DE4318450A1 - New primers for PCR detection of Listeria - including individual species, also new peptide(s) for raising antibodies for immunochemical detection - Google Patents

Abstract

New primers from the iap (invasion-associated protein) gene for amplification of nucleic acid are of formulae (Va)-(Vh) and/or their complementary sequences. X1AATATGAAAAAAGCX2 (Va) X1TAACAGCAATTCAAEX2 (Ve) X1GCTTCGGTCGCGTAX2 (Vb) X1CTGAGGTAGCEAGCX2 (Vf) X1ACAGCTGGATTGCX2 (Vc) X1AGCACTCCAGTTGTTAX2 (Vg) X1ACTGCTAACACAGCTX2 (Vd) X1GCAGTTTCTAAACCTX2 (Vh) X1 and X2 = H or 1-20 nucleotide residues. USE - The primers are used to detect listeria by gene amplification and the Ab to detect them by usual immunoassay methods (partic. ELISA). By appropriate choice of reagents partic. species can be detected (esp. L. monocytogenes).

Description

The invention relates to means and methods for the detection of Bacteria of the genus Listeria, especially L. monocytogenes.

The members of the genus Listeria are gram-positive sticks shaped bacteria that are ubiquitous. To this genus belong to seven different species: L. monocytogenes, L. ivanovii, L. seeligeri, L. welshimeri, L. innocua, L. murrayi and L. grayi. Of these, only L. monocytogenes is pathogenic to humans Det are especially newborns, pregnant women and the elderly, as well Patients on immunosuppression. Infections often run along L. monocytogenes fatal.

The cause of infections with listeria are often contaminated Food in which the germs are found even at low temperatures doors can increase (by 4 ° C). So different Listeria Epidemics on the consumption of contaminated food, such as e.g. B. raw milk, cheese or coleslaw, returned. Fast after method for the detection of Listeria, especially in Food or clinical samples are urgently needed Lich. These procedures must also be between L. monocytogenes and differentiate between the non-human pathogenic species. Still is required that all variants of the human pathogenic type L. monocytogenes can be detected.

Recently, experts have been discussing whether the Listeria species L. innocua as a key germ for the possible occurrence of L. monocytogenes could be used sensibly. That’s why evidence of L. innocua is also useful.  

L. monocytogenes has so far been detected using methods based on the culture of the microorganisms. The int. J. Food Microbiol. 4 (1987), 249-256, method takes two Weeks. A slightly faster procedure is used by the International Dairy Foundation (IDF) recommended; but it takes at least 6-8 Days. Both procedures are quick for their duration Identification unsuitable. Both procedures are also labor-intensive, since nutrient media are used to obtain individual colonies have to be inoculated several times, and then the isolates using biochemical and serological examination methods must be characterized.

The immunological tests that have been on the market to date are ongoing only a few hours, but do not allow the important one Differentiate between different types of listeria. Also at this process becomes a two-day pre-enrichment culture needed.

In Appl. Environ. Microbiol. 54 (1988), 2933-2937 is a method described in the L. monocytogenes with the help of synthetic Oligodeoxyribonucleotide probes is specifically detected. However, the probes used are not sufficiently specific because they also react with the non-human pathogenic L. seeligeri. For this procedure, too, there is a prior multiplication of the germs necessary: Food samples or their dilutions are opened Spread out agar plates, the inoculated plates are incubated and then with a radiolabelled DNA probe in the colony hybridization method examined. Evidence is provided by autoradiography. This method is also labor and time consuming.

In Infect. Immune. 58, 1943-1950 (1990) the DNA sequence of L. monocytogenes iap (invasion-associated protein) gene described. This gene encodes a protein that is also under the Designation p60 is known, and in variants in all Listeria  Species occurs. In L. monocytogenes this protein is for the Ability of bacteria to enter animal cells, responsible. A polynucleotide (400 bases) with a partial sequence from this gene is suitable as a DNA probe for L. monocytogenes from distinguish other organisms.

The polymerase chain reaction (PCR) allows the in vitro multiplication of nucleic acids, a preculture is generally not necessary in this process. So that Reaction can be started, short pieces of nucleic acid (primer) needed, the genome section to be propagated limit. Usually two primers are used, each with hybridize to a nucleic acid strand. One of the primers owns therefore the complementary sequence of the respective gene segment. The Selection of these primers determines the specificity of the detection reaction. For the detection of L. monocytogenes, this method is described in Appl. Environmental Microbiology 57, 606-609 (1991), in Letters Appl. Microbiol. 11, 158-162 (1990) and in J. Appl. Bact. 70, 372-379 (1991). There you will find more information on the Details of these procedures. The DNA primers bind to the gene for Listeriolysin, the Listeria hemolysin. The specificity of this Primer is, as from comments in J. Appl. Bact. 70 shows at least insecure: L. seeligeri is not safe from L. distinguish monocytogenes. With the help of those described so far Primer in PCR technology is therefore the reliable detection of L. monocytogenes not yet possible.  

Polyclonal antibodies against L. monocytogenes p60 also react with the p60 protein from other apathogenic listeria species. Antibodies of this type are therefore unsuitable, L. monocytogenes specifically detected by immunological methods. It is in principle possible through such a polyvalent antiserum specific absorption of interfering antibody fractions clean: To do this, protein p60 would have to be removed from all others Listeria species are covalently bound to carriers. They don't desired antibody fractions can be specific absorb; what remains is an antiserum that only has protein p60 from L. monocytogenes reacts. This method of extraction a serum specific for L. monocytogenes is expensive: Man requires significant amounts of the polyvalent antiserum Starting material, as well as the iap gene products p60 from different types of Listeria. When obtaining monoclonal Antibodies to protein p60 would cause this high material requirement does not occur, however, the formation of antibodies against certain epitopes are random: First, a large number of antibody-producing cell clones are made from which then clones with suitable antibodies must be selected. It So far it has not been possible to target antibodies against epitopes which are specific for L. monocytogenes. The same applies for antibodies against epitopes specific for L. innocua.

The object of the present invention is to provide improved means and Methods for the differentiation of bacteria of the genus Listeria, especially for the detection of bacteria of type L. to provide monocytogenes. In particular, according to the invention primer sequences suitable for the PCR technique, and peptides for targeted production of specific antibodies for the species-specific immunological detection of bacteria of the species L. monocytogenes and L. innocua are provided.  

The invention relates to primers selected from the iap gene, for the amplification of nucleic acids, for example by means of the Polymerase chain reaction, characterized in that the primers as a partial sequence at least one sequence according to one of the formulas Ia up to Ib and / or an associated complementary sequence, with up to 20 more before and / or after this partial sequence Nucleotide building blocks can be bound. Such primers are suitable for the detection and differentiation of bacteria from the Genus Listeria, especially of the species L. monocytogenes using PCR.

AATATGAAAAAAGC (Ia)

GCTTCGGTCGCGTA (Ib)

ACAGCTGGGATTGC (Ic)

ACTGCTAACACAGCT (Id)

TAACAGCAATTCAAG (Ie)

CTGAGGTAGCGAGC (If)

AGCACTCCAGTTGTTA (Ig)

GCAGTTTCTAAACCT (Ih)

Primers which have a sequence after a of the formulas IIa to IIh and / or an associated complementary sequence contain.

GTCGACTGAATATGAAAAAAGCAAC (IIa)

TTGGCTTCGGTCGCGTAGAATTCATA (IIb)

GCTACAGCTGGGATTGCGGT (IIc)

CAAACTGCTAACACAGCTACT (IId)

CAATAACAGCAATTCAAGTGC (IIe)

TAACTGAGGTAGCGAGCGAA (IIf)

ACTAGCACTCCAGTTGTTAAAC (IIg)

CCAGCAGTTTCTAAACCTGCT (IIh)

The invention further relates to peptides which are part of sequence at least one sequence according to one of the formulas IIIa to IIIi included, with up to and / or behind this partial sequence each seven amino acids can be peptide-bound.

ProValAlaProThrGln (IIIa)

ThrGlnAlaThrThrProAla (IIIb)

AlaIleLysGlnThrAlaAsnThrAla (IIIc)

GlnGlnThrAlaProLysAlaProThr (IIId)

ValAsnAsnGluValAlaAlaAlaGluLysThrGlu (IIIe)

ThrProValValLysGlnGluValLys (IIIf)

ValLysGlnProThrThrGlnGlnThrAlaPro (IIIg)

IleLysGlnProThrLysThrValAlaPro (IIIh)

GlnGlnThrThrThrLysAlaProThr (IIIi)

Peptides with a sequence according to one of FIGS. 2a-i and one of FIGS. 5a-d are particularly preferred.

The invention also relates to the use of one of the peptides mentioned with a partial sequence according to one of the formulas IIIa to IIIi for the preparation of immunogenic conjugates. Peptides with a sequence according to one of FIGS. 2a-i and according to one of FIGS. 5a-d are particularly preferred for this purpose.

The invention also relates to an antibody which binds an epitope which is formed by the polypeptide according to Figure 3, or which is a peptide according to one of the formulas IIIa-IIIi, preferably according to one of Figs. 2a-i, and according to one of Fig . 5a-d, contains.

The invention further relates to an antibody which can be prepared by immunizing a test animal with a polypeptide according to FIG. 3 or with an immunogenic conjugate which contains a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3.

The invention also relates to a method for producing an antibody directed against the protein p60 from Listeria by immunizing a test animal with an immunogen and isolating the antibodies, characterized in that a polypeptide according to FIG. 3 or an immunogenic conjugate is used as the immunogen, which contains a polypeptide according to FIG. 3. Immunogenic conjugates which contain a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3 or which contain a peptide according to one of the formulas IVa-IVi are preferred, wherein X ³ and X ⁴ each independently of one another are hydrogen, any one Amino acid or any oligopeptide with up to 7 amino acids.

X³ProValAlaProThrGlnX⁴ (IVa)

X³ThrGlnAlaThrThrProAlaX⁴ (IVb)

X³AlaIleLysGlnThrAlaAsnThrAlaX⁴ (IVc)

X³GlnGlnThrAlaProLysAlaProThrX⁴ (IVd)

X³ValAsnAsnGluValAlaAlaAlaGluLysThrGluX⁴ (IVe)

X³ThrProValValLysGlnGluValLysX⁴ (IVf)

X³ValLysGlnProThrThrGlnGlnThrAlaProX⁴ (IVg)

X³IleLysGlnProThrLysThrValAlaProX⁴ (IVh)

X³GlnGlnThrThrThrLysAlaProThrX⁴ (IVi)

Peptides with a sequence according to one of FIGS. 2a-i and one of FIGS. 5a-d are particularly preferred.

The invention finally relates to the use of a Primers, which is a partial sequence according to one of the formulas Ia-Ih or preferably a sequence according to one of the formulas IIa-IIh or one contains associated complementary sequence for the detection of Bacteria of the genus Listeria.

The invention also relates to methods for the detection of Bacteria of the genus Listeria using a primer, the one Partial sequence according to one of the formulas Ia-Ib or preferably one Sequence according to one of the formulas IIa-IIh or an associated one Contains complementary sequence.

The invention furthermore relates to the use of an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or which is directed against one of the epitopes with an amino acid sequence according to one of FIGS. 2a-i or 5a-d for the detection of bacteria of the genus Listeria.

The invention also relates to methods for the detection of bacteria of the genus Listeria by means of an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or against one of the epitopes with an amino acid sequence according to one of FIGS. 2a-i or 5a -d is directed.

Finally, the invention relates to test compilations for the detection of bacteria of the genus Listeria, in particular the Art L. monocytogenes, by means of amplification of nucleic acids, for example by means of the polymerase chain reaction, the one Primer with a partial sequence according to one of the formulas Ia-Ih or preferably with a sequence according to one of the formulas IIa-IIh or contain an associated complementary sequence.

The invention also relates to test compositions for the immunological detection of bacteria of the Listeria monocytogenes type, in which an antibody which is directed against an epitope from the polypeptide sequence according to FIG. 3 or against one of the epitopes with an amino acid sequence according to one of FIG. 2a -i is directed, is included, as well as test compositions for the immunological detection of bacteria of the Listeria innocua type, in which an antibody which is directed against one of the epitopes with an amino acid sequence according to one of FIGS. 5a-d is contained.

Fig. 1 shows the result of electrophoretic separation of amplification products; the experimental details are shown in Example 8.

FIGS. 2a-i show the amino acid sequences of particularly before ferred immunogenic peptides selected from the sequence of the protein p60 from Listeria monocytogenes.

Fig. 3 shows the amino acid sequence of the polypeptide selected from the sequence of the protein p60 from Listeria monocytogenes, whose epitopes are suitable for the immunological detection of bacteria of the genus Listeria.

FIG. 4 shows the amino acid sequence of the p60 protein from Listeria monocytogenes for comparison purposes, which is shown in two partial images a and b.

FIG. 5a-d show the amino acid sequences of the immunogenic peptides is particularly ferred before selected from the sequence of the protein p60 from Listeria innocua.

The invention is described in more detail below. Thereby in usually on details of biochemical, immunological and  molecular biological methods known to those skilled in the art, and the details of which are described in the literature received. With these methods one can also do it by itself known, not described variants use do.

The oligonucleotides according to the formulas Ia-Ih and IIa-IIh are primers for nucleic acid amplification methods and thus for the specific detection of bacteria of the genus Listeria suitable. Their sequences are in the usual way from 5'- End written to the 3′-end. Depending on the Requirements of the amplification system used in each case either deoxyribonucleotides or ribonucleotides with the sequences according to the invention used. In the latter case they are Thymidine building blocks each replaced by uridine building blocks. The A person skilled in the art is furthermore aware that the exchange of a or fewer bases in a nucleotide sequence their biological Properties not changed. Therefore, the include nucleotide sequences according to the invention also those which Base exchange derived from sequences Ia-Ih and IIa-IIh and have the same biological effect as the respective primer show with the original sequence. Since usually one primer each one of the DNA strands should react, one of the primers used in the complementary sequence. The complementary sequence arises in a known manner according to the rules of base pairing.

Based on the respective sequence, the oligonucleotides according to the invention can be synthesized by methods known to the person skilled in the art, for example the phosphotriester or the phosphoamidite method. The phosphoamidite method is preferably used, in particular using mechanized synthesizers. The method is in Tetrahedron Lett. (1981) 22:
1859-1862. Further details of such synthesis processes are described, for example, in Winnacker, EL (1985) Gene and Clones, pages 44-61 (VCH-Verlagsgesellschaft mbH, Weinheim).

The primers according to the invention are suitable for DNA amplification, for example with the help of the polymerase chain reaction (PCR). To the DNA is first broken down into individual strands by heating. Two primers are used, each with the homologous DNA Hybridize sections on one DNA strand at a time. The genomab section that lies between these two primers is increased. The primers attached to the DNA are the starting points for the Amplification. A polymerase, preferably Taq DNA polymerase, then complements in the presence of the four nucleotide triphosphates the second strand according to the sequence of the original DNA. Then the resulting double strands are run through again Heating broken down into single strands. This amplification cycle can be repeated several times. After a sufficient number amplification cycles can amplify the nucleic acid can be demonstrated using known methods. The DNS separated by electrophoresis, then with ethidium bromide stained and finally by fluorescence using UV excitation be detected. Detection using DNS Hybridization. The details of suitable amplification and Detection methods are also in review articles, e.g. B. Innis et al. (eds.) PCR Protocols (Academic Press, Inc., Harcourt Brace Jovanovich, Publishers). Other nucleic acid amplification methods are also in which the invention Primers can be used, known from the literature. To this belongs to the ligase chain reaction described by Bond, S. et al. (1990), pages 425-434 at Raven Press (New York, NY / USA).  

The selection of the primers according to the preferred formulas IIa-IIh determines the position of the starting points on the iap gene and thus the Specificity of the detection reaction: combinations of Primers selected from the sequence of the iap gene as non-specific and therefore unsuitable for the detection of listeria using DNA Amplification (see, for example, column F in Table 1). However, other selected combinations proved to be specific fish for the genus Listeria, others for groups of Listeria Species, still others for individual Listeria species. Overall, that is Selection and compilation of the primers is therefore critical. The Selection of one of the two primers is always particularly critical, while the second primer can rather be varied without the To change the specificity of the detection reaction significantly. Hence can according to the teaching of the present invention for this second Primer can also be chosen a sequence that is not one corresponds to the formulas Ia-Ih or IIa-IIh.

According to the invention, at least one of the primers is from the formulas Ia-Ih or preferably selected from the formulas IIa-IIh. The second primer affects, as already explained, the specificity of the Amplification reaction much less than the first primer. However, combinations in which both primers are preferred the formulas Ia-Ih or IIa-IIh can be selected. examples for such preferred combinations are (typical results are summarized in Table 1):

• a) When using a combination of a primer according to formula IIc with a primer with the complementary sequence according to formula IIb only the DNA of Listeria is amplified, not the DNA from other types of bacteria (see column D in Table 1).
• b) When using a combination of a primer according to formula IId with a primer with the complementary sequence according to formula IIb only L. monocytogenes DNA is amplified, not  however, the DNA from other listeria or other bacteria (see column B in table 1).
• c) When using a combination of a primer according to formula IIf with a primer with the complementary sequence according to formula IIb only the DNA of certain Listeria species is amplified, namely exclusively from L. seeligeri, L. welshimiri and L. ivanovii A group-specific proof is therefore possible (see column E in table 1).
• d) Another example of group-specific evidence consists in using a combination of a primer Formula IIh with a primer with the complementary sequence according to Formula IIb: It only uses the DNA of L. grayi and L. murrayi amplified (see column G in Table 1).
• e) Since the amplification products of different Listeria species have different molecular weights, a combination of several primers (according to formulas IId, IIf, IIg and IIh) with the complementary sequence of formula IIb can be used to differentiate bacteria of the genus Listeria with a single polymerase reaction. Details of this further development of polymerase technology can be seen from Example 8 (see column H in Table 1 and FIG. 1).

As already mentioned, it is also possible to do the amplification detect products by nucleic acid hybridization. To do this suitable nucleic acid in the reaction mixture after amplification pieces (nucleic acid probes) added. These nucleic acid probes have a base sequence that is completely or partially complementary to the amplified gene segment. These probes are also for marked a detection reaction: you can use radioactive isotopes contain, or wear fluorescent labels, or by Enzymes must be labeled. Suitable markers, methods too their insertion into the nucleic acid probe and detection methods known to the expert.  

In particular, the amplification reaction can be specific for the Genus Listeria (as described above under a)) or for described a group of Listeria species (as above under c) and d) ben) must be designed. By using nucleic acid probes that are specific for each species, then in the reaction batch, the presence of these types of listeria can be recognized. If the probes may contain various labeling agents different species can be detected side by side. These Process variant thus allows similar to that described under e) above the detection of different Listeria species side by side.

The use of a nucleic acid probe or a mixture different probes, with amplification products of all Listeria species react, allowing the specificity of the ampli to check the fiction reaction or provide uniform evidence to provide reagent for different types of Listeria.

The peptides according to the formulas IVa-IVi and according to Fig. 2a-i, as well as according to Fig. 5a-1, can be incorporated into immunogenic conjugates. With the help of these conjugates, antibodies can be generated which make it possible to specifically detect bacteria of the genus Listeria using immunological methods.

The positions of the peptides according to the invention in the overall sequence of the p60 protein from Listeria monocytogenes are as follows specified:

• a) The sequence according to formula IIIa begins with proline at position 148 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2a, 2e and 2f.
• b) The sequence according to formula IIIb begins with threonine at position 178 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2b and 2h.  
• c) The sequence according to formula IIIc begins with alanine at position 243 of the p60 sequence (Figure 4a); are in this region also the peptides according to FIGS. 2c and 2i.
• d) The sequence according to formula IIId begins with glutamine at position 292 of the p60 sequence (Figure 4b); is in this region also the peptide according to FIG. 2d.
• e) The sequence according to formula IIIe begins with valine at position 71 the p60 sequence (Fig. 4a); is in this region also the peptide according to FIG. 2g.

The sequences of the peptides according to the invention shown in Fig. 5a-d come from the total sequence of the p60 protein from Listeria innocua; the same applies to the partial sequences described with the formulas IIIf-IIIi and IVf -IVi.

It is known to the person skilled in the art that frequently the exchange of one or a few amino acids in a peptide does not change its biological properties. For this reason, the peptide sequences according to the invention also include those which are derived from the sequences according to FIGS. 2a-i, according to FIGS. 5a-d or according to FIG. 3 by amino acid exchange and which biologically show the same effect as the respective peptides with the original sequence.

The selection of the peptides according to the invention proved to be critical. For example, if you choose a specific peptide that is different from that for L. monocytogenes specific gene segment is encoded for Production of antibodies from, surprisingly, none shows the antisera reacted with the p60 protein.

Based on the sequence of the amino acids, the peptides can be synthesized by methods known to the person skilled in the art, for example the T _boc or the f _moc method (tert-butyloxycarbonyl or 9-fluorenyl methyloxycarbonyl). Details of these processes are described, for example, in J. Am. Chem. Soc. 85, 2149-2154 (1963) and in Synthetic Polypeptides as Antigens (van Regenmortel et al. (Eds.) Elsevier 1988 (Volume 19 of the book series Laboratory Techniques in Biochemistry and Molecular Biology). The f _moc method is preferred, in particular Mechanized process variants, details of the process and suitable amino acid protective groups are known to the person skilled in the art.

Peptides are generally not suitable for generating antibodies. However, if peptides are coupled to high-molecular carrier substances, this is how immunogenic conjugates are formed. The peptides according to the invention can be conjugated with known carriers. To include polyethylene glycols, serum albumin, KLH (Keyhole Limpet Hemocyanin; Limpet haemocyanin), ovalbumin, Bacillus megaterium glucose dehydrogenase and PPD (purified protein derivative of tuberculin). Preferred carriers are KLH and glucose dehydrogenase from B. megaterium.

In addition, bridge connections (left) are often used. These are low molecular weight organic compounds with at least two linkable functional groups. Suitable Connections are known to the person skilled in the art; these include, for example wise: 1,2-diaminoethane, succinic acid, β-alanine, 1,6- Diaminohexane, 6-aminocaproic acid, adipic acid, cysteine. Prefers cysteine is used as a linker, this amino acid residue is already incorporated in the synthesis of the peptide. Linker who contain both an amino and a carboxyl function (e.g. β-alanine, 6-aminocaproic acid or cysteine), can optionally on the C- or the N-terminus of the peptide. To make the Bonds between peptide and carrier are preferred m Maleimidobenzoyl-N-hydroxysuccinimide ester (MBS) used.

The immunogenic conjugates mentioned serve, according to known Methods to generate antibodies in experimental animals. Usually mammals such as sheep, goats,  Rabbits or mice used. Rabbits are for production polyclonal antibody preferred. But it is also possible to use With the help of the immunogenic conjugates monoclonal To produce antibodies.

Details of the immunological methods are known to the person skilled in the art. There are also various references to the implementation of these procedures in the literature; Examples include:
_* Antibodies, E. Harlow and D. Lane, Cold Spring Harbor (1988)
_* Woodard, LF and Jasman, RL (1985) Vaccine 3, 137-144
_* Woodard, LF (1989) Laboratory Animal Sci 39, 222-225
_* Handbook of Experimental Immunology (1986) Weir, DM et al. eds .; Blackwell Scientific Publications, Oxford, GB.

 These methods include, for example, conjugation and Immunization procedures, as well as the production and purification of Antibodies and also immunological detection methods. To the immunological detection methods in which the invention Antibodies that can be used preferably include agglutinations method, immunometric detection method, the immuno-blot Processes and in particular the sandwich (ELISA) process.

According to the invention, the term antibody encompasses both immunoglobulins and antisera. It is also known to the person skilled in the art that instead of a single antibody which is directed against a single epitope, it is frequently possible to use a mixture of different antibodies with different specificity. This results in advantages, particularly with regard to detection sensitivity. This is particularly true for monoclonal antibodies, but also for other antibodies that are directed against an epitope. Accordingly, it may be advantageous to combine several antibodies which are directed against different peptide structures according to the formulas IIIa-IIIi or according to one of FIGS. 3, 2a-i or 5a-d, for the use according to the invention and / or the methods according to the invention.

Details of the preparation of the primers and Peptides, as well as their use, are from the following examples evident. The person skilled in the art takes further methodical details the cited literature. The examples are intended to be the subject of Invention illustrate and do not limit the Invention.

Examples Example 1: Preparation of the primer according to formula IIa

The primer according to Formula IIa is made with the DNA synthesizer 380A from Applied Biosystems manufactured using the phosphoamidite method. The The main features of the method are in Tetrahedron Lett. (1981) 22: 1859- 1862. Further details can be found in the Documentation from the device manufacturer.

The primers according to formula IIc, IId, IIf, IIg and IIh made. The primers according to formulas IIb and IIe are used in the respective complementary sequence (IIb: TTGGCTTCGGTCGCGTAGAATTCATA; IIe: GCACTTGAATTGCTGTTATTG).

Example 2: Execution of the PCR reaction to the species-specific Detection of L. monocytogenes

A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IId and IIe (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 55 ° C. (binding phase) for 30 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in a polyacrylamide gel (6%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

Only if DNA or cells from L. monocytogenes in the sample PCR products are observed (see column A in Table 1).

Example 3: Implementation of the PCR reaction to the species-specific Detection of L. monocytogenes

The procedure described in Example 2 is carried out using the Primers according to formulas IId and IIb (see example 1) instead of Repeat primers according to formulas IId and IIe. In this case, too PCR products are only observed when DNA or cells from L. monocytogenes are present in the sample (see column B in Table I).  

Example 4: Implementation of the PCR reaction for enjoyment-specific Detection of bacteria of the genus Listeria

A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIc and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 5 ° C. (binding phase) for 30 seconds and to 72 ° C. (elongation phase) for two minutes. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

In this case PCR products are observed if DNA or cells of bacteria of the genus Listeria are present in the sample (see column D in table 1).

Example 5: Implementation of the PCR reaction for the group-specific Evidence of listeria

A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIf and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 58 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

In this case only PCR products are observed if DNA or Bacterial cells from the group L. ivanovii, L. seeligeri and L. welshimeri are present in the sample (see column E in Table 1).

Example 6: Implementation of the PCR reaction to the species-specific Evidence of L. innocua

A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIg and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 62 ° C. (binding phase) for 60 seconds and to 72 ° C. (elongation phase) for 45 seconds. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

Only if DNA or cells from L. innocua are present in the sample PCR products are observed (see column C in Table 1).

Example 7: Implementation of the PCR reaction for the group-specific Evidence of listeria

A bacteria-containing sample with approx. 1 µg DNA is suspended in 50 µl water and heated to 110 ° C for 5 minutes. Subsequently, primers according to formulas IIh and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (from Pharmacia) are dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1, 5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step takes 3 minutes at 94 ° C. The temperature is then raised to 56 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for 45 seconds. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in an agarose gel (1%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). Then the separated PCR products are stained  stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

In this case only PCR products are observed if DNA or Bacterial cells from the group L. grayi and L. murrayi in the Sample are available (see column G in Table 1).

Example 8: Carrying out a combined PCR reaction for Species-specific detection of L. monocytogenes and L innocua and for group-specific detection of groups L. ivanovii / L. seeligeri L. welshimeri and L. grayi / L.murrayi

A bacterial sample with approx. 1 µg DNA is suspended in 50 µl buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl) and heated to 110 ° C for 5 minutes. A mixture of primers according to formulas IId, IIf, IIg, IIh and IIb (see Example 1; 0.4 µg each) and 2.5 U Taq polymerase (Pharmacia) is then dissolved in reaction buffer (10 mM Tris-HCl pH 8.5; 1.5 mM MgCl ₂ and 50 mM KCl), as well as 200 µM dGTP, dATP, dTTP and dCTP added (total reaction volume 100 µl). The first denaturation step lasts 3 minutes at 94 ° C. The temperature is then raised to 56 ° C. (binding phase) for 45 seconds and to 72 ° C. (elongation phase) for one minute. The following denaturation steps (at 94 ° C) take 45 seconds. After 30 reaction cycles, a final elongation step (at 72 ° C.) is carried out for 5 minutes.

The PCR products are in a polyacrylamide gel (4%) in one Tris-Borate running buffer (50 mM each) separated with EDTA (2.5 mM). In addition, a nucleic acid mixture (e.g. the Product from the cleavage of Sppl phage DNA by restriction endonuclease EcoRI) carried as a molecular weight standard.  

Then the separated PCR products are stained stained with ethidium bromide (0.1 mg / ml in water) and irradiation visualized with UV light (260 nm).

The presence of DNA or cells from bacteria of type L. monocytogenes, of the species L. innocua, of the group L. ivanovii / L. seeligeri / L. welshimeri or the group L. grayi / L. murrayi can differ due to the different molecular weights be decorated (see column H in Table 1, and Figure 1).

Example 9: Synthesis of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu

The f _moc method (9-fluorenylmethyloxycarbonyl protective group) is used for the synthesis of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu. This peptide corresponds to a peptide of the formula IVd with an additional N-terminal cysteine residue as a linker. A peptide synthesizer from Applied Biosystems is used for the synthesis; the process parameters are contained in the device documentation.

A polymeric carrier with 4- (2 ', 4'-dimethoxyphenylaminomethyl) phenoxy groups serves as a solid phase. The amino acids are used as α-N-f _moc derivatives. If the amino acids contain reactive side groups, these are masked by additional protective groups which can be split off by trifluoroacetic acid hydrolysis. The peptide bonds are made by activating the carboxyl groups using diisopropylcarbodiimide. The sequence of the amino acid derivatives used results from the desired sequence.

In the first step of the synthesis cycle, the amino group on the solid phase, ie in the first cycle the amino groups of the 4- (2 ′, 4′-dimethoxyphenylaminomethyl) phenoxy radical of the support, in the following cycles the α-amino group of the last added amino acid, with the Carboxyl group of the next amino acid, which is used as an α-Nf _moc derivative, optionally with protected side chains, and which is activated by diisopropylcarbodiimide. Unreacted amino acid derivatives are washed out with dimethyl formamide. The f _moc group is then split off by treatment with 20% (v / v) piperidine in dimethylformamide. The remaining protective groups remain unchanged in this reaction. The next reaction cycle can begin with the removal of the α-N protective group. After the last amino acid has been added in accordance with the intended sequence, the protective groups of the side chains and the bond to the carrier resin are cleaved by acid hydrolysis using trifluoroacetic acid. The peptide is then purified by high pressure liquid chromatography.

According to the procedure described above, the other peptides synthesized with the sequences according to the invention.

Example 10: Conjugation of the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu with glucose dehydrogenase

• a) Derivatization of glucose dehydrogenase: 30 mg Bacillus megatherium glucose dehydrogenase (Merck, Art. No. 13732) are dissolved in 4 ml of sodium phosphate buffer (50 mM; pH 8.0). 6.78 mg of N-y-maleimidobutyryl are added to 2.4 ml of this solution oxysuccinimide (Calbiochem) dissolved in 50 ul dimethyl sulfoxide added and left for 30 minutes at room temperature. Then the excess N-y-maleimidobutyryloxy succinimide by gel filtration on PD-10 (Pharmacia)  separated by chromatography. After chromatography one obtains 3.5 ml solution of the activated carrier protein with a Concentration of 4.5 mg / ml.
• b) Coupling with the peptide: To 1.1 ml of the solution from the above step, 5.2 mg of the peptide, prepared according to Example 9, dissolved in 1 ml of sodium phosphate buffer (50 mM; pH 7.0) are added and the mixture is stirred for 3 hours Leave room temperature. The unbound peptide is then separated chromatographically by gel filtration on PD-10 (from Pharmacia). After chromatography, 3.5 ml solution of the conjugate with a concentration of 2.3 mg / ml is obtained.
  Conjugates with the other peptides according to the present invention are also prepared according to the procedure described above.

Example 11: Generation of polyclonal antibodies against the Peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu

Two rabbits are each made with an emulsion of 0.18 ml Conjugate from Example 10, 0.07 ml phosphate buffered saline and 0.25 ml oil adjuvant (MISA 50, Seppic, FR) i.m. injected. Three, five and seven weeks after the first injection Booster injections with the same amount. A week after the last one Injection, the animals are sacrificed and bled. After that If blood has clotted, the antiserum is obtained by centrifugation and sodium azide to a final concentration of 0.02%. The antiserum is stored frozen at -20 ° C.  

Example 12: Generation of monoclonal antibodies against the Peptide CysGlnGlnGlnThrAlaProLysAlaThrGlu

Two mice are each made with an emulsion of 0.1 ml conjugate from Example 10 and 0.1 ml of oil adjuvant (MISA 50, Seppic, FR) s.c. injected. Two, four and six weeks after the first injection there are booster injections with the same amount. Three days after the the last injection, the animals are sacrificed and the spleen isolated. The cells from the spleen are isolated according to conventional methods and fused with a permanent murine cell line. From the Fusion products are selected cell lines, the antibodies against the peptide CysGlnGlnGlnThrAlaProLysAlaProThrGlu.

Example 13: Immunological detection of L. monocytogenes

•  a) Pre-culture and centrifugation of the bacteria: 10 ml CASO broth with material from several colonies of L. monocytogenes inoculated and incubated at 30 ° C overnight. Then 1 ml of culture removed. The bacterial cells are centrifuged off (13,000 rpm).
• b) Identification reaction: 300 µl of the supernatants from the previous work step are in the recesses of a Pipette microtiter plate and incubate at 4 ° C overnight. Then three times each with 100 ul washing solution (9 g / l NaCl and 0.05% Tween 20 in water). Be in the wells pipette 100 µl of antiserum prepared according to Example 11 and incubated for one hour at room temperature. It is repeated three times each washed with 100 µl washing solution. Then in each well 100 µl anti-rabbit labeled with alkaline phosphatase Pipette antibody solution (Art.No. A 8025; Sigma) and 30 Incubated for minutes at room temperature. The wells will be  washed again with 100 µl washing solution and then the bound enzyme-labeled antibodies detected. For this, 200 µl a buffer solution filled with substrate and at 30 minutes Incubated at room temperature. The reaction is carried out by adding 100 2 N NaOH solution (Art.No. 9136, Merck) stopped and that Reaction product made visible. A yellow-orange color shows the presence of L. monocytogenes.

Example 14: Specific detection of L. monocytogenes using Immunoblot

Bacteria are precultivated as described in Example 13a) and centrifuged the cells. The centrifuged cells are in 1 ml of phosphate-buffered saline was taken up and suspended. 2 µl of this suspension are applied to a nitrocellulose membrane (Hybond C, 0.45 µm, item no. RPN 283 C, from Amersham). after the Solution is dry, the membrane is left for an hour Room temperature with a solution of bovine serum albumin (10 g / l) in treated with phosphate buffered saline. It will be a thinner (1: 200) of the antiserum obtained in Example 11 with a solution of bovine serum albumin (10 g / l) and Tween 20 (0.5 g / l) in phosphate buffered saline (antibody solution A), and another Dilution (1: 500) of peroxidase-labeled anti-rabbits Antibodies (anti Rabbit IgG, Art.No. 68-397; ICN Immuno Biologicals) with the same diluent (HRP antibody solution) prepared. The membrane is used for one hour at room temperature Incubated antibody solution A and then three times with phosphate buffered saline washed with 0.05% Tween 20. To the To detect antibody binding, the membrane is then a Incubated for one hour at room temperature with HRP antibody solution and each three times with a) Tween 20 (0.5 g / l) in phosphate buffered saline, b) with phosphate buffered saline and c) with TRIS buffer (50 mM; pH  7.4; washed with 200 mM NaCl). For the color reaction, a Solution of 4-chloro-1-naphthol (3 mg / ml in methanol) with five Volume of TRIS buffer (50 mM; pH 7.4; with 200 mM NaCl) diluted and Hydrogen peroxide added (final concentration 0.1 g / l). The The membrane is incubated in this substrate solution. A blue-black Coloring indicates L. monocytogenes.  

Table 1

Specificity of the polymerase chain reaction when using different primers according to formula IIa-IIh

Claims (22)

1. Primer, selected from the iap gene (invasion associated protein), for the amplification of nucleic acids, characterized by a sequence according to one of the formulas Va to Vh and / or an associated complementary sequence, in which
X ¹ and X ² each independently represent hydrogen, any nucleotide or any oligonucleotide with up to 20 nucleotide units. X¹AATATGAAAAAAGCX² (Va) X¹GCTTCGGTCGCGTAX² (Vb) X¹ACAGCTGGGATTGCX² (Vc) X¹ACTGCTAACACAGCTX² (Vd) X¹TAACAGCAATTCAAGX² (Ve) X¹CTGAGGTAGCGAGXTXAGCTAX 2. Primer, characterized by a sequence according to one of the Formulas IIa to IIh. ATGAATATGAAAAAAGCAAC (IIa) TTGGCTTCGGTCGCGTATAA (IIb) GCTACAGCTGGGATTGCGGT (IIc) CAAACTGCTAACACAGCTACT (IId) CAATAACAGCAATTCAAGTGC (IIe) TAACTGAGGTAGCGAGAGTGAGTCCAAGT 3. A peptide selected from the protein p60, characterized by a sequence according to one of the formulas IVa to IVi X³ProValAlaProThrGlnX⁴ (IVa) X³ThrGlnAlaThrThrProAlaX⁴ (IVb) X³AlaIleLysGlnThrAlaAsnThrAlaX⁴ (IVc) X³GlnGlnThrAlaProLysAlaProThrX⁴ (IVd) X³ValAsnAsnGluValAlaAlaAlaGluLysThrGluX⁴ (IVe) X³ThrProValValLysGlnGluValLysX⁴ (IVf) X³ValLysGlnProThrThrGlnGlnThrAlaProX⁴ (IVg) X³IleLysGlnProThrLysThrValAlaProX⁴ (IVh) X³GlnGlnThrThrThrLysAlaProThrX⁴ (IVi) wherein
X ³ and X ⁴ each independently represent hydrogen, any amino acid or any oligopeptide with up to 7 amino acids. 4. Peptide according to claim 3, characterized by one of the sequences shown in Fig. 2a-i. 5. Peptide according to claim 3, characterized by one of the sequences shown in Fig. 5a-d. 6. Use of a peptide according to any one of claims 3-5 for Preparation of immunogenic conjugates. 7. antibodies directed against the protein p60 from Listeria, characterized in that it is an epitope from the sequence of the 3 binds polypeptide.   8. Antibody according to claim 7, characterized in that it binds an epitope which contains one of the sequences shown in Fig. 2a-i. 9. Antibodies which can be produced by immunizing a test animal with a polypeptide according to FIG. 3 or with an immunogenic conjugate which contains a peptide with 7 to 24 amino acids selected from the polypeptide according to FIG. 3. 10. Antibody directed against the protein p60 from Listeria, characterized in that it binds an epitope which contains one of the sequences shown in Fig. 5a-d. 11. Antibodies which can be produced by immunizing a test animal with an immunogenic conjugate which contains a peptide according to one of FIGS. 5a-d. 12. A method for producing an antibody directed against the protein p60 from Listeria by immunizing a test animal with an immunogen and isolating the antibody, characterized in that the immunogen is a polypeptide according to FIG. 3 or an immunogenic conjugate which is a polypeptide Fig contains. 3 is used. 13. The method according to claim 12, characterized in that an immunogenic conjugate is used as the immunogen, which contains a peptide with 7 to 24 amino acids selected from the polypeptide of FIG. 3. 14. The method according to the preamble of claim 12, characterized characterized in that an immunogenic conjugate is used as the immunogen used a peptide according to one of the formulas IVa-IVi Claim 3 contains. 15. Use of a primer according to one of claims 1-2 for the detection of bacteria of the genus Listeria. 16. Method for the detection of bacteria of the genus Listeria by means of gene amplification, characterized in that a primer is used according to one of claims 1-2. 17. Use of an antibody according to any one of claims 7-11 for the detection of bacteria of the genus Listeria. 18. Method for the detection of bacteria of the genus Listeria by means of an immune reaction, characterized in that a Antibody according to one of claims 7-11 is used. 19. Test compilation for the detection of bacteria of the genus Listeria using polymerase chain reaction, characterized net that contain a primer according to any one of claims 1-2 is. 20. Test compilation according to claim 19 for the detection of Bacteria of the species Listeria monocytogenes. 21.Test compilation for the detection of bacteria of the type Listeria monocytogenes by immunoassay, characterized in that contain an antibody according to any one of claims 7-9 is. 22.Test compilation for the detection of bacteria of the type Listeria innocua by immunoassay, characterized in that it contains an antibody according to any one of claims 10-11.