DE3686148T2 - LYMPHOTOXIN GENE, METHOD FOR THE PRODUCTION THEREOF AND LYMPHOTOXIN. - Google Patents

Description

The invention relates to a novel gene, a part thereof encoding a polypeptide having lymphotoxin activity, a process for producing the gene and a human lymphotoxin produced from the gene using genetic engineering methods.

Lymphotoxin (hereinafter referred to as LT) is known as a kind of lymphokine which is specifically or non-specifically released from lymphocytes or lymphoid-established cell lines and which has cytotoxic activity. LT not only has cytotoxic activity against various cancer cells but also has activity of enhancing the cytotoxic activity of certain kinds of carcinostatics or interferons, and is believed to have utility as a tumor curative or other therapeutic agent. (See Granger G.A. et al., "International Congress of Chemotherapy," Kyoto, Japan, June 23-28, abstracts, p. 15; and Matsunage K. et al., ibid, p. 352.)

There are a variety of processes for the production of human LT, in which human-derived cells or human-derived tumor cells are cultured and the culture supernatant is purified to obtain human LT. For example, a method is known in which tonsil cells or peripheral blood lymphocytes are cultured together with a phytohemagglutinin (hereinafter referred to as PHA) and the human LT is isolated from the culture supernatant (see Peter, TB et al., J. Immunol., 111, 770 (1973); Walker, SM and Lucas, ZJ, J. Immunol., 109, 1233 (1972)). Another method is known in which lymphoid tumor cells are cultured and the human LT is isolated from the culture supernatant (see Yamamoto, RS et al., J. Biol. Response Modifiers, 3, 76 (1984); European Patent Application No. 0 100 641). Still another method is known in which T cell hybridomas are cultured in the presence of phorbol myristate acetate (hereinafter referred to as PMA) and/or concanavalin A (hereinafter referred to as Con A) and the human LT is isolated from the culture supernatant (see Asada, M. et al., Cell. Immunol., 77, 150 (1983)).

However, these known methods have problems in that the content of LT in the culture supernatant is extremely small, and that the nutrient sources for use in culturing (e.g. fetal calf serum) are expensive. Therefore, economic production of LT of high purity by the known methods is difficult.

To produce human LT it would be desirable to use a method using genetic engineering, wherein a gene corresponding to the LT is inserted into a vector and the resulting recombinant plasmid is replicated, transcribed and translated in bacteria, fungi, yeast or animal cells to obtain the desired human LT as produced in these cells.

The inventors previously obtained an LT-producing human T cell hybridoma clone A-C5-8 cell line using a human T cell hybridization method (emetine/actinomycin D method). (See Asada, M., et al., Cell Immunol., 77, 150 (1983)). However, when the A-C5-8 cell line was cultured in the presence of Con A and PMA under optimal LT production conditions (incubation period of 30 hours or more), no messenger RNA (hereinafter referred to as mRNA) corresponding to the LT could be obtained, and therefore the gene corresponding to the LT was not obtained. There is therefore a continuing need for a method for producing LT by gene technology.

It is therefore an object of the invention to provide a gene encoding a polypeptide having an LT activity as produced from an mRNA corresponding to the LT.

It is a further object of the invention to provide a method for producing an LT gene that encodes a polypeptide having LT activity.

It is a further object of the invention to produce large quantities of LT produced from the LT gene, which encodes a polypeptide with LT activity.

These and other inventive objects, as will be explained below, were solved by the inventors' investigations.

The inventors have studied the conditions for obtaining mRNA corresponding to LT and found that mRNA corresponding to LT can be obtained by incubating the A-C5-8 cell line together with PMA and/or Con A within 24 hours, preferably within 4 hours, and further succeeded in cloning a gene encoding a human LT polypeptide by using the mRNA by genetic engineering, and further succeeded in producing a new LT using the cloned gene, thus completing the present invention.

Accordingly, the invention provides a gene encoding a polypeptide having LT activity, a process for producing the same and a novel LT obtained by using the gene.

In particular, the invention relates to a gene encoding a polypeptide having LT activity which is produced from mRNA isolated from a lymphokine-producing human T-cell hybridoma obtained by incubating the A-C5-8 cell line in a medium solution containing PMA and/or Con A for 24 h, the mRNA being isolated as 12.6S to 14.6S fractions in the fractionation according to the Sucrose density gradient centrifugation method, as well as mutants of the gene, including allelic mutants by gene coding degeneration or partial modification, and a method for producing the gene and a novel LT produced using the gene. Mutants of the LT gene which fall within the scope of the invention are in particular those wherein the base sequence of Table 1 is altered in such a way that the encoded amino acid sequence is not altered. Also within the scope of the invention are genes encoding polypeptides which retain LT activity, including altered codons. Such altered codons may be conservative substitutions of amino acids, e.g. Ala for Gly, Ser for Thr, Leu for Val, etc.) or may be a small number (e.g. 1 to 3) of missing codons.

The present gene has a base sequence as shown in Table 1: Table 1

Fig. 1 is a diagram showing a restriction endonuclease cleavage map of the working example of the present invention.

Fig. 2 is a diagram showing the restriction endonuclease sites used for determining the base sequence and the directions and regions for determining the base sequence in the working example of the invention.

In these drawings, B represents BamHI, E EcoRI and P PstI.

Figure 3 shows the steps for the formation of the tac promoter-containing phenotypic expression plasmid pLT13tac6 in Example 5, in which the arrows indicate the working direction of the promoter.

Figure 4 shows the steps for the formation of the tac promoter-containing phenotypic expression plasmid pDK10 in Example 9, in which the arrows indicate the working direction of the promoter.

Figure 5 shows the steps for constructing the tac promoter-containing phenotypic expression plasmid pDK11 in Example 9, where the examples indicate the direction of operation of the promoter.

Figure 6 shows the steps for the formation of the tac promoter-containing phenotypic expression plasmid pDM12 in Example 9, in which the arrows indicate the working direction of the promoter.

Figure 7 shows the steps for constructing the plasmid pSV2-LT/MMTV-LTR for expression in animal cells in Example 13, where the arrows indicate the direction of operation of the promoter.

There are some reports by Gray, P.W. et al (Nature, 312, 721 (1984)) and Nedwin, G.E. et al (Nucleic Acids Research, 13, 6361 (1985)) on the base sequence of the gene encoding the polypeptide with human LT activity. Gray et al. prepared LT cDNA using mRNA extracted and purified from human peripheral blood mononuclear cells (hereinafter referred to as PBMC) activated with PMA, staphylococcal enterotoxin B and thymosin alpha₁ for 48 h. Nedwin et al. obtained a PBMC gene which was identical to the gene of Gray et al. could be hybridized by screening a recombinant human lambda library by a hybridization procedure using 32P-labeled DNA encoding the 34-amino-terminal residues of the LT of Greay et al. As shown in Table 2 below, the present LT gene differs from the PBMC cDNA of Gray et al. by 14 nucleotides in four positions, and differs from Nedwin's et al. PBMC gene by 9 nucleotides in two positions. In addition, it should be noted that the PBMC gene of Nedwen et al. contains an intron of 247 nucleotides between the 267th base and 268th base.

Regarding the method for producing the gene, Gray et al extracted and purified the mRNA from the cells obtained by incubating non-adhesive cells of human peripheral blood lymphocytes in the presence of PMA, Staphylococcal enterotoxin and thymosin alpha₁ for 48 h, and prepared the gene from the obtained mRNA. On the other hand, the inventors extracted and purified the mRNA from the cells obtained by incubating LT-producing human T cell hybridoma in the presence of PMA and/or Con A after 0.5 to 5 h, and prepared the gene from the obtained mRNA. Table 2 Comparison of the base sequences in the LT gene of the present invention, the PBMC-derived LT gene and the LT gene derived from the recombinant human lambda library: (a) present invention (b) Gray et al. (c) Nedwin et al.

To confirm the LT activity expression of the gene (A-C5-8 cDNA) of the present invention, the cloned DNA was treated with restriction enzymes and then inserted into an appropriate phenotypic expression vector to obtain an LT-producing plasmid, the obtained plasmid was introduced into Escherichia coli and animal cells for its transduction, and the production of LT by these cells was confirmed.

LT having the following amino acid sequence (I) or (II) can be obtained as mentioned below. (The LT having the respective amino acid sequence (I) or (II) is hereinafter referred to as LT(I) or LT(II)). Amino acid sequence (I): Amino acid sequence (II):

The A-C5-8 cDNA (see Table 1 above) is digested with restriction enzymes. On the other hand, a phenotypic expression vector into which a translation initiation site has been introduced is digested with the same restriction enzymes. These are ligated to obtain a phenotypic expression plasmid for LT production, and the obtained plasmid is introduced into a suitable host such as Escherichia coli to obtain a transformant. The obtained transformant is cultured, and the culture medium or transformant is extracted and purified to obtain the desired LT which does not contain a substantial amount of impurities.

As shown in Table 3 below, both the LT(I) and LT(II) of the present invention differ from the known LT (Gray, P.W. et al., Nature, 312, 721 (1984)) in their molecular structures in that LT(I) lacks 10 N-terminal amino acids of the known LT but is linked by Met-Asp-Pro bonding, and LT(II) lacks 19 N-terminal amino acids of the known LT.

Compared with a different LT (EP application 0 100 641) obtained by incubation of lymphoid tumor cells and subsequent isolation of the culture supernatant, LT(I) is superior because it has a higher pH stability and, in addition, because it has a different isoelectric point. Table 3 Comparison between LT according to the invention and known LT with regard to the N-terminal amino acid sequences: Amino acid sequence (I) Amino acid sequence (II) Gray, et al. (N-terminus)

In general, when a genetic product is obtained using recombinant microorganisms, the obtained product has a structure containing an unnecessary methionine at the N-terminal end of the product from a gene of a natural type. However, since the LT(II) of the present invention does not contain an unnecessary methionine, it therefore has a structure very similar to the natural product. In addition, LT(II) can be used very safely.

The invention is described in detail below.

(1) Selection of cells with high LT productivity:

As LT-producing cells, normal human lymphocytes, human T-lymphoid-established cell lines such as CCRF-CEM, MOLT-4F and JURKAT and cloned cell lines thereof, as well as human B-lymphoid-established cell lines such as RPMI-1788 can be used. In particular, LT-producing human T cell hybridomas obtained by cell fusion of normal human T lymphocytes and human T lymphoid-established cells are used because they have high LT productivity and subculturing of the cells is possible. The LT-producing human T cell hybridomas have higher LT productivity than the parent cells of human T lymphoid-established cells, and therefore high amounts of mRNA can be extracted and isolated from these cells.

The analysis for measuring LT activity was carried out in accordance with the method of Kobayashi Y., et al. (J. Immunol., 122, 791 (1979)). In this measurement, the cytotoxic activity of a sample from a supernatant of cultured cells or an extract from cultured cells against mouse L.P3 cells was defined as a standard (sub-line of L cells). One unit/ml of LT was set as the concentration that kills 50% of the cells.

The LT-producing human T cell hybridoma can be obtained by a known method (Japanese Patent Application (OPI) No. 72520/83). (The term "OPI" as used herein means an unexamined and published application.)

For example, human T lymphoid tumor cells are treated with a protein synthesis inhibitor or with a combination of the inhibitor and an RNA synthesis inhibitor, and on the other hand, human T lymphocytes are stimulated with a mitogen or an antigen, and then both are hybridized in the presence of a hybridization accelerator (e.g., polyethylene glycol) and the resulting hybridized cells (human T cell hybridoma cells) are isolated. The human T cell hybridomas thus obtained are incubated in a culture medium (for example, a culture medium obtained by adding 10% fetal calf serum; 5 x 10⁻⁵ M 2-mercaptoethanol and 2 mM glutamine to a minimal medium of RPMI 1640, which is hereinafter referred to as RPMI medium) at 37ºC in CO₂(5%)-air(95%) atmosphere, and then the above-mentioned LT-producing human T cell hybridomas were screened.

(2) Incubation of cells:

To obtain mRNA from the LT-producing human T cell hybridomas, at least 109 or more cells are required, and these cells are generally obtained by incubating the resulting hybridomas. For example, the cells are placed in a culture medium in an amount of 105 to 107 cells/ml, and these are incubated in a laboratory dish placed in a rotary bottle incubator for tissue incubation (spin bottle) at 37°C in an atmosphere of CO2 (5%)-air (95%).

The incubation time varies depending on the composition of the medium and the initial cell concentration, and is therefore generally 1 to 5 days. After incubation, the culture solution is centrifuged to isolate the cells.

The nutrient medium can be selected from a minimal medium containing one or more components selected from saccharides, amino acids, vitamins, hormones, proteins, antibiotics, growth factors and inorganic bases, or a medium containing the minimal medium and an added animal serum.

Commercially available RPMI 1640 medium, MEM medium, Dulbecco modified medium, etc. can also be used as minimal medium.

Regarding the animal serum, fetal calf serum, calf serum, horse serum, human serum or the like can be added to the minimal medium in an amount of 1 to 20% of the medium.

In addition, the cells can be multiplied in nude mice, hamsters or other warm-blooded animals with the exception of humans.

(3) Replication of mRNA:

The LT-producing human T cell hybridomas obtained in (2) are placed in a culture medium in an amount of 106 to 107 cells/ml, and PMA and/or Con A is added, whereby the cells produce a larger amount of mRNA corresponding to LT upon incubation. The preferred concentration of PMA is 20 to 200 ng/ml and the preferred concentration of Con A is 5 to 50 μg/ml.

The incubation time is within 24 hours, preferably within 8 hours. This is because the content of mRNA corresponding to LT activity in the cultured cells decreases with the passage of time. In particular, if the incubation time exceeds 24 hours, the best period for obtaining LT from the supernatant of the culture medium after incubation of the LT-producing human T cell hybridomas is 24 to 72 hours, and the amount of mRNA corresponding to LT in the cultured cells becomes extremely small in such a period, and therefore the recovery of mRNA is difficult. The method for establishing the LT-producing human T cell line T-cell hybridoma A-C5-8 cell line for use in the invention and its properties are described in known publications. (See Asada, M. et al., Cellular Immunology, 77, 150 (1983)).

(4) Extraction of total cellular RNA from the cells:

Extraction of total cellular RNA from the cells obtained under (3) can be carried out by the guanidine hydrochloride method (Deeley, R.G. et al., J. Biol. Chem., 252, 8310 (1977)), or by a similar method.

For example, the cells (109 or more cells) obtained in (3) are suspended in a homogenate buffer (containing 8M guanidine hydrochloride, 5mM dithiothreitol and 20mM sodium acetate, adjusted to pH 7 with NaOH) and homogenized in a homogenizer or the like. A complete nucleic acid fraction is extracted from the obtained homogenate material by ethanol precipitation or phenol extraction, and then total cellular RNA is recovered therefrom by lithium chloride precipitation. In the extraction step, it is preferable that the equipment to be used has been dry-heated or treated with diethyl pyrocarbonate and then sterilized in an autoclave, and that the laboratory staff wear vinyl plastic gloves on their hands during the procedure to prevent decomposition of the RNA by RNase.

(5) Isolation of mRNA from total cellular RNA:

Isolation of the desired mRNA from total cellular RNA can be accomplished by conventional methods, including the sucrose density gradient centrifugation method, the gel filtration method, the electrophoresis method, the membrane filter method, or the oligo-dT cellulose chromatography method, or by a combination of these methods.

To confirm that the mRNA thus obtained is the desired LT-encoding mRNA, the mRNA is translated into a protein and its biological activity is checked. For example, the mRNA is injected or added into an appropriate protein synthesis system, e.g., Xenopus laevis oocytes, reticulocyte lysates or wheat germs, to thereby be translated into the protein, and the obtained protein is checked to see whether or not it has cytotoxic activity against mouse L.P3 cells. Specifically, the confirmation procedure using Xenopus laevis oocytes, e.g., is carried out as follows:

The mRNA is injected into the oocytes in an amount of approximately 50 to 100 ng per oocyte by a microinjection method, and 20 oocytes are placed in 200 μl of a modified Barth's salt solution (containing 0.13 g NaCl, 0.075 g KCl, 0.2 g NaHCO₃, 0.2 g MgSO₄.7 H₂O, 0.08 g Ca(NO₃)₂.4H₂O, 0.09 g CaCl₂.6H₂O, 2.38 g HEPES, 100 mg streptomycin and 100,000 units penicillin G dissolved in 1 L of the solution at a pH of 7.4, wherein the solution (hereinafter referred to as MBS) at 23ºC for 48 h. The culture supernatant is used as a sample and the LT activity of the sample is measured relative to the L.P3 cytotoxic activity standard.

The LT-encoding mRNA of the present invention has the following properties:

(i) it has an S value of 12.6S to 14.6S;

(ii) it is polyadenylated at its 3'-end;

(iii) it encodes an LT polypeptide.

(6) Cloning of lymphotoxin cDNA:

The mRNA obtained in step (5) is used as a template, and oligo (dT) is used as a primer, and a single-stranded cDNA complementary to the mRNA is synthesized with a reverse transcriptase (e.g., avian myeloblastosis virus-derived reverse transcriptase) in the presence of dATP, dGTP, dCTP and dTTP, and the template mRNA is denatured by heat treatment. Then, this single-stranded cDNA is used as a template, and a double-stranded DNA is synthesized using DNA polymerase I (Klenow fragment) from Escherichia coli. This double-stranded DNA is isolated from the denatured mRNA and protein by alkali treatment and phenol extraction. The double-stranded DNA is reacted with reverse transcriptase, thereby obtaining a more complete double-stranded DNA. The DNA thus obtained has a hairpin loop structure, and the hairpin loop structure is cleaved using S1 nuclease (Aspergillus oryzae-derived S1 nuclease) to obtain a DNA having a complete double-stranded structure. The DNA thus obtained is inserted into, for example, the restriction enzyme PstI-cleaved site of the plasmid pBR322 in a conventional manner such as the poly(dG)-poly(dC) or poly(dA)-poly(dT) homopolymer extension method (Noda, M. et al., Nature, 295, 202 (1982); Maniatis, T. et al., Molecular Cloning (a laboratory manual), 217 (1982) , Cold Spring Harbor Laboratory, New York). The obtained recombinant plasmid is introduced into a host, e.g. BE coli HB101 strain is introduced for transformation according to the method of Perbal, B. (A Practical Guide to Molecular Cloning, 268 (1984), John Wiley & Sons Inc., Canada), a tetracycline-resistant strain is selected and a cDNA library is formed.

The cDNA library is subjected to the colony hybridization assay using a synthetic probe (Montgomery, DL et al., Cell, 14, 673 (1978); Goeddel, DV et al., Nucleic Acids Res 8, 4057 (1980)) to screen for the desired clone. For example, two nucleotides are chemically synthesized corresponding to the 18 bases from the 404th to the 421st base and the complementary 18 bases from the 500th to the 517th base in the lymphotoxin gene, as reported by Gray et al in Nature, 312, 721 (1984), and phosphoric acid from gamma-³²P-ATP is transferred to the hydroxyl group at the 5'-end of the probe with a polynucleotide kinase (T4 phage-infected E. coli-derived T4 polynucleotide kinase), so that two kinds of 32P-labeled probes are formed. From the above-mentioned cDNA library, a clone capable of binding strongly with both probes is selected. Plasmid DNA is isolated from the clone thus obtained, and this is converted into a single-stranded DNA by heating or alkali denaturation, which is fixed on a nitrocellulose filter. To this is added an mRNA fraction containing lymphotoxin mRNA for hybridization, and then the bound mRNA is recovered by elution. This is introduced into oocytes of Xenopus laevis, and the resulting mRNA is checked whether or not it encodes lymphotoxin. (This is hereinafter referred to as "hybridization translation test"). According to the above method, a cloned DNA into which a DNA fragment having a base sequence complementary to the lymphotoxin mRNA has been introduced can be obtained.

In addition, the cloned DNA fragment of the transformed strain is digested with relevant restriction enzymes and labeled with ³²P, and this is used as a probe to re-screen the above-mentioned cDNA library so that a larger cDNA fragment can be selected.

An endonuclease restriction cleavage map of the cloned DNA fragment thus obtained is formed, the fragment is cloned with M13 phage, the base sequence thereof is analyzed by the dideoxy sequencing method of Sanger F. et al. (Proc. Natl. Acad. Sci. USA, 5463 (1977)), the base sequence corresponding to the amino acid sequence of the lymphotoxin which has already been determined is is detected, and finally the cDNA containing the base sequence (ie, the base sequence from the 165th to the 677th base of the above-mentioned Table 1) corresponding to the complete translation region of the lymphotoxin is selected. By this, the cloned DNA (Table 1) having the base sequence encoding the LT amino acid sequence-containing polypeptide can be obtained.

The plasmid pBR322 into which the cloned DNA encoding the polypeptide having the LT amino acid sequence as shown in the table was inserted was named pLT13. E. coli HB101 strain was transfected with the pLT13 to obtain a recombinant strain, which was deposited at the Fermentation Research Institute (Bikoken), Agency of Industrial Science and Technology, Ministry of International Trade and Industry, Japan under the accession number FERM-BP No. 1226 on November 29, 1986 under the Budapest Treaty.

The cDNA shown in Table 1 obtained according to the present invention is different from the known LT gene as shown in the above-mentioned Table 2, and it was not clear at first whether the product of the cDNA of the present invention (shown in Table 1) had LT activity or not. This is because a difference of only one amino acid between the proteins can result in an extremely large difference in the properties of the two proteins.

Consequently, the inventors undertook further experiments in which pLT13 was treated with relevant restriction enzymes was cleaved, the cleaved fragments were inserted into a phenotypic expression vector, and the resulting recombinant plasmid was introduced into E. coli or animal cells for transfection, and these were checked whether or not they expressed LT activity. As a result, both the transfected bacteria and animal cells were found to express LT activity, from which it was concluded that the cDNA shown in Table 1 is indeed the cDNA encoding the amino acid sequence of the LT as mentioned below (7) and in the working examples.

(7) Preparation of the phenotypic expression vector containing the LT(I) coding base sequence: (a) Cleavage of the cDNA encoding the amino acid sequence of the LT polypeptide with restriction enzymes:

To prepare the DNA encoding the amino acid sequence of the invention, the complete cDNA as shown in Table 1 was digested with restriction enzymes PvuII and EcoRI in the usual manner, extracted by agarose gel electrophoresis to extract the cDNA fragment containing about 650 base pairs (hereinafter abbreviated as "bp"), and the cDNA fragment was recovered. This cDNA fragment contains the 193rd to 840th base of the complete cDNA as shown in Table 1.

(b) Cleavage of the polylinker site of the phenotypic expression vector with restriction enzymes:

The polylinker site of the phenotypic expression vector pKK223-3 (from Pharmacia Co.) was first completely digested with EcoRI and then partially digested with BamHI, and both the vector partially digested with BamHI and the vector not digested with BamHI were recovered by agarose gel electrophoresis. In addition, mixed vectors were completely digested with SmaI. Thus, a vector in which the cleavage site is an EcoRI-BamHI site and the vector in which the cleavage site is an EcoRI-SmaI site were formed.

(c) Ligation of the translation initiation site and EcoRI-BamHI site-cleaved pKK223-3:

The vector of pKK223-3 cleaved at the EcoRI-BamHI site and the transportable translation initiation site having the following structure (which was formed by hybridizing an upper chain containing a terminal EcoRI site and a lower chain containing a BamHI site, both chains being commercial products of Pharmacia Co.) were again reacted in the presence of T4 DNA ligase to obtain a vector having a circular structure.

AATTTGGAGGAAAAAATTATG

ACCTCCTTTTTTAATACCTAG

The regenerated vector is introduced into E. coli for transformation, and the strain containing the regenerated vector is selected as an ampicillin-resistant strain, and the regenerated vector is recovered from the cultured bacteria.

(d) Insertion of the LT cDNA fragment generated in (a) into the reconstructed vector generated in (c):

The reconstituted vector prepared in (c) is partially cleaved with BamHI, and then its 5'-end is dephosphorylated with bovine intestinal mucosa alkaline phosphatase, and then the cohesive ends are converted into blunt ends with DNA polymerase I (Klenow fragment). On the other hand, the PvuII-EcoRI site of the LT cDNA prepared in (a) is modified to have a blunt end, and it is subjected to blunt end ligation with the above-mentioned blunt-ended open circular vector. After the reaction, the closed circular vector is recovered in a conventional manner and is introduced into E. coli for transformation.

(e) Screening with a synthetic oligonucleotide probe:

The 32P-labeled synthetic oligonucleotide probe shown in (6) and the transformant E. coli strain formed in (d) were subjected to colony hybridization, and the strain capable of hybridizing with the synthetic oligonucleotide probe was selected. Then, a vector was prepared from the colony and digested with restriction enzyme, and thus the desired vector containing cDNA fragments of about 650 bp and about 250 bp was obtained by agarose gel electrophoresis.

(8) Production of LT(I) in E. coli:

The E. coli transformants obtained in (e) are incubated in a medium containing isopropyl-beta-D-thiogalactoside (hereinafter referred to as IPTG) until the O.D. 550 nm reaches ca. 1.

After the incubated bacteria are harvested, they are lysed by ultrasonic wave treatment, extracted with Tris-HCl buffer (pH 8.0), and filtered under aseptic conditions, and then the LT activity is measured, screening the transformant strain expressing the largest amount of LT polypeptide.

(9) Incubation and purification of LIT(I)-producing E. coli:

The transformants (LT-producing E. coli) obtained in (8) are incubated in a medium containing IPTG until a sufficient amount of LT polypeptide is produced. Then, the incubated material is digested by a method such as lysozyme digestion, freezing and thawing, ultrasonic digestion, French press, Dinor mill, etc., and the extract solution is collected by centrifugation or filtration. The obtained extract solution is purified by a combination of ammonium sulfate salting out, ultrafiltration, ion exchange chromatography, hydrophobic chromatography, gel filtration and SDS-polyacrylamide electrophoresis, whereby the LT polypeptide can be obtained in the form of a substantially pure product.

(10) The LT(I) obtained in (9) was analyzed to determine the amino acid composition and the N-terminal amino acid sequence, as a result of which the same analysis values as those assumed from the amino acid sequence (I) shown in the following working example were measured. The isoelectric point was 7.6 ± 0.3.

The DNA encoding amino acid sequence (I) and its corresponding base sequence (I) are shown below: Amino acid sequence (I) : Base sequence (I) :

(11) The LT(I) was stable to pH changes, and even when incubated in a Britton-Robinson buffer solution in a wide pH range of 4 - 10 for 24 h, the LT activity was maintained.

(12) Preparation of the phenotypic expression vector containing the base sequence encoding LT(II): (a) Cleavage of LT(II)-encoding cDNA with restriction enzymes:

To prepare the DNA encoding the amino acid sequence of the invention, the complete cDNA as shown in Table 1 is digested with the restriction enzymes PvuII and EcoRI in the usual manner and separated by agarose gel electrophoresis to extract the DNA fragment containing about 650 base pairs (bp), and the cDNA fragment is recovered. This cDNA fragment contains the 225th to 840th bases of the complete cDNA as shown in Table 1.

(b) Ligation of the synthetic oligonucleotide with the LT cDNA fragment:

The synthetic oligonucleotide having the following structure:

AATTCTATGCA

GAT and the LT cDNA fragment obtained in (a) are ligated and then digested with EcoRI, and the EcoRI fragment of 623 bp is recovered in the usual manner.

(c) Inserting the LT cDNA into the expression vector:

The expression vector pKK233-3 obtained from Pharmacia Co. is digested with EcoRI, and then the 5' end is dephosphorylated with alkaline phosphatase from bovine intestinal mucosa. The EcoRI fragment obtained in (b) and the above open circular vector are ligated. After the reaction, the closed circular vector is recovered in the usual manner, and this is introduced into E. coli for transformation.

(d) Screening with a synthetic oligonucleotide probe:

The 32P-labeled synthetic oligonucleotide probe shown in (6) and the transformant E. coli strain formed in (c) are subjected to colony hybridization, and the strain capable of hybridizing with the synthetic oligonucleotide probe is selected. Then, a vector is prepared from the colony and digested with restriction enzymes, and thus the desired vector having a cDNA fragment of 623 bp is obtained by agarose gel electrophoresis.

(13) Preparation of the vector in which the 3'-terminal non-coding region of the LT cDNA was removed: (a) Removal of the 3'-terminal non-coding region of the LT cDNA:

The vector obtained in (12) is converted into a linear DNA using HindIII, and then the 3'-terminal non-coding region of the LT cDNA is removed using BAL31 nuclease. The end is then blunted using DNA polymerase I (Klenow fragment), and then the vector is digested with EcoRI and then separated by polyacrylamide gel electrophoresis to obtain a fragment of approximately 460 bp.

(b) Ligatization of LT cDNA and linker:

The 460 bp fragment obtained in (a) and a HindIII linker (manufactured by Takara Shuzo Co.) are ligated and then digested with HindIII.

(c) Ligatization of LT-cDNA and expression vector:

pKK223-3 is digested with EcoRI and HindIII to obtain a fragment of 4555 bp. Then the EcoRI-HindIII fragment of about 465 bp obtained in (b) is joined to the fragment, and the resulting fragment is introduced into E. coli for transformation in the usual manner to obtain a vector with an LT cDNA fragment of about 465 bp.

(14) Formation of a multiple-copy expression vector:

pAT153 (manufactured by Amersham Co.) is digested with BamHI and PvuI and purified by agarose gel electrophoresis to obtain a fragment of 2655 bp. On the other hand, the vector obtained in (13) is also digested analogously with BamHI and PvuI to obtain a fragment of about 980 bp. These two BamHI-PvuI fragments are ligated with an LT cDNA fragment to obtain a vector.

(15) Expression of LT cDNA in E. coli:

The E. coli transformants obtained in (14) are incubated in a medium containing IPTG until the O.D. 550 nm reaches ca. 1.

The incubated bacteria are then collected, disrupted by sonication, extracted with Tris-HCl buffer (pH 8.0) and filtered under aseptic conditions, and then the LT activity is measured, screening for the transformant strain expressing the highest amount of LT polypeptide.

(16) Incubation and purification of LT polypeptide-producing E. coli:

The transformant (LT-producing E. coli) obtained in (14) is incubated in a medium containing IPTG until a sufficient amount of LT polypeptide is formed. Then, the incubated material is digested by a method such as lysozyme digestion, freezing and thawing, ultrasonic digestion, French press, Dinor mill, etc., and the extract solution is collected by centrifugation or filtration. The obtained extract solution is purified by a combination of an ammonium sulfate salting-out step, ultrafiltration, ion exchange chromatography, hydrophobic chromatography, gel filtration and SDS-polyacrylamide electrophoresis, whereby LT polypeptide can be obtained as a substantially pure product.

(17) The LT(II) obtained in (16) was analyzed to determine the amino acid composition and the N-terminal amino acid sequence, and the measured test results were the same as those assumed for the amino acid sequence (II) as shown in the following working example.

The DNA encoding the amino acid sequence (II) and its corresponding base sequence (II) are shown below: Amino acid sequence (II) Base sequence (II)

The invention is explained in detail by reference to the following examples, which, however, should not be construed as limiting the invention.

example 1 (1) Preparation of a lymphotoxin-producing human T-cell hybridoma:

106/ml human peripheral blood lymphocytes (hereinafter referred to as PBL) were treated with 20 μg/ml Con A in RPMI medium for 2 days, and then the Con A bound to the cells was removed as much as possible using 0.2 M alpha-methyl-D-mannoside.

On the other hand, human T lymphoid tumor cells CCRF-CEM (hereinafter referred to as CEM) which were in a growth stage in RPMI medium were collected by centrifugation, and they were suspended in RPMI 1640/10 mM HEPES medium in an amount of 2 x 10⁶ cells/ml. To these were added emetine hydrochloride (manufactured by Nakarai Chemical Co.) and actinomycin D (manufactured by PL Biochemicals Co.) in an amount of 5 x 10⁻⁵ M and 0.25 µg/ml, and they were treated at 37°C for 2 hours. Then, the emetine hydrochloride and actinomycin D in the culture solution were removed by centrifugation.

The PBL and CEM thus prepared were mixed in a ratio of 10:1 and centrifuged to obtain a cell pellet, to which was added 0.5 ml of 46% polyethylene glycol (PEG-1540, manufactured by Wako Junyaku KK), and MEM medium containing 5 μg/ml poly-L-arginine and 15% dimethyl sulfoxide were added and slowly stirred at 37ºC for 45 s for hybridization. Then, 10 ml of MEM medium buffered with 10 ml of 25 mM HEPES (pH 7.2) was gradually added and the mixture was centrifuged.

RPMI medium was added to the cell pellets and the cell number was adjusted to 106/ml. 100 µl of the resulting cell-containing medium was mixed with 100 µl of RPMI medium containing mitomycin C-treated CEM (4 x 105 cells/ml) as partner cells, and the resulting mixture was placed in a 96-well culture plate and incubated at 37°C under a CO2 (5%)-air (95%) atmosphere for 3 to 4 weeks. After incubation, the grown hybridoma cells were cloned by limiting dilution culture methods using the above-mentioned mitomycin C-treated CEM as partner cells. After the growth of each clone, the lymphotoxin activity was measured.

Subsequent incubation was carried out under a CO2(5%)-air(95%) atmosphere at 37ºC, unless otherwise stated.

The lymphotoxin-producing cloned human T cell hybridoma A-C5-8 strain of the present invention, which was in the form of a solution having a cell concentration of 2.5 x 10⁵ cells/ml, was stimulated with 20 µg/ml Con A and 20 ng/ml PMA and incubated for 24 hours, and as a result, the lymphotoxin activity was 250 units/ml. On the other hand, A non-stimulated A-C5-8 strain showed a lymphotoxin activity of 4 units/ml.

Example 2 Isolation and purification of the mRNA fraction from the lymphotoxin-producing human T-cell hybridoma (A-C5-8): (1) Incubation of lymphotoxin-producing human T-cell hybridoma (A-C5-8):

The A-C5-8 cell line, which was in the form of a suspension at a cell concentration of 5 x 10⁶ to 10⁷/ml, was incubated for 2, 4, 8, 24 and 48 h with PMA and Con A added at a final concentration of 100 ng/ml and 200 μg/ml, respectively.

(2) Preparation of total cellular RNA:

The extraction of total cellular RNA of the A-C5-8 cell line was essentially carried out by the guanidine hydrochloride method. Specifically, after incubating the A-C5-8 cell line for the same period of time as indicated in (1), the cells were collected by centrifugation (1000 rpm, 5 min) and suspended in PBS (containing 5 mM phosphate buffer and 0.15 M NaCl with a pH of 7.4), and the obtained solution was further centrifuged at 1000 rpm for 5 min, and the obtained cells were washed.

The cells (in an amount of 4 x 10⁸, 6 x 10⁸, 3.2 x 10⁸, 1.8 x 10⁸ and 2 x 10⁸ in each incubation period in step (1)) were suspended in a homogenate buffer and homogenized therein. To the obtained homogenate, 0.025 equivalent of 1 M acetic acid and 1.5 times the amount of cold ethanol (at -20°C) were added and mixed together. Then, the obtained mixture was kept at -20°C for 3 hours or more. Then, it was centrifuged at -10°C for 30 minutes at 15,000 rpm using a Hitachi RPR 18-2 rotor. To the resulting precipitate, a washing buffer (prepared by adding 20 mM EDTA.2Na to the homogenate buffer, which was referred to as WB hereafter) was added and homogeneously dissolved by pipetting. Then, 1 M acetic acid was added to adjust the pH to 5 and 1.5 times the amount of cold ethanol was added, and the mixture was kept at -20ºC for 3 h or more. The mixture was centrifuged at -10ºC for 30 min at 15000 rpm, and the resulting precipitate was dissolved in WB. The pH adjustment with 1 M acetic acid and the cold ethanol precipitation were repeated three times.

A small amount of 0.1% SDS was added to the ethanol precipitate to prepare a suspension, and to this was added 1 equivalent of an extraction buffer (containing 0.5% SDS, 0.1 M NaCl, 50 mM sodium acetate and 5 mM EDTA.2Na with a pH of 5.2) and two equivalents of water-saturated phenol (containing 0.1% 8-quinolinol and saturated with 100 mM Tris-HCl buffer, pH 8.0)/chloroform/isoamyl alcohol solution (50:50:1 by volume ratio). The mixture was shaken for 10 min, and then the resulting mixture was centrifuged at 3000 rpm for 10 min. After centrifugation, the mixture was divided into three layers and the bottom layer was removed. The equivalent amount of chloroform/isoamyl alcohol solution (volume ratio 50:1) was added to the upper layer and middle layer respectively and the mixture was shaken for 10 min, and then the resulting mixture was centrifuged at 3000 rpm for 10 min and the bottom layer was removed. The extraction with the chloroform/isoamyl alcohol solution was repeated three times. 0.1 equivalent of 3 M sodium acetate (pH 5.2) was added to the upper layer containing DNA, RNA and saccharides, followed by adding two equivalents of cold methanol and keeping the whole at -20ºC for 3 hours or more, followed by centrifugation at 15,000 rpm for 30 minutes (RPR 18-2 rotor). A small portion of sterile distilled water was added to the resulting precipitate and dissolved, followed by adding the equivalent amount of cold 4 M lithium chloride and leaving it at 0ºC overnight. The mixture was then centrifuged at 15,000 rpm for 30 minutes. The resulting precipitate was washed with a small amount of 2 H lithium chloride, and then sterile distilled water was added and dissolved, and then 1/10 of the equivalent amount of 3 M 3.2 x 10⁸, 1.8 x 10⁹ and 2 x 10⁹ in each incubation period in step (1)) were suspended in a homogenate buffer and homogenized therein. To the resulting homogenate were added 0.025 equivalents of 1 M acetic acid and 1.5 times the amount of cold ethanol (at -20ºC) and mixed together. The resulting mixture was then kept at -20ºC for 3 h or more. This was then centrifuged at -10ºC for 30 min at 15000 rpm using a Hitachi RPR 18-2 rotor. To the resulting precipitate was added a washing buffer (prepared by adding 20 mM EDTA.2Na to the homogenate buffer, hereinafter referred to as WB) and dissolved homogeneously by pipetting. Then 1 M acetic acid was added to adjust the pH to 5 and 1.5 times the amount of cold ethanol, and the mixture was kept at -20ºC for 3 h or more. The mixture was centrifuged at -10ºC for 30 min at 15000 rpm, and the resulting precipitate was dissolved in the WB. The pH adjustment with 1 M acetic acid and the cold ethanol precipitation were repeated three times.

A small amount of 0.1% SDS was added to the ethanol precipitate to prepare a suspension, and to this was added 1 equivalent of an extraction buffer (containing 0.5% SDS, 0.1 M NaCl, 50 mM sodium acetate and 5 mM EDTA.2Na with a pH of 5.2) and two equivalents of water-saturated phenol (containing 0.1% 8-quinolinol and saturated with 100 mM Tris-HCl buffer, pH 8.0)/chloroform/isoamyl alcohol solution (volume ratio 50:50:1). The mixture was shaken for 10 min, and then the resulting mixture was centrifuged at 3000 rpm for 10 min. After centrifugation, the mixture was divided into three layers and the bottom layer was removed. The equivalent amount of chloroform/isoamyl alcohol solution (volume ratio 50:1) was added to the upper layer and middle layer respectively, and the mixture was shaken for 10 min, and then the resulting mixture was centrifuged at 3000 rpm for 10 min and the bottom layer was removed. The extraction with the chloroform/isoamyl alcohol solution was repeated three times. 0.1 of the equivalent amount of 3 M sodium acetate (pH 5.2) was added to the upper layer containing DNA, RNA and saccharides, followed by two equivalents of cold methanol and keeping at -20°C for 3 hours or more, followed by centrifugation at 15,000 rpm for 30 min (RPR 18-2 rotor). A small portion of sterile distilled water was added to the resulting precipitate and dissolved, followed by adding the equivalent amount of cold 4 M lithium chloride and leaving it at 0°C overnight. The mixture was then centrifuged at 15,000 rpm for 30 min. The resulting precipitate was washed with a small amount of 2 H lithium chloride, and then sterile distilled water was added and dissolved, followed by 1/10 of the equivalent amount of 3 M sodium acetate (pH 5.2), two equivalents of cold ethanol and kept at -20°C for 3 hours or more. The mixture was centrifuged at 15,000 rpm for 30 min, and the resulting precipitate was dissolved in 0.01 M Tris-HCl buffer (containing 0.5 M NaCl, 0.1% SDS and 1 mM EDTA.3Na at pH 7.5). Then, 3 ml of oligo(dT)₁₂₋₁₈-cellulose (manufactured by PL Biochemicals Co.) previously buffered with the same buffer was filled into a column with a diameter of 1 cm, and the entire cellular RNA fraction was added to the column. This was washed with the same buffer until the absorbance at 260 nm reached 0.05 or less, and then elution was started with a 0.01 M Tris-HCl buffer (containing 0.5 M NaCl, 0.1% SDS and 1 mM EDTA.3Na with a pH of 7.5), and the column was washed until the absorbance at 260 nm reached 0.05 or less. Finally, 0.01 M Tris-HCl buffer (containing 0.1% SDS and 1 mM EDTA.3Na at pH 7.5) was passed through the column to elute the polyadenylic acid-bound RNA (mRNA), which was collected with a fraction collector, collecting the fraction with a measurable absorbance at 260 nm. In this way, 58 ug, 130 ug, 180 ug, 120 ug and 258 ug mRNA were recovered from the A-C5-8 cells incubated for 2, 4, 8, 24 and 48 h, respectively.

(3) Confirmation of translation of LT-corresponding mRNA in oocytes:

Gonadotropin from a pregnant mare (veterinary Peamex injection, from Sankyo Co.) was injected into an approximately 2-year-old Xenopus laevis (female, weight 50 g or more, available from Japan Biological Material Center) by intramuscular injection into the hip at a rate of 200 units/animal. The next day, the animals were anesthetized by immersion in ice water, after which the abdomen was cut open and the oocytes were and isolated in MBS. The mRNA obtained in step (2) was dissolved in sterile distilled water to form a solution of 1 mg (mRNA)/ml, and the obtained solution was injected into the oocytes having a diameter of 1 mm or more in an amount of 50 nl (50 ng) per oocyte using a microcapillary and a microinjector (manufactured by Seimo Scientific Instruments Co.) under observation with an appropriate microscope. 20 oocytes thus treated were incubated in 0.2 ml of MBS at 23ºC. For a control test, 20 oocytes treated only with 50 nl of sterile distilled water were incubated in an analogous manner in 0.2 ml of MBS at 23ºC.

After 24 hours or 48 hours of incubation, the LT activity of the supernatant of the culture solution was measured, and as a result, it was confirmed that the 48-hour incubation provided the optimal conditions for the incubation of the oocytes. Regarding the incubation time of the A-C5-8 cells stimulated with Con A and PMA, the LT activity translated from the mRNA in the cells incubated for 7, 4, 8, 24 and 48 hours was 7.8, 4.6, 4.1, 2.7 and 0 units/ml, and therefore the best incubation time of the A-C5-8 cells for obtaining the mRNA was 2 hours. No LT activity was detected in the corresponding control test, and it was therefore confirmed that the mRNA of the LT was translated in the oocytes.

(4) Mass incubation of A-C5-8 cells and production of mRNA:

The A-C5-8 cells were incubated under optimal conditions (stimulated with Con A and PMA) as determined in step (3) above and 3 x 109 cells were collected. The mRNA was isolated and purified from these cells after step (2) to obtain 512 µg of the mRNA fraction.

(5) Fractionation of mRNA by sucrose density gradient centrifugation and determination of the LT-corresponding mRNA sedimentation coefficient:

512 μg of total mRNA was dissolved in 0.01 M Tris-HCl buffer (containing 0.01 M EDTA.2Na and 0.2% SDS, pH 7.5), and the mixture was poured over 5 ml of a 5 to 30% sucrose density gradient solution dissolved in the same buffer, and then centrifuged at 15°C for 16 h at 28,000 rpm using the RPR 40T-208 rotor (Hitachi Co.). The contents were then separated into 25 sample tubes (each with a capacity of 216 μl). 1/10 equivalent of 3 M sodium acetate and two equivalents of cold ethanol were added to each fraction and the mixture was stored at -20ºC overnight for recovery of mRNA.

The mRNA thus obtained was dissolved in sterile distilled water (0.5 mg/ml) and 100 nl of the resulting solution was injected into 20 oocytes in the same manner as in Step (3). The oocytes were incubated with 0.2 ml of MBS for 48 hours, and then the LT activity in the culture supernatant was measured. As a result, it was found that fraction No. 13 showed the maximum LT activity. Accordingly, the sedimentation coefficient of the mRNA corresponding to LT was determined to be 12.6S to 14.6S based on the curve obtained using standard markers for sedimentation coefficients (5S, 18S, 28S).

The purified mRNA obtained in this example was used in the following experiment.

Example 3 (1) Synthesis of cDNA:

To obtain cDNA, the reverse transcriptase system [32P] (from New England Nuclear Co.) was partially modified using 5 μg of pure mRNA. Specifically, a system containing 20 µl of reverse transcriptase reaction buffer, 10 µl of deoxynucleoside/triphosphate mixture, 20 units of ribonuclease A inhibitor, 10 µg of oligo(dT)₁₂₋₁₈ primer, 5 µl of 600 mM beta-mercaptoethanol, [alpha-32P]dCTP (relative activity: 800 Ci/mmol (100 Ci)), 5 µg of mRNA and 50 units of simian myeloblastosis virus reverse transcriptase was reacted in a volume of 100 µl at 42°C for 1 h, and then cooled with ice to terminate the reaction. After centrifugation, the hybrid of mRNA and cDNA was heated in a boiling water bath for 3 min to separate, then quickly cooled in an ice bath for 5 minutes.

The denatured protein was subjected to centrifugation (12000 x g, 2 min) to form pellets, which were cooled with ice. To 99 μl of the reaction solution, after stopping the reaction, were added 16.2 μl of sterile distilled water, 46.8 μl of DNA polymerase I reaction buffer, 10.4 μl of deoxynucleoside/triphosphate mixture [alpha-32P]dCTP (800 Ci/mmol (100 μCi)) and 15.6 μl of DNA polymerase I from E. coli (8000 units/ml) and cooled with ice to adjust the total volume of the resulting mixture to 198 μl. The mixture was stirred well, centrifuged and then reacted at 15°C for 20 h. After the reaction, 39.4 μl of 0.2 M EDTA.2Na was added to 197 μl of the reaction solution to terminate the reaction, and 1 N NaOH (49.25 μl) was added for alkali heat treatment at 65°C for 1 h to decompose the mRNA, and after ice-cooling and centrifugation, 1 M Tris-HCl buffer (49.25 μl, pH 8.0) and 1 N HCl (49.25 μl) were added for neutralization.

The mixture was extracted with 1/2 equivalent of water-saturated phenol and 1/2 equivalent of chloroform/isoamyl alcohol (50:1), and after centrifugation, the upper saturated solution was removed. An equivalent amount of 10 mM tris-HCl buffer (containing 100 mM NaCl and 1 mM EDTA.2Na with a pH of 8.0) was added to the lower phase for re-extraction, and the upper separated phase was also removed. The two upper phases thus removed were mixed together. combined and extracted with an equivalent amount of chloroform/isoamyl alcohol and centrifuged, and the lower phase (organic phase) which had separated was removed. This extraction was repeated four times, and then the obtained extract was further extracted with an equivalent amount of water-saturated ethyl ether three times, and the organic phase was removed. Thereafter, the obtained extract was heated in a hot water bath at 60°C to remove the ethyl ether.

The resulting aqueous solution was concentrated with sec-butanol, MgCl2 to a final concentration of 0.01 M and two equivalents of cold ethanol (-20°C) were added and left at -80°C overnight. The resulting mixture was centrifuged (12000 x g) for 10 min and the precipitate obtained was dried under reduced pressure and dissolved in 50 μl of sterile distilled water. To the obtained solution, 20 μl of reverse transcriptase buffer, 5 μl of 600 mM beta-mercaptoethanol, 10 μl of deoxynucleoside/triphosphate mixture and [alpha-32P]-dCTP (800 Ci/mmol (100 μCi)) were added, and the mixture was stirred well, and after centrifugation, 5 μl of the above-mentioned reverse transcriptase was added and reacted at 42°C for 1 h. The reaction was stopped under ice cooling to obtain the complete DNA with a hairpin loop structure.

To 99 μl of the above-mentioned reaction solution were added 92.1 μl of sterile distilled water, 23.4 μl of the above-mentioned DNA polymerase I reaction buffer, 55 μl S1 nuclease reaction buffer and 5.5 µl of S1 nuclease from Aspergillus oryzae (50 units/mL) were added, and the mixture was reacted at 39°C for 30 min to cleave the hairpin loop structure of cDNA to obtain double-stranded cDNA. To this solution was added 46 µl of 0.1 M Tris-HCl buffer (containing 0.1 M EDTA.2Na and having a pH of 7.5), and the solution was applied to a Sephacryl S-200 column (size: 1.0x25cm) with a bed capacity of 200 mL, and eluted with 10 mM Tris-HCl buffer (containing 0.1 M NaCl and 1 mM EDTA.2Na at a pH of 7.5). Fractionation was performed to obtain fractions of 300 μl each, and the fraction eluted near the cutoff volume was concentrated with sec-butanol and subjected to ethanol precipitation to recover cDNA.

(2) Preparation of cDNA with attached oligo(dC) tail:

To the double-stranded cDNA obtained above, 160 µl of a reaction buffer having the following composition was added, and the mixture was reacted at 37°C for 5 min, whereby the oligo(dC) tail was attached to the double-stranded cDNA.

The reaction buffer is 0.2 M potassium cacodylate/25 mM Tris-HCl buffer (pH 6.9) containing 2 mM DTT, 5 mM CoCl2, 0.25 mg/ml BSA, 5 µM dCTP, 3H-labeled dCTP (25 Ci/mmol (15 µCi)) and 30 units of terminal deoxynucleotidyltransferase.

The reaction was stopped by ice-cooling, and one equivalent of water-saturated phenol/chloroform/isoamyl alcohol (50:50:1) was added to the reaction solution for extraction. The obtained extract was extracted again with chloroform/isoamyl alcohol (50:1), and 40 µg of E. coli ribosomal RNA and 1/50 equivalent of 5 M NaCl were added to the extract, and then 2 equivalents of cold ethanol were added and stored at -80ºC overnight. The cDNA with the oligo(dC) tail was recovered by centrifugation and dissolved in sterile distilled water to obtain a solution with a concentration of 0.5 ng/µl.

(3) Formation of the recombinant plasmid:

1.375 ng of the cDNA with the oligo(dC) tail and 10 ng of pBR322 DNA with an oligo(dG)₁₀₋₂₀ tail (manufactured by Amersham) were hybridized in 25 µl under hybridization conditions (10 mM Tris-HCl buffer containing 100 mM NaCl and 0.1 mM EDTA.2Na at pH 7.8) at 65°C for 15 min, and then the incubator was set to 45°C and incubated at 45°C for an additional 2 h. Then the mixture was cooled with ice for hybridization to obtain a recombinant plasmid-containing solution.

(4) Selection of the transformant:

The solution containing the recombinant plasmid obtained above was added to an E. coli HB101 strain for transformation. Specifically, the E. coli HB101 strain incubated in 10 ml of L medium containing 0.1% glucose at 37°C until the absorbance of the cultured medium (650 nm) reached 0.05, and 5 ml of the cultured solution was added to 500 ml of L medium containing 0.1% glucose and further incubated until the absorbance (650 nm) reached 0.3. After cooling with ice for 30 min, the mixture was centrifuged at 4°C for 5 min at 3000 rpm (using RPR 9-2 rotor from Hitachi Co.) to collect the grown bacteria. The bacteria were dispersed in 250 ml of cold 50 mM CaCl₂ and cooled with ice for 15 min. The mixture was subjected to centrifugation using the RPR 9-2 rotor (4°C, 5 min, 2500 rpm), and the collected bacteria were dispersed in 25 ml of 50 mM CaCl₂ containing 20% glycerol, and the resulting dispersion was divided into two sample tubes each containing 1 ml and freeze-dried with dry ice powder and then stored at -80°C. The stored bacterial dispersion was thawed under cooling with ice, and 0.3 ml of the thus-thawed bacterial dispersion was mixed with 0.15 ml of the above-mentioned recombinant plasmid solution and 0.15 ml of 20 mM CaCl₂/60 mM MnCl₂/20 mM RbCl solution, and kept at 0°C for 20 min and then at room temperature for 10 min. Then, 2.4 ml of 0.1% glucose-containing L-medium previously warmed to 37ºC was added and mixed, and the whole was incubated at 37ºC for 1 h with shaking. A portion of the thus incubated solution was taken, and this was spread over L-medium/agar plates containing 15 µg/ml tetracycline in addition to the above components and incubated at 37ºC for about 12 h, and the tetracycline-resistant bacteria were selected to form a cDNA library.

(5) Hybridization test:

To screen the transformant with the plasmid carrying the LT-encoding cDNA, the above-mentioned cDNA library was subjected to a colony hybridization assay using 32P-labeled synthetic cDNA probes. To form the synthetic cDNA probes, 18 bases (404th to 421st base) (5'-GTCTACTCCCAGGTGGTC-3') and the complementary base sequence (5'-CACATGGAAGGGGTACTG-3') corresponding to the 18 bases (500th to 517th base) in the LT gene according to Gray et al. (Nature, 312, 721 (1984)) and 16.6 pmoles of it were reacted with 5 units of polynucleotide kinase from T4 phage-infected E. coli and [gamma-32P]ATP (5 uCi/pmole (20 uCi)) in 50 mM Tris-HCl buffer (containing 10 mM MgCl2, 5 mM DTT, 0.1 mM spermidine and 0.1 mM EDTA.2Na and pH 7.6) at 37°C for 30 min.

The reaction was terminated by adding EDTA solution to the reaction solution and cooling it with ice at 0°C. These two types of 32P-labeled cDNA probes were used in the hybridization test, and the transformants with a recombinant plasmid capable of hybridizing with both probes under weak conditions were selected. In this way, 6 colonies were selected from about 10,000 colonies.

Subsequently, the recombinant plasmid was separated from the 6 strains selected in this way, and this was cleaved with restriction enzyme HindIII, subjected to agarose electrophoresis, Nitrocellulose filters and hybridized with the ³²P-labeled synthetic cDNA samples under stringent conditions. As a result, one clone was selected.

Then, the strain thus selected was subjected to a hybridization translation assay according to the method described in Maniatis T. et al., Molecular Cloning, 329 (1980) (Cold Spring Harbor Laboratory). The plasmid DNA was extracted from the transformant strain, and after heating and denaturation, it was fixed on a nitrocellulose filter, and the LT mRNA-containing mRNA fraction obtained from the previous Example 2-(4) was added and reacted at 50°C for 3 hours for hybridization. The bound mRNA was recovered by elution and then injected into oocytes in the same manner as in the previous Example 2-(3), and then the recovered mRNA was checked whether or not it was LT mRNA.

As a result, 10 units/ml LT was detected in the case of pLT13, whereas no LT activity was detected in the control pBR322.

This cDNA was digested with restriction enzyme HindIII, and its size was measured by agarose gel electrophoresis, and it was confirmed that it contained a cDNA portion of approximately 1.35 Kbp.

The transformant containing this cDNA (strain number: Lt 13, cloned DNA number: pLT 13) was treated to isolate the cloned DNA, and the base sequence thereof was determined according to the procedure described below.

Example 4 Determination of the base sequence of the cloned DNA: (1) Creation of a restriction endonuclease cleavage site map:

The strain (LT 13) obtained from the previous Example 3-(5) was incubated in L medium containing 0.1% glucose and 15 ug/ml tetracycline to obtain bacteria. Plasmid DNA was recovered from the bacteria, and its restriction endonuclease site map was constructed using restriction enzymes EcoRI, SmaI, BamHI, PstI, SalI and HindIII, which can be introduced into M13mp 8, 9 as mentioned below. (See Fig. 1)

(2) Determination of the base sequence of the cloned DNA:

To determine the base sequence of the cloned DNA, the cDNA fragment was subcloned with M13mp 8 or mp 9 according to the method of Messing et al. (Gene, 19, 269 (1982)) and then processed according to the method of Sanger et al., the dideoxy chain termination method (Proc. Natl. Acad. Sci. USA, 74, 5463 (1977); J. Mol. Biol. , 162, 729 (1982)) for hybridization of the primers, synthesis of the complementary chain with Klenow fragment of DNA polymerase I (labeled with alpha-32P-labeled dCTP (800 Ci/mmol (20 uCi)), gel electrophoresis and autoradiography.

Figure 2 shows the restriction enzyme sites used to determine the base sequence, the direction of determining the base sequence and its region indicated by arrows. The part indicated by the rectangles shows the part encoding the translation region of LT.

The base sequence is the same as shown in the previous Table 1. There is a 16 G linkage tail upstream of the first C and an 18 C linkage tail downstream of the 1310th T, and these are homopolymers synthesized when added to the vector. The 63rd to 677th bases form a base sequence believed to encode the necessary polypeptide to form the LT precursor.

Of these bases, those from the 165th base onwards are believed to encode LT, the base sequence differing from that of LT as reported by Gray P.W. et al. (Nature, 312, 721 (1984)) in that the 26th amino acid in the former is Asn(AAC), whereas the amino acid in the latter is Thr(ACC). The present sequence has a terminal codon (TAG) followed by the C-terminal amino acid (leucine). In addition, the present sequence is further different from the Gray et al. sequence in non-peptide coding parts, namely, in that the first to fourth bases are CGGG instead of GGTC, the 862nd to 865th bases are ACAC instead of CACA, and the 1306th to 1310th bases are CCCCT instead of TGAAA.

Example 5 (1) Cleavage of the cDNA fragment of pLT 13 with restriction enzymes:

Due to the structure of the complete cDNA, the restriction enzymes PvuII (190th base) and EcoRI (838th base) were used. pLT13 was digested with the restriction enzymes in the usual way and subjected to 1.5% agarose gel electrophoresis, whereby a cDNA fragment of approximately 650 bp was subsequently extracted from the agarose gel. This cDNA fragment was subjected to water-saturated phenol extraction and chloroform/isoamyl alcohol extraction followed by ethanol precipitation to recover the cDNA fragment. This cDNA fragment lacks 28 bases at its N-terminal end compared to that of C with the N-terminus of LT, and therefore this fragment contains up to 164 bases downstream of the stop codon.

(2) Cleavage of the polylinker site of the phenotypic expression vector pKK223-3 (manufactured by Pharmacia Co.) with restriction enzymes:

The polylinker site of pKK223-3 (4585 bp) was initially completely digested with EcoRI and then partially digested with BamHI. The DNA fragment of pKK223-3 which was completely digested with BamHI was isolated by 1.5% agarose gel electrophoresis, and the remaining parts were subjected to agarose gel extraction, phenol extraction, chloroform/isoamyl alcohol extraction and ethanol precipitation in this order. In this way, the plasmid which was partially digested with BamHI and the vector which was not digested with BamHI were recovered. Then, these plasmids were completely digested with SmaI to obtain the digested EcoRI-BamHI site and EcoRI-SmaI site.

(3) Ligation of the portable translation initiation site (PTIS: upper chain (EcoRI): lower chain (BamHI) from Pharmacia Co.) with the EcoRI-BamHI site-cleaved pKK223-3:

The EcoRI-BamHI site-cleaved vector pKK223-3 as obtained in (2) and PTIS (in which the upper chain and the lower chain had previously been heated at 65°C for 5 min in 0.01 M Tris-HCl buffer containing 0.1 M NaCl and 0.1 mM EDTA at pH 7.8, transferred to a water bath at 37°C for 1 h, followed by incubation at room temperature for 20 min for hybridization and then stored at -20°C) were reacted overnight at 14°C in 50 mM Tris-HCl buffer (containing 10 mM MgCl2, 10 mM dithiothreitol and 1 mM ATp, pH 7.6) with DNA ligase from T4 phage-infected E. coli to convert into a circular vector. structure. This modified vector was introduced into E. coli strain JM 105 in the usual way for transformation, and the resulting transformant strains were spread on LB agar medium containing ampicillin. The bacteria containing the modified plasmid were then selected as ampicillin-resistant bacteria, and the plasmid was subsequently obtained in the usual manner. This plasmid was named PP-3.

(4) Cleavage of PP-3 with restriction enzymes and ligation of the blunt ends with cDNA fragment:

First, PP-3 obtained in (3) above was partially digested with BamHI and then treated with bovine intestinal mucosa alkaline phosphatase (manufactured by Pharmacia Co.) in 50 mM Tris-HCl buffer containing 1 mM MgCl2, 0.1 mM ZnCl2 and 1 mM spermidine, pH 9.0) at 37°C for 30 min for 5'-terminal dephosphorylation. This was followed by extractions with water-saturated phenol and with CIA (chloroform/isoamyl alcohol). It was then precipitated with ethanol to recover the opened circular plasmid and then the overlapping ends were blunted using DNA polymerase I (Klenow fragment). This blunt-ended plasmid was subsequently recovered by extraction with water-saturated phenol, extraction with CIA and precipitation with ethanol.

The EcoRI-PvuII fragment of pLT13 obtained in (1) was reacted with DNA polymerase I (Klenow fragment) which gave a blunt end, and the fragment was then recovered by extraction with phenol, extraction with CIA and precipitation with ethanol in that order. The recovered fragment was then ligated with the blunt-end containing open circular PP-3 plasmid in the presence of DNA ligase at 16°C for 20 h. After the reaction, the closed circular plasmid was recovered by extraction with water-saturated Phenol, extraction with CIA and precipitation with ethanol in this order, and the plasmid was introduced into E. coli strain JM 105 in the usual manner for transformation. Using an ampicillin resistance medium, 5300 transformants were selected.

(5) Screening with synthetic cDNA probe:

The transformants obtained in (4) were screened by the colony hybridization test using a 32P-labeled synthetic cDNA probe in the same manner as in Example 3-(5) to select 100 colonies. A plasmid was prepared from 20 colonies in the usual manner, and this plasmid was digested with restriction enzymes (BamHI and HindIII) and then subjected to agarose gel electrophoresis. The desired plasmid having the DNA fragments of about 650 bp and about 250 bp was located. As a result, three desired colonies were selected.

(6) Expression of LT in E. coli:

One of the three transformants obtained in (5) was used for LT expression. The tac promoter of the plasmid inserted into the host bacteria of E. coli strain JM 105 was suppressed in the host bacteria, but the suppression can be eliminated by adding IPTG. The transformants were grown in LB medium (composition: 10 g bactotryptone, 5 g bacto yeast extract and 10 g NaCl in 1 L, pH 7.0 to 7.5, containing 25 mg ampicillin) containing 0 to 1 mM IPTG until a OD (550 nm) of 1.1 to 1.2. The bacteria thus incubated were collected by centrifugation and washed with physiological saline buffered with a phosphate buffer (hereinafter referred to as PBS). The bacteria were again collected by centrifugation and then suspended in PBS in such a manner that the OD (550 nm) was 1.0. The obtained suspension was treated with ultrasonication to disrupt the bacteria. The suspension was filtered under aseptic conditions and the LT activity was measured. In the case of no addition of IPTG, the LT activity was 0.26 x 10⁴ units/ml; when IPTG was added at concentrations of 0.01 mM, 0.1 mM and 1 mM, the LT activity was 11 x 10⁴, 10 x 10⁴ units/ml. and 15 x 10⁴ units/ml. However, when the same test was performed using bacteria with pKK223-3 inserted as a control, no LT activity could be detected. Thus, it was shown that the expression of LT activity resulted from the insertion of the recombinant plasmid into the host bacterium. The strain number of the transformant as used herein was called LT13tac6, and the plasmid inserted therein was called pLT13tac6. Fig. 3 shows the method for preparing pLT13tac6.

Example 6

The transformant LT13tac6 strain was incubated in M9 minimal medium containing 19 essential amino acids (except proline) overnight, and the culture broth was inoculated with 10 times the amount of LB medium. After 2.5 h, IPTG was added to a final concentration of 0.1 mM, and incubation was continued for another 3 h. The bacteria were then collected by ultrafiltration and centrifugation. 90 g (wet weight) of bacteria were suspended in 300 ml of 50 mM Tris-HCl (pH 8.0) containing 30 mM NaCl and 0.01 mM p-APMSF (p-aminophenylmethanesulfonyl fluoride hydrochloride, manufactured by Wake Junyaku KK), and were disrupted by ultrasonic treatment. The obtained suspension was subjected to centrifugation to remove the residual bacteria, and the supernatant liquid was the crude extract. The total LT activity of 347.5 ml of crude extract was 12.2 x 10⁸ units, and the relative activity thereof was 9 x 10⁴ units/mg (protein).

Example 7 Purification of LT polypeptide: (1) Ammonium sulfate salting out:

Ammonium sulfate was added to 347 ml of the crude extract to prepare a 40% saturated solution at 5°C. After incubation at 5°C for 30 min, the solution was subjected to centrifugation. The precipitate formed was dissolved in 100 ml of 5 mM phosphate buffer (pH 7.4) (hereinafter referred to as PB), and the resulting solution was dialyzed against 4 L of PB with four-fold exchange. After dialysis, the solution was processed as an ammonium sulfate-salted sample. The total LT activity of 117 ml of the sample was 11.7 x 10⁸ units, and the relative activity thereof was 4.6 x 10⁵ units/mg (protein).

(2) Anion exchange chromatography:

116 ml of the ammonium sulfate-salted sample was applied to a column (2.6 x 34 cm) of DEAE-Sepharose CL-6B (manufactured by Pharmacia Co.) previously equilibrated with 50 mM PB (pH 7.4). The column was then washed with 400 ml of 5 mM PB (pH 7.4), and the sample in the column was eluted with an increasing salt gradient whose concentration increased from 0 to 0.3 M. The obtained eluate was collected in 25 ml aliquots, and the LT activity of each fraction was measured. Thus, fractions containing the LT activity were obtained. Approximately 1000 mL of the obtained solution was concentrated on an ultrafiltration membrane (fractionation molecular weight: 10000, manufactured by Millipore Co.) to 88 mL. The concentrated solution was called DEAE fraction solution. The total LT activity of the DEAE fraction solution was 4.4 x 10⁸ units, and its relative activity was 8.27 x 10⁸ units/mg (protein).

(3) Hydrophobic chromatography:

85 ml of the DEAE fraction solution was adsorbed on a column (2.6 x 14 cm) of Phenyl-Sepharose CL-6B (manufactured by Pharmacia Co.) which had been previously equilibrated with PBS, and then washed with 150 ml of 10 mM PB (pH 7.4) containing 30% ethylene glycol. The column was then eluted with ethylene glycol, the concentration of the ethylene glycol eluent continuously increasing from 30% to 70%. The obtained eluate was fractionated into 15 ml aliquots, the fractions were then dialyzed against PBS, and the LT activity of each fraction was measured. The fractions having LT activity were thus recovered. 308 ml of the obtained solution was concentrated to 9.4 ml by the above-mentioned ultrafiltration, and the thus concentrated solution was called the phenyl fractionated solution. The total LT activity of the phenyl fractionated solution was 3.94 x 10⁸ units, and the relative activity thereof was 5.63 x 10⁷ units/mg (protein).

The obtained fraction was treated with Britton-Robinson buffer in a wide concentration range (Britton and Robinson; J. Chem. Soc., 1931, 458, 1456) to adjust the pH to a certain value and then incubated at 4°C for 24 h. The thus incubated solution was dialyzed against PBS for 24 h and its LT activity was measured, the LT concentration in each buffer being 4.6 µg/ml. As a result, a loss of 98% or more of LT activity occurred at pH 2, whereas no decrease in LT activity occurred in a pH range of 4 to 10. The phenyl-fractionated solution was analyzed by 0.1% SDS-containing polyacrylamide gel electrophoresis (SDS-PAGE). (See U.K. Laemmli, Nature, 227, 680 (1970)). The LT activity appeared in a protein peak, corresponding to a molecular weight of about 17,500, as determined by silver staining. The molecular weight markers used in SDS-PAGE were:

Phosphorylse B: MG 94000, BSA: MG 67000, ovalbumin: MG 43000, carboxylic anhydrase: MG 30000, soybean trypsin inhibitor: MG 20000, alpha-lactalbumin: MG 14400.

Example 8

The phenyl fractionated solution was further concentrated to 1/4 of the original volume by ultrafiltration, and 0.5 ml of the concentrated solution was fractionated on SDS-PAGE (gel plate: 1.5 mm x 16 cm x 14 cm). The gel fraction corresponding to a molecular weight of 17,500 was cut out and extracted with Tris-acetate buffer (pH 8.6). This procedure was repeated, and the resulting extracts were combined and concentrated by ultrafiltration on a membrane having a fractionation molecular weight of 5,000 (manufactured by Amicon Co.) and then dialyzed. This gave a purified LT polypeptide LT(I). The amino acid composition, N-terminal amino acid sequence and isoelectric point of the purified LT polypeptide LT(I) were measured as follows:

(1) Amino acid composition:

LT(I) was dried to a solid under reduced pressure. 6 N HCl was added to this solid and the mixture was hydrolyzed at 110°C for 6 h. Then, the mixture was reacted with phenylisothiocyanate to obtain PTC-amino acid and then the composition was analyzed by using an amino acid analyzer (reverse phase distribution method of Waters Co.). The tryptophan and cysteine were quantitatively determined by the Inglis method (Methods in Enzymology, vol. 91, p. 26, edited by C.H.W. Hirs et al., Academic Press, 1983). The result is shown in Table 4.

The analyzed data correspond well to the amino acid composition obtained from the base sequence of the DNA encoding LT polypeptide. Table 4 Amino acid composition of LT(I) Amino acid analysis values (mol) Amino acid composition obtained from the base sequence (mol)

(2) N-terminal amino acid sequence:

The N-terminal amino acid sequence was determined using the Edman method (P. Edman; Arch. Biochem. Biophys., 22, 475 (1949)).

LT(I) (ca. 100 μg) was reacted with phenylisothiocyanate by a coupling reaction, and then the N-terminal amino acid was cleaved in the form of a 2-anilino-5-thiazolinone derivative, which was further converted into a phenylthiohydantoin amino acid. This was identified by using HPLC (manufactured by Waters Co.) with a C18 reverse phase column to determine the N-terminal amino acid. This operation was repeated to determine the amino acid sequence of the N-terminal part. The obtained amino acid sequence of the N-terminal part of LT(I) is as follows:

(3) Measurement of the isoelectric point:

The isoelectric point of LT(I) was measured by electrophoresis using a flat gel containing Pharmalite (from Pharmacia Co.) and 5% polyacrylamide with a pH range of 5.0 to 8.0. The obtained isoelectric point of LT(I) was 7.6 ± 0.3.

Electrophoresis was performed at 2000 V for 4.5 h The gel was cut into 3 mm particles and extracted with PBS (pH 7.4), and the LT activity was measured. The LT activity occurred in the pH range of 7 6 ± 0.3. A calibration curve was prepared using beta-latoglobulin-A (pI 5.20), bovine carboxylic anhydrase-B (pI 5.85), human carboxylic anhydrase-B (pI 6.55), horse myoglobin acid sideband (pI 6.85), and horse myoglobin base sideband (pI 7.35) as pH markers.

Example 9 (1) Cleavage of the cDNA fragment of pLT13 with restriction enzymes:

From the restriction enzymes that seemed suitable for cleaving the cDNA fragment of pLT13 in view of the structure of its entire cDNA, NsiI (222nd base) and EcoRI (838th base) were selected, and the pLT13 was digested with the restriction enzymes thus selected in the usual manner and subjected to 1.5% agarose gel electrophoresis, and a cDNA fragment of 616 pb was extracted from the agarose gel. The cDNA fragment was purified in the usual manner. This cDNA fragment lacks 60 bases corresponding to 20 amino acid residues in the N-terminal region of LT.

(2) Ligation of synthetic oligonucleotide with LT-cDNA:

A synthetic oligonucleotide having the following structure, manufactured by Applied Biosystem Co., synthesized using a 381A DNA synthesizer) and the LT cDNA fragment from step (1) above were reacted using T4 DNA ligase in 66 mM Tris-HCl buffer (pH 7.6), 6.6 mM MgCl₂, 10 mM DDT and 1 mM ATP at 16°C overnight, thereby ligating the synthetic oligonucleotide to the LT cDNA fragment.

Structure of the synthetic oligonucleotide:

AATTCTATGCA

GAT

The reaction product was purified in the usual manner and then digested with EcoRI to obtain the EcoRI fragment of 623 bp.

(3) Introduction of the LT cDNA fragment into an expression vector:

The expression vector pKK223-3 (obtained from Pharmacia Co.) was digested with EcoRI and then treated with bovine intestinal mucosa alkaline phosphatase (manufactured by Pharmacia Co.) in 50 mM Tris-HCl buffer (pH 9.0), 1 mM MgCl2, 0.1 mM ZnCl2 and 1 mM spermidine at 37°C for 30 min for 5'-terminal dephosphorylation and then purified in a conventional manner. The vector thus treated was ligated with the EcoRI fragment of 623 bp obtained from the above step (2), and then the obtained product was introduced into E. coli strain JM 105 in a conventional manner for Transformation was introduced. Using an ampicillin resistance medium, 8700 transformants were obtained.

(4) Screening with synthetic cDNA probe:

The transformants obtained in (3) were screened by colony hybridization assays using a 32P-labeled synthetic cDNA probe in the same manner as in the previous Example 3-(5) to select 150 colonies. 24 colonies were randomly selected from these colonies, and a plasmid was prepared therefrom in a conventional manner. The plasmid was digested with relevant restriction enzymes and was then subjected to agarose gel electrophoresis to determine the desired fragment and its direction. As a result, seven desired colonies were selected, and the plasmid was named pDK 10. The step for forming pDK 10 is shown in Fig. 4.

(5) Removal of the 3'-terminal non-coding region of LT-cDNA:

Plasmid pDK10 obtained in (4) was digested with HindIII and then treated with BAL31 nuclease (manufactured by Takara Shuzo Co.) in 20 mM Tris-HCl buffer (pH 8.0), 12 mM CaCl2, 12 mM MgCl2, 1 mM EDTA and 600 mM NaCl for 10 to 60 min at 30°C to remove the DNA terminal. Then, this plasmid was treated with DNA polymerase (Klenow fragment) to blunt the terminal end and then with EcoRI. digested and separated by 5% polyarylamide gel electrophoresis to yield a fragment of approximately 480 bp or so (preferably 460 bp).

(6) Ligation of the LT cDNA with the linker:

The DNA fragment obtained in (5) was ligated with the HindIII linker (manufactured by Takara Shuzo Co.) and then digested with HindIII and purified in a conventional manner.

(7) Ligation of LT-cDNA with the expression vector:

pKK223-3 was digested with EcoRI and HindIII, and then the fragment of 4555 bp was isolated by 0.7% agarose gel electrophoresis and purified in a conventional manner. This was ligated with the EcoRI-HindIII DNA fragment obtained in (6) to form a vector containing the LT cDNA fragment. (This plasmid was named pDK 11). The step of forming pDK11 is shown in Fig. 5.

(8) Introduction of LT cDNA into a multi-copy vector:

The plasmid obtained in (7) was digested with BamHI and PvuI, and then the fragment containing the LT cDNA was isolated and purified by agarose gel electrophoresis. A plasmid pAT153 (commercial product of Amersham Co.) was also digested with BamHI and PvuI in the same manner, and then a fragment containing a DNA replication initiation point was fractionated and purified. These two types of BamHI-PvuI fragments were ligated and then introduced into E. coli JM 105 in the usual manner for transformation. Using the ampicillin resistance medium, 4300 transformants were selected. 24 colonies were randomly selected from them, and a plasmid DNA was purified in the usual manner. The plasmid was digested with relevant restriction enzymes, thereby determining the number of desired LT cDNA fragments and their direction. As a result, 24 desired colonies were selected. (The plasmid was named pDK 12). The step for preparing the plasmid pDK 12 is shown in Fig. 6.

Example 10

E. coli JM 105 transformed with pDK12 were pre-incubated in M9 medium containing 50 µg/ml ampicillin and 19 amino acids (except proline) overnight. The next day, the pre-incubated solution was inoculated into LB medium (containing 10 g bactotryptone, 5 g bactoyeast extract and 10 g NaCl in 1 L, pH 7 to 7.5) containing 25 µg/ml ampicillin, with the medium being diluted to a concentration of 1/10 by the addition of the pre-incubated solution. After an O.D.550 nm of 0.3 was reached, IPTG was added to a final concentration of 1 mM, and then the bacteria were further incubated until an O.D.550 nm of 1 was reached. The cultured material was disrupted by sonication and the LT activity of the cell extract was measured. The LT activity was approximately 3.5 x 10⁵ units/ml of cultured material.

Example 11

E. coli JM 105 transformed with pDK12 was incubated in M9 medium containing 50 μg/ml ampicillin and 19 amino acids (excluding proline) overnight, then the cultured solution was further incubated in 20-fold volume of a medium containing the following composition. Ingredients Sodium citrate Glucose Casamic acid Yeast extract Thiamine Ampicillin

After the OD 550 of the medium reached about 10, IPTG was added to the medium to a final concentration of 5 mM, and then the bacteria were further incubated until the OD550 nm reached 30. The culture broth was recovered by ultrafiltration and centrifugation, and thus 750 g (wet weight) of bacteria were obtained. The bacteria were suspended in 2000 ml of a mixture containing 50 mM Tris-HCl buffer (pH 8.0), 30 mM NaCl and 0.01 mM (p-amidinophenyl)methanesulfonyl fluoride hydrochloride (manufactured by Wako Junyaku Co.), and incubated under using a Dinor mill and then subjected to centrifugation to obtain a crude extract solution. The total LT activity of the crude extract solution (3700 ml) was 6.0 x 10¹² units and the relative activity was 5 x 10⁵ units/mg (protein).

Example 12 (1) Ammonium sulfate fractionation:

To 3700 ml of the crude extract solution obtained in Example 11, ammonium sulfate was added to 40% saturation at 5°C. After incubation at 5°C for 30 min, the solution was centrifuged. The precipitate formed was dissolved in 500 ml of 5 mM phosphate buffer (PH 7.8), hereinafter referred to as PB, and the resulting solution was centrifuged repeatedly, followed by dilution to remove the salt, and an ammonium sulfate salted-out sample was obtained. The total LT activity of 185 ml of the sample was 5.2 x 10¹² units and the relative activity was 3.7 x 10⁶ units/mg (protein).

(2) Anion exchange chromatography:

184 ml of the ammonium sulfate-salted sample was applied to a column (4.5 cm x 50 cm) of DEAE-Sepharose CL-6B (manufactured by Pharmacia Co.) previously equilibrated with 5 mM MPB (pH 7.8). The column was washed with 3.0 l of 5 mM PB, and the sample was eluted with a eluates continuously increased from 0 to 0.3 M. The obtained eluate was fractionated into 100 ml aliquots, and the LT activity of each fraction was measured. The obtained fractions with the LT activity were pooled. About 3.0 L of the obtained solution was concentrated to 170 ml through an ultrafiltration membrane (fractionation molecular weight 10000, manufactured by Millipore Co.). The concentrated solution was called DEAE fractionated solution. The total LT activity of the DEAE fractionated solution was 2.9 x 10¹² units and the relative activity was 2.4 x 10⁷ units/mg (protein).

(3) Hydrophobic chromatography:

169 ml of the DEAE fractionated solution was adsorbed onto a column (5.0 cm x 15 cm) of phenyl-Sepharose CL-6B (manufactured by Pharmacia Co.) which had been previously equilibrated with a physiological saline solution buffered with PB, and then washed with 600 ml of 10 mM PB (pH 7.8) containing 30% ethylene glycol. The column was eluted with ethylene glycol, and the concentration of the ethylene glycol eluate increased continuously to 70%. The ethylene glycol was removed from the resulting solution by ultrafiltration. The eluate solution was then concentrated to 63 ml, and the concentrated solution was called the phenyl fractionated solution. The total LT activity of the phenyl fractionated solution was 2.3 x 10¹² units and the relative activity was 7.3 x 10⁷ units/mg (protein). The phenyl fractionated solution was purified by 0.1% SDS-containing polyacrylamide gel electrophoresis (SDS-PAGE) analyzed (see UK Laemmli, Nature, 227, 680 (1970)). As a result, a band at the site with a molecular weight of 17000 was identified by silver staining. The molecular weight markers of SDS-PAGE were as follows:

Phosphorylase B: MW 94000; RSA: MG 67000; Ovalbumin: MG 43000; Carbonic anhydrase: MG 30000; Soybean trypsin inhibitor: MG 20000; alpha-lactalbumin: MW 14400.

Example 13

The phenyl fractionated solution was further concentrated to 1/3 by ultrafiltration, and 0.5 ml of the concentrated solution was separated by SDS-PAGE (gel plate 1.5 mm x 16 cm x 14 cm), and then the gel fragment corresponding to a molecular weight of 17,000 was cut out and extracted with Tris-acetate buffer (pH 8.6). This operation was repeated, and the obtained extracts were combined and concentrated with an ultrafiltration membrane having a fractionation molecular weight of 5,000 (manufactured by Amicon Co.) and then dialyzed. This gave purified LT polypeptide LT(II). The amino acid composition and N-terminal amino acid sequence of the purified LT polypeptide LT(II) were determined as follows:

(1) Amino acid composition:

The purified LT(II) was converted to a solid under reduced pressure. 6N HCl was added and the mixture was hydrolyzed at 110°C for 6 hours. This mixture was then reacted with phenylisothiocyanate to obtain PTC amino acid and its composition was analyzed by an amino acid analyzer (reverse phase distribution method of Waters Co.). The tryptophan and cysteine were quantitatively determined according to the method of AS Inglis (Methods in Enzymology, vol. 91, p. 26, edited by CHW Hirs et al., Academic Press, 1983). The result is shown in Table 5.

The analytical values correspond well to the amino acid composition determined from the base sequence of the LT polypeptide-encoded DNA. Table 5 Amino acid composition of LT(II) Amino acid analysis values (mol) Amino acid composition obtained from the base sequence (mol)

(2) N-terminal amino acid sequence:

The N-terminal amino acid sequence was determined using the Edman method (P. Edman; Arch. Biochem. Biophys., 22, 475 (1949)).

LT(II) (ca. 100 µg) was reacted with phenylisothiocyanate by coupling reaction, and then the N-terminal amino acid was cleaved in the form of a 2-anilino-5-thiazolinone derivative, and was further converted into a phenylthiohydantoin amino acid. This was identified using HPLC (manufactured by Waters Co.) with a C18 reverse phase column to determine the N-terminal amino acid. This operation was repeated, and the amino acid sequence of the N-terminal part was thus determined. The obtained amino acid sequence of the N-terminal part of LT(II) was as follows:

Example 14 Expression of the LT gene in animal cells: (1) Preparation of cDNA fragment:

The LT13 strain obtained in the previous Example 3-(5) was incubated in an L medium to obtain grown bacteria. Plasmid DNA (pLT13) was isolated from the Bacteria and digested with restriction enzyme XhoII and subjected to 1.5% agarose gel electrophoresis to obtain a DNA fragment of about 940 bp in the same manner as in the previous Example 5-(1). This DNA fragment contains the 24th to 969th bases of the cDNA in Table 1.

The overlapping ends of this DNA fragment were converted into blunt ends using DNA polymerase I (Klenow fragment), and the fragment was recovered by phenol extraction and CIA extraction followed by ethanol precipitation. This DNA fragment was ligated with BamHI linker d(CGGATCCG) (manufactured by Takara Shuzo Co.), and thus the DNA was recovered by phenol/CIA extraction, CIA extraction followed by ethanol precipitation. This DNA was digested with restriction enzyme BamHI and subjected to 0.8% agarose gel electrophoresis to obtain DNA fragments of about 940 bp in the same manner as in Example 5-(1). They were thought to contain a DNA fragment with a BamHI linker-derived BamHI-cleaved end and a DNA fragment that did not.

(2) Preparation of the expression vector (pSV2-Ecogpt-MMTV-LTR) :

Cloning of MMTV-LTR was performed according to the method of J.E. Majors and H.E. Varmus (Science, 289, 253 (1981)) or the method of N. Fesel (EMBO J, 1, 3 (1982)).

First, a gene containing Ecogpt in the lambda phage was cloned as an EcoRI fragment of about 9 kb, and then the PstI fragment, which was a fragment of about 1.3 kb, was subcloned into the Pst site of pBR322. After subcloning, pBR322-MMTVLTR was partially digested with PstI and subjected to agarose gel electrophoresis to obtain the linear plasmid of about 6 kb in the usual manner. The plasmid thus obtained was subjected to S1 nuclease digestion, and its overlapping ends were converted to blunt ends, which were recovered by agarose gel electrophoresis. Then, the mixture was ligated with a BamHI linker and then completely digested with BamHI and PstI. Afterwards, fragments of about 1.3 kb were isolated and recovered by agarose gel electrophoresis. The fraction thus isolated is assumed to contain two types of DNA with an overlapping end of the PstI-BamHI.

pSV2-Ecogpt was constructed according to the method of RC Mulligan and P. Berg (Science, 209, 1422 (1980); Proc. Natl. Acad. Sci. USA, 78, 2072 (1981)). This plasmid contains a fragment of 2.3 kb containing the origin of replication from pBR322 and the Amp gene and early region promoter polyadenylation site from SV40 and a small antigen intron and the XGPRT gene from E. coli (Ecogpt). This pSV2-Ecogpt was partially digested with PstI and completely digested with BamHI and then subjected to gel electrophoresis to obtain a fragment of approximately 4.9 kb. This fragment and the above-mentioned MMTV-LTR-containing PstI-BamHI fragment were ligated in the usual manner and then transfected into HB101. These were selected under Amp condition to obtain the desired transformant. A plasmid was isolated from the transformant in the usual manner and digested with HindIII and SstI, and the resulting fragments were analyzed by agarose gel electrophoresis to obtain the desired plasmid pSV2-Ecogpt-MMTV-LTR, which was capable of forming fragments of about 4 kb and about 2.2 kb.

(3) Preparation of pSV2-MMTV-LTR with LT cDNA fragment:

The cDNA fragment obtained in step (3) was ligated with the pSV2-MMTV-LTR obtained in step (2) with the blunt ends of BamHI in the presence of DNA ligase from T4 phage-infected E. coli for transfection into E. coli HB101 strain. The bacteria were inoculated onto L-medium agar plates containing ampicillin to obtain 300 transformant colonies. From these, 20 colonies were randomly selected and these were preincubated in 1 ml of L-medium, glycerol was added and the thus incubated bacteria were kept at -20°C. Of these 20 basic strains, seven were inoculated into 10 ml of L-medium and incubated overnight at 37°C, and then the plasmids were recovered therefrom in the usual manner. As a result of 0.8% agarose gel electrophoresis, three colonies were found to contain the LT cDNA fragment. These plasmids were further digested with restriction enzyme EcoRI, and as a result, two clones containing an LT fragment normally inserted into the lower flux of MMTV LTR in the 5' to 3' direction and one clone containing the fragment in inserted in the reverse direction. The former plasmid was named pSV2-LT/MMTV-LTR. The step of forming the plasmid is shown in Fig. 7.

(4) Transfection of pSV2-LT/MMTV-LTR into Cos 1 cells and LT expression:

Transfection was performed using the DNA-calcium phosphate coprecipitation method as follows:

24 h before transfection, Cos 1 cells (0.5 x 106 cells/5 ml (MEM-10% FCS medium)) were placed in disposable Petri dishes with a diameter of 6 cm and incubated at 37ºC under a 5% (CO2)-95% (air) atmosphere. 4 h before transfection, the medium was changed and the cells were further incubated. Solution (A) (containing 500 µl of 2 x HBS (containing 10 g/L HEPES and 16 g/L NaCl pH 7.10) and 10 µl of 100 x PO₄ (containing an equivalent mixture of 70 mM Na₂HPO₄ and 70 mM NaH₂PO₄)) was prepared while supplying air, solution (B) containing 60 µl of 2 M CaCl₂ and 440 µl of carrier DNA (salmon sperm DNA)-containing aqueous plasmid solution with a final concentration of 20 µg/ml) was added dropwise, and the mixture was kept at room temperature for 20 min for coprecipitation, 500 µl of the coprecipitated deposit was added to the above-mentioned Cos 1 cell-incubated solution, and the cells were further incubated for 16 h at 37ºC under 5% (CO₂)-95% (air) atmosphere. The medium was exchanged and dexamethasone was added in a Final concentration of 1 x 10⁶ M was added, incubation was continued at 37°C under 5% (CO₂)-95% (air) for 24 and 48 hours. After incubation, the supernatants were collected respectively. In the present assay, use of the plasmid DNA-containing LT cDNA fragment in the normal direction in an amount of 2 µg, 1 µg and 200 ng for transfection gave a yield of LT activity of 5.5, 2.3 and 1.9 units/ml. On the other hand, use of the other plasmid DNA-containing fragment in the reverse direction showed no yield of LT activity. These results confirmed the expression of LT cDNA in animal cells.

Having fully described the invention, it will be apparent that many changes and modifications are possible for those skilled in the art without departing from the spirit and scope of the invention as set forth herein.

Claims (7)

1. Gene with the following base sequence wherein a portion of the base sequence encodes a polypeptide having lymphotoxin activity. 2. Gene according to claim 1, which is prepared from a messenger RNA which is isolated from a lymphotoxin-producing human T-cell hybridoma and is obtained in the 12.6S to 14.6S fractions by fractionation according to a sucrose density gradient centrifugation method. 3. A method for producing a gene according to claim 1, comprising: Incubation of lymphotoxin-producing T-cell hybridoma in a medium containing phorbol myristate acetate, concanavalin A or a mixture thereof for 24 hours, Fractionation of the obtained cells using a sucrose density gradient centrifugation method, Isolation of a messenger RNA in the 12.6S to 14.6S fractions and production of a gene from this messenger RNA. 4. Lymphotoxin with the following amino acid sequence (I): 5. DNA encoding a lymphotoxin having the amino acid sequence (I) of claim 4. 6. Lymphotoxin with the following amino acid sequence (II): 7. DNA encoding a lymphotoxin having the amino acid sequence (II) of claim 6.