotides or ribonucleotides with the sequences according to the invention used. In the latter case they are Thymidine building blocks each replaced by uridine building blocks. The A person skilled in the art is furthermore aware that the exchange of a or fewer bases in a nucleotide sequence their biological Properties not changed. Therefore, the include nucleotide sequences according to the invention also those which Base exchange derived from sequences Ia-Ih and IIa-IIh and have the same biological effect as the respective primer show with the original sequence. Since usually one primer each one of the DNA strands should react, one of the primers used in the complementary sequence. The complementary sequence arises in a known manner according to the rules of base pairing.

Basierend auf der jeweiligen Sequenz können die erfindungsgemäßen Oligonukleotide nach dem Fachmann bekannten Verfahren, beispiels weise der Phosphotriester- oder der Phosphoamidit-Methode, synthe tisiert werden. Bevorzugt wird die Phosphoamidit-Methode benutzt, insbesondere unter Verwendung von mechanisierten Synthetizern. Die Methode ist in Tetrahedron Lett. (1981) 22:
1859-1862 beschrieben. Weitere Einzelheiten derartiger Synthese verfahren sind beispielsweise in Winnacker, E. L. (1985) Gene und Klone, Seite 44-61 (VCH-Verlagsgesellschaft mbH, Weinheim), beschrieben.Based on the respective sequence, the oligonucleotides according to the invention can be synthesized by methods known to the person skilled in the art, for example the phosphotriester or the phosphoamidite method. The phosphoamidite method is preferably used, in particular using mechanized synthesizers. The method is in Tetrahedron Lett. (1981) 22:
1859-1862. Further details of such synthesis processes are described, for example, in Winnacker, EL (1985) Gene and Clones, pages 44-61 (VCH-Verlagsgesellschaft mbH, Weinheim).

Die erfindungsgemäßen Primer sind geeignet für DNS-Amplifikation, beispielsweise mit Hilfe der Polymerase Chain Reaction (PCR). Dazu wird die DNS durch Erwärmen zunächst in die Einzelstränge zerlegt. Es werden zwei Primer verwendet, die jeweils mit dem homologen DNS- Abschnitt auf jeweils einem DNS-Strang hybridisieren. Der Genomab schnitt, der zwischen diesen beiden Primern liegt, wird vermehrt. Die an die DNS angelagerten Primer stellen die Startpunkte für die Amplifikation dar. Eine Polymerase, bevorzugt Taq-DNA-Polymerase, ergänzt anschließend in Gegenwart der vier Nukleotidtriphosphate den zweiten Strang entsprechend der Sequenz der ursprünglichen DNA. Anschließend werden die entstandenen Doppelstränge wieder durch Erwärmen in die Einzelstränge zerlegt. Dieser Amplikationszyklus kann mehrfach wiederholt werden. Nach einer ausreichenden Anzahl von Amplifikationszyklen kann die amplifizierte Nukleinsäure mittels bekannter Methoden nachgewiesen werden. Dazu kann die DNS mittels Elektrophorese aufgetrennt, anschließend mit Ethidiumbromid angefärbt und schließlich durch Fluoreszenz mittels UV-Anregung nachgewiesen werden. Möglich ist auch der Nachweis mittels DNS- Hybridisierung. Die Einzelheiten geeigneter Amplifikations- und Nachweismethoden sind auch in Übersichtsartikeln, z. B. Innis et al. (eds.) PCR Protocols (Academic Press, Inc., Harcourt Brace Jovanovich, Publishers) beschrieben. Ebenso sind andere Nukleinsäureamplifikationsverfahren, bei denen die erfindungsgemäßen Primer benutzt werden können, aus der Literatur bekannt. Zu diesen gehört die Ligase-Ketten-Reaktion, beschrieben von Bond, S. et al. (1990), Seite 425-434 bei Raven Press (New York, NY/USA). The primers according to the invention are suitable for DNA amplification, for example with the help of the polymerase chain reaction (PCR). To the DNA is first broken down into individual strands by heating. Two primers are used, each with the homologous DNA Hybridize sections on one DNA strand at a time. The genomab section that lies between these two primers is increased. The primers attached to the DNA are the starting points for the Amplification. A polymerase, preferably Taq DNA polymerase, then complements in the presence of the four nucleotide triphosphates the second strand according to the sequence of the original DNA. Then the resulting double strands are run through again Heating broken down into single strands. This amplification cycle can be repeated several times. After a sufficient number amplification cycles can amplify the nucleic acid can be demonstrated using known methods. The DNS separated by electrophoresis, then with ethidium bromide stained and finally by fluorescence using UV excitation be detected. Detection using DNS Hybridization. The details of suitable amplification and Detection methods are also in review articles, e.g. B. Innis et al. (eds.) PCR Protocols (Academic Press, Inc., Harcourt Brace Jovanovich, Publishers). Other nucleic acid amplification methods are also in which the invention Primers can be used, known from the literature. To this belongs to the ligase chain reaction described by Bond, S. et al. (1990), pages 425-434 at Raven Press (New York, NY / USA).

Die Auswahl der Primer nach den bevorzugten Formeln IIa-IIh bestimmt die Lage der Startpunkte auf dem iap-Gen und somit die Spezifität der Nachweisreaktion: So erwiesen sich Kombinationen von Primern ausgewählt aus der Sequenz des iap-Gens als unspezifisch und folglich ungeeignet für den Nachweis von Listerien mittels DNA- Amplifikation (siehe dazu beispielsweise Spalte F in Tabelle 1). Jedoch erwiesen sich andere ausgewählte Kombinationen als spezi fisch für die Gattung Listeria, andere für Gruppen von Listeria- Arten, wieder andere für einzelne Listeria-Arten. Insgesamt ist die Auswahl und die Zusammenstellung der Primer also kritisch. Die Auswahl eines der beiden Primer ist stets besonders kritisch, während der zweite Primer eher variiert werden kann, ohne die Spezifität der Nachweisreaktion nennenswert zu verändern. Folglich kann nach der Lehre der vorliegenden Erfindung für diesen zweiten Primer durchaus auch eine Sequenz gewählt werden, die nicht einer der Formeln Ia-Ih oder IIa-IIh entspricht.The selection of the primers according to the preferred formulas IIa-IIh determines the position of the starting points on the iap gene and thus the Specificity of the detection reaction: combinations of Primers selected from the sequence of the iap gene as non-specific and therefore unsuitable for the detection of listeria using DNA Amplification (see, for example, column F in Table 1). However, other selected combinations proved to be specific fish for the genus Listeria, others for groups of Listeria Species, still others for individual Listeria species. Overall, that is Selection and compilation of the primers is therefore critical. The Selection of one of the two primers is always particularly critical, while the second primer can rather be varied without the To change the specificity of the detection reaction significantly. Hence can according to the teaching of the present invention for this second Primer can also be chosen a sequence that is not one corresponds to the formulas Ia-Ih or IIa-IIh.

Erfindungsgemäß wird zumindestens einer der Primer aus den Formeln Ia-Ih oder bevorzugt aus den Formeln IIa-IIh ausgewählt. Der zweite Primer beeinflußt, wie bereits erläutert, die Spezifität der Amplifikationsreaktion wesentlich weniger als der erste Primer. Bevorzugt werden jedoch Kombinationen, bei denen beide Primer aus den Formeln Ia-Ih oder IIa-IIh ausgewählt werden. Beispiele für derartige bevorzugte Kombinationen sind (typische Ergebnisse sind in Tabelle 1 zusammengefaßt):According to the invention, at least one of the primers is from the formulas Ia-Ih or preferably selected from the formulas IIa-IIh. The second primer affects, as already explained, the specificity of the Amplification reaction much less than the first primer. However, combinations in which both primers are preferred the formulas Ia-Ih or IIa-IIh can be selected. examples for such preferred combinations are (typical results are summarized in Table 1):

a) When using a combination of a primer according to formula IIc with a primer with the complementary sequence according to formula IIb only the DNA of Listeria is amplified, not the DNA from other types of bacteria (see column D in Table 1).
b) When using a combination of a primer according to formula IId with a primer with the complementary sequence according to formula IIb only L. monocytogenes DNA is amplified, not however, the DNA from other listeria or other bacteria (see column B in table 1).
c) When using a combination of a primer according to formula IIf with a primer with the complementary sequence according to formula IIb only the DNA of certain Listeria species is amplified, namely exclusively from L. seeligeri, L. welshimiri and L. ivanovii A group-specific proof is therefore possible (see column E in table 1).
d) Another example of group-specific evidence consists in using a combination of a primer Formula IIh with a primer with the complementary sequence according to Formula IIb: It only uses the DNA of L. grayi and L. murrayi amplified (see column G in Table 1).
e) Since the amplification products of different Listeria species have different molecular weights, a combination of several primers (according to formulas IId, IIf, IIg and IIh) with the complementary sequence of formula IIb can be used to differentiate bacteria of the genus Listeria with a single polymerase reaction. Details of this further development of polymerase technology can be seen from Example 8 (see column H in Table 1 and FIG. 1).

Wie bereits erwähnt, ist es auch möglich, die Amplifikations produkte durch Nukleinsäurehybridisierung nachzuweisen. Dazu werden dem Reaktionsansatz nach der Amplifikation geeignete Nukleinsäure stücke (Nukleinsäuresonden) zugesetzt. Diese Nukleinsäuresonden besitzen eine Basensequenz, die ganz oder teilweise komplementär zu dem amplifizierten Genabschnitt ist. Diese Sonden sind außerdem für eine Nachweisreaktion markiert: Sie können radioaktive Isotope enthalten, oder Fluoreszenzmarkierungen tragen, oder auch durch Enzyme markiert sein. Geeignete Markierungsmittel, Methoden zu ihrer Einfügung in die Nukleinsäuresonde und Nachweismethoden sind dem Fachmann bekannt. As already mentioned, it is also possible to do the amplification detect products by nucleic acid hybridization. To do this suitable nucleic acid in the reaction mixture after amplification pieces (nucleic acid probes) added. These nucleic acid probes have a base sequence that is completely or partially complementary to the amplified gene segment. These probes are also for marked a detection reaction: you can use radioactive isotopes contain, or wear fluorescent labels, or by Enzymes must be labeled. Suitable markers, methods too their insertion into the nucleic acid probe and detection methods known to the expert.

Im besonderen kann die Amplifikationsreaktion spezifisch für die Gattung Listeria (wie oben unter a) näher beschrieben) oder für eine Gruppe von Listerien-Arten (wie oben unter c) und d) beschrie ben) ausgelegt sein. Durch Verwendung von Nukleinsäuresonden, die für jeweils eine Art spezifisch sind, kann dann im Reaktionsansatz, das Vorhandensein dieser Arten von Listerien erkannt werden. Wenn die Sonden verschiedene Markierungsmittel enthalten, können auch verschiedene Arten nebeneinander nachgewiesen werden. Diese Verfahrensvariante erlaubt also ähnlich der unter e) oben beschrie benen den Nachweis verschiedener Listerien-Arten nebeneinander.In particular, the amplification reaction can be specific for the Genus Listeria (as described above under a)) or for described a group of Listeria species (as above under c) and d) ben) must be designed. By using nucleic acid probes that are specific for each species, then in the reaction batch, the presence of these types of listeria can be recognized. If the probes may contain various labeling agents different species can be detected side by side. These Process variant thus allows similar to that described under e) above the detection of different Listeria species side by side.

Die Verwendung einer Nukleinsäuresonde oder eines Gemisches verschiedener Sonden, die mit Amplifikationsprodukten aller Listerienarten reagieren, erlaubt es, die Spezifität der Ampli fikationsreaktion zu überprüfen oder ein einheitliches Nachweis reagenz für verschiedene Listerien-Arten bereitzustellen.The use of a nucleic acid probe or a mixture different probes, with amplification products of all Listeria species react, allowing the specificity of the ampli to check the fiction reaction or provide uniform evidence to provide reagent for different types of Listeria.

Die erfindungsgemäßen Peptide nach den Formeln IVa-IVi und nach Abb. 2a-i, sowie nach Abb. 5a-1 können in immunogene Konjugate eingebaut werden. Mit Hilfe dieser Konjugate können Antikörper erzeugt werden, die es ermöglichen, Bakterien der Gattung Listeria mit immunologischen Methoden spezifisch nachzuweisen.The peptides according to the formulas IVa-IVi and according to Fig. 2a-i, as well as according to Fig. 5a-1, can be incorporated into immunogenic conjugates. With the help of these conjugates, antibodies can be generated which make it possible to specifically detect bacteria of the genus Listeria using immunological methods.

Die Positionen der erfindungsgemäßen Peptide in der Gesamtsequenz des Proteins p60 aus Listeria monocytogenes sind im folgenden angegeben:The positions of the peptides according to the invention in the overall sequence of the p60 protein from Listeria monocytogenes are as follows specified:

a) The sequence according to formula IIIa begins with proline at position 148 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2a, 2e and 2f.
b) The sequence according to formula IIIb begins with threonine at position 178 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2b and 2h.
c) The sequence according to formula IIIc begins with alanine at position 243 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2c and 2i.
d) The sequence according to formula IIId begins with glutamine at position 292 of the p60 sequence (Figure 4b); is in this region also the peptide according to FIG. 2d.
e) The sequence according to formula IIIe begins with valine at position 71 the p60 sequence (Fig. 4a); is in this region also the peptide according to FIG. 2g.

Die Sequenzen der erfindungsgemäßen Peptide nach Abb. 5a-d stammen aus der Gesamtsequenz des Proteins p60 aus Listeria innocua; gleiches gilt für die mit den Formeln IIIf-IIIi und IVf -IVi beschriebenen Teilsequenzen.The sequences of the peptides according to the invention shown in Fig. 5a-d come from the total sequence of the p60 protein from Listeria innocua; the same applies to the partial sequences described with the formulas IIIf-IIIi and IVf -IVi.

Dem Fachmann ist bekannt, daß häufig der Austausch von einer oder wenigen Aminosäuren in einem Peptid dessen biologische Eigenschaf ten nicht verändert. Deswegen umfassen die erfindungsgemäßen Peptidsequenzen auch solche, die durch Aminosäureaustausch aus den Sequenzen nach Fig. 2a-i, nach Fig. 5a-d oder nach Fig. 3 abgeleitet sind, und die biologisch dieselbe Wirkung wie die jeweiligen Peptide mit der Ursprungssequenz zeigen.It is known to the person skilled in the art that frequently the exchange of one or a few amino acids in a peptide does not change its biological properties. For this reason, the peptide sequences according to the invention also include those which are derived from the sequences according to FIGS. 2a-i, according to FIGS. 5a-d or according to FIG. 3 by amino acid exchange and which biologically show the same effect as the respective peptides with the original sequence.

Die Auswahl der erfindungsgemäßen Peptide erwies sich als kritisch. Wählt man beispielsweise ein bestimmtes Peptid, das von dem für L. monocytogenes spezifischen Genabschnitt kodiert wird, für die Erzeugung von Antikörpern aus, so zeigt überraschenderweise keines der Antiseren eine Reaktion mit dem p60-Protein.The selection of the peptides according to the invention proved to be critical. For example, if you choose a specific peptide that is different from that for L. monocytogenes specific gene segment is encoded for Production of antibodies from, surprisingly, none shows the antisera reacted with the p60 protein.

Basierend auf der Sequenz der Aminosäuren können die Peptide nach dem Fachmann bekannten Verfahren, beispielsweise dem T_boc- oder dem f_moc-Verfahren (tert.butyloxycarbonyl-, bzw. 9-fluorenyl methyloxycarbonyl-), synthetisiert werden. Einzelheiten dieser Verfahren sind beispielsweise in J. Am. Chem. Soc. 85, 2149-2154 (1963) und in Synthetic Polypeptides as Antigens (van Regenmortel et al. (eds.) Elsevier 1988 (Band 19 der Buchreihe Laboratory Techniques in Biochemistry and Molecular Biology) beschrieben. Bevorzugt wird das f_moc-Verfahren, insbesondere mechanisierte Verfahrensvarianten. Einzelheiten des Verfahrens, sowie geeignete Aminosäureschutz gruppen sind dem Fachmann bekannt.Based on the sequence of the amino acids, the peptides can be synthesized by methods known to the person skilled in the art, for example the T _boc or the f _moc method (tert-butyloxycarbonyl or 9-fluorenyl methyloxycarbonyl). Details of these processes are described, for example, in J. Am. Chem. Soc. 85, 2149-2154 (1963) and in Synthetic Polypeptides as Antigens (van Regenmortel et al. (Eds.) Elsevier 1988 (Volume 19 of the book series Laboratory Techniques in Biochemistry and Molecular Biology). The f _moc method is preferred, in particular Mechanized process variants, details of the process and suitable amino acid protective groups are known to the person skilled in the art.

Peptide sind im allgemeinen nicht geeignet, Antikörper zu erzeugen. Werden Peptide jedoch an hochmolekulare Trägersubstanzen gekoppelt, so entstehen immunogene Konjugate. Die erfindungsgemäßen Peptide lassen sich mit bekannten Trägersubstanzen konjugieren. Dazu gehören Polyäthylenglykole, Serumalbumine, KLH (Keyhole Limpet Hemocyanin; Hämocyanin von Napfschnecken), Ovalbumin, Glucosedehydrogenase aus Bacillus megaterium und PPD (purified protein derivative of tuberculin). Bevorzugte Trägersubstanzen sind KLH und Glucosedehydrogenase aus B. megaterium.Peptides are generally not suitable for generating antibodies. However, if peptides are coupled to high-molecular carrier substances, this is how immunogenic conjugates are formed. The peptides according to the invention can be conjugated with known carriers. To include polyethylene glycols, serum albumin, KLH (Keyhole Limpet Hemocyanin; Limpet haemocyanin), ovalbumin, Bacillus megaterium glucose dehydrogenase and PPD (purified protein derivative of tuberculin). Preferred carriers are KLH and glucose dehydrogenase from B. megaterium.

Außerdem werden zusätzlich häufig Brückenverbindungen (linker) eingesetzt. Dies sind niedermolekulare organische Verbindungen mit mindestens zwei verknüpfbaren funktionellen Gruppen. Geeignete Verbindungen sind dem Fachmann bekannt; dazu gehören beispiels weise: 1,2-Diaminoethan, Bernsteinsäure, β-Alanin, 1,6- Diaminohexan, 6-Aminocapronsäure, Adipinsäure, Cystein. Bevorzugt wird Cystein als Linker eingesetzt, wobei dieser Aminosäurerest bereits bei der Synthese des Peptides eingebaut wird. Linker, die sowohl eine Amino- als auch eine Carboxylfunktion enthalten (z. B. β-Alanin, 6-Aminocapronsäure oder Cystein), können wahlweise am C- oder N-Terminus des Peptids angeknüpft werden. Zur Herstellung der Bindungen zwischen Peptid und Trägersubstanz werden bevorzugt m- Maleimidobenzoyl-N-hydroxysuccinimidester (MBS) eingesetzt.In addition, bridge connections (left) are often used. These are low molecular weight organic compounds with at least two linkable functional groups. Suitable Connections are known to the person skilled in the art; these include, for example wise: 1,2-diaminoethane, succinic acid, β-alanine, 1,6- Diaminohexane, 6-aminocaproic acid, adipic acid, cysteine. Prefers cysteine is used as a linker, this amino acid residue is already incorporated in the synthesis of the peptide. Linker who contain both an amino and a carboxyl function (e.g. β-alanine, 6-aminocaproic acid or cysteine), can optionally on the C- or the N-terminus of the peptide. To make the Bonds between peptide and carrier are preferred m Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) used.

Die genannten immunogenen Konjugate dienen dazu, nach bekannten Verfahren in Versuchstieren Antikörper zu erzeugen. Üblicherweise werden für diesen Zweck Säugetiere, beispielsweise Schaf, Ziege, Kaninchen oder Mäuse benutzt. Kaninchen sind für die Erzeugung polyklonaler Antikörper bevorzugt. Es ist aber auch möglich, mit Hilfe der erfindungsgemäßen immunogenen Konjugate monoklonale Antikörper herzustellen.The immunogenic conjugates mentioned serve, according to known Methods to generate antibodies in experimental animals. Usually mammals such as sheep, goats, Rabbits or mice used. Rabbits are for production polyclonal antibody preferred. But it is also possible to use With the help of the immunogenic conjugates monoclonal To produce antibodies.

Einzelheiten der immunologischen Verfahren sind dem Fachmann bekannt. Hinweise zur Durchführung dieser Verfahren sind außerdem vielfaltig in der Literatur anzutreffen; beispielsweise seien genannt:
_* Antibodies, E. Harlow und D. Lane, Cold Spring Harbor (1988)
_* Woodard, L.F. und Jasman, R.L. (1985) Vaccine 3, 137-144
_* Woodard, L.F. (1989) Laboratory Animal Sci 39, 222-225
_* Handbook of Experimental Immunology (1986) Weir, D.M. et al. eds.; Blackwell Scientific Publications, Oxford, GB.Details of the immunological methods are known to the person skilled in the art. There are also various references to the implementation of these procedures in the literature; Examples include:
_* Antibodies, E. Harlow and D. Lane, Cold Spring Harbor (1988)
_* Woodard, LF and Jasman, RL (1985) Vaccine 3, 137-144
_* Woodard, LF (1989) Laboratory Animal Sci 39, 222-225
_* Handbook of Experimental Immunology (1986) Weir, DM et al. eds .; Blackwell Scientific Publications, Oxford, GB.

Zu diesen Verfahren gehören beispielsweise die Konjugations- und Immunisierungsverfahren, sowie die Herstellung und Aufreinigung von Antikörpern und auch immunologische Nachweisverfahren. Zu den immunologischen Nachweisverfahren, bei denen erfindungsgemäße Antikörper benutzt werden können, gehören bevorzugt Agglutinations verfahren, immunometrische Nachweisverfahren, die Immuno-Blot- Verfahren und insbesondere die Sandwich-(ELISA)-Verfahren. These methods include, for example, conjugation and Immunization procedures, as well as the production and purification of Antibodies and also immunological detection methods. To the immunological detection methods in which the invention Antibodies that can be used preferably include agglutinations method, immunometric detection method, the immuno-blot Processes and in particular the sandwich (ELISA) process.

Der Begriff Antikörper umfaßt erfindungsgemäß sowohl Immunglobuline als auch Antiseren. Es ist dem Fachmann weiterhin bekannt, daß häufig statt eines einzigen Antikörpers, der gegen ein einzelnes Epitop gerichtet ist, eine Mischung von verschiedenen Antikörpern mit verschiedener Spezifität benutzt werden kann. Dadurch resultieren Vorteile, insbesondere bezüglich der Nachweis empfindlichkeit. Dies trifft im besonderen für monoklonale Antikörper, aber auch für andere Antikörper zu, die gegen jeweils ein Epitop gerichtet sind. Entsprechend kann es vorteilhaft sein, mehrere Antikörper, die gegen verschiedene Peptidstrukturen nach den Formeln IIIa-IIIi oder nach einer der Abb. 3, 2a-i oder 5a-d gerichtet sind, für die erfindungsgemäße Verwendung und/oder die erfindungsgemäßen Verfahren zu kombinieren. According to the invention, the term antibody encompasses both immunoglobulins and antisera. It is also known to the person skilled in the art that instead of a single antibody which is directed against a single epitope, it is frequently possible to use a mixture of different antibodies with different specificity. This results in advantages, particularly with regard to detection sensitivity. This is particularly true for monoclonal antibodies, but also for other antibodies that are directed against an epitope. Accordingly, it may be advantageous to combine several antibodies which are directed against different peptide structures according to the formulas IIIa-IIIi or according to one of FIGS. 3, 2a-i or 5a-d, for the use according to the invention and / or the methods according to the invention.

Einzelheiten der Herstellung der erfindungsgemäßen Primer und Peptide, sowie ihrer Verwendung sind aus den folgenden Beispielen ersichtlich. Weitere methodische Einzelheiten entnimmt der Fachmann der zitierten Literatur. Die Beispiele sollen den Gegenstand der Erfindung illustrieren und stellen keine Einschränkung der Erfindung dar.Details of the preparation of the primers and Peptides, as well as their use, are from the following examples evident. The person skilled in the art takes further methodical details the cited literature. The examples are intended to be the subject of Invention illustrate and do not limit the Invention.

Examples Example 1: Preparation of the primer according to formula IIa

Der Primer nach Formel IIa wird mit dem DNA-Syntheziser 380A von Applied Biosystems nach der Phosphoamidit-methode hergestellt. Die Grundzüge der Methode sind in Tetrahedron Lett. (1981) 22 : 1859- 1862, beschrieben. Weitere Einzelheiten finden sich in der Dokumentation des Geräteherstellers.The primer according to Formula IIa is made with the DNA synthesizer 380A from Applied Biosystems manufactured using the phosphoamidite method. The The main features of the method are in Tetrahedron Lett. (1981) 22: 1859- 1862. Further details can be found in the Documentation from the device manufacturer.

Entsprechend werden die Primer nach Formel IIc, IId, IIf, IIg und IIh hergestellt. Die Primer nach Formel IIb und IIe werden in der jeweiligen Komplementärsequenz (IIb: TTGGCTTCGGTCGCGTAGAATTCATA; IIe: GCACTTGAATTGCTGTTATTG) hergestellt.The primers according to formula IIc, IId, IIf, IIg and IIh made. The primers according to formulas IIb and IIe are used in the respective complementary sequence (IIb: TTGGCTTCGGTCGCGTAGAATTCATA; IIe: GCACTTGAATTGCTGTTATTG).

Example 2: Execution of the PCR reaction to the species-specific Detection of L. monocytogenes

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Puffer (10 mM Tris-HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl) suspendiert und 5 Minuten auf 110 °C erhitzt. Anschließend werden Primer nach Formel IId und IIe (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq- Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris- HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl). Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 30 Sekunden auf 55 °C (Bindungsphase) und für eine Minute auf 72 °C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72°C) mit 5 Minuten Dauer ausgeführt.A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IId and IIe (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 55 ° C. (binding phase) for 30 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

Die PCR-Produkte werden in einem Polyacrylamid-Gel (6%) in einem Laufpuffer Tris-Borat (je 50 mM) mit EDTA (2,5 mM) aufgetrennt. Anschließend werden die aufgetrennte PCR-Produkte durch Anfärbung mit Ethidiumbromid (0,1 mg/ml in Wasser) angefärbt und Bestrahlung mit UV-Licht (260 nm) sichtbar gemacht.The PCR products are in a polyacrylamide gel (6%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

Nur wenn DNA oder Zellen von L. monocytogenes in der Probe vorhanden sind, werden PCR-Produkte beobachtet (siehe Spalte A in Tabelle 1).Only if DNA or cells from L. monocytogenes in the sample PCR products are observed (see column A in Table 1).

Example 3: Implementation of the PCR reaction to the species-specific Detection of L. monocytogenes

Das in Beispiel 2 beschriebene Verfahren wird unter Verwendung der Primer nach Formel IId und IIb (siehe Beispiel 1) anstelle der Primer nach Formel IId und IIe wiederholt. Auch in diesem Fall werden nur PCR-Produkte beobachtet, wenn DNA oder Zellen von L. monocytogenes in der Probe vorhanden sind (siehe Spalte B in Tabelle I). The procedure described in Example 2 is carried out using the Primers according to formulas IId and IIb (see example 1) instead of Repeat primers according to formulas IId and IIe. In this case, too PCR products are only observed when DNA or cells from L. monocytogenes are present in the sample (see column B in Table I).

Example 4: Implementation of the PCR reaction for enjoyment-specific Detection of bacteria of the genus Listeria

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Wasser suspendiert und 5 Minuten auf 110°C erhitzt. Anschließend werden Primer nach Formel IIc und IIb (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq-Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris-HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl). Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 30 Sekunden auf 5°C (Bindungsphase) und für zwei Minuten auf 72°C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72 °C) mit 5 Minuten Dauer ausgeführt.A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIc and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 5 ° C. (binding phase) for 30 seconds and to 72 ° C. (elongation phase) for two minutes. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

Die PCR-Produkte werden in einem Agarose-Gel (1%) in einem Laufpuffer Tris-Borat (je 50 mM) mit EDTA (2,5 mM) aufgetrennt. Anschließend werden die aufgetrennte PCR-Produkte durch Anfärbung mit Ethidiumbromid (0,1 mg/ml in Wasser) angefärbt und Bestrahlung mit UV-Licht (260 nm) sichtbar gemacht.The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

In diesem Fall werden PCR-Produkte beobachtet, wenn DNA oder Zellen von Bakterien der Gattung Listeria in der Probe vorhanden sind (siehe Spalte D in Tabelle 1).In this case PCR products are observed if DNA or cells of bacteria of the genus Listeria are present in the sample (see column D in table 1).

Example 5: Implementation of the PCR reaction for the group-specific Evidence of listeria

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Wasser suspendiert und 5 Minuten auf 110°C erhitzt. Anschließend werden Primer nach Formel IIf und IIb (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq-Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris-HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl). Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 45 Sekunden auf 58°C (Bindungsphase) und für eine Minute auf 72°C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72 °C) mit 5 Minuten Dauer ausgeführt.A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIf and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 58 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

In diesem Fall werden nur PCR-Produkte beobachtet, wenn DNA oder Zellen von Bakterien aus der Gruppe L. ivanovii, L. seeligeri und L. welshimeri in der Probe vorhanden sind (siehe Spalte E in Tabelle 1).In this case only PCR products are observed if DNA or Bacterial cells from the group L. ivanovii, L. seeligeri and L. welshimeri are present in the sample (see column E in Table 1).

Example 6: Implementation of the PCR reaction to the species-specific Evidence of L. innocua

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Puffer (10 mM Tris-HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl) suspendiert und 5 Minuten auf 110°C erhitzt. Anschließend werden Primer nach Formel IIg und IIb (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq- Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris- HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl). Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 60 Sekunden auf 62°C (Bindungsphase) und für 45 Sekunden auf 72°C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72°C) mit 5 Minuten Dauer ausgeführt.A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIg and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 62 ° C. (binding phase) for 60 seconds and to 72 ° C. (elongation phase) for 45 seconds. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

Die PCR-Produkte werden in einem Agarose-Gel (1%) in einem Laufpuffer Tris-Borat (je 50 mM) mit EDTA (2,5 mM) aufgetrennt. Anschließend werden die aufgetrennten PCR-Produkte durch Anfärbung mit Ethidiumbromid (0,1 mg/ml in Wasser) angefärbt und Bestrahlung mit UV-Licht (260 nm) sichtbar gemacht.The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

Nur wenn DNA oder Zellen von L. innocua in der Probe vorhanden sind, werden PCR-Produkte beobachtet (siehe Spalte C in Tabelle 1).Only if DNA or cells from L. innocua are present in the sample PCR products are observed (see column C in Table 1).

Example 7: Implementation of the PCR reaction for the group-specific Evidence of listeria

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Wasser suspendiert und 5 Minuten auf 110°C erhitzt. Anschließend werden Primer nach Formel IIh und IIb (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq-Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris-HCl pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl). Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 45 Sekunden auf 56°C (Bindungsphase) und für 45 Sekunden auf 72°C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72 °C) mit 5 Minuten Dauer ausgeführt.A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIh and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 56 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for 45 seconds. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

In diesem Fall werden nur PCR-Produkte beobachtet, wenn DNA oder Zellen von Bakterien aus der Gruppe L. grayi und L. murrayi in der Probe vorhanden sind (siehe Spalte G in Tabelle 1).In this case only PCR products are observed if DNA or Bacterial cells from the group L. grayi and L. murrayi in the Sample are available (see column G in Table 1).

Example 8: Carrying out a combined PCR reaction for Species-specific detection of L. monocytogenes and L innocua and for group-specific detection of groups L. ivanovii / L. seeligeri L. welshimeri and L. grayi / L.murrayi

Eine bakterienhaltige Probe mit ca. 1 µg DNA wird in 50 µl Puffer (10 mM Tris-HCI pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl) suspendiert und 5 Minuten auf 110°C erhitzt. Anschließend wird eine Mischung von Primern nach Formel IId, IIf, IIg, IIh, sowie IIb (siehe Beispiel 1; je 0,4 µg), sowie 2,5 U Taq-Polymerase (Fa. Pharmacia), gelöst in Reaktionspuffer (10 mM Tris-HCI pH 8,5; 1,5 mM MgCl₂ und 50 mM KCl), sowie jeweils 200 µM dGTP, dATP, dTTP und dCTP zugefügt (gesamtes Reaktionsvolumen 100 µl) Der erste Denaturierungsschritt dauert 3 Minuten bei 94°C. Anschließend wird für 45 Sekunden auf 56°C (Bindungsphase) und für eine Minute auf 72°C (Elongationsphase) temperiert. Die folgenden Denaturierungsschritte (bei 94 °C) dauern 45 Sekunden. Nach 30 Reaktionszyklen wird ein abschließender Elongationsschritt (bei 72 °C) mit 5 Minuten Dauer ausgeführt.A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. A mixture of primers according to formulas IId, IIf, IIg, IIh and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (Pharmacia) is then dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step lasts 3 minutes at 94 ° C. The temperature is then raised to 56 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

Die PCR-Produkte werden in einem Polyacrylamid-Gel (4%) in einem Laufpuffer Tris-Borat (je 50 mM) mit EDTA (2,5 mM) aufgetrennt. Zusätzlich wird eine Nukleinsäuremischung (beispielsweise das Produkt aus der Spaltung von Sppl Phagen DNA mittels Restriktions endonuklease EcoRI) als Molekulargewichtsstandard mitgeführt. The PCR products are in a polyacrylamide gel (4%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). In addition, a nucleic acid mixture (e.g. the Product from the cleavage of Sppl phage DNA by restriction endonuclease EcoRI) carried as a molecular weight standard.

Anschließend werden die aufgetrennten PCR-Produkte durch Anfärbung mit Ethidiumbromid (0,1 mg/ml in Wasser) angefärbt und Bestrahlung mit UV-Licht (260 nm) sichtbar gemacht.Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

Das Vorhandensein von DNA oder Zellen von Bakterien aus der Art L. monocytogenes, der Art L. innocua, der Gruppe L. ivanovii / L. seeligeri / L. welshimeri oder der Gruppe L. grayi / L. murrayi kann auf Grund der unterschiedlichen Molekulargewichte differen ziert werden (siehe Spalte H in Tabelle 1, sowie Figur 1).The presence of DNA or cells from bacteria of type L. monocytogenes, of the species L. innocua, of the group L. ivanovii / L. seeligeri / L. welshimeri or the group L. grayi / L. murrayi can differ due to the different molecular weights be decorated (see column H in Table 1, and Figure 1).

Example 9: Synthesis of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu

Für die Synthese des Peptides CysGlnGlnGlnThrAlaProLysAlaProThrGlu wird das f_moc-Verfahren (9-Fluorenylmethyloxycarbonyl-Schutzgruppe) benutzt. Dieses Peptid entspricht einem Peptid der Formel IVd mit einem zusätzlichen N-terminalen Cysteinrest als Linker. Für die Synthese wird ein Peptid-Synthetizer der Fa. Applied Biosystems henutzt, die Prozeßparameter sind in der Gerätedokumentation enthalten.The f _moc method (9-fluorenylmethyloxycarbonyl protective group) is used for the synthesis of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu. This peptide corresponds to a peptide of the formula IVd with an additional N-terminal cysteine residue as a linker. A peptide synthesizer from Applied Biosystems is used for the synthesis; the process parameters are contained in the device documentation.

Ein polymerer Träger mit 4-(2′,4′-Dimethoxyphenylaminomethyl) phenoxygruppen dient als Festphase. Die Aminosäuren werden als α-N- f_moc-Derivate eingesetzt. Soweit die Aminosäuren reaktive Seiten gruppen enthalten, werden diese durch zusätzliche Schutzgruppen, die durch Trifluoressigsäurehydrolyse abspaltbar sind, maskiert. Die Peptidbindungen werden durch Aktivierung der Carboxylgruppen mittels Diisopropylcarbodiimid hergestellt. Die Reihenfolge der eingesetzten Aminosäurederivate ergibt sich aus der gewünschten Sequenz. A polymeric carrier with 4- (2 ', 4'-dimethoxyphenylaminomethyl) phenoxy groups serves as a solid phase. The amino acids are used as α-N-f _moc derivatives. If the amino acids contain reactive side groups, these are masked by additional protective groups which can be split off by trifluoroacetic acid hydrolysis. The peptide bonds are made by activating the carboxyl groups using diisopropylcarbodiimide. The sequence of the amino acid derivatives used results from the desired sequence.

Im ersten Schritt des Synthesezyklus reagiert die Aminogruppe an der Festphase, d. h. im ersten Zyklus die Aminogruppen des 4-(2′,4′- Dimethoxyphenylaminomethyl)-phenoxyrests des Trägers, in den folgenden Zyklen die α-Aminogruppe der zuletzt angefügten Aminosäure, mit der Carboxylgruppe der nächsten Aminosäure, die als α-N-f_moc-Derivat, gegebenenfalls mit geschützten Seitenketten eingesetzt wird, und die durch Diisopropylcarbodiimid aktiviert wird. Nicht umgesetzte Aminosäurederivate werden mit Dimethyl formamid ausgewaschen. Anschließend wird die f_moc-Gruppe durch Behandeln mit 20% (V/V) Piperidin in Dimethylformamid abgespalten. Die übrigen Schutzgruppen bleiben bei dieser Reaktion unverändert. Mit der Entfernung der α-N-Schutzgruppe kann der nächste Reaktions zyklus beginnen. Nachdem die letzte Aminosäure entsprechend der vorgesehenen Sequenz zugefügt worden ist, werden die Schutzgruppen der Seitenketten und die Bindung zum Trägerharz durch saure Hydrolyse mittels Trifluoressigsäure gespalten. Das Peptid wird anschließend durch Hochdruckflüssigkeitschromatographie gereinigt.In the first step of the synthesis cycle, the amino group on the solid phase, ie in the first cycle the amino groups of the 4- (2 ′, 4′-dimethoxyphenylaminomethyl) phenoxy radical of the support, in the following cycles the α-amino group of the last added amino acid, with the Carboxyl group of the next amino acid, which is used as an α-Nf _moc derivative, optionally with protected side chains, and which is activated by diisopropylcarbodiimide. Unreacted amino acid derivatives are washed out with dimethyl formamide. The f _moc group is then split off by treatment with 20% (v / v) piperidine in dimethylformamide. The remaining protective groups remain unchanged in this reaction. The next reaction cycle can begin with the removal of the α-N protective group. After the last amino acid has been added in accordance with the intended sequence, the protective groups of the side chains and the bond to the carrier resin are cleaved by acid hydrolysis using trifluoroacetic acid. The peptide is then purified by high pressure liquid chromatography.

Entsprechend der oben beschriebenen Vorgehensweise werden auch die übrigen Peptide mit den erfindungsgemäßen Sequenzen synthetisiert.According to the procedure described above, the other peptides synthesized with the sequences according to the invention.

Example 10: Conjugation of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu with glucose dehydrogenase

a) Derivatization of glucose dehydrogenase: 30 mg Bacillus megatherium glucose dehydrogenase (Merck, Art. No. 13732) are dissolved in 4 ml of sodium phosphate buffer (50 mM; pH 8.0). 6.78 mg of N-y-maleimidobutyryl are added to 2.4 ml of this solution oxysuccinimide (Calbiochem) dissolved in 50 ul dimethyl sulfoxide added and left for 30 minutes at room temperature. Then the excess N-y-maleimidobutyryloxy succinimide by gel filtration on PD-10 (Pharmacia) separated by chromatography. After chromatography one obtains 3.5 ml solution of the activated carrier protein with a Concentration of 4.5 mg / ml.
b) Coupling with the peptide: To 1.1 ml of the solution from the above step, 5.2 mg of the peptide, prepared according to Example 9, dissolved in 1 ml of sodium phosphate buffer (50 mM; pH 7.0) are added and the mixture is stirred for 3 hours Leave room temperature. The unbound peptide is then separated chromatographically by gel filtration on PD-10 (from Pharmacia). After chromatography, 3.5 ml solution of the conjugate with a concentration of 2.3 mg / ml is obtained.
Conjugates with the other peptides according to the present invention are also prepared according to the procedure described above.

Example 11: Generation of polyclonal antibodies against the Peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu

Zwei Kaninchen werden jeweils mit einer Emulsion aus 0,18 ml Konjugat aus Beispiel 10, 0,07 ml phosphatgepufferter Saline und 0,25 ml Öladjuvans (MISA 50, Fa. Seppic, FR) i.m. injiziert. Drei, fünf und sieben Wochen nach der Erstinjektion erfolgen Boosterinjektionen mit gleicher Menge. Eine Woche nach der letzten Injektion werden die Tiere getötet und ausgeblutet. Nachdem das Blut geronnen ist, wird das Antiserum durch Zentrifugation gewonnen und Natriumazid bis zu einer Endkonzentration von 0,02% zugefügt. Das Antiserum wird bei -20°C eingefroren gelagert. Two rabbits are each made with an emulsion of 0.18 ml Conjugate from Example 10, 0.07 ml phosphate buffered saline and 0.25 ml oil adjuvant (MISA 50, Seppic, FR) i.m. injected. Three, five and seven weeks after the first injection Booster injections with the same amount. A week after the last one Injection, the animals are sacrificed and bled. After that If blood has clotted, the antiserum is obtained by centrifugation and sodium azide to a final concentration of 0.02%. The antiserum is stored frozen at -20 ° C.

Example 12: Generation of monoclonal antibodies against the Peptide CysGlnGlnGlnThrAlaProLysAlaThrGlu

Zwei Mäuse werden jeweils mit einer Emulsion aus 0, 1 ml Konjugat aus Beispiel 10 und 0,1 ml Öladjuvans (MISA 50, Fa. Seppic, FR) s.c. injiziert. Zwei, vier und sechs Wochen nach der Erstinjektion erfolgen Boosterinjektionen mit gleicher Menge. Drei Tage nach der letzten Injektion werden die Tiere getötet und die Milz isoliert. Die Zellen aus der Milz werden nach üblichen Verfahren isoliert und mit einer permanenten murinen Zellinie fusioniert. Aus den Fusionsprodukten werden Zellinien selektioniert, die Antikörper gegen das Peptid CysGlnGlnGlnThrAlaProLysAlaProThrGlu bilden.Two mice are each made with an emulsion of 0.1 ml conjugate from Example 10 and 0.1 ml of oil adjuvant (MISA 50, Seppic, FR) s.c. injected. Two, four and six weeks after the first injection there are booster injections with the same amount. Three days after the the last injection, the animals are sacrificed and the spleen isolated. The cells from the spleen are isolated according to conventional methods and fused with a permanent murine cell line. From the Fusion products are selected cell lines, the antibodies against the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu.

Example 13: Immunological detection of L. monocytogenes

a) Pre-culture and centrifugation of the bacteria: 10 ml CASO broth with material from several colonies of L. monocytogenes inoculated and incubated at 30 ° C overnight. Then 1 ml of culture removed. The bacterial cells are centrifuged off (13,000 rpm).
b) Identification reaction: 300 µl of the supernatants from the previous work step are in the recesses of a Pipette microtiter plate and incubate at 4 ° C overnight. Then three times each with 100 ul washing solution (9 g / l NaCl and 0.05% Tween 20 in water). Be in the wells pipette 100 µl of antiserum prepared according to Example 11 and incubated for one hour at room temperature. It is repeated three times each washed with 100 µl washing solution. Then in each well 100 µl anti-rabbit labeled with alkaline phosphatase Pipette antibody solution (Art.No. A 8025; Sigma) and 30 Incubated for minutes at room temperature. The wells will be washed again with 100 µl washing solution and then the bound enzyme-labeled antibodies detected. For this, 200 µl a buffer solution filled with substrate and at 30 minutes Incubated at room temperature. The reaction is carried out by adding 100 2 N NaOH solution (Art.No. 9136, Merck) stopped and that Reaction product made visible. A yellow-orange color shows the presence of L. monocytogenes.

Example 14: Specific detection of L. monocytogenes using Immunoblot

Bakterien werden wie in Beispiel 13a) beschrieben vorkultiviert und die Zellen abzentrifugiert. Die abzentrifugierten Zellen werden in 1 ml phosphatgepufferter Saline aufgenommen und suspendiert. 2 µl dieser Suspension werden auf eine Nitrocellulosemembran (Hybond C, 0,45 µm, Art.Nr. RPN 283 C, Fa. Amersham) pipettiert. Nachdem die Lösung eingetrocknet ist, wird die Membran für eine Stunde bei Raumtemperatur mit einer Lösung von Rinderserumalbumin (10 g/l) in phosphatgepufferter Saline behandelt. Es wird eine Verdünnung (1 : 200) des in Beispiel 11 erhaltenen Antiserums mit einer Lösung von Rinderserumalbumin (10 g/l) und Tween 20 (0,5 g/l) in phosphatgepufferter Saline (Antikörperlosung A), sowie eine weitere Verdünnung (1 : 500) von peroxidasemarkiertem anti-Kaninchen Antikörper (anti Rabbit IgG, Art.Nr. 68-397; Fa. ICN Immuno Biologicals) mit demselben Verdünnungsmittel (HRP-Antikörperlösung) vorbereitet. Die Membran wird eine Stunde bei Raumtemperatur mit Antikörperlösung A inkubiert und anschließend dreimal mit phosphatgepufferter Saline mit 0,05% Tween 20 gewaschen. Um die Antikörperbindung nachzuweisen, wird die Membran anschließend eine Stunde bei Raumtemperatur mit HRP-Antikörperlösung inkubiert und je dreimal mit a) Tween 20 (0.5 g/l) in phosphatgepufferter Saline, b) mit phosphatgepufferter Saline und c) mit TRIS-Puffer (50 mM; pH 7,4; mit 200 mM NaCl) gewaschen. Für die Farbreaktion wird eine Lösung von 4-Chloro-1-naphthol (3 mg/ml in Methanol) mit fünf Volumen TRIS-Puffer (50 mM; pH 7,4; mit 200 mM NaCl) verdünnt und Wasserstoffperoxid zugesetzt (Endkonzentration 0,1 g/l). Die Membran wird in dieser Substratlösung inkubiert. Eine blauschwarze Färbung zeigt L. monocytogenes an. Bacteria are precultivated as described in Example 13a) and centrifuged the cells. The centrifuged cells are in 1 ml of phosphate-buffered saline was taken up and suspended. 2 µl of this suspension are applied to a nitrocellulose membrane (Hybond C, 0.45 µm, item no. RPN 283 C, from Amersham). after the Solution is dry, the membrane is left for an hour Room temperature with a solution of bovine serum albumin (10 g / l) in treated with phosphate buffered saline. It will be a thinner (1: 200) of the antiserum obtained in Example 11 with a solution of bovine serum albumin (10 g / l) and Tween 20 (0.5 g / l) in phosphate buffered saline (antibody solution A), and another Dilution (1: 500) of peroxidase-labeled anti-rabbits Antibodies (anti Rabbit IgG, Art.No. 68-397; ICN Immuno Biologicals) with the same diluent (HRP antibody solution) prepared. The membrane is used for one hour at room temperature Incubated antibody solution A and then three times with phosphate buffered saline washed with 0.05% Tween 20. To the To detect antibody binding, the membrane is then a Incubated for one hour at room temperature with HRP antibody solution and each three times with a) Tween 20 (0.5 g / l) in phosphate buffered saline, b) with phosphate buffered saline and c) with TRIS buffer (50 mM; pH 7.4; washed with 200 mM NaCl). For the color reaction, a Solution of 4-chloro-1-naphthol (3 mg / ml in methanol) with five Volume of TRIS buffer (50 mM; pH 7.4; with 200 mM NaCl) diluted and Hydrogen peroxide added (final concentration 0.1 g / l). The The membrane is incubated in this substrate solution. A blue-black Coloring indicates L. monocytogenes.

Tabelle 1 Table 1

Spezifität der Polymerase-Ketten-Reaktion bei Verwendung verschiedener Primer entsprechend Formel IIa-IIh Specificity of the polymerase chain reaction when using different primers according to formula IIa-IIh

Claims

1. Primer, selected from the iap gene (invasion associated protein), for the amplification of nucleic acids, characterized by a sequence according to one of the formulas Va to Vh and / or an associated complementary sequence, in which
X ¹ and X ² each independently represent hydrogen, any nucleotide or any oligonucleotide with up to 20 nucleotide units. X¹AATATGAAAAAAGCX² (Va) X¹GCTTCGGTCGCGTAX² (Vb) X¹ACAGCTGGGATTGCX² (Vc) X¹ACTGCTAACACAGCTX² (Vd) X¹TAACAGCAATTCAAGX² (Ve) X¹CTGAGGTAGCGAGXTXAGCTAX

2. Primer, characterized by a sequence according to one of the Formulas IIa to IIh. ATGAATATGAAAAAAGCAAC (IIa) TTGGCTTCGGTCGCGTATAA (IIb) GCTACAGCTGGGATTGCGGT (IIc) CAAACTGCTAACACAGCTACT (IId) CAATAACAGCAATTCAAGTGC (IIe) TAACTGAGGTAGCGAGAGTGAGTCCAAGT

3. A peptide selected from the protein p60, characterized by a sequence according to one of the formulas IVa to IVi X³ProValAlaProThrGlnX⁴ (IVa) X³ThrGlnAlaThrThrProAlaX⁴ (IVb) X³AlaIleLysGlnThrAlaAsnThrAlaX⁴ (IVc) X³GlnGlnThrAlaProLysAlaProThrX⁴ (IVd) X³ValAsnAsnGluValAlaAlaAlaGluLysThrGluX⁴ (IVe) X³ThrProValValLysGlnGluValLysX⁴ (IVf) X³ValLysGlnProThrThrGlnGlnThrAlaProX⁴ (IVg) X³IleLysGlnProThrLysThrValAlaProX⁴ (IVh) X³GlnGlnThrThrThrLysAlaProThrX⁴ (IVi) wherein
X ³ and X ⁴ each independently represent hydrogen, any amino acid or any oligopeptide with up to 7 amino acids.

4. Peptide according to claim 3, characterized by one of the sequences shown in Fig. 2a-i.

5. Peptide according to claim 3, characterized by one of the sequences shown in Fig. 5a-d.

6. Use of a peptide according to any one of claims 3-5 for Preparation of immunogenic conjugates.

7. antibodies directed against the protein p60 from Listeria, characterized in that it is an epitope from the sequence of the 3 binds polypeptide.

8. Antibody according to claim 7, characterized in that it binds an epitope which contains one of the sequences shown in Fig. 2a-i.

9. Antibodies which can be produced by immunizing a test animal with a polypeptide according to FIG. 3 or with an immunogenic conjugate which contains a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3.

10. Antibody directed against the protein p60 from Listeria, characterized in that it binds an epitope which contains one of the sequences shown in Fig. 5a-d.

11. Antibodies which can be produced by immunizing a test animal with an immunogenic conjugate which contains a peptide according to one of FIGS. 5a-d.

12. A method for producing an antibody directed against the protein p60 from Listeria by immunizing a test animal with an immunogen and isolating the antibody, characterized in that the immunogen is a polypeptide according to FIG. 3 or an immunogenic conjugate which is a polypeptide Fig contains. 3 is used.

13. The method according to claim 12, characterized in that an immunogenic conjugate is used as the immunogen, which contains a peptide with 7 to 24 amino acids selected from the polypeptide of FIG. 3.

14. The method according to the preamble of claim 12, characterized characterized in that an immunogenic conjugate is used as the immunogen used a peptide according to one of the formulas IVa-IVi Claim 3 contains.

15. Use of a primer according to one of claims 1-2 for the detection of bacteria of the genus Listeria.

16. Method for the detection of bacteria of the genus Listeria by means of gene amplification, characterized in that a primer is used according to one of claims 1-2.

17. Use of an antibody according to any one of claims 7-11 for the detection of bacteria of the genus Listeria.

18. Method for the detection of bacteria of the genus Listeria by means of an immune reaction, characterized in that a Antibody according to one of claims 7-11 is used.

19. Test compilation for the detection of bacteria of the genus Listeria using polymerase chain reaction, characterized net that contain a primer according to any one of claims 1-2 is.

20. Test compilation according to claim 19 for the detection of Bacteria of the species Listeria monocytogenes.

21.Test compilation for the detection of bacteria of the type Listeria monocytogenes by immunoassay, characterized in that contain an antibody according to any one of claims 7-9 is.

22.Test compilation for the detection of bacteria of the type Listeria innocua by immunoassay, characterized in that it contains an antibody according to any one of claims 10-11.