DE4226373A1 - Glyco-proteins derived from Halobacterium salinarium - useful in treatment and prophylaxis of diseases by non-specifically stimulating the immune system - Google Patents

Abstract

Glycoproteins including the aminoacid sequence Glu-Glu-Pro-Asp-Gln-Thr-Thr-Val-Asp- Gln-Pro-Glu-Asn-Asn'-Gln-Thr-Met-Thr' -Thr'-Thr'-Met-Thr-Glu in which Asp' and Thr' respectively are bound to an acidic oligosaccharide by an N-glycosidic bonding and by a complete or partial O-glycosidic bonding to a neutral oligosaccharide are new. The glycopeptides may be elongated at (i) their N-terminus by up to 740 aminoacids (AA), and at their (ii) C-terminus by up to 54 AA, possible including N- and O-glycosidically bound oligosaccharides and/or polysaccharides. USE/ADVANTAGE - The glycopeptides are useful in medicaments for therapy and prophylaxis of patients with bacterial, viral, fungal and parasitic infections by boosting the unspecific body defence. The new glycopeptides are more effective in protection against infection and in increasing the colony stimulating factor (CSF). In an example, the 600 bp fragment of H.salinarious DSM668 was cleaved with subtilisin and the glycoproteins of the sequence above were shown to have a very good immunostimulating activity. The activation of tumour necrosis factor (TNF) activity in sera was determined by cytolysis of TNF-sensitive WEHI164/13 cells. NMRI mice together with WEHI-cells in FCS/RPMI medium were incubated overnight at 37 deg.C and 7% CO2. The TNF serum level was increased after treatment with the glycoprotein. To test the prophylaxis for acute infections (peritonitis, sepsis) 24 mice were either treated with the glycoprotein or glycopeptide or with physiological NaCl soln.. After 24 hr they were injected intraperitoneally with 10x LD50 of Staphylococcus aureus ATCC13709. After 7 days, none, 3/24 and 9/24 mice treated with 10 mg/kg of NaCl glycoprotein and glycopeptide respectively survived. 0/24, 6/24 and 12/24 survived when treated with NaCl, glycoprotein and glycopeptides respectively.

Description

The invention relates to certain glycopeptides of cell wall components Archaebacteria, medicaments containing such cell wall components and their Use to improve the body's defense.

It has been found that proteins, glycoproteins and glycopeptides derived from certain groups belonging to the archaebacteria can be used to stimulate the body's defense system and thus as immuno Logically active preparations can be used.

Archaebacteria are described in detail in The Bacteria, A Treatise On Structure And Function, Vol. VIII, Archaebacteria, Academic Press Inc., 1985; archaebacteria, Edited by Otto Kandler, Gustav Fischer Verlag, Stuttgart, New York 1982 and Archaebacteria, J. Mol. Evol. 11, 245-252 (1978), C.R. Woese et al. described.

It has now been found that certain glycopeptides from such cell wall Kompo a particularly good effect to improve the body's defense to have.

The improvement of nonspecific body-own defense wins as a therapy principle, because in clinical trials the efficacy immunostimulating substances as pharmaceuticals with wide application possibilities could be demonstrated in patients with impaired immune performance. A weakening of the immune system is u. a. in patients with malignant tumors after treatment with cytostatics and radiation, as well as in patients with observed chronic infections.  

Indications for such medicines are:

Prophylaxis and therapy of infections with bacteria, viruses, fungi and parasites in patients with existing or expected immune deficiency, eg. B .:

• - Tumor patients under chemo- / radiotherapy
• - Prophylaxis and therapy of chronic infections, eg. B .: chronic bronchitis, chronic pyelonephritis
• - Infection prophylaxis in HIV-positive persons
• - Infection prophylaxis in patients with burns
• - Tumor therapy by stimulating the immune system
• - Pre- and perioperative infection prevention
• - People of higher age.

The effect of drugs that improve non-specific defense is based on the provision and activation of immune cells, such as Of phagocytes responsible for the uptake and intracellular killing of germs by the release of cytotoxic mediators (eg, O ₂ radicals, enzymes). Such drugs may be either cytokines or substances which stimulate the production and release of cytokines in humans and / or have effects such as cytokines. Examples of the clinical use of cytokines which increase the defense reactions in humans are known. Thus, G-CSF and GM-CSF are approved as drugs (Gabrilove et al., (1988) N. Eng., J. Med., 318, 1414-22; Bronchud et al (1987) Br. J. Cancer 56: 809-813 ).

Immune stimulating activity has also been reported for glycoproteins and their Glycopeptide fragments from Halobacterien shown (EP 286 869). The immunostimulant effect was in vivo in the mouse and in vitro on cells of the immune system demonstrated.

The deepening of the glycopeptides obtained after trypsin cleavage Halobacteria revealed that from fraction I of example 3 section A Surprisingly, glycopeptides could be isolated with respect to the Effective height and effective dose - z. B. infection protection, increase in CSF activity - the Fraction II of Example 3, Section A (EP 286 869) are superior.

Compared to the entire glycoprotein, the new glycopeptides have a significantly improved effect.

Extensive subtilisin cleavage of this fragment leads to a glycopeptide (1) excellent immune stimulating activity, the following amino acid sequence has:

Glu-Glu-Pro-Asp-Gln-Thr-Thr-Val-Asp-Gln-Pro
Glu-Asn-Asn * -Gln-Thr-Met-Thr # -Thr # -Thr # -Met-Thr-Glu (1)

The labeled asparagine (Asn *) in the sequence given above is N-glycosi associated with one of the following acidic oligosaccharides (2):

β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-Glc or
β-D-Glc (1-4) β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-Glc (2)

These oligosaccharides are partially sulfated at the C3 atom of the glucuronic acids.  

In a small part of the oligosaccharides, the D-glucuronic acid by Be replaced L-iduronic acid.

At least two of the three labeled threonines (Thr #) are O-glycosidic with a neutral disaccharide (3) having the following structure:

α-D-glucose (1-2) β-D-galactose (3)

Although the amino acid sequence of the glycopeptide herein as part of the Amino acid sequence of cell surface glycoprotein (CSG) from H. halobium Chem. 262, 9724-29) (Lechner & Sumper (1987) J. Biol. Chem Glycopeptide in its glycosylation significantly from the published for this Structures from:

• A) Compared to the glycopeptide described here could be found by sequence analysis of the CSG from H. halobium no glycosylation on Asn of the amino acid sequence described here. On the other hand, an N-glycosylation could be experimentally detected on Asn-2, Asn-479 and Asn-609 of the sequence described there, ie outside the fragment described here (Lechner & Sumper, (1987) J. Biol. Chem. 262, 9724-29).
  The lack of N-glycosylation on Asn-753 in the H. halobium CSG was demonstrated by the results of pronase cleavage, which isolated one glycopeptide with the entire O-glycosylated region. This glycopeptide contained only galactose and glucose, but not the uronic acids and sulphate radicals characteristic of the N-glycosidically bound oligosaccharides (Wieland et al. (1992) Zbl. Bakt. Hyg., I. Depart. Orig. C3, 161-70). In the pronase cleavage of the glycopeptide described here, in contrast to galactose and glucose, glucuronic acid was always detected.
• B) The N-glycosidically bound in the CSG from H. halobium Oligosaccharides contain 2 or 3 glucuronic acids per oligosaccharide chain, 1 or 2 glucoses, 3 sulphate residues and one iduronic acid each (Wieland et al. (1986) FEBS 195, 77-81).
• C) Further differences also occur in the O-glycosidically bound Disaccharides. While exclusive in the glycopeptide described herein Glc (1-2) Gal was found to be H. halobium in the CSG both Glc (1-3) Gal (Paul & Wieland (1987) J. Biol. Chem. 262, 9587-93; Sumper (1987) Biochim. Biophys. Acta 906, 69-79) as well as Glc (1-2) Gal (Lechner & Wieland (1989) Annu., Rev. Biochem 58, 173-94).

The amino acid sequence of the subtilisin fragment described herein can be both be extended with amino acids at the N- as well as at the C-terminus. An example for the extension of the N- and C-terminus, the amino acid sequence of Trypsin cleavage of CSG from H. salinarium glycopeptide 4 (Sequence protocol 1).

The amino acid sequence was detected at the peptide level by direct N-terminal Sequencing as well as at the nucleotide level by DNA sequencing of the PCR amplification product of the C-terminal region of the CSG from H. salinarium (Sequence Listing 2).

Substantial extension of the N-terminus over structure 4 presents this total CSG from H. salinarium (Lechner et al, J. Biol. Chem. 1987, Vol 262, P. 9724-9729), which also has an immunostimulating effect. Gene sequencing of the C-terminal region of the total CSG from H. salinarium gave rise to the published sequence of H. halobiums at five positions Amino acids.  

The differences are as follows:

These differences can not be interpreted as artifacts of the PCR method since the sequence could be verified on three different clones.

The shortening of the C-terminal region of the obtained by trypsin cleavage Glycopeptides (Sequence Listing 1) - Ile-65 as the C-terminal amino acid - has none Influence on the immunostimulatory effect of the substance.

The amino acids added to the amino acid sequence of the subtilisin fragment can at the labeled positions (Sequence Listing 1) with Oligosaccha be linked, wherein the labeled threonines O-glycosidically with the Struk and the labeled asparagines N-glycosidically linked to the structure 2 could be.  

Example 1

Fermentation of halobacterium salinarium DSM 668 in seawater medium in 2000 l scale.

The cultivation of Halobacterium salinarium DSM 668 took place via the following stages:
Stem preserved in liquid nitrogen

25 ml shake flask
1 l - shake flask
20 l fermenter
200 l fermenter
2 000 l fermenter

At all culture stages, a nutrient solution was used, which was in a final volume of 1 liter contained the following ingredients:

Yeast autolysate Ohly PHT | 10.0 g / l Part 2: @ Na citrate 3.0 g / l (NH₄) ₂SO₄ 5.0 g / l MgSO₄ × 7 H₂O 21.0 g / l MgCl₂ × 6 H₂O 16.0 g / l NaHCO₃ 0.65 g / l KCl 5.0 g / l NaCl 250.0 g / l

The nutrient solution was prepared with deionized water, part 1 in 1/10, part 2 in 9/10 of the final volume. The pH of the Part 1 solution was with 1 N NaOH 7.2, the pH of the Part 2 solution was not adjusted.  

Production of the nutrient solution on an industrial scale: Part 1 was sterilized in a continuous process (150 ° C 52 sec) and in Submitted fermenter. Part 2 was then sterile filtered into the fermenter.

The culture was frozen with nitrogen (frozen at -196 ° C Culture broth). This was thawed; with about 1 ml, 30 ml Inoculated culture solution in 100 ml Erlenmeyer flask. The culture was at 35 ° C a rotary shaker incubated at 200 rpm for 5 days. At this time the culture had grown well and had an optical density at 578 nm of about 3. With 20 ml of this culture, 200 ml of culture solution. In a 1 liter Erlenmeyer inoculated and incubated for 3 days at 35 ° C and 200 rpm. With this 2nd passage 20 l culture solution was inoculated in a 30 l fermenter.

The conditions for this 20 liter stirred tank pre-culture stage were: 35 ° C, 200 rpm (disc stirrer), 10 l air / min, pH control with 35% H ₃ PO ₄ at 7.6, run time 72 hours. The entire volume from this pre-culture stage was inoculated into 2,000 l culture solution of the main culture step; the fermentation conditions were: 35 ° C, 100 to 150 rpm (the stirrer speed was chosen within this range to maintain the dissolved oxygen concentration above 20% saturation), 200 l air / min.

In the 2,000 l main culture step, the pH was adjusted to 7.0 with citric acid kept constant. The temperature at all stages was 37 ° C.

After a running time of about 60 hours, the optical density of the culture 2.5 to 3 measured at 578 nm, the cell count was 5 × 10 ⁹ and the biomass content about 7 kg wet weight / m ³ .

The culture solution was cooled at this time and the cells were harvested.  

example 2

All equipment used were previously successively with 2% sodium hydroxide lye and 2% nitric acid and washed neutral with water or sterilized before use.

The culture broth of Halobacterium salinarium (2,000 l) was pre-chilled Stirred vessel filled and further cooled with stirring with brine to 3 ° C to 5 ° C.

The red cell mass was added using a Westfalia separator SAMR 15037 4500 rpm (corresponding to 6000 to 8000 g) and a feed of 1000 to 1500 liters / hour separated from the nutrient medium. The anhaf from the nutrient medium The saline solution was mixed with 40 l of water or 25% sodium chloride solution repressed. The centrifugate of 2000 liters was discarded. The wet one Cell residue of about 35 to 70 kg was diluted with water 1: 1, with 250 mg each DNase and 250 g of RNase at pH 6.5 to 7.5 are treated to release the To degrade nucleic acids. The enzymatic nucleic acid degradation occurred within of 60 minutes at 20 to 25 ° C until the viscosity is a constant low value has reached. To the solution was added pre-chilled methanol to -18 ° C until 60 vol.% Are reached. The formed precipitate was filled with an Eller-Voll Centrifuged spin-coat at 1800 rpm, the solution was cooled.

The centrifugate of about 350 l was discarded. The residue of methanol precipitate From about 30 to 50 kg was 10 volumes, based on the residue of Methanol precipitation on n-butanol (pre-cooled to -18 ° C) and extracted again in a Eller-Schleuder with sieve drum and Köpersack at 500 to 1000 rpm centrifu yaws. The solid was washed on the running drum with n.-butanol and the centrifugate of about 500 l is discarded. The residue of n-butanol precipitation from 3 to 5 kg was in a vacuum oven at a temperature of 40 ° C. and a vacuum of 20 mbar for 24 hours. There were about 3 to 5 kg raw product received.  

example 3

Homogenization was used instead of DNase / RNase digestion in Example 2 or degradation of the nucleic acids in a high pressure homogenizer of the company Bran and Lübbe (type SHL 15) at a pressure of 500 bar. These High pressure homogenization has been reported at least once Conditions repeated. The further work-up was carried out as in Example 2 specified.

example 4

To avoid proteolytic degradation can according to Example 2 or 3 of the Protease inhibitor PMSF (phenylmethylsulfonyl fluoride) to the separator centrifugate be added.

1.74 g of PMSF were dissolved in 100 ml of ethanol and 10 ml of the solution of 10 each diluted Separatorschlamm given (contact time with stirring about 1 hour).

example 5

5 g of solid after lipid extraction with butanol was incubated in 250 ml of 50 mM Tris / HCl, pH 7.4, with 50 mg of trypsin (Type XIII, Sigma) for 16 hours at 37 ° C with stirring in a JA-14 rotor ( Beckrhann) was centrifuged for 25 minutes at 14,000 rpm and the supernatant was applied to a 36 ml DEAE-Sepharose (Fast Flow, Pharmacia) equilibrated with 0.1 M Tris / HCl, pH 6.8. After washing with 200 ml of equilibration buffer, a linear NaCl gradient (100 ml) of 0 to 0.5 M NaCl in 0.1 M Tris / HCl, pH 6.8 was applied. The elution course was detected by UV absorption at 260 and 280 nm. Further, the fractions were assayed for the presence of a 20 kD glycosylated band by SDS gel electrophoresis, transfer to PVDF membrane and subsequent detection of glycoproteins with the glycan detection kit (GD kit) (see Example 20). The appropriate fractions were pooled, concentrated by ultrafiltration, and chromatographed on an S-300 column (4.5 x 100 cm) with 10 mM NH ₄ HCO ₃ . The elution course was monitored by UV absorption at 260 and 280 nm. Fractions 54-74 (Figure 4) were pooled and a solution containing 50mM Tris / HCl; 44% phenol and 5% KCl prepared, stirred for 2 hours at 4 ° C and centrifuged. After dialysis of the aqueous phase, lyophilization was performed. 40 mg of a white substance was obtained.

This workup resulted in type 4 structures but without transmembrane domain. It is believed that the binding between Ile and Pro through H. salinarium own proteases is cleaved.

N-terminal sequencing gives the following amino acid sequence:

Gln-Asn-Val-Glu-Ile-Val-Glu-Glu-Ser-Glu-Glu

and small amounts of N-terminal truncated sequences such as

Val-Glu-Glu-Ser-Glu-Glu-Pro.

The amino acid composition is shown in Table 1.

Percent of single amino acid Asp 15.33 Thr 21.63 Ser 3.34 Glu 26.48 Gly 11.39 Val 6.04 Ile 4.14 Leu 3.46 Per 2.25

The carbohydrate components are described below.  

example 6

5 g of solid after lipid extraction with n-butanol were stirred twice with 100 ml of n-propanol: H ₂ O (1: 1) for 1 hour at 4 ° C, centrifuged at 15,000 rpm in a JA-20 rotor for 15 minutes and dried.

The resulting 4.79 g of products were again cleaved with benzonase by adding in 100 ml of buffer (50 mM Tris / HCl, pH 6.8, 1 mM PMSF, 1 mM 1,10-phenanthro lin) together with 250 U Benzonase (Merck) for 1 hour at room temperature were incubated. After addition of N, N-dimethyl-dodecylamine-N-oxide (LDAO) (0.5% w / v) was stirred at 4 ° C for 1 hour. Subsequently, in a JA-20 rotor centrifuged for 20 minutes at 20 000 rpm and the supernatant to a 200 ml DEAE-Sepharose (Fast Flow) column treated with 50 mM Tris / HCl, pH 6.8, 1 mM EDTA, 0.5 mM PMSF and 0.5% LDAO (buffer A) was equilibrated and with a linear NaCl gradient (400 ml) of 0 to 0.5 M NaCl in Buffer A elutes. The elution course was by UV absorption at 260 and 280 nm and by immunoblot and glycan detection kit (see Example 11). The desired fractions were pooled and the product was 70% Ethanol precipitated at 4 ° C.

308 mg were obtained which were dissolved in 15 ml of 50 mM Tris / HCl, pH 7.2 and cleaved with 3 mg of trypsin (type XIII, Sigma) for 4 hours at room temperature. The reaction was stopped by addition of 0.2 mM PMSF, 1 mM EDTA and 1 mM 1,10-phenanthroline (final concentrations) and equilibrated over a 40 ml CM-Sepharose supplemented with 50 mM Tris / HCl, pH 8.0 was, filtered. The filtrate was applied directly to a 36 ml DEAE-Sepharose (Fast Flow) column equilibrated with 200 ml of 0.1 M Tris / HCl, pH 6.8 and 1% w / v LDAO. After washing with 200 ml of equilibration buffer, a linear NaCl gradient (200 ml) of 0 to 0.5 M NaCl in 0.1 M Tris / HCl, pH 6.8 and 1% (w / v) LDAO was applied. The elution course was detected by UV absorption at 260 and 280 nm. Further, the fractions were examined by Western blot followed by immunoblotting for a 20 kD band. The appropriate fractions were added together, concentrated by ultrafiltration and chromatographed on an S-300 column (4.5 x 100 cm) with 10 mM NH ₄ HCO ₃ . The elution course was monitored by UV absorption at 260 and 280 nm and by immunoblot. The fractions were pooled and a solution prepared with 50 mM Tris / HCl, 44% phenol and 5% KCl, stirred for 2 hours at 4 ° C and centrifuged. After dialysis of the aqueous phase was lyophilized. 31 mg of glycopeptide 4 were obtained as a white powder.

The occurrence of the amino acids arginine proves the structure 4 (see Table 2).

The carbohydrate components are described below.

N-terminal sequencing gives the following amino acid sequence:

Gln-Asn-Val-Glu-Ile-Val-Glu-Glu-Ser-Glu-Glu.

The amino acid composition is shown in Table 2.

Percent of single amino acid Asp 13.16 Thr 17.50 Ser 5.11 Glu 22.38 Gly 10.99 Ala 6.15 Val 8.07 mead 1.79 Ile 4.02 Leu 5.7 Phe 1.16 bad 1.11

example 7

500 mg of substance 4 without transmembrane domain were dissolved in 50 ml of buffer (50 mM Tris / HCl, pH 8.0, 1 mM CaCl ₂ , 1 mM MgCl ₂ ), mixed with 25 mg of subtilisin (Sigma) and at 36 ° for 24 hours C incubated. This was followed by FPLC separation on Mono Q (HR 10/10, Pharmacia) with a linear NaCl gradient from 0 to 1 M NaCl in 100 mM Tris / HCl, pH 6.8. The gradient run lasted 60 minutes. It was detected at 210 nm. The fraction eluted from the column with 0.48 to 0.5 M NaCl was lyophilized and chromatographed on a P-2 column (4.5 x 100 cm) with H ₂ O. The substance which eluted from the column in the exclusion volume was lyophilized.

98.5 mg of substance 1 were obtained.

N-terminal amino acid sequencing revealed as a major sequence:

Glu-Glu-Pro-Asp-Gln-Thr-Thr-Val-Asp-Glu-Pro-Glu

and in small quantities a sequence extended by the amino acid serine:

Ser-Glu-Glu-Pro-Asp-Glu-Thr-Thr-Val-Asp-Glu-Pro.

The amino acid composition is shown in Table 3.

amino acids Percent of single amino acid Asp 15.74 Thr 33.29 Glu 33,20 Val 2.33 mead 6.28 Per n.d.

Due to N-terminal amino acid sequencing, amino acid combined and the DNA sequence deduced from the amino acid sequence of 4 leaves Structure 1 is derived.  

example 8

The N-terminal amino acid sequencing of 4 resulted in a peptide sequence that 100% homologous to the amino acid sequence from the C-terminal region of the CSG from H. halobium (J. Lechner and M. Sumper, J. Biol. Chem. (1987) 262, 9724-29). to Investigation of whether the entire C-terminal regions of the CSG of H. salinarium and H. halobium are identical, the corresponding DNA fragment from the chromosomal DNA from H. salinarium amplified using the PCR method, cloned and sequenced.

A) Isolation of the chromosomal DNA of H. salinarium

From 10 ml of culture broth was prepared by centrifugation in a JA-14 rotor. (Beckmann) received the bacterial cells at 7000 rpm for 10 minutes, in 2 ml buffer (10 mM Tris / HCl, pH 8.0, 2.5 M NaCl) and dropwise to 8 ml of a solution of 10 mM Tris / HCl, pH 8.0; 0,5 m EDTA, 100 μg / ml proteinase K and 0.4% laurylsarcosine added. To 1 hour incubation at 37 ° C was first 3 times with phenol / chloroform, 1: 1, and then extracted twice with chloroform. To the aqueous Phase against 1 L TE buffer (10 mM Tris / HCl, pH 7.4, 1 mM EDTA) were dialysed 0.6 vol. isopropanol, 0.1 vol. 3M NaOAc, pH 5.2, added and centrifuged after 10 minutes. The residue was 3 times washed with 80% ethanol, dried and in 2 to 3 ml 10 mM TE buffer added. For this purpose, 1.3 g of CsCl and ml of solution per ml 40 .mu.l / ml of a 10 mg / ml ethidium bromide solution and in a Beckmann VTI-65 rotor centrifuged at 15 ° C with 50000 rpm for 20 hours.

The chromosomal DNA was removed and seeded 5 to 7 times with CsCl extracted extracted isopropanol. The DNA-containing solution was 5 times with TE buffer diluted with 0.6 vol. Isopropanol and 0.1 vol. 3 M NaOAc, pH 5.2; precipitated and centrifuged. Then the residue was 3 times Washed 80% ethanol, dried and aufgenom in 1 ml of TE buffer men.  

B) Amplification and isolation of the 600 bp fragment

The amplification of the DNA fragment from the C-terminal region of H. salinarium cell surface glycoprotein was carried out by means of the PCR reaction (Current Protocols in Molecular Biology Vol. 2, 15.01-15.4.6) using primer I.
d (AAGTTCGGTGAGGACACC) and the primer II
d (TCACTTCTGGCGCAGXGCCAGCAG). The following reaction mixture was used:

10 μl buffer (100 mM Tris / HCl, pH 8.4, 500 mM KCl, 1 mg / ml gelatin, 10 mM MgCl)
16 μl 2 mM nucleotide mixture
10 μl of primer I (10 pmol / μl)
10 μl Primer II (10 pmol / μl)
1 μl template DNA (50 ng / μl)
0.5 μl of Taq polymerase (6.5 U / μl)
53 μl H ₂ O
2 drops of mineral oil.

After denaturation of the DNA at 94 ° C for 2 minutes, 30 seconds was found Addition of the primers to the ss DNA at 50 ° C instead, whereupon the Polymerase reaction at 72 ° C for 2 minutes and again a denaturation Stepped for 20 seconds at 94 ° C. This cycle has been 40 times run through. An aliquot of the reaction mixture was on a 1.5% Agarose gel separated and analyzed by Southern blotting (Current Protocols in Molecular Biology Vol. I 2.9.5). As a hybridization probe served the radioactive labeled DNA sequence,

d (ACGACCACCGAGACCACCACC)

that obtained by FAB analysis corresponds to the peptide sequence Thr-Thr-Thr-Glu-Thr-Thr-Thr. That through Southern blot analysis detected 600 base pair fragment was removed from the Cut out 1.5% agarose gel and the DNA with the Geneclean Sy according to the manufacturer's instructions (Bio 101, La Jolla, California) cleaned.  

Subsequently, the isolated DNA fragment according to a method manufacturer (Invitrogen, TA Cloning Instruction Manual, San Diego, California) with the linearized pCT vector, and competent E. coli cloned. The subsequent colony hybridization was after Sambrook et al (Sambrook, Fritsch and Maniatis, Molecular Cloning, Vol. I, 2. ed., 1.90-1.104) with the hybridization probe described above carried out. The colonies hybridising with the oligodeoxynucleotide were in 4 ml LB medium in the presence of 50 ug / ml kanamycin incubated at 37 ° C. The cells were centrifuged (10,000 rpm, 5 Minutes, Eppendorf centrifuge) and in 150 μl of STET buffer (8%). Sucrose, 0.5% Triton X-100, 50 mM EDTA and 50 mM Tris / HCl), the 2 mg / ml lysozyme, shaken gently for 10 minutes at room temperature treated, mixed with 300 ul 0.2 M NaOH and 0.1% SDS and another 5 minutes incubated. After addition of 300 μl of 3 M NaOAc, pH 5.2, the over was mixed with 720 ul of isopropanol and 10 minutes at 10 000 rpm in an Eppendorf centrifuge centrifuged. The residue was washed off taken up with ethanol in 100 μl of TE buffer, with 100 mg of CsCl and 10 μl Ethidium bromide solution (10 mg / ml) and 10 minutes in one Centrifuge microcentrifuge at 10,000 rpm. The supernatant was now Extracted 3 times with 200 .mu.l of CsCl-saturated isopropanol. To Dilution with 450 μl of TE buffer was followed by addition of the plasmid 720 ul of isopropanol precipitated. The residue was washed in ethanol and taken up in 20 μl of TE buffer.

C) Sequencing

3 μg of plasmid were dissolved in 20 μg of 0.2 M NaOH at room temperature for 5 minutes denatured. After precipitation of the DNA, the sequencing with the Sequenase kit according to the instructions of the manufacturer (United State Biochemical Corporation). The sequencing of three clones occurred in both Directions.  

It turns out that both the amino acid, as well as the DNA sequences of the C-terminal trypsin cleavage fragments of H. salinarium and H. halobium are identical. Outside this sequence, differences occur at 5 positions in the amino acids. These differences do not represent artifacts of PCR reaction, because the results of sequencing of three clones to match.

example 9 Examination of the O-glycosidically bound oligosaccharides 9.1 Kinetic β-elimination for the analysis of O-glycosylation

70 μg of glycopeptide were dissolved in 1 ml of 0.1 N sodium hydroxide solution and dissolved in Quartz cuvettes photometrically for 15 hours at 232 nm in 5 minutes-Ab measured. The comparative solution was 0.1 N sodium hydroxide solution taken. The increase in absorbance at 232 nm is proportional to that at the mild β-elimination from the O-glycosylated threonines or Serines resulting α, β-unsaturated amino acid derivatives.

9.2 Isolation of the O-glycosidically linked oligosaccharides

5 to 10 mg of glycopeptide were dissolved in 2 ml of 0.05 N NaOH / 1 M NaBD ₄ or NaBH ₄ and incubated for 14 hours at 37 ° C. By adding solid Dowex 50X8 (H⁺), the pH was adjusted to 4 to 5, stopping the reaction. The cation exchanger was filtered off via glass wool and the boric acid was removed by repeated addition of methanol as boric acid methyl ester on a rotary evaporator. Then the solution was completely concentrated, in 2.5 ml of deion. Water and chromatographed on a Biogel P2 column (column volume: 150 ml).

A total of 100 fractions of 1 ml each were collected. 40 μl each of these Fractions were tested for sugar with the phenol-sulfuric acid test (Dubois et al (1956), Anal Chem 28, 350-356).

The positive fractions were collected and lyophilized. The fractio NEN 48-58 contain the de-O-glycosylated glycopeptide (component I), the Fractions 94-106 the reduced O-glycosidically linked oligosaccharide (Component II).

For further purification, Component I in deionized Was and taken over a DEAE column (column volume: 8 ml) gege and with a NaCl-Gra increasing continuously from 0 to 1 M NaCl served eluted. The flow rate of the column was 2 ml / min. It 60 fractions of 2.5 ml were collected. 150 μl of these fractions were Tested for uronic acid using a carbazole test. The positive fractions were combined lyophilized and then desalted on Sephadex G25 and analyzed.

Component II was further purified by AG1-X2 (OAc). To a column was filled with 20 ml of anion exchanger. The substance was dissolved in 2 ml of 5 mM pyridinium acetate pH 5.5 and applied to the column. Subsequently, each with 3 column volumes 5 mM, then with 100 mM, 250 mM and 500 mM pyridinium acetate pH 5.5 eluted. 100 μl of the collected 2 ml fractions were assayed with the phenol-sulfuric acid tested for sugary components. The positive fractions, which is in a typical range for neutral oligosaccharides at 5 mM Buffer eluted, were collected, lyophilized and analyzed.

The amino acid analysis demonstrated α-aminobutyric acid become. Accordingly, the O-glycosidically bound oligosaccharides are on Bound threonine. Comparison with the amino acid composition of the obtained by trypsin cleavage glycopeptide showed that about 80% of Threonines are O-glycosylated.  

9.3 Analysis of Cleaved Oligosaccharides 9.3.1 Gas Chromatography of Peracetylated Sugar Alditols

200 ug oligosaccharide were hydrolyzed with 6 N trifluoroacetic acid for 6 hours at 100 ° C, the monosaccharides with NaBD ₄ (4 mg / ml 0.05 M NH₄ OH) for 1 hour at room temperature.

The sugar alcohols were boric acid after removal of the boric acid methyl ester with pyridine: acetic anhydride = 1: 11 hours at 100 ° C. peracetylated. After removal of the solvents, the residue was dissolved in Dichloromethane and via a Durabond 1 capillary column (60 m, J & W) on a Varian 3400 gas chromatograph (temperature gradient 120 to 270 ° C, 1 ° / min) and chromatographed with a FID (Detector temperature 270 ° C) detected. By comparison with standards the components were determined by the retention times as glucitol and Galactitol identified. Based on the peak areas, a ratio of Galactitol: Glucitol of 1: 1 can be determined.

9.3.2 Mass spectrometric analysis of O-glycosidically bound oligo saccharides

The neutral oligosaccharide was peracetylated as described in 9.3.1 and examined by mass spectrometry. The molecular weight of the peracetylated According to EI-MS and CI-MS spectrum, oligosaccharide is 722 daltons, which is corresponds to the molecular weight of a reduced, peracetylated dihexose.

9.3.3 HPLC analysis of the O-glycosidically bound disaccharides

For component elucidation, the oligosaccharide with 6 N trifluores acidified and hydrolyzed at 100 ° C for 6 hours. The mono saccharides were on an HPLC system (Beckman) using a  AS6-A anion exchange column (5 μm, Dionex) in the individual Separated sugar components, which with a pulsed amperometri detector PAD (Dionex) were detected and the computer Goldsystem (Version 4, Beckman) by comparison with Stan dards analyzed. The neutral monosaccharides and the aminosugars wur The isocratic with 15 mM sodium hydroxide solution with a flow of 1 ml / min chro and after Nachsäulenzufuhr of 300 mM sodium hydroxide solution ampe detected rometrically. The negatively charged monosaccharides were used with 100 mM sodium hydroxide solution / 30 mM NaOAc also with 1 ml / min isocratic ge separates. The detection was carried out as before after addition of 300 mM sodium hydroxide lye.

The analysis revealed that the disaccharide was at the non-reducing end Contains glucose.

9.3.4 linkage analysis

200 μg of disaccharide were prepared according to T.J. Waeghe et al., 1983 (Carbohydr. 123, 281-304) with the modification according to Phillips & Fraser, 1981 (Carbohydr. Res. 90, 149-152) with potassium dimsyl base.

The EI-MS spectrum of the permethylated disaccharide shows that for a quadruple methylated hexose typical fragments m / z 219, 187, 155, 101, 88 and 45 and for the five-fold methylated hexitol the fragments m / z 235 and 171. The fragments m / z (177), 145, and 115 indicate the splitting off of a quadruple methylated C4 fragment and thus on a 2- or 5-linkage of galactitol (Dulcit) out.

The EI-MS of the partially methylated Zuckeracetate have characteristic Fragmentation pattern, which by comparison with standard spectra as 2-O-acetyl-1-deutero-1,3,4,5,6-penta-O-methyl-galactitol and 1,5-di-O- Acctyl-1-deutero-2,3,4,6-tetra-O-methylglucitol were identified.  

9.3.5 NMR spectroscopic examination of the reduced disaccharide

The 500 MHz ¹ H NMR spectrum of the sodium borohydride reduced disaccharide has a signal at 5.10 ppm for the terminal glucose H1 atom. The chemical shift and the small coupling of 3.5 Hz prove an α-configuration of the glucose unit. The double triplet at 3.97 ppm could be assigned to the H2 atom by using the 2D homocorrelated spectrum (COZY) and the triplet at 3.78 ppm to the H5 atom of galactitol. The coupling pattern of the signal at 3.94 ppm simplifies in the spectrum of the sodium boride-deuterated disaccharide to a double doublet. The chemical shift of the H2 signal compared to the spectrum of the free galactitol and the different σ values of the otherwise overlapping signals for the H2 and H5 atoms prove a substitution at C2 of the sugar alcohol.

The assignment in the ¹³ C-NMR spectrum confirms the structure 3:

9.4 Investigation of the configuration of galactose

150 ug glycopeptide were dissolved in 20 ul citrate buffer pH 6.4 and with 0.1 U α-glucosidase and α- or β-galactosidase are added and then Incubated for 14 hours at 37 ° C. The solution was over with Dowex 50 (H⁺) filled pipette. The pass was caught and then the column with another 800 .mu.l ention. Washed water. The aqueous solutions were combined and passed through a Sep-Pak C18 cartridge further separated. The aqueous solution was analyzed by HPLC (9.3.3) and examined with an anthrone test. Only with enzymatic cleavage free galactose was detected with β-galactosidase.

9.5 Examination of the O-glycosylation sites

The obtained by trypsin cleavage glycopeptide was initially with Cyanobromide (B.J. Smith in New Protein Techniques (1988), Humana Press Clitton, New Jersey, p. 71ff) and then V8 (G. Allen in "Sequencing of proteins and peptides "(1981), Elsevier Science Publisher B.V., p. 58ff) digested. The sample was analyzed by HPLC (RP 18) with an acetonitrile-Gra served in the presence of 0.01% TFA (0 to 100% within 2 hours the) cleaned. The fractions were β-eliminated and included released disaccharides after permethylation (9.3.4) using FAB-MS detected (m / z 471). The thus identified O-glycosylated glycopeptides were underivatized or after permethylation by FAB-MS analyzed. The masses m / z 1329 and 1654 correspond to glycopeptides, the by comparison with structure 4, amino acids 31-36 (Thr-Glu-Thr-Thr-Thr-Glu) with two or three underivatized Disaccharides could be assigned. The masses m / z 1329 and 1654 were able to sequence Met-Thr-Thr-Thr-Gln-Glu (amino acid 41-46) with two or three bound disaccharides are assigned.  

The permethylated glycopeptides (cf. I.7) give signals at m / z 1801 and 1393, which sequence of Thr-Thr-Thr-Glu (amino acids 33-36 of Structure 4) associated with three or two bound disaccharides can.

Accordingly, the sequence is:

Thr-Glu-Thr-Thr-Thr-Glu-Thr-Thr-Thr-Glu-Met-Thr-Thr-Thr-Gln-Glu

with six to nine disaccharides O-glycosylated.

example 10 Investigation of N-glycosidically bound oligosaccharides 10.1 Sugar analysis of the subtilisin-derived glycopeptide

a) The component elucidation by HPLC analysis (see 9.3.3) showed that the Glycopeptide in addition to galactose and glucose which contains glucuronic acid, which mild β-elimination de-O-glycosylated glycopeptide, however, only glucose and glucuronic acid. The main sugar components of N-glycosidic bound oligosaccharide are glucose and glucuronic acid.

b) The quantitative determination of the hexoses with the anthrone test (Dische (1962) Meth. Carbohydr. Chem. 1, 389-390) and glucuronic acid with the Carbazole test (Dische (1947) J. Biol. Chem. 167, 189-194) intact glycopeptide has a hexoses / glucuronic acid ratio of about 2.3: 1, the de-O-glycosylated glycopeptide is glucose / glucuronic acid On the other hand, the ratio is about 1.5: 3. This indicates that the N-glycosidically bound oligosaccharides from 1 to 2 glucoses and 3 Glucuronic acids are constructed (tetra- or pentasaccharides).

Sulfate determination according to Terho & Hartiala, 1971 (Anal. Biochem. 471-476), 0.3 moles of sulfate per mole of glucuronic acid. So that's it Oligosaccharide substituted with a sulfate radical.  

c) 500 μg of de-O-glycosylated glycopeptide were carboxyl-reduced according to the method of J. Lehrfeld, 1981 with sodium bordeuteride (Anal.Biochem., 115, 410-418) and the solution subsequently desalted via a PD 10 column (Pharmacia) , The sample was derivatized as described under 9.3.1 and analyzed by GC-MS. By comparison with the internal standards (glucose, idose, M + NH ₄ ⁺: 453) it was possible to detect not only carboxyldeutero-reduced glucuronic acid (M + NH ₄ ⁺: 455) but also small traces of decalin-reduced iduronic acid.

10.2 Mass spectrometric analyzes 10.2.1 FAB-MS analysis

The glycopeptide was permethylated as described in 9.3.4 or deuteropermethylated by addition of deuterated methyl iodide. The methylated fractions of the Sep-Pak separation was analyzed by negative Ion FAB-MS analyzed. In the permethylated 15% acetonitrile fraction One finds signals at m / z 533 or 329, which in the spectrum of deuteromethylated fraction to m / z 554 and 341, respectively. These correspond to a fragment consisting of 1 hexose, 1 hexuronic acid and 1 sulfate ester or a fragment consisting of 1 hexuronic acid and 1 Sulfatester. A signal at m / z 751, which in the spectrum of deuteromethy The fraction fractionated to m / z 781 can shift the fragment Hex-HexUA-HexUA be associated with a sulfate radical. The fragments are created by a methylation β-elimination of the 1,4 linked Glucuronic acids in the following structures:

and

10.2.2 linkage analysis

Through the linkage analysis of the carboxyl-reduced, de-O-glycosy The following partially methylated glycopeptides (see 9.3.4) could be used Sugar acetals are identified:

1,5-Di-O-acetyl-1-deutero-2,3,4,6-tetra-O-methylglucitol
1,4,5-Tri-O-acetyl-1-deutero-2,3,6-tri-O-methylglucitol
1,4,5-Tri-O-acetyl-1,6-deutero-2,3,6-tri-O-methylglucitol
1,3,4,5-tetra-O-acetyl-1,6-deutero-2,6-di-O-methylglucitol.

Thus, the oligosaccharide consists of terminal glucose, 1,4-linked glucose, 1,4-linked glucuronic acid and 1,3,4-substituted Glucuronic.

10.3 Analysis of the reducing end of the oligosaccharide

To study the reducing end of the N-glycans, 1 mg Glycopeptide according to the method of Morf & Lampert, 1977 (Anal. Biochem. 82, 289-309) treated with anhydrous hydrofluoric acid and thus all Cleaved O-glycosidic sugars.

The proteinaceous components were separated and analyzed via a Sep-Pak C18 cartridge of salts and split sugars. The ¹ H NMR spectrum shows an anomeric signal at 4.9 ppm with a β-anomeric trypic signal splitting. Component analysis by HPLC (9.3.3) revealed that the sugar is glucose.

Thus, the N-glycosidically-linked oligosaccharide is reduced bound the end via a glucose to asparagine.  

10.4 Examination of the unreduced end of the oligosaccharide

1 mg of the de-O-glycosylated glycopeptide was dissolved in 1 ml of 1 M NaOH / 1 M NaBD ₄ and heated at 100 ° C for 4 hours (drastic β elimination). The solution was then neutralized and the boric acid removed by co-distillation with methanol. The residue was measured by ¹ H NMR spectroscopy. The spectrum has three signals at 8: 5.80; 5.87 and 5.95 ppm, whose chemical shift is characteristic of the H4 signals of α, β-unsaturated uronic acids. The sample was then further separated on a PD-10. 20 .mu.l of the 20 total molten 500 .mu.l fractions were examined with the phenol-sulfuric acid test and the carbazole test for sugar or uronic acids. The positive fractions, which elute in the range of charged disaccharides, absorb at 240 nm in a characteristic range for unsaturated compounds. The fractions were pooled and lyophilized. The sugar analysis and the MS analysis of the permethylated disaccharides revealed that this product consists of an α, β-unsaturated glucuronic acid and a glucitol.

10.5 Enzymatic glucose cleavage

150 μg de-O-glycosylated glycopeptide was dissolved in 200 μl citrate buffer pH 6.4 dissolved and treated with 0.1 U α-glucosidase or β-glucosidase and how treated under 9.4. Only in the case of β-glucosidase treated Sample could be detected glucose.

10.6 Pronase digestion

2 mg of the subtilisin-derived glycopeptide were determined by the method by R.G. Spiro, 1972 (Meth. Enzymol., 28, 3-43) digested with pronase. The Proteins were separated with Dowex 50X8 (H⁺). The glycopeptides were chromatographed on an RP 18 column (Pharmacia) by HPLC and at 210 nm detected. The 0.2 minute fractions were treated with the phenol  Sulfuric acid test for sugar. The positive fractions were isolated and analyzed by anthrone and carbazole assay. The Hexose: hexuronic acid ratio of the obtained by pronase cleavage Glycopeptide is 2.5: 1 and thus corresponds to the ratio of by Subtilisin cleavage of glycopeptide obtained. Accordingly, that contains by Pronase cleavage glycopeptide obtained both the O- and the N-glycosylation sites.

The following Examples 11 to 22 show the effect in some biological Systems:

example 11 Detection of glycoprotein and glycopeptides from Halobacterium salinarium

For more detailed analysis of fragments used in immunostimulant preparations When glycopeptides are formed, corresponding samples were denatured Subjected to SDS gel electrophoresis. This was the case of Laemmli, U.K. (Nature, 227 680; 1977). After the run were the up bands separated electrophoretically on polyvinylidene difluoride (PVDF) membranes (detailed description of the method in Harlow, E. and Lane, D .: Antibodies - A laboratory manual, Cold Spring Harbor Laboratory 1988).

Immobilized cell wall glycoprotein, as well as fragments thereof, were transferred via their Sugar side chains detected. For this, the sugars were oxidized by periodate and then reacted with digoxigeninhydrazide. The way with digoxigenin labeled glycoproteins and peptides were characterized by a digoxigenin-specific fish, alkaline phosphatase-coupled antibodies and the subsequent Enzyme reaction in which an insoluble reaction product is released on the Membrane detected. This glycoprotein detection is as a glycan detection kit from Boehringer Marutheim and detailed on the package leaflet described.  

In addition to this method, immobilized glycoproteins and peptides were also included a specific monoclonal antibody (mAb) detected (immunoblot; after electrophoresis and transfer to PVDF membranes or enzyme coupled Immunosorbent assay, ELISA). This mAb was prepared as follows: a purified, by tryptic cleavage from the cell wall glycoprotein of H.sal. glycopeptide fraction obtained was purified with keyhole limpet hemocyanin (KLH) coupled by the addition of glutaraldehyde. With this conjugate were female Balb / c mice (6 to 8 weeks old) according to the following schedule every 14 days immunized: 100 μg s.c. (referring to the glycopeptide) with Freund's complete Adjuvant, twice 50 μg s.c. with Freund's incomplete adjuvant and, three days before the fusion 50 μg i.v. and 50 μg i.p., both without adjuvant. The PEG-mediated Fusion, rearing and cloning of hybridomas and purification of monoclonal immunoglobulin was given to Harlow and Lane (supra) Methods performed following. To test the antibody-containing hybridoma Residues were the typical Glykopeptid on polystyrene microtiter plates bound. Culture supernatants which specifically bind in this assay were probed with the Immunoblotting method (see above) further characterized. Derived from this immunization mAb F35-600 binds to the glycoprotein of H.sal. and fragments thereof, and was used to detect these fragments, the Molekularge weight estimate and used for concentration estimation.

Specifically bound mAb was detected either by anti-mouse immunoglobulin sera bound to alkaline phosphatase (immunoblot) or those linked to horseradish peroxidase (ELISA). These tests were also taken from the Harlow and Lane manual.
Fig. X: Detection of glycoprotein fragments in the immunoblot
Lane 1,3-glycoprotein from H. salinarium
Lane 2,4-tryptic digestion of the glycoprotein from H. salinarium
Lane 1.3 immunoblot with F35-600
Lane 3,4-Glycan Detection Kit

example 12 Activation of human monocytes

The cytokines are tumor necrosis factor (TNF), colony stimulating factor (CSF) and Interleukins (IL) represent mediators of the immune system.

In vitro, the formation of IL-1 and 10 was dose-dependent on human monocytes TNFα detect (24 hours culture period, use elutriergereinigter Monocytes with <70% purity, detection of TNFα in the WEHI assay, detection of IL-1 by D10 cells (bioassay), concentration range of glycopeptide 0.1 to 100 μg / ml).

example 13 Activation of granulocytes

On purified peripheral, human granulocytes (<95% purity) could by the glycopeptide in the absence of another stimulus neither a leukotriene still an oxygen radical formation can be observed. On the other hand led the Preincubation of granulocyte fractions with the glycopeptide into one "Priming" the cells with increased oxygen radical and leukotriene formation (Secondary stimulus fMLP and Ca-ionophore).

The in vitro data show that the glycopeptide has several mechanisms and different cell types have a stimulating effect on the nonspecific Has infection control.

example 14 Tumor Necrosis Factor (TNF)

Serum TNF activity was determined by cytolysis of TNF-sensitive WEHI 164/13 cells. Serum samples from treated mice of the strain NMRI were incubated together with WEHI cells in FCS / RPMI medium overnight at 37 ° C and 7% CO ₂ . As controls, sera from untreated or LPS-treated mice were carried. The glycopeptide induces higher levels of serum TNF in mice than glycoprotein. While only weak TNF activity was measured at a dose of 10 mg / kg glycoprotein, TNF serum levels were markedly elevated after treatment with the glycopeptide. Pretreatment with antibodies to murine TNF neutralized TNF activity.

example 15 Detection of tumor necrosis factor (TNF) in the galactosamine model

By infection or after administration of the cell wall building block lipopolysaccharide (LPS) of gram-negative bacteria it comes to the release of TNF and at high TNF levels for septic shock with fatal outcome.

By treatment with galactosamine, the sensitivity of mice to TNF elevated. The galactosamine model is therefore characterized by its high sensitivity to detect TNF. Even under low doses of LPS, below In fektionsbedingungen with otherwise sublethal pathogen amounts or substance-indu In galactosamine-treated mice, it can adversely affect TNF release with leta Come in shock. Intraperitoneal, intravenous or subcutaneous administration of the Glycopeptides from H. salinarium dose-dependently led to the lethality of galactosamine sensitized mice. It was found that the glycopeptide already at 0.03 mg / kg 50% lethality triggered, whereas the lethality for the glycoprotein at 0.1 mg / kg remains well below 50%. These effects could be due to antibodies be inhibited against TNF. The results again show the ability of Gly copeptids for TNF induction.

example 16 Immune Tolerance / unresponsiveness

The release of TNF by the glycopeptide failed one by the gram negati Escherichia coli (E.) coli induced TNF release normally lead to septic shock (immune tolerance / non-respon-  sive ness). The condition of this tolerance could be up to 5 days after glycopeptide Gift be observed.

Experimental studies of the past have shown that more normal lethal doses of endotoxin / LPS do not result in the expected immune responses lead ("unresponsiveness") when previously in contact with a sublethal dose LPS took place (sensitization). This phenomenon is called tolerance. Recent results showed that tolerance is not directly dependent on endotoxin, but via a cytokine release (TNF) is mediated. That was tolerance inducible by sensitization with recombinant TNF.

On the basis of this information, the glycopeptide became tolerogenic Potential examined. F1 (B6D2) mice became one hour and 24 hours, respectively Stress with a lethal LPS dose of 10 mg / kg body weight of the glycopeptide sensibili Siert (LPS: 0.1 kg / mouse plus 600 mg / kg D-galactosamine = 100% mortality in the NaCl-control group). Both experimental approaches, sensitization one hour or 24 hours before the stress, led to tolerance and thus to protection.

example 17 Colony Stimulating Factor (CSF)

Bone marrow cells (10 ⁵ ) were incubated together with serum from treated NMRI mice in McCoy 5A medium (0.3% agar) at 37 ° C and 7% CO ₂ . After 7 days, the number of stem cell colonies (CFU-C) was counted. As a control, serum from untreated or LPS-treated mice was carried. The glycopeptide induced higher CSA levels in serum of mice compared to glycoprotein. While only a slight CS activity was measured at a dose of 10 mg / kg glycoprotein, the serum CSF level was markedly elevated after glycopeptide treatment.

example 18 Hematopoiesis / leukocyte count

In the rabbit, the single, intravenous injection of the glycopeptide caused H. salinarium (dose: 1 mg / kg body weight) an increase in the number of peripheral Leukocytes beyond normal. The increase in leucocyte numbers is reassuring te on an increase in neutrophilic granulocytes. The increased white blood cell count was observed for four days.

Cyclophosphamide-pretreated, deficient-weakened animal (rabbit) the effects were even more evident. After three injections of Cyclophosphamide (30 mg / kg i.v.) and 1 mg of the glycopeptide once per kg of body weight on day 4 (or the corresponding volume of PBS buffer) the leukocyte counts were in the group treated with the glycopeptide within the next 6 days (until day 10) over those of the control animals. This Increase was due to an increase in left-shifted granulocyte counts, which persisted over the 11th day caused. The results are consistent with Findings on hematopoietic activity in bone marrow (Mouse).

example 19 Hematopoiesis / bone marrow

Regeneration of the hematopoietic system after damage to the hematopoietic system Bone marrow by 5-fluorouracil was obtained by treatment with the glycopeptide accelerated dose-dependently (10 to 100 mg / kg sc). With 5-fluorouracil immunosuppressed mice (reduction of stem cell count) showed 4 days after sc Administration of 100 mg of glycopeptide per kg normal values. The effects with 30 and 10 mg / kg were lower, but here too an accelerated Bone marrow restoration versus fluorouracil control observed.  

example 20 radioprotection

The administration of the glycopeptide at a dose of 10 mg / kg protected mice Lethality by gamma rays. The protective effect could not be due to antibodies be lifted against TNF. Presumably, the protection is by induction of Because the glycopeptide is capable of delivering IL1 release, IL1 mediates induce.

example 21

The glycoprotein (MW 200,000) from Halobacterium salinarium was distinguished good effects in terms of improving the defense against infection (EP 286 869). Surprisingly, with the present glycopeptide (MW about 14 000) from H. salinarium an even stronger defense-enhancing effect was observed become. This fact is confirmed by the following test results.

infection experiments

Female mice weighing about 18 g were randomized on Distributed groups, used in the infection experiments. The observation of the mice after the infection took place until no more mice died, d. H. a Healing of the infectious disease had occurred.

1a) Prophylaxis of acute infections (peritonitis / sepsis) with problem germs the clinic

Mice were treated with the glycoprotein or glycopeptide, or they received phys. NaCl solution inuaperitoneal. Twenty-four hours later, the animals were treated with 10 times the LD 50 of Staphylococcus aureus ATCC 13709 infected intraperitoneally.

Table 1 shows that the survival rate, seven days after infection, at the mice treated with the glycopeptide were significant  above that of mice treated with the glycoprotein or physiological saline.

Table 1

Comparison of the effects of the glycoprotein with the glycopeptide after a single prophylactic intraperitoneal administration one day before lethal infection with Stapyhlococcus aureus ATCC 13709

Table 2

Efficacy comparison of glycopeptide with glycoprotein at 7 days after lethal infection with S.aureus (in 7% mucin) intraperitoneally. The treatment was subcutaneous with 10 mg of substance per kg of body weight

b) Subacute to chronic infection (mouse typhus)

The infection with Salmonella typhimurium (mouse typhus) represents a subacute to chronic infection that represents as a model of the human Typhoid is internationally recognized (Plant, J., Glynn, A.A., J. Infect. Dis. 133: 72, 1976).

Three groups of mice were used in the experiments. A group received 10 mg glycopeptide per kg bw, a second group 10 mg glyco protein and a third group of physiological saline subcutaneously. After 24 hours, mice were given a 10-fold lethal dose of 50 (LD 50) of Salmonella tynhimurium 25268 subcutaneously infected. About one Period of 28 days after infection, the survivors were daily Mice counted. As can be seen from Table 3, there was one on the 28th day significantly higher survival both after treatment with glycopeptide as well as after administration of glycoprotein to the control. The over life of the mice treated with glycopeptide significantly above the survival rate of mice treated with glycoprotein  had been. This result underlines the superiority of Glyco peptide towards glycoprotein.

Table 3

Comparison of the effect of glycopeptide with glycoprotein in mouse Salmonella typhimurium infection

c) Klebsiella pneumoniae infection in mice with severe Severe Combined Immuno-Deficiency (SCID)

SCID mice have no functional lymphocytes (Bosma, G.C., Custer, R.P., Bosma, M.J. Nature 301: 527, 1983). Your defense performance is therefore based on the activity of their phagocytic cells without the aid of acquired immunity. SCID mice were treated with glycopeptide or glyco protein treated or received phys. NaCl solution. The treatment succeed te intraperitoneally. Twenty-four hours later, they were with the 2 to 3x LD 50 of Klebsiella Dneumoniae Wi infected intraperitoneally. The Observation period was seven days. Table 4 shows that 10 mg Glycoprotein per kg of body weight was weaker than 1 mg glycopeptide per kg KG. Similar findings were found in SCID mice after infection S. aureus ATCC 13709 (Table 5).  

Table 4

Comparison of effects of glycopeptide and glycoprotein in mice with severe, combined immunodeficiency (SCID) after infection with Klebsiella pneumoniae Wi

Table 5

Comparison of effects of glycopeptide and glycoprotein in mice with severe, combined immunodeficiency (SCID) after infection with S.aureus ATCC 13709

d) Infection with Candida albicans

For the Candida infection trial were 6 weeks old female B6D2F1 mice used. The animals were examined the day before the i.v. infection (10⁶ shoot cells of C. albicans H12) with the indicated substances i.p. treated. Subsequently, the disease progress was observed over 14 days pay close attention to control animals treated with physiological saline had been treated.

Figures 1 and 2 demonstrate the superiority of glycopeptide over glycoprotein. There is a clear increase in the mean survival time as well as a significant increase in the survival rate of glycopeptide ( Fig. 1) versus glycoprotein ( Fig. 2).

example 22 Effect in the tumor model

Influence of glycopeptide on tumor growth in a melanoma model of Mouse.

In C57b1 / 6J mice, the influence of glycopeptide on metastasis and examined the survival time in a melanoma model. The animals were intra- venous melanoma cells (B16F10, syngeneic tumor) were injected and the number of Metastases in the lungs determined on day 18; parallel to this was survival time determined. Glycopeptide (30 mg / kg) lowers after intravenous or intraperitoneal administration (day 1, 3, 5, 7, 9, 11, 14) significantly compared the number of lung metastases a control group (NaCl 0.9% given on the same days); Control 13.5 ± 3.1; Glycopeptide i.p. 5.3 ± 1.8; iv 4.8 ± 2.1; Mean ± SEM).

The survival time was after i.v. Administration of glycopeptide versus the control group extended, after i.p. There was no difference to the control group.  

Sequence Listing 1

Claims (11)

1. Glycopeptides containing the following amino acid sequence: Glu-Glu-Pro-Asp-Gln-Thr-Thr-Val-Asp-GIn-Pro-Glu-Asn-Asn * -Gln
Thr-Met-Thr # -Thr # -Thr # -Met-Thr-Glu, wherein the labeled asparagine (Asn *) is N-glycosidically linked to an acidic oligosaccharide and the three labeled threonines (Tbr #) are fully or partially O-glycosidic a neutral oligosaccharide are linked. 2. glycopeptides according to claim 1, which at the N-terminus up to 740 amino acids may be extended, preferably 8 amino acids, with the sequence: Gln-Asn-Val-Glu-Ile-Val-Glu-Glu. 3. The additional amino acids according to claim 2 at the N-terminus further N- and / or O-glycosidically bound oligosaccharides and / or Wear polysaccharides. 4. Glycopeptides according to claim 1 to 3, which may be extended at the C-terminus by further amino acids, preferably by up to 54 amino acids, especially with the sequence: Thr # -Thr # -Thr # -Glu-Thr # -Thr # Thr # Glu-Met-Thr Thr # # Gln-Glu-Asn - * - Thr-Thr
Glu-Asn * Gly-Ser-Glu-Gly-Thr-Ser-Gly-Asp-Glu-Ser-Gly-Gly-Ser-Ile-Pro - Gly
Phe-Gly-Val-Gly-Val-Ala-Leu-Val-Ala-Val-Leu-Gly-Ala-Ala-Leu-Leu-Ala - Leu-Arg and parts thereof. 5. glycopeptides according to claim 4, wholly or partially N- and / or O-glycosylated, but preferably on the labeled Amino acids. 6. glycopeptides according to claim 4, wherein the labeled threonines (Thr #) with neutral oligosaccharides, the labeled asparagines (Asn *) with acidic Oligosaccharides are linked. 7. Glycopeptides according to claim 6, wherein the N-linked glycosidically acidic oligosaccharides contain hexoses and uronic acids and preferential have the following structure: β-D-Glc (1-4) β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-GlcUA (1-4) β-D-Glc. 8. Glycopeptides according to claim 7, wherein the acidic oligosaccharides are completely or partially sulfated, preferably at the C3 atom of Glucuronic. 9. glycopeptides according to claims 7 and 8, wherein in the Oligosaccha a part of the D-glucuronic acids are replaced by L-iduronic acid. 10. glycopeptides according to claims 1 to 4, wherein the O-glycosidic bound neutral oligosaccharides containing glucose and galactose and preferably have the following structure: α-D-glucose (1-2) β-D-galactose. 11. Medicaments containing one or more of the glycopeptides from the Claims 1 to 10.