DE202015009002U1 - Targeting of human PCSK9 for cholesterol treatment - Google Patents

Abstract

An antibody or antibody fragment for use in a method of reducing a cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering the antibody or fragment to a human, wherein the antibody or fragment is a proprotein. Convertase, subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising a mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1, and wherein the antibody or fragment is a human kappa A light chain constant region comprising an amino acid selected from the group consisting of a position 84 of SEQ ID NO: 50 corresponding Val and a position 87 of SEQ ID NO: 50 corresponding Cys, and wherein the human ( i) comprises an IGKC * 01 human kappa chain constant region gene segment, or human expresses antibodies that maintain the kappa light chain constant e regions comprising the amino acids Val, corresponding to position 84 of SEQ ID NO: 50, and Cys, corresponding to position 87 of SEQ ID NO: 50, and (ii) a nucleotide sequence comprising the proprotein convertase, subtilisin / Kexin type 9 (PCSK9) comprising a C-terminal domain comprising the mutation in SEQ ID NO: 1.

Description

TECHNICAL AREA

The technology described here relates to ligands, e.g. As antibodies, for the treatment of diseases.

BACKGROUND

It is known that individuals differ in their sequence, and more recently several individuals, for example James Watson and Craig Venter, have had their genome sequenced. In comparing the genome sequences of individuals, differences in their sequence were noted in both the coding and non-coding parts of the genome. Some of these variations in humans are significant and contribute to the phenotypic differences between individuals. In extreme cases, they lead to genetic diseases. The aim of the 1000 Genome Project is to catalog sequences in the human genome by sequencing the genomes of a very large number of individuals from different art recognized human ethnic populations.

The proprotein convertase subtilisin / kexin type 9 (Proprotein Convertase Subtilisin Kexin Type 9, PCSK9) is a serine protease involved in the regulation of LDLR (Low Density Lipoprotein Receptor) protein concentrations ( Horton et al., 2007; Seidah and Prat, 2007 ). In vitro experiments have shown that by adding PCSK9 to HepG2 cells, the levels of cell surface LDLR are lowered ( Benjannet et al., 2004 ; Lagace et al., 2006 ; Maxwell et al., 2005 ; Park et al., 2004 ). Experiments with mice have shown that increasing PCK protein levels reduces LDLR protein levels in the liver ( Benjannet et al., 2004 ; Lagace et al., 2006 ; Maxwell et al., 2005 ; Park et al., 2004 ), whereas PCSK9 knockout mice have elevated LDLR levels in the liver ( Rashid et al., 2005 ). In addition, several human PCSK9 mutations have been identified that result in either elevated or decreased LDL plasma levels ( Kotowski et al., 2006 ; Zhao et al., 2006 ). It has been shown that PCSK9 interacts directly with the LDLR protein, is endocytosed together with the LDLR, and is immunofluoresced with the LDLR along the endosomal pathway ( Lagace et al., 2006 ).

PCSK9 is a prohormone proprotein convertase from the subtilisin (S8) family of serine proteases ( Seidah et al., 2003 ). Humans have nine prohormone proprotein convertases that can be divided among the S8A and S8B subfamilies (Rawlings et al., 2006). furin , PC1 / PC3, PC2, PACE4, PC4, PC5 / PC6 and PC7 / PC8 / LPC / SPC7 are assigned to subfamily S8B. Crystal and NMR structures of different domains of murefurin and PC1 show subtilisin-like pro and catalytic domains and a P-domain directly C-terminal to the catalytic domain ( Henrich et al., 2003 ; Tangrea et al., 2002 ). Based on the amino acid sequence similarity in this subfamily, it is predicted that all seven members have similar structures ( Henrich et al., 2005 ). SKI-1 / S1P and PCSK9 are assigned to subfamily S8A. Sequence comparisons with these proteins also indicate the presence of subtilisin-like pro and catalytic domains ( Sakai et al., 1998 ; Seidah et al., 2003 ; Seidah et al., 1999 ). In these proteins, the amino acid sequence that is C-terminal to the catalytic domain is more variable and does not indicate the presence of a P-domain.

Prohormone proprotein convertases are expressed as zymogens and can mature through a multi-step process. The Prodomain has a dual function in this process. Initially, the prodomain acts as a chaperone and is required for proper folding of the catalytic domain ( Ikemura et al., 1987 ). After the catalytic domain is folded, auto-catalysis occurs between the prodomain and the catalytic domain. After this initial cleavage reaction, the prodomain remains attached to the catalytic domain, where it acts as an inhibitor of catalytic activity ( Fu et al., 2000 ). Under the right conditions, ripening will proceed with a second autocatalytic event at a site within the prod domain ( Anderson et al., 1997 ). After this second cleavage event has occurred, the prodomain and catalytic domain dissociate to give an active protease.

Autocatalysis of the PCSK9 zymogen occurs between Gln152 and Ser153 (VFAQ | SIP (SEQ ID NO: 67)) ( Naureckiene et al., 2003 ) and has been shown to be necessary for its secretion from cells ( Seidah et al., 2003 ). A second autocatalytic event at one site within the pro domain of PCSK9 was not observed. Purified PCSK9 consists of two species that can be separated by non-reducing SDS-PAGE: the prod domain at 17 Kd and the catalytic plus C-terminal domains at 65 Kd. PCSK9 was not isolated without its inhibitory prodomain, and measurements The catalytic activity of PCSK9 has given different results ( Naureckiene et al., 2003 ; Seidah et al., 2003 ).

In certain embodiments, a PCSK9 polypeptide includes, but is not limited to, terminal residues such as leader sequence residues, targeting residues, amino terminal methionine residues, lysine residues, tag residues, and / or fusion protein residues. "PCSK9" is also referred to as FH3, NARC1, HCHOLA3, proprotein convertase subtilisin / kexin type 9, and convertase 1 regulated by neural apoptosis. The PCSK9 gene codes for a proprotein convertase protein belonging to the proteinase K subfamily of the secretory subtilase family. The term "PCSK9" refers to both the proprotein and the product produced after autocatalysis of the proprotein. When referring only to the autocatalyzed product (such as an antigen-binding protein or ligand that binds to the cleaved PCSK9), the protein may be termed "mature,""split,""processed," or " denote active "PCSK9. When referring only to the inactive form, one may refer to the protein as "inactive,""pro-form," or "unprocessed" form of PCSK9. The term PCSK9 also includes PCSK9 molecules that include post translational modifications of the PCSK9 amino acid sequence, such as PCSK9 sequences that have been glycosylated, PCSK9 sequences from which the signal sequence has been cleaved, a PCSK9 sequence from which the prodomain of the but not separated from the catalytic domain (see e.g. 1A and 1B of the US20120093818A1 ).

SUMMARY

Using human genetic variation analysis and rationally designed sequence selection, the present invention provides improvements in the diagnosis and therapy of human patients based on variations in human PCSK9. It should be emphasized that the invention enables the development of customized drugs targeting individual genotypes or phenotypes of human patients.

The inventor's analysis of a large number of natural genomic human PCSK9 sequences shows that there is considerable variation between different human populations and makes it possible to correlate individual human patients with tailor-made, targeted medical and diagnostic approaches. The technical applications of these results according to the present invention thus contribute to better treatment, prophylaxis and diagnosis in humans and provide a benefit to the patient by providing personalized medications and therapies. This will provide benefits of better prescribing practice, less wasted medication and improved chances of drug efficacy and better patient diagnosis.

Further, the inventor has surprisingly discovered that some of the rarer natural forms, although much less common in humans than the conventional form, are nonetheless present in multiple and ethnically diverse human populations, usually with many human examples per reported ethnic population. The inventor has thus found that targeting such more rare forms would provide effective treatment, prophylaxis or diagnosis across many human ethnic populations, thereby enhancing the utility of the present invention and better serving patients in these populations.

Thus, the inventor has found that there are significant industrial and medical applications for the invention, which is the direction in the selection of an anti-PCSK9 ligand for administration to human patients for the therapy and / or prophylaxis of PCSK9-mediated or PCSK9-associated diseases and Suffering affects. In this way, the patient receives drugs and ligands that are tailored to his needs, due to the genetic or phenotypic composition of the patient. Along with this, the invention provides the genotyping and / or phenotyping of patients in connection with such treatment, thereby making it possible to find the appropriate drug for the patient. This increases the chances of medical efficacy, reduces the likelihood of poor treatment with drugs or ligands that are not personalized to the patient (eg, poor efficacy and / or side effects), and avoids pharmaceutical misconduct and waste.

For this purpose, the invention provides the following:

In a first configuration

An anti-human PCSK9 ligand for use in a method of treating and / or preventing a PCSK9 mediated disease or a PCSK9 mediated disease in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, which method comprises administering the ligand to a human.

In a second configuration

A ligand that binds a human PCSK9 that comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4-27 for use in a method comprising the step of using the ligand to target the PCSK9 in a human Treatment and / or prevention of a PCSK9-mediated disease or a PCSK9-mediated condition, which method comprises administering the ligand to a human.

In a third configuration

A pharmaceutical composition or a pharmaceutical kit for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease.

In a fourth configuration

A method of producing an anti-human PCSK9 antibody binding site, the method comprising recovering a plurality of anti-PCSK9 antibody binding sites, screening the antibody binding sites for binding to any of those of forms f, c, r, p, m, e, h, aj and q selected human PCSK9 or a catalytic or C-terminal domain or a peptide thereof, which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3 and isolating an antibody binding site that binds in the screening step and optionally producing a fragment or derivative of the isolated antibody that binds the form f, c, r, p, m, e, h, aj or q of the PCSK9.

In a fifth configuration

A method of producing an anti-human PCSK9 antibody, the method comprising immunizing a non-human vertebrate (e.g., a mouse or a rat) with a human PCSK9 having an amino acid sequence selected from the group consisting of amino acid sequences the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof, which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and isolating an antibody encoding a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3, and optionally producing a form f, c, r, p, m, e, h, aj or q the PCSK9 binding fragment or derivative of isolier antibody.

In a sixth configuration

A kit for PCSK9 genotyping of a human, said kit comprising a nucleic acid comprising (i) a sequence of consecutive nucleotides that specifically hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridizing with an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes with at least one nucleotide present in the selected sequence, but not in SEQ ID NO: 28, or hybridized with an antisense sequence or an RNA transcript thereof; and / or (ii) comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or comprises an antisense sequence or RNA version of these contiguous nucleotides, wherein the sequence of consecutive nucleotides comprises at least one Nucleotide present in the selected sequence but not present in SEQ ID NO: 28.

In a seventh configuration

Use of an anti-PCSK9 ligand which binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q in the manufacture of a medicament for the treatment and / or Prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.

In an eighth configuration

Use of an anti-PCSK9 ligand that binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q in the manufacture of a medicament for targeting PCSK9 in a human for the treatment and / or prevention of a PCSK9-mediated disease or a condition mediated by PCSK9.

In a ninth configuration

A method for targeting a PCSK9 for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition in a human, the method comprising administering to a human an anti-PCSK9 ligand having a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, being targeted to a coded by the nucleotide sequence PCSK9.

In a tenth configuration

A method of treating and / or preventing a PCSK9 mediated disease or a PCSK9 mediated disease in a human, the method comprising targeting a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e , h, aj, and q, by administering to humans a ligand that binds the PCSK9, thereby treating and / or preventing the disease or condition in humans.

In an eleventh configuration

A method of PCSK9 genotyping a human nucleic acid sample, the method comprising identifying the presence of a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof in the sample ,

In a twelfth configuration

A method of PCSK9-typing a human protein sample, the method comprising identifying the presence of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q in the sample ,

In a thirteenth configuration

A method for the treatment and / or prevention of cardiovascular disease or cardiovascular disease, or a disease or condition associated with elevated LDL cholesterol (e.g., hypercholesterolemia) in a human human patient, wherein the patient receives or has previously received statin treatment for the disease, the method comprising typing the patient using a method of the invention and administering a ligand of the invention, wherein the human is being treated or the disease or disease that suffering is prevented; optionally also reducing or stopping the statin treatment.

In a fourteenth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp which corresponds to position 204 of SEQ ID NO: 42, or a Leu which Position 206 of SEQ ID NO: 42, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain containing the mutation I474V, E670G, N4255 or Q619P (eg I474V or E670G) in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising a human heavy chain constant region IGHG1 * 01 gene segment, or the Human expressing antibodies comprising human gamma-1 constant regions comprising such Asp and Leu.

In a fifteenth configuration

A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) that has a C- comprising a terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp, position 204 of SEQ ID NO: 42, or a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the human (i) comprises a human heavy chain constant region IGHG1 * 01 gene segment or the human is expressing antibody comprising constant regions of the human heavy gamma-1 chain comprising such an Asp or Leu, and (ii) a nucleotide sequence coding for the Propr oteinconvertase subtilisin / kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.

In a sixteenth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody comprising a human gamma 2 heavy chain constant region comprising one amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val, position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a A C-terminal domain comprising the mutation I474V, E670G, N4255 or Q619P (eg I474V or E670G) in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising a human heavy chain constant region IGHG2 * 01 gene segment or human expressing antibodies comprising human gamma 2 constant regions comprising such Pro, Asn, Phe, Val and Ala include.

In a seventeenth configuration

A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) that has a C- comprising a terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human gamma 2 heavy chain constant region comprising one amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val, position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human (i) is a gene region of the constant region IGHG2 * 01 or human expressing antibodies comprising human gamma 2 heavy chain constant regions comprising such Pro, Asn, Phe, Val and Ala; and (ii) a nucleotide sequence specific for the proprotein convertase subtilisin / Kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.

In an eighteenth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a its needy human, wherein the antibody or fragment comprises a human kappa light chain constant region corresponding to a Val, position 84 of SEQ ID NO: 50, or a Cys, position 87 of SEQ ID NO: 50 and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation of I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising a human light chain constant region IGKC * 01 gene segment or the human expressing antibodies comprising human kappa light chain constant regions containing such Val and Cys include.

In a nineteenth configuration

A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) that has a C- comprising a terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, to said human, said antibody or fragment comprising a human kappa light chain constant region comprising a Val, position 84 of SEQ ID NO: 50, or a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the human (i) comprises a human light chain constant region IGKC * 01 gene segment or the human expresses antibodies comprising human kappa light chain constant regions comprising such a Val and Cys, and (ii) a nucleotide sequence coding for the proprotein con vertest subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1 comprises.

In a twentieth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01 and the antibody or the fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence encodes and comprises a human lambda light chain constant region IGLC2 * 01 gene segment, or human expresses antibodies comprising human lambda light chain constant region IGLC2 * 01 constant regions.

In a twenty-first configuration

A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) that has a C- comprising a terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human lambda light chain constant region IGLC2 * 01, and wherein human (i ) comprises a human light chain constant region IGLC2 * 01 gene segment, or human expressing antibodies comprising human lambda light chain constant region IGLC2 * 01 regions, and (ii) a nucleotide sequence coding for the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1, includes.

In a twenty-second configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human variable domain resulting from the recombination of a human VH gene segment , a human D gene segment and a human JH gene segment, wherein the VH gene segment is derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment is selected from the group consists of (i) IGHV1-18 * 01 and the human genome comprises a human IGHV1-18 * 01 nucleotide sequence or human Expressing antibodies comprising variable domains derived from the recombination of human IGHV1-18 * 01; or (ii) IGVH1-46 * 01 and the human genome comprises a human IGHV1-46 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGHV1-46 * 01, and the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence, which encodes the amino acid sequence and comprises the VH gene segment or expresses antibodies comprising VH domains derived from the recombination of the human VH gene segment, a human D gene segment and a human JH gene segment.

In a twenty-third configuration

A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) that has a C- comprising a terminal domain comprising a mutation I474 or E670G in SEQ ID NO: to a human, wherein (i) the antibody or fragment comprises a human variable domain resulting from the recombination of a human VH gene segment, a human VH gene segment human D gene segment and a human JH gene segment, wherein the VH gene segment is selected from the group consisting of (a) IGHV1-18 * 01 and the human genome comprises a human IGHV1-18 * 01 nucleotide sequence or human Expressing antibodies comprising variable domains derived from the recombination of human IGHV1-18 * 01; and (b) IGVH1-46 * 01 and the human genome comprises a human IGHV1-46 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGHV1-46 * 01, and wherein the human (ii) comprises a nucleotide sequence coding for the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1.

In a twenty-fourth configuration

A method for treating a PCSK9 mediated disease or a PCSK9 mediated disease in a human by targeting a PCSK9 comprising an amino acid polymorphism in the C-terminal domain (as compared to SEQ ID NO: 1), the method comprising administering a Human ligand (eg, an antibody or fragment) that has been found to specifically bind to a PCSK9 comprising a C-terminal domain comprising I474V or 670G (numbering as shown in SEQ ID NO: 1). 1); wherein the human expresses the PCSK9 or the human genome comprises a nucleotide sequence encoding the PCSK9; whereby the human being is treated against the illness or the suffering.

In a twenty-fifth configuration

• a. Durchführen einer ersten Behandlung des Menschen über einen ersten Behandlungszeitraum durch Verabreichung eines Anti-Human-PCSK9-Liganden (z. B. eines Antikörpers oder eines Fragments) an den Menschen, wobei (i) festgestellt wurde, dass der Ligand spezifisch an eine PCSK9 bindet, die eine C-terminale Domäne umfasst, die I474V oder 670G umfasst (Nummerierung gemäß SEQ ID NO: 1); (ii) der Mensch die PCSK9 exprimiert oder das Genom des Menschen eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, und (iii) der Mensch eine Statinbehandlung zum Absenken oder Aufrechterhalten des Cholesterinspiegels erhält oder erhalten hat; wobei die erste Behandlung die Verabreichung einer einzelnen oder mehrerer Dosen des Liganden an den Menschen umfasst;
• b. Entscheiden, (i) die Statinbehandlung zu beenden, (ii) den Menschen nicht mit Statinen zu behandeln; oder (iii) die Statinbehandlung nach der ersten Behandlungsperiode zu reduzieren; und
• c. Fortsetzen der Verabreichung des Liganden an den Patienten nach dem Ablauf der Zeitperiode, wodurch der Cholesterinspiegel angesenkt oder ein zuvor abgesenkter Cholesterinspiegel in dem Menschen aufrechterhalten wird.

A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a person in need thereof, the method comprising:

• a. Performing a first human treatment for a first treatment period by administering to a human an anti-human PCSK9 ligand (eg, an antibody or a fragment), (i) determining that the ligand specifically binds to a PCSK9 comprising a C-terminal domain comprising I474V or 670G (numbering according to SEQ ID NO: 1); (ii) the human expressing PCSK9 or the human genome comprises a nucleotide sequence encoding the PCSK9, and (iii) the human receives or has received a statin treatment to lower or maintain the cholesterol level; wherein the first treatment comprises administering to the human a single or multiple doses of the ligand;
• b. Decide (i) to stop statin treatment, (ii) not to treat humans with statins; or (iii) to reduce statin treatment after the first treatment period; and
• c. Continuing the administration of the ligand to the patient after the lapse of the time period whereby the cholesterol level is lowered or a previously lowered cholesterol level in the human is maintained.

In a twenty-sixth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human heavy (eg gamma) chain constant region which comprises a first amino acid derived from a gene segment SNP is encoded for a constant region of a human heavy (eg, gamma) chain, and the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain, the a mutation I474V, E670G, N4255 or Q619P (eg I474V or E670G) in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the PCSK9 amino acid sequence, and a SNP-comprising gene segment for a constant Human heavy (eg gamma) chain or human expressing antibodies comprising human constant (eg gamma) regions comprising the first amino acid.

In a twenty-seventh configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment is a human light (e.g., kappa or lambda) constant region ) Chain comprising a first amino acid encoded by a gene segment SNP for a human light (eg kappa or lambda) chain constant region, and the antibody or fragment specifically a proprotein convertase subtilisin / Kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the PCSK9 amino acid sequence comprises the SNP gene segment for a human light (eg kappa or lambda) chain constant region, or human antibody he expressed, the human constant (z. Kappa or lambda) regions comprising the first amino acid.

In a twenty-eighth configuration

An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human variable (e.g., VH, Vκ, or Vλ). ) Domain comprising a first amino acid encoded by a V (eg VH, Vκ or Vλ) gene segment SNP and the antibody or fragment specifically a proprotein convertase subtilisin / kexin Type 9 (PCSK9) amino acid sequence which comprises a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the PCSK9 amino acid sequence and an SNP or human expressing antibodies comprising V (e.g., VH, Vκ, and Vλ) domains, respectively, which comprises the first Include amino acid.

BRIEF DESCRIPTION OF THE DRAWINGS

1 shows a computer model of PCSK9 surface residue variants.

2 Figure 10 shows the cumulative allele frequency distribution across the database of the 1000 Genome Project of human VH3-23 alleles comprising SNP rs56069819 (where such alleles are referred to as "C" and the most abundant allele (not including this SNP) as "A" referred to as).

3 shows skeletons and CDRs encoded by VH3-23 * 04 obtained from the IMGT database (available from the World Wide Web at www.IMGT.org). 3 discloses the nucleotide sequences as SEQ ID NOS 69, 69, 69, 71, 71, 71, 72, 74, 76, 39 and 77, respectively, in order of appearance. 3 discloses the encoded amino acid sequences as SEQ ID NOS 70, 70, 70, 70, 70, 70, 73, 75, 75, 38 and 78, respectively, in order of appearance.

4 shows sequences of VH3-23 * 04. The section of VH3-23 * 04 comprising the change of the FW1 residue of rs56069819 is shown (SEQ ID NO: 38). The portion of the nucleic acid sequence encoding rs56069819 is shown (SEQ ID NO: 39). The FW1 encoded by VH3-23 * 04 is shown (SEQ ID NO: 40).

DETAILED DESCRIPTION

It will be appreciated by those skilled in the art that SNPs or other alterations that are translated into amino acid variations may result in conformation or activity variability in the human targets to be targeted. This has led to a great deal of interest in personalized medicine in helping one to more efficiently adapt medication and diagnoses to patients genotyping and knowledge of protein and nucleotide variability. The present invention provides tailored pharmaceuticals and assays that specifically address more rare forms of a human target of interest (TOI), the target being human PCSK9.

The present invention harnesses the power of human genetic variation analysis and rationally designed sequence selection.

The technical applications of these approaches according to the present invention contribute to better treatment, prophylaxis and diagnosis in humans and provide a benefit to the patient by providing alternatives and enabling personalized medications and therapies. This will provide benefits of better prescribing practice, less wasted medication and improved chances of drug efficacy and better patient diagnosis.

• 1. HapMap ( The International HapMap Consortium. 2003; http://hapmap.ncbi.nlm.nih.gov/index.html.en ). Das HapMap Project ist ein internationales Projekt, dessen Ziel es ist, die genetischen Sequenzen verschiedener Individuen zum Identifizieren chromosomaler Regionen mit gemeinsamen genetischen Varianten miteinander zu vergleichen. Die HapMap-www-Website stellt Werkzeuge zum Identifizieren chromosomaler Regionen und der Varianten darin bereit, wobei die Möglichkeit besteht, Häufigkeitsdaten auf dem Populationsniveau gründlich zu recherchieren.
• 2. 1000 Genomes Project ( The 1000 Genomes Project Consortium 2010; verfügbar im World Wide Web unter http://www.1000genomes.org/ ). Diese Quelle stellt vollständige genomische Sequenzen von wenigstens 2500 nicht identifizierten Individuen aus einer von 25 unterschiedlichen Bevölkerungsgruppen bereit.
• 3. Japanese SNP Database ( H. Haga et al. 2002; verfügbar im World Wide Web unter http://snp.ims.u-tokyo.ac.jp/index.html ). Basiert auf einer Studie, in der 190.562 humane genetische Varianten identifiziert wurden.

As sources of genomic sequence variation data, those skilled in the art will be aware of the available databases and sources (including updates thereof) provided by the following:

• 1. HapMap ( The International HapMap Consortium. 2003; http://hapmap.ncbi.nlm.nih.gov/index.html.en ). The HapMap Project is an international project whose goal is to compare the genetic sequences of different individuals to identify chromosomal regions with common genetic variants. The HapMap www website provides tools for identifying chromosomal regions and variants therein, with the ability to thoroughly search frequency data at the population level.
• 2. 1000 Genomes Project ( The 1000 Genomes Project Consortium 2010; Available on the World Wide Web at http://www.1000genomes.org/ ). This source provides complete genomic sequences of at least 2,500 unidentified individuals from one of 25 different population groups.
• 3. Japanese SNP Database ( H. Haga et al. 2002; available on the World Wide Web at http://snp.ims.u-tokyo.ac.jp/index.html ). Based on a study identifying 190,562 human genetic variants.

Inter alia, the present invention is concerned with the identification and cataloging of naturally occurring human genomic target sequence variants, including the variants that are found at relatively low frequencies, or are rare, that one encounters in isolation in particular human ethnic populations and many individuals.

One aspect of the invention is based on a rationally designed sequence selection, with the desirability of adapting drugs and diagnostics to rarer, but still significant, groups of human individuals suffering from a disease or disease mediated by the target of interest or who are likely to suffer from it (ie where such a risk exists). In designing this rational concept of the present aspect of the invention, the inventor has considered the range of frequencies of naturally occurring target sequence variants across several different human ethnic populations, as well as the importance of responding to such populations where many individuals are likely to have a genotype and / or phenotype one or more of the variants analyzed, with. As part of this concept, the inventor considered it important to adopt the art recognized classification of human ethnic populations, and in this regard, the inventor based the analysis and concept on the recognized human ethnic populations adopted by the 1000 Genomes Project because it is a source that has been widely accepted by the scientific and medical community and is becoming more so.

2 Figure 10 shows the cumulative allele frequency distribution across the database of the 1000 Genome Project of human VH3-23 alleles comprising SNP rs56069819 (where such alleles are referred to as "C" and the most abundant allele (not including this SNP) as "A" referred to as). The figure shows that the VH3-23 alleles comprising SNP rs56069819 occur at a cumulative frequency of 11% across all human ethnic populations taken together, while in certain specific human ethnic subpopulations (ASW, LWK, YRI, CEU and GBR) such alleles with an above-average cumulative frequency occur. Shown in the figure are the variant forms of human PCSK9 (designated as "variants") found in various subpopulations with above-average occurrence of human VH3-23 alleles with SNP rs56069819.

In accordance with this aspect of the invention, the inventor designed the following sequence variant selection criteria, which are criteria that the inventor has determined to provide valuable drugs and diagnostics tailored to the needs of the human population.

selection criteria

• • natürlich vorkommende humane PCSK9-Sequenzvarianten mit einer kumulativen humanen Allelhäufigkeit von 35% oder weniger;
• • natürlich vorkommende humane PCSK9-Sequenzvarianten mit einer humanen Genotypgesamthäufigkeit von 40% oder weniger;
• • natürlich vorkommende humane PCSK9-Sequenzvarianten, die sich in vielen verschiedenen humanen ethnischen Populationen finden (unter Anwendung der Standardkategorisierung des 1000 Genomes Project; siehe Tabelle 4 unten); und
• • natürlich vorkommende humane PCSK9-Sequenzvarianten, die sich in vielen Individuen verteilt über solche vielen verschiedenen ethnischen Populationen finden.

Three or four of the following:

• Naturally occurring human PCSK9 sequence variants with a cumulative human allele frequency of 35% or less;
• • naturally occurring human PCSK9 sequence variants with a total human genome frequency of 40% or less;
• • naturally occurring human PCSK9 sequence variants found in many different human ethnic populations (using the standard categorization of the 1000 Genome Project, see Table 4 below); and
• • naturally occurring human PCSK9 sequence variants found in many individuals distributed across such many different ethnic populations.

The inventor's selection included, as a consideration, the selection of nucleotide variation that resulted in amino acid variations in the corresponding PCSK9 forms (i.e., non-synonymous variations) as opposed to silent variations in which the amino acid residues in the target protein did not change.

If necessary, you can also use further sequence analyzes and 3D computer models (see eg 1 Variants whose amino acid residue variants (as compared to the most common form of human PCSK9) are surface exposed on the target are desirable for selection, as the inventor has recognized that these contribute to the determination of the topography on the target, and possibly contribute to how and where ligand binding occurs on the target.

In one embodiment, the cumulative human allele frequency is 30, 25, 20, 15, 10 or 5% or less, e.g. In the range of 1 to 20% or 1 to 15% or 1 to 10%.

In one embodiment, the total human genotype is 35, 30, 25, 20, 15, 10 or 5% or less, e.g. In the range of 1 to 25%, 1 to 20%, 1 to 15%, 1 to about 15%, 1 to 10%, 1 to about 10% or 1 to 5% or 1 to about 5%.

In one embodiment, the naturally occurring human target sequence variants are found in at least 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 different human ethnic populations (using the standard categorization of the 1000 Genome Project).

In one embodiment, the naturally occurring human target sequence variants are found in at least 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 130, 140 or 150 individuals spread across such many different ethnic populations.

• • natürlich vorkommende humane PCSK9-Sequenzvarianten mit einer kumulativen humanen Allelhäufigkeit von 15% oder weniger;
• • natürlich vorkommende humane PCSK9-Sequenzvarianten mit einer humanen Genotypgesamthäufigkeit von 20% oder weniger;
• • natürlich vorkommende humane PCSK9-Sequenzvarianten, die sich in wenigstens 5 verschiedenen humanen ethnischen Populationen finden (unter Anwendung der Standardkategorisierung des 1000 Genomes Project); und
• • natürlich vorkommende humane PCSK9-Sequenzvarianten, die sich in vielen Individuen verteilt über solche vielen verschiedenen ethnischen Populationen finden.

An example uses the following criteria:

• • naturally occurring human PCSK9 sequence variants with a cumulative human allele frequency of 15% or less;
• • naturally occurring human PCSK9 sequence variants with a total human genome frequency of 20% or less;
• • naturally occurring human PCSK9 sequence variants found in at least 5 different human ethnic populations (using the standard categorization of the 1000 Genome Project); and
• • naturally occurring human PCSK9 sequence variants found in many individuals distributed across such many different ethnic populations.

According to any aspect, configuration, example, embodiment, clause, or concept, frequencies may be determined using bioinformatics.

In accordance with any aspect, configuration, example, embodiment, clause, or concept, frequencies may be determined with reference to a database having at least 1000 or 2000 human sequences.

According to any aspect, configuration, example, embodiment, clause, or concept, "heterozygous human genotyping" herein means the cumulative frequency of all genotypes in the sample or database or in humans where the rare allelic variant once occurs and another allele occurs once (heterozygous state), z. B. Genotype in the 1000 Genomes Database.

According to any aspect, configuration, example, embodiment, clause, or concept, "homozygous human genotype frequency" herein means the cumulative frequency of two occurrences of the allelic variant (homozygous state), e.g. B. Genotype in the 1000 Genomes Project Database.

According to any aspect, configuration, example, embodiment, clause, or concept, "total human genotype" herein means the total abundance of heterozygous plus homozygous human genotypes.

According to any aspect, configuration, example, embodiment, clause, or concept, "cumulative human allele frequency" here means the total number of alleles of the allelic variant in the sample or database or in humans, e.g. In the 1000 Genomes Project database.

In one example, the criteria are applied to one or more human genomic sequence databases as described herein. For example, the criteria are those as applied to the 1000 Genomes database.

For example, in any aspect, example, embodiment, or configuration of the invention, the 1000 Genomes database is version 13. For example, the 1000 Genomes database in its most recent version, as of October 1, 2013.

• (a) Identifizieren einer genomischen Region mit einer interessierenden PCSK9-Targetsequenz ('genomische Targetregion') und Berechnen der genomischen Koordinaten unter Anwendung von Koordinaten, die der Sequenz-Assembly entsprechen, die entweder unter Verwendung des 1000 Genomes Projekts oder des International HapMap Projekts (oder einer anderen ausgewählten humanen Gendatenbank erster Wahl) erstellt wurde.
• (b) Identifizieren genomischer Varianten, die sich auf der Karte der zuvor in (a) identifizierten genomischen Region befinden. Abrufen der Allelhäufigkeiten für Varianten für jede Superpopulation und vorzugsweise Unterpopulation, wenn solche Daten verfügbar sind. Für diesen Schritt kann man sich des VWC-Tools für das 1000 Genomes Project bedienen.
• (c) Durchfiltern der Liste genomischer Varianten aus einer genomischen Targetregion, so dass sie nur Varianten enthält, die entweder als 'nicht synonyme' Einzelnukleotid-Polymorphismen (Single Nucleotide Polymorphisms, SNPs) oder genomische 'Insertionen oder Deletionen (Indels) klassifiziert werden. Weiteres Durchfiltern, so dass sie nur die einschließt, die in exonischen Sequenzen vorhanden sind. ”Nicht synonym” bezieht sich auf eine Nukleotidvariation, die zu einer Aminosäurevariation führt (d. h. ausschließlich stummen Mutationen).
• (d) Korrelieren der Populationshäufigkeitsdaten jeder der identifizierten Varianten für jede der Superpopulationen (zum Beispiel 'europäischer Abstammung', 'ostasiatischer Abstammung', 'westafrikanischer Abstammung', 'Amerika' und 'südasiatischer Abstammung') zum Identifizieren der Varianten, die mit weniger als zwei Superpopulationen segregieren. Ferner Korrelieren aller identifizierten Varianten mit jeder der Unterpopulationen (so könnte zum Beispiel die Superpopulation 'europäischer Abstammung' in Gruppen wie 'CEU – Einwohner von Utah mit nord- oder westeuropäischer Abstammung', 'TSI Toskana in Italien' und 'Britisch aus England und Schottland' unterteilt werden) und Erstellen einer zweiten Bewertung der Seltenheit von Varianten innerhalb einer Superpopulation.
• (e) Sammeln einer oder mehrerer Sequenzen, die auf spezielle Unterpopulationen beschränkt sind, zur Verwendung in der vorliegenden Erfindung, z. B. gemäß den wie hier beschriebenen Auswahlkriterien.

The following bioinformatics protocol should allow human sequences to be identified for use in the present invention:

• (a) identifying a genomic region having a PCSK9 target genome of interest ('genomic target region') and computing the genomic coordinates using coordinates corresponding to the sequence assembly generated using either the 1000 Genome Project or the International HapMap Project ( or any other selected human gene database of first choice).
• (b) identifying genomic variants that are on the map of the genomic region previously identified in (a). Retrieving allele frequencies for variants for each superpopulation, and preferably subpopulation if such data is available. For this step you can use the VWC tool for the 1000 Genomes Project.
• (c) filtering the list of genomic variants from a genomic target region so that it contains only variants that are classified as either 'non-synonymous' single nucleotide polymorphisms (SNPs) or genomic insertions or deletions (indels). Further filtering so that it includes only those present in exonic sequences. "Non-synonymous" refers to a nucleotide variation that results in an amino acid variation (ie, only silent mutations).
• (d) correlating the population frequency data of each of the identified variants for each of the superpopulations (e.g., 'European descent', 'East Asian descent', 'West African descent', 'Americas' and 'South Asian descent') to identify variants associated with fewer than segregate two superpopulations. Furthermore, correlating all identified variants with each of the subpopulations (for example, the superpopulation of 'European descent' could be grouped into groups such as 'CEU - Residents of Northern or Western European Descent', 'TSI Tuscany in Italy' and 'British from England and Scotland' and make a second assessment of the rarity of variants within a superpopulation.
• (e) collecting one or more sequences restricted to specific subpopulations for use in the present invention, e.g. B. according to the selection criteria as described herein.

Human populations

The ethnic populations may be selected from those identified in the 1000 Genomes Project database. In this regard, see Table 4, which gives more detail on the ethnic populations on which the 1000 Genomes Project database is based.

NA Rosenberg et al (Science December 20, 2002: Vol. 298 No. 5602 2342-2343) studied the genetic structure of human populations of different geographical origins. In total, samples from 52 populations were examined, these being populations with:
of African descent
(Mbuti pygmies, Biaka pygmies, San peoples and speakers of the Niger Kordofanian languages (Bantu, Yoruba and Mandenka populations),
of Eurasian descent
(of European descent (Orcadians, Adygians, Basques, French, Russians, Italians, Sardinians, Tuscans),
Middle Eastern descent (Mozabites, Bedouins, Druzes, Palestinians), Central / South Asian descent (Balochl, Brahul, Makrani, Sindhi, Pathan, Burusho, Hazara, Uygur, Kalash)),
East Asian descent
(Han, Dal, Daur, Hezhen, Lahu, Miao, Oroqen, She, Tujia, Tu, Xibo, Yi, Mongols, Naxi, Cambodians, Japanese, Yakuts) of oceanic descent (Melanesian, Papuan); or
American descent
(Karitiana, Surui, Kolombian, Maya, Pima).

In The International HapMap Project, Nature, Dec. 18, 2003; 426 (6968): 789-96 , the goal of the HapMap project is disclosed: determining the common patterns of DNA sequence variations in the human genome by determining the genotypes of one million or more sequence variants, their abundance and the extent of association between them in DNA samples from ancestral populations Sharing Africa, Asia and Europe. The relevant human populations of different geographical origins include Yoruba, Japanese, Chinese, Northern and Western European populations. More precisely:

Utah population of North or West European descent (samples collected in 1980 by the Center d'Etude du Polymorphisme Humain (CEPH));
Population of the Yoruba from Ibadan, Nigeria;
Population with Japanese ancestry; and
Population of Han Chinese origin from China.

The authors point out, based on earlier publications, that pedigree geography is a reasonable basis for sampling from human populations.

• (a) Europäische Abstammung
• (b) nordeuropäische Abstammung; westeuropäische Abstammung; toskanische Abstammung; britische Abstammung; finnische Abstammung oder iberische Abstammung.
• (c) Genauer gesagt die Population der Bewohner von Utah mit nord- und/oder westeuropäischer Abstammung; die Toskana-Population in Italien; die britische Population in England und/oder Schottland; die finnische Population in Finnland; oder die iberische Population in Spanien.
• (a) Ostasiatische Abstammung
• (b) japanische Abstammung; chinesische Abstammung oder vietnamesische Abstammung.
• (c) Genauer gesagt die japanische Population in Toyko, Japan; die Population der Han-Chinesen in Peking, China; die chinesische Dai-Population in Xishuangbanna; die Kinh-Population in Ho-Chi-Minh-Stadt, Vietnam; oder die chinesische Population in Denver, Colorado, USA.
• (a) Westafrikanische Abstammung
• (b) Yoruba-Abstammung; Luhya-Abstammung; gambische Abstammung; oder malawische Abstammung.
• (c) Genauer gesagt die Yoruba-Population in Ibadan, Nigeria; die Luhya-Population in Webuye, Kenya; die gambische Population in der Western Division, Gambia; oder die malawische Population in Blantyre, Malawi.
• (a) Population des amerikanischen Doppelkontinents
• (b) uramerikanische Abstammung; afrokaribische Abstammung; mexikanische Abstammung; puertorikanische Abstammung; kolumbianische Abstammung; oder peruanische Abstammung.
• (c) Genauer gesagt die Population afrikanischer Abstammung im Südwesten der USA; die afroamerikanische Population in Jackson, MS; die afrokaribische Population in Barbados; die Population mexikanischer Abstammung in Los Angeles, CA; die puertorikanische Population in Puerto Rico; die kolumbianische Population in Medellin, Kolumbien; oder die peruanische Population in Lima, Peru.
• (a) Südasiatische Abstammung
• (b) Ahom-Abstammung; Kayadtha-Abstammung; Reddy-Abstammung; Maratha; oder Punjabi-Abstammung.
• (c) Genauer gesagt die Ahom-Population im Staat Assam, Indien; die Kayadtha-Population in Kalkutta, Indien; die Reddy-Population in Hyderabad, Indien; die Maratha-Population in Bombay, Indien; oder die Punjabi-Population in Lahore, Pakistan.

An appropriate sample of human populations used in the present invention is as follows:

• (a) European descent
• (b) Northern European descent; Western European descent; Tuscan descent; British descent; Finnish descent or Iberian descent.
• (c) Specifically, the population of the inhabitants of Utah of North and / or West European descent; the Tuscany population in Italy; the British population in England and / or Scotland; the Finnish population in Finland; or the Iberian population in Spain.
• (a) East Asian descent
• (b) Japanese descent; Chinese descent or Vietnamese descent.
• (c) More specifically, the Japanese population in Toyko, Japan; the Han Chinese population in Beijing, China; the Chinese Dai population in Xishuangbanna; the Kinh population in Ho Chi Minh City, Vietnam; or the Chinese population in Denver, Colorado, USA.
• (a) West African descent
• (b) Yoruba descent; Luhya descent; Gambian descent; or Malawian descent.
• (c) Specifically, the Yoruba population in Ibadan, Nigeria; the Luhya population in Webuye, Kenya; the Gambian population in the Western Division, Gambia; or the Malawian population in Blantyre, Malawi.
• (a) Population of the American double continent
• (b) American descent; Afro-Caribbean descent; Mexican descent; Puerto Rican descent; Columbian descent; or Peruvian descent.
• (c) Specifically, the population of African descent in the southwestern United States; the African American population in Jackson, MS; the Afro-Caribbean population in Barbados; the population of Mexican descent in Los Angeles, CA; the Puerto Rican population in Puerto Rico; the Colombian population in Medellin, Colombia; or the Peruvian population in Lima, Peru.
• (a) South Asian descent
• (b) Ahom lineage; Kayadtha lineage; Reddy lineage; Maratha; or Punjabi descent.
• (c) More specifically, the Ahom population in the state of Assam, India; the Kayadtha population in Calcutta, India; the Reddy population in Hyderabad, India; the Maratha population in Bombay, India; or the Punjabi population in Lahore, Pakistan.

In any configuration of the invention, in one embodiment, the human population is selected from a form marked "(a)" above.

In an arbitrary configuration of the invention, in another embodiment, each human population is selected from a form marked "(b)" above.

In an arbitrary configuration of the invention, in another embodiment, each human population is selected from a form marked "(c)" above.

In one embodiment, the ethnic populations are selected from the group consisting of an ethnic population of European descent, an ethnic population of East Asian, an ethnic population of West African descent, an ethnic population of American descent and an ethnic population of South Asian descent.

In one embodiment, the ethnic populations are selected from the group consisting of an ethnic population of northern European descent; or an ethnic population of Western European descent; or an ethnic population of Tuscan descent; or an ethnic population of British descent; or an ethnic population of Icelandic descent; or an ethnic population of Finnish descent; or an ethnic population of Iberian descent; or an ethnic population of Japanese descent; or an ethnic population of Chinese descent; or an ethnic population of Vietnamese descent; or an ethnic population of Yoruba descent; or an ethnic population of Luhya descent; or an ethnic population of Gambian descent; or an ethnic population of Malawian descent; or an ethnic population of native American descent; or an ethnic population of Afro-Caribbean descent; or an ethnic population of Mexican descent; or an ethnic population of Puerto Rican descent; or an ethnic population of Colombian descent; or an ethnic population of Peruvian descent; or an ethnic population with Ahom ancestry; or an ethnic population with kayadtha lineage; or an ethnic population with Reddy descent; or an ethnic population with maratha; or an ethnic population of Punjabi descent.

Anti-targeting ligand

The invention provides valuable anti-target ligands to humans who are afflicted with or at risk of such disease or condition as mediated by or associated with PCSK9. For example, the ligand specifically binds to a PCSK9 variant as in the invention. The ligand may inhibit or antagonize the activity of the PCSK9 target; z. For example, the ligand can neutralize the target. One skilled in the art will be familiar with neutralizing ligands in general, such as antibodies or antibody fragments, and will be able to easily test suitable ligands for specific binding and / or neutralizing a target in vitro or in an in vivo assay.

In one example, the ligand is (or was determined to be) a PCSK9 neutralizing substance. In one example, the determination is in a human (eg, in a clinical trial). In one example, the determination is in a non-human animal, e.g. In a mouse, a rat, a rabbit, a pig, a dog, a sheep, or a non-human primate (e.g., a cynomolgus monkey, a rhesus monkey, or a baboon).

An antibody "fragment" comprises a portion of an intact antibody, preferably the antigen binding and / or the variable region of the intact antibody. Examples of antibody fragments include dAb, Fab, Fab ', F (ab') 2 and Fv fragments; diabodies; linear antibodies; Single chain antibody molecules and multispecific antibodies formed from antibody fragments.

According to one embodiment, the ligand according to the invention is or comprises an antibody or an antibody fragment, for example an antibody or antibody fragment, which comprises human variable regions (and optionally also human constant regions). Anti-PCSK9 or PCSK9-binding or PCSK9-targeting antibodies and fragments can be prepared by any known method, e.g. Using transgenic mice (eg the Kymouse ^™ or Velocimouse ^™ , or Omnimouse ^™ , Xenomouse ^™ , HuMab Mouse ^™ or MeMo Mouse ^™ ), rats (eg the Omnirat ^™ ), camelids, sharks, Rabbits, chickens or other non-human animals immunized with PCSK9, optionally followed by humanization of the constant regions and / or the variable regions to produce human or humanized antibodies. In one example, one can use display technologies, such as yeast, phage or ribosome display, as will be known to those skilled in the art. Standard affinity maturation, e.g. Example, using display technology, can be carried out in a further step after isolating an antibody motif from a transgenic animal, a phage display library or other library. Representative examples of suitable technologies are in the US20120093818 (Amgen, Inc), which are hereby incorporated by reference in their entirety, for. B. the methods described in paragraphs [0309] to [0346], by reference is part of the present application.

In general, one can provoke a VELOCIMMUNE ^™ or other mouse with the antigen of interest and obtain from the mouse antibody-expressing lymphoid cells (such as B cells). The lymphoid cells can be fused with a myeloma cell line to obtain immortal hybridoma cell lines, and such hybridoma cell lines are screened and selected to obtain hybridoma cell lines that produce specific antibodies against the antigen of interest. One can isolate DNA encoding the heavy chain and light chain variable regions and link them to desired isotypic heavy and light chain constant regions. Such an antibody protein can be produced in a cell such as a CHO cell. Alternatively, one can isolate DNA encoding the antigen-specific chimeric antibodies or the light and heavy chain variable domains directly from antigen-specific lymphocytes.

First, high affinity chimeric antibodies having a human variable region and a mouse constant region are isolated. As described below, the antibodies are characterized and selected for desirable characteristics including affinity, selectivity, epitope, etc. The murine constant regions are replaced with a desired human constant region to yield the fully human antibody of the invention, for example, wild-type or modified IgG1 or IgG4 (for example, SEQ ID NO: 751, 752, 753 in US2011 / 0065902 (incorporated herein by reference in its entirety), the sequences of which are incorporated herein by reference for use in the ligands of the present invention). While the chosen constant region may vary depending on the specific application, the high affinity antigen binding and the target specificity reside in the variable region.

In one example, the ligand of the invention is or comprises a nucleic acid, e.g. B. RNA, z. B. siRNA which hybridizes under stringent conditions with the PCSK9 sequence variant, z. G., Hybridized to a nucleotide sequence comprising one or more nucleotides, which are variants (as compared to the most abundant PCSK9 sequence, eg, in relation to the 1000 Genomes Project database).

For example, the nucleic acid hybridizes to a region that is immediately adjacent to a nucleotide that is variant to the corresponding nucleotide of the PCSK9 nucleotide sequence having the highest cumulative human allele frequency and / or the highest human genotype total frequency. In one example, the nucleic acid hybridizes to two or more of such nucleotide variants.

Specific hybridization occurs under stringent conditions, which will be known to those skilled in the art, e.g. B. Conditions of 5x SSC, 5x Denhardt's reagent and 0.5% SDS at 65 ° C.

Target binding ability, specificity and affinity (Kd, K _off and / or K _on ) can be determined by any routine method known in the art, e.g. B. by surface plasmon resonance (Surface Plasmon Resonance, SPR). The term "Kd" as used herein is intended to refer to the equilibrium dissociation constant of a particular antibody-antigen interaction.

In one embodiment, surface plasmon resonance (SPR) is performed at 25 ° C. In another embodiment, the SPR is performed at 37 ° C.

In one embodiment, the SPR is performed at a physiological pH, such as pH 7, or at pH 7.6 (eg, using Hepes buffered saline at pH 7.6 (also referred to as HBS-EP)).

According to one embodiment, the SPR is at a physiological salt concentration, z. B. 150 mM NaCl performed.

In one embodiment, the SPR is at a surfactant concentration of not more than 0.05 vol .-%, z. In the presence of P20 (polysorbate 20, eg Tween-20 ^™ ) at 0.05% and 3 mM EDTA.

In one example, the SPR is performed at 25 ° C or 37 ° C in a buffer at pH 7.6, 150 mM NaCl, 0.05% surfactant (eg P20) and 3 mM EDTA. The buffer may contain 10 mM Hepes. In one example, the SPR is performed at 25 ° C or 37 ° C in HBS-EP. HBS-EP is available from Teknova Inc (California, catalog number H8022).

• 1. Kuppeln von Anti-Maus-(oder einer anderen relevanten konstanten Region eines Antikörpers eines Menschen, einer Ratte oder eines nicht menschlichen Wirbeltieres artabgestimmt)IgG (z. B. Biacore^TM BR-1008-38) an einen Biosensor-Chip (z. B. GLM-Chip) wie z. B. durch primäre Aminkupplung;
• 2. Exponieren des Anti-Maus-IgG (bzw. des anderen artabgestimmten Antikörpers) gegenüber einem Test-IgG-Antikörper zum Einfangen von Testantikörper auf dem Chip;
• 3. Leiten des Testantigens über die Einfangoberfläche des Chips in einer Konzentration von 1024 nM, 256 nM, 64 nM, 16 nM, 4 nM mit einem 0 nM (d. h. nur Puffer); und
• 4. Bestimmen der Bindungsaffinität des Testantikörpers zum Testen des Antigens durch Oberflächenplasmonresonanz, z. B. unter einer der oben diskutierten SPR-Bedingungen (z. B. bei 25°C in physiologischem Puffer). Die SPR kann unter Verwendung eines beliebigen Standard-SPR-Geräts wie von Biacore^TM oder unter Verwendung des ProteOn XPR36^TM (Bio-Rad^®) durchgeführt werden.

In one example, the affinity of the ligand (eg, antibody) is determined using SPR

• 1. Coupling of anti-mouse (or other relevant constant region of an antibody of a human, rat, or non-human vertebrate species-matched) IgG (e.g., Biacore ^™ BR-1008-38) to a biosensor chip (e.g. B. GLM chip) such. By primary amine coupling;
• 2. exposing the anti-mouse IgG (or other art-matched antibody) to a test IgG antibody for capturing test antibody on the chip;
• 3. Passing the test antigen across the capture surface of the chip at a concentration of 1024 nM, 256 nM, 64 nM, 16 nM, 4 nM with a 0 nM (ie only buffer); and
• 4. Determine the binding affinity of the test antibody for testing the antigen by surface plasmon resonance, e.g. Under one of the SPR conditions discussed above (eg at 25 ° C in physiological buffer). The SPR can be performed using any standard SPR device, such as by Biacore ^™ or using the Proteon XPR36 ^TM (Bio-Rad ^®).

The regeneration of the capture surface can be done with 10 mM glycine at a pH of 1.7. This removes the captured antibody and allows the surface to be used for another interaction. The binding data can be adapted to an inherent 1: 1 model using standard techniques, e.g. Using an inherent model of the ProteOn XPR36 ^™ analysis software.

In one example, the ligand of the invention is in a medical container, e.g. An ampoule, a syringe, an IV container or an injection device (eg an intraocular or intravitreal injection device). In one example, the ligand is in vitro, e.g. B. in a sterile container. In one example, the invention provides a kit comprising the ligand of the invention, the packaging and instructions for use in the treatment or prevention or diagnosis of a PCSK9 mediated disease or a PCSK9 mediated disease in a human. In one example, the instructions indicate that human should be genotyped for a PCSK9 sequence variant prior to administration of the ligand to humans. In one example, the instructions indicate that human should be phenotyped for a PCSK9 variant prior to administration of the ligand to humans. In one example, the human is of Chinese ethnicity (eg, Han or CHS), and the instructions are in Chinese (eg, Mandarin). In one example, the instructions include instructions for administering alirocumab or evolocumab to this human.

The invention addresses the need to treat humans with naturally occurring, less abundant natural PCSK9 alleles, genotypes and phenotypes (rarer protein forms). In this regard, the invention provides the following aspects.

According to a first aspect:

An anti-human PCSK9 ligand for use in a method of treating and / or preventing a PCSK9 mediated disease or a PCSK9 mediated disease in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, which method comprises administering the ligand to a human.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

The PCSK9 variant is not the one that occurs most often.

According to one embodiment of any configuration, example, embodiment or aspect, the ligand of the invention, the antibody of the invention, the fragment of the invention or the binding site of the invention are recombinant.

According to a second aspect:

The ligand of aspect 1, wherein it has been determined that the ligand is capable of binding a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q.

In one example of any aspect, the ligand binds two, three, four or more human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q (or it has been found he binds these).

In one example of any aspect, the ligand comprises a protein domain that binds specifically to PCSK9, e.g. For example, a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q.

The term "specifically binds" or the like means that a ligand, e.g. For example, an antibody or antigen-binding fragment thereof forms a complex with an antigen which is relatively stable under physiological conditions. Specific binding may be characterized as an equilibrium dissociation constant of at least about 1 x 10 ^-6 M or less (a smaller KD, for example, denotes a more rigid binding). Methods for determining whether two molecules bind specifically are well known in the art and include, for example, equilibrium dialysis, surface plasmon resonance, and the like. However, an isolated antibody that specifically binds a human PCSK9 may show cross-reactivity with other antigens such as a PCSK9 molecule of other species. In addition, multispecific antibodies (eg, bispecific) that bind to human PCSK9 and one or more additional antigens are nevertheless considered to be antibodies that "specifically bind" PCSK9, as the term is used herein.

In an example of any aspect, the ligand comprises or consists of a protein domain which mimics the EGFA domain of the LDL receptor and binds specifically to PCSK9, e.g. For example, a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q.

In an example of any aspect, the ligand antagonizes PCSK9, e.g. For example, a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q.

In an example of any aspect, the method (prior to administration of the ligand) comprises the step of determining that the ligand is capable of producing a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e , h, aj and q bind.

In an example of any aspect, binding is detected by SPR. In one example of any aspect, binding is detected by ELISA.

In one example of any aspect, the shapes are the mature shapes.

In an example of any aspect, the shapes are the pro-shapes.

The terms "will be determined / determined", "will be genotyped" or "will be phenotyped" and the like herein will mean that the method includes a step of such determination, genotyping or phenotyping.

According to a third aspect:

A ligand that binds a human PCSK9 that comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4-27 for use in a method comprising the step of using the ligand to target the PCSK9 in a human Treatment and / or prevention of a PCSK9-mediated disease or a PCSK9-mediated condition, which method comprises administering the ligand to a human.

In one example, the disease is mediated by a human PCSK9 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4-27.

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOS: 4-23, 26 and 27; or selected from the group consisting of SEQ ID NOS: 4-14 and 18-27; or selected from the group consisting of SEQ ID NOs: 4-14, 18-23, 26 and 27. These are naturally occurring sequences that are not 46L and that meet the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the amino acid sequence is SEQ ID NO: 18, 19, or 20, which includes a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 26, and 27, which comprise 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOS: 10-14 and 18-27; or selected from the group consisting of SEQ ID NOs: 10-14, 18-23, 26, and 27. These are sequences in which a naturally occurring combination of differences of SEQ ID NOs: 1-3 (form a) and meet the criteria listed below.

In one example, the amino acid sequence is SEQ ID NO: 4.

In one example, the amino acid sequence is SEQ ID NO: 5.

In one example, the amino acid sequence is SEQ ID NO: 6.

In one example, the amino acid sequence is SEQ ID NO: 7.

In one example, the amino acid sequence is SEQ ID NO: 8.

In one example, the amino acid sequence is SEQ ID NO: 9.

In one example, the amino acid sequence is SEQ ID NO: 10.

In one example, the amino acid sequence is SEQ ID NO: 11.

In one example, the amino acid sequence is SEQ ID NO: 12.

In one example, the amino acid sequence is SEQ ID NO: 13.

In one example, the amino acid sequence is SEQ ID NO: 14.

In one example, the amino acid sequence is SEQ ID NO: 15.

In one example, the amino acid sequence is SEQ ID NO: 16.

In one example, the amino acid sequence is SEQ ID NO: 17.

In one example, the amino acid sequence is SEQ ID NO: 18.

In one example, the amino acid sequence is SEQ ID NO: 19.

In one example, the amino acid sequence is SEQ ID NO: 20.

In one example, the amino acid sequence is SEQ ID NO: 21.

In one example, the amino acid sequence is SEQ ID NO: 22.

In one example, the amino acid sequence is SEQ ID NO: 23.

In one example, the amino acid sequence is SEQ ID NO: 24.

In one example, the amino acid sequence is SEQ ID NO: 25.

In one example, the amino acid sequence is SEQ ID NO: 26.

In one example, the amino acid sequence is SEQ ID NO: 27.

According to a fourth aspect:

The ligand of aspect 3, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to a fifth aspect:

The ligand of any one of the preceding aspects, wherein human is or has been genotyped as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain coding sequence thereof.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37.

These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that meet the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to a sixth aspect:

The ligand according to any one of the preceding aspects, wherein the human is positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or at least the catalytic or C-terminal Domain of which has been or will be phenotyped.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a seventh aspect:

The ligand of any one of the preceding aspects, wherein the method comprises human genotyping as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to an eighth aspect: The ligand according to any of the preceding aspects, wherein the method of human phenotyping is positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or at least the catalytic or C-terminal domain thereof.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a ninth aspect:

The ligand of any one of the preceding aspects, wherein the human has been genotyped as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof; wherein the human optionally as the nucleotide sequence of SEQ ID NO: 28 or at least the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal Domain coding sequence thereof has been or will be genotyped.

"Heterozygous" as used herein means that in the human genotype, one allele comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain-encoding sequence thereof and another allele may be any PCSK9 may (eg, form a, a 'or an allele comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain coding sequence thereof).

In one example, the method (prior to administration of the ligand) comprises genotyping the human as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof; and optionally also human genotyping as the nucleotide sequence of SEQ ID NO: 28 or at least the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (FIG. Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to a tenth aspect: The ligand according to any one of aspects 1 to 9, wherein the human genome is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or at least the catalytic or C-terminal domain coding sequence it was or will be genotyped.

"Homozygous" as used herein means that in the human genotype, each allele comprises the same nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof.

In one example, the method comprises genotyping the human as homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to an eleventh aspect:

The ligand of any one of the preceding aspects, wherein the ligand comprises an antibody binding site that binds a human PCSK9 that comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4-27, and has been found to be or become capable of such a bond.

In one example, the method (prior to administration of the ligand) comprises the step of determining that the ligand is capable of binding to the human PCSK9.

In one example, the binding is a specific binding. In one example, the ligand binds (or was found to be binding) to the PCSK9 with an affinity (Kd) of 1 mM, 100 mM, 10 nM, or 1 nM or less. In one embodiment, the affinity is not less than 10, 100 or 1000 fM.

In one example, binding or affinity is determined by SPR or ELISA.

In one example, the disease is mediated by a human PCSK9 comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 4-27.

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOS: 4-23, 26 and 27; or selected from the group consisting of SEQ ID NOS: 4-14 and 18-27; or selected from the group consisting of SEQ ID NOs: 4-14, 18-23, 26 and 27. These are naturally occurring sequences that are not 46L and that meet the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the amino acid sequence is SEQ ID NO: 18, 19, or 20, which includes a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOs: 10, 11, 12, 26, and 27, which comprise 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the amino acid sequence is selected from the group consisting of SEQ ID NOS: 10-14 and 18-27; or selected from the group consisting of SEQ ID NOs: 10-14, 18-23, 26, and 27. These are sequences in which a naturally occurring combination of differences of SEQ ID NOs: 1-3 (form a) and meet the criteria listed below.

In one example, the amino acid sequence is SEQ ID NO: 4.

In one example, the amino acid sequence is SEQ ID NO: 5.

In one example, the amino acid sequence is SEQ ID NO: 6.

In one example, the amino acid sequence is SEQ ID NO: 7.

In one example, the amino acid sequence is SEQ ID NO: 8.

In one example, the amino acid sequence is SEQ ID NO: 9.

In one example, the amino acid sequence is SEQ ID NO: 10.

In one example, the amino acid sequence is SEQ ID NO: 11.

In one example, the amino acid sequence is SEQ ID NO: 12.

In one example, the amino acid sequence is SEQ ID NO: 13.

In one example, the amino acid sequence is SEQ ID NO: 14.

In one example, the amino acid sequence is SEQ ID NO: 15.

In one example, the amino acid sequence is SEQ ID NO: 16.

In one example, the amino acid sequence is SEQ ID NO: 17.

In one example, the amino acid sequence is SEQ ID NO: 18.

In one example, the amino acid sequence is SEQ ID NO: 19.

In one example, the amino acid sequence is SEQ ID NO: 20.

In one example, the amino acid sequence is SEQ ID NO: 21.

In one example, the amino acid sequence is SEQ ID NO: 22.

In one example, the amino acid sequence is SEQ ID NO: 23.

In one example, the amino acid sequence is SEQ ID NO: 24.

In one example, the amino acid sequence is SEQ ID NO: 25.

In one example, the amino acid sequence is SEQ ID NO: 26.

In one example, the amino acid sequence is SEQ ID NO: 27.

According to a twelfth aspect:

The ligand of aspect 11, wherein the ligand is an antibody or an antibody fragment. For example, the antibody or antibody fragment is a PCSK9 antagonist, e.g. For example, it neutralizes PCSK9. Examples of such antibodies are, for example, in WO 2008/057457 . WO2008 / 057458 . WO 2008/057459 . WO 2008/063382 . WO 2008/133647 . WO 2009/100297 . WO 2009/100318 . WO 2011/037791 . WO 2011/053759 . WO 2011/053783 . WO 2008/125623 . WO 2011/072263 . WO 2009/055783 . WO 2010/029513 . WO 2011/111007 . WO 2010/077854 whose disclosures and sequences of such antibodies are incorporated herein by reference in their entirety for use in the invention. A specific example is AMG 145 (Amgen), LY3015014 (Eli Lilly) or alirocumab, or a PCSK9-binding derivative thereof. Advantageously, the ligand is or comprises alirocumab.

Alternatively, the ligand is or comprises evolocumab.

In one example, the ligand is SAR236553 / REGN727 (Sanofi Aventis / Regeneron) or a PCSK9 binding derivative thereof.

In one example, the ligand comprises or consists of a neutralizing antibody that binds to PCSK9, which antibody binds to PCSK9 and reduces the likelihood that PCSK9 will bind to LDLR.

The ligand of aspect 11, wherein the ligand is a PCSK9 antagonist, e.g. B. PCSK9 neutralized.

In one example of any aspect of the invention, the ligand comprises a ligand selected from evolocumab, 1D05-IgG2 (Merck & Co.), ALN-PCS02 (Alnylam), RN316 (Pfizer-Rinat), LY3015014 (Eli Lilly), and alirocumab, or a PCSK9-binding derivative thereof, or consists thereof. In one example, the ligand is SAR236553 / REGN727 (Sanofi Aventis / Regeneron) or a PCSK9 binding derivative thereof.

According to a thirteenth aspect:

The ligand of any one of aspects 1 to 10, wherein (i) the ligand comprises a sequence of contiguous nucleotides specific to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the ones for the catalytic domain or C-terminal domain encoding sequence thereof hybridized or specifically hybridized with an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes with at least one nucleotide present in the selected sequence but not in SEQ ID NO : 28, or hybridized with an antisense sequence or an RNA transcript thereof; and / or (ii) the ligand comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence or RNA version of these contiguous nucleotides, the sequence being sequential Nucleotides comprise at least one nucleotide present in the selected sequence but not in SEQ ID NO: 28.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

In one embodiment, the ligand comprises at least 10, 11, 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50 or 100 consecutive nucleotides of the nucleotide sequence.

According to a fourteenth aspect:

The ligand according to any one of the preceding aspects, wherein the disease or condition is hyperlipidemia, hypercholesterolemia (eg, familial hypercholesterolemia), heart attack, stroke, coronary heart disease, atherosclerosis or cardiovascular disease, or heart disease. Circulatory disease is.

The ligand of any one of the preceding aspects, wherein the disease or condition is hypercholesterolemia, hyperlipidemia, hypercholesterolemia, dyslipidemia, cholestatic liver disease, nephrotic syndrome, hypothyroidism, obesity, atherosclerosis or cardiovascular disease.

In one example, the disease or condition is hypercholesterolemia. The term "hypercholesterolemia" as used herein refers to a condition wherein cholesterol levels are elevated above a desired level. According to some embodiments, this refers to increased serum cholesterol levels. According to some embodiments, at the desired concentrations, various "risk factors" are considered which are known to the person skilled in the art (and in US Pat US20120093818 described or mentioned).

The ligand according to any preceding aspect, wherein the human has been identified as heterozygous for familial hypercholesterolemia, statin intolerant or not statinally responsive, or at risk for the occurrence of hypercholesterolemia, dyslipidemia, cholestatic liver disease, nephrotic syndrome, hypothyroidism, obesity, atherosclerosis or a heart Cycle disease was identified.

According to a fifteenth aspect: The ligand of any one of the preceding aspects, wherein the disease is associated with elevated LDL cholesterol.

Cholesterol levels are measured in the United States and in some other countries in milligrams (mg) of cholesterol per deciliter (dl) of blood. In Canada and most European countries, cholesterol is measured in millimoles (mmol) per liter (l) of blood. Below are general guidelines for ideal ranges and elevated ranges. Total cholesterol (USA and some other countries) Total cholesterol * (Canada and most European countries) below 200 mg / dl below 5.2 mmol / l ideal 200-239 mg / dl 5.2-6.2 mmol / l borderline high 240 mg / dl and above over 6.2 mmol / l high LDL cholesterol (US and some other countries) LDL cholesterol * (Canada and most European countries) 100-129 mg / dl 2.6-3.3 mmol / l ideal 130-159 mg / dl 3.4-4.1 mmol / l borderline high 160-189 mg / dl 4.1-4.9 mmol / l high 190 mg / dl and above over 4.9 mmol / l very high * Canadian and European guidelines are slightly different from US regulations. These conversions are based on US guidelines.

Elevated LDL cholesterol is thus 160 mg / dL or above (4.1 mmol / L or above).

According to a sixteenth aspect:

The ligand of any one of the preceding aspects, wherein the ligand inhibits binding of human PCSK9 to the human LDL receptor, and optionally was or was determined to be capable of such inhibition.

In one example, the method (prior to administration of the ligand) comprises determining that the ligand is capable of such inhibition.

The finding of an inhibition is z. B. inhibition in a blood or serum sample at RT, at a pH of 7, at 37 degrees Celsius and / or under the physiological conditions of a human body.

According to a seventeenth aspect:

The ligand of any one of the preceding aspects, wherein the human is resistant or substantially resistant to statin (e.g., avorstatin and / or fluvastatin) treatment of the disease or condition.

According to an eighteenth aspect:

• (i) dessen Genom SEQ ID NO: 29 umfasst und wobei der Mensch ASW-, YRI-, GBR-, TSI-, CLM-, LWK-, MXL-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung ist; oder
• (ii) dessen Genom SEQ ID NO: 30 umfasst und wobei der Mensch ASW-, YRI-, GBR-, TSI-, CLM-, CHB-, LWK-, CHS-, JPT-, PUR-, FIN- oder CEU-Abstammung ist; oder
• (iii) dessen Genom SEQ ID NO: 32 umfasst und wobei der Mensch ASW-, GBR-, TSI-, CLM-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung ist; oder
• (iv) dessen Genom SEQ ID NO: 33 umfasst und wobei der Mensch LWK-, ASW-, YRI- oder CLM-Abstammung ist; oder
• (v) dessen Genom SEQ ID NO: 34 umfasst und wobei der Mensch LWK-, ASW- oder YRI-Abstammung ist; oder
• (vi) dessen Genom SEQ ID NO: 35 umfasst und wobei der Mensch PUR-, TSI-, FIN- oder CEU-Abstammung ist; oder
• (vii) dessen Genom SEQ ID NO: 36 umfasst und wobei der Mensch LWK-, ASW- oder YRI-Abstammung ist; oder
• (viii) dessen Genom SEQ ID NO: 37 umfasst und wobei der Mensch CHS-, ASW-, JPT-, PUR- oder CHB-Abstammung ist.

The ligand of any one of the preceding aspects, wherein the ligand is for use in the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human,

• (i) whose genome comprises SEQ ID NO: 29 and wherein human beings are ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU Descent is; or
• (ii) whose genome comprises SEQ ID NO: 30, and wherein human beings are ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU Descent is; or
• (iii) whose genome comprises SEQ ID NO: 32 and wherein the human is ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU ancestry; or
• (iv) whose genome comprises SEQ ID NO: 33 and wherein the human is LWK, ASW, YRI or CLM lineage; or
• (v) whose genome comprises SEQ ID NO: 34 and wherein the human is LWK, ASW or YRI derived; or
• (vi) whose genome comprises SEQ ID NO: 35 and wherein the human is PUR, TSI, FIN or CEU ancestry; or
• (vii) whose genome comprises SEQ ID NO: 36 and wherein the human is LWK, ASW or YRI derived; or
• (viii) whose genome comprises SEQ ID NO: 37 and wherein the human is CHS, ASW, JPT, PUR or CHB descent.

According to a nineteenth aspect:

• (i) welcher die PCSK9-Form f exprimiert und wobei der Mensch ASW-, YRI-, GBR-, TSI, CLM-, LWK-, MXL-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung ist; oder
• (ii) welcher die PCSK9-Form c exprimiert und wobei der Mensch ASW-, YRI-, GBR-, TSI-, CLM-, CHB-, LWK-, CHS-, JPT-, PUR-, FIN- oder CEU-Abstammung ist; oder
• (iii) welcher die PCSK9-Form p exprimiert und wobei der Mensch ASW-, GBR-, TSI-, CLM-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung ist; oder
• (iv) welcher die PCSK9-Form m exprimiert und wobei der Mensch LWK-, ASW-, YRI- oder CLM-Abstammung ist; oder
• (v) welcher die PCSK9-Form e exprimiert und wobei der Mensch LWK-, ASW- oder YRI-Abstammung ist; oder
• (vi) welcher die PCSK9-Form h exprimiert und wobei der Mensch PUR-, TSI-, FIN- oder CEU-Abstammung ist; oder
• (vii) welcher die PCSK9-Form aj exprimiert und wobei der Mensch LWK-, ASW- oder YRI-Abstammung ist; oder
• (viii) welcher die PCSK9-Form q exprimiert und wobei der Mensch CHS-, ASW-, JPT-, PUR- oder CHB-Abstammung ist.

The ligand of any one of the preceding aspects, wherein the ligand is for use in the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human,

• (i) expressing the PCSK9 form f and wherein the human being is ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU ancestry ; or
• (ii) expressing the PCSK9 form c, and wherein human beings are ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU ancestry is; or
• (iii) expressing the PCSK9 form p and wherein the human is ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU; or
• (iv) expressing the PCSK9 form m and wherein the human is LWK, ASW, YRI or CLM lineage; or
• (v) expressing the PCSK9 form e and wherein the human being is LWK, ASW or YRI derived; or
• (vi) expressing the PCSK9 form h and wherein the human is PUR, TSI, FIN or CEU ancestry; or
• (vii) which expresses the PCSK9 form aj and wherein the human is LWK, ASW or YRI derived; or
• (viii) which expresses the PCSK9 form q and wherein the human is CHS, ASW, JPT, PUR or CHB descent.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a twentieth aspect:

A pharmaceutical composition or a pharmaceutical kit for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease (such as listed in Aspects 14 or 15), wherein the composition or kit comprises a ligand according to any one of preceding aspects and optionally a statin (eg cerovastatin, atorvastatin, simvastatin, pitavastin, rosuvastatin, fluvastatin, lovastatin or pravastatin); and optionally in combination with a label or instructions for use in the treatment and / or prevention of the disease or condition in a human (e.g., covering treatment of a human, as in Aspects 18 or 19); the label or instructions optionally comprising a drug approval number (eg, an FDA or EMA approval number); optionally, the label or instructions include instructions for administering alirocumab or evolocumab to a human; wherein the kit optionally comprises an IV or injection device which comprises the ligand (and, for example, also a statin).

According to a twenty-first aspect:

A method of producing an anti-human PCSK9 antibody binding site, the method comprising recovering a plurality of anti-PCSK9 antibody binding sites, screening the antibody binding sites for binding to any of those of forms f, c, r, p, m, e, h, aj and q selected human PCSK9 or a catalytic or C-terminal domain or a peptide thereof, which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3 and isolating an antibody binding site that binds in the screening step, and optionally, producing a fragment or derivative of the isolated antibody that binds the form f, c, r, p, m, e, h, aj, or q of the PCSK9.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

In one example of this and the next aspect, the plurality of binding sites comprises a plurality of 4-chain antibodies or fragments thereof, e.g. DAbs, Fabs or scFvs, or consists thereof. Suitable methods for making multiple numbers of binding sites for screening include phage display (to obtain a phage display library of antibody binding sites), ribosome display (to obtain a ribosome display library of antibody binding sites), yeast display (whereby obtaining a yeast display library of antibody binding sites) and immunizing a non-human vertebrate (e.g., a rodent, e.g., a mouse or rat, e.g., a Velocimouse ^™ , Kymouse ^™ , Xenomouse ^™ , Aliva Mouse ^TM , HuMab Mouse ^™ , Omnimouse ^™ , Omnirat ^™ or MeMo Mouse ^™ ) with a PCSK9 epitope and the isolation of a repertoire of antibody-producing cells (eg a B-cell, a plasma cell or a plasma-load repertoire) and / or Repertoire of isolated antibodies.

In one example, the method comprises selecting one or more antibody binding sites that specifically bind to a human PCSK9 epitope comprising an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3.

For example, the ligand specifically binds to an epitope comprising an amino acid that is a variant compared to the corresponding amino acid of PCSK9 encoded by SEQ ID NO: 1, 2 or 3. In one example, the ligand specifically binds to an epitope comprising two or more such amino acid variants. In one example, specific binding means binding with an affinity (Kd) of 1 mM, 100 nM, 10 nM or 1 nM or less, e.g. B. determined by means of SPR.

The term "epitope" is a region of an antigen bound by an antibody. Epitopes can be defined as structurally or functionally. Functional epitopes are generally a subset of the structural epitopes and have the residues that directly contribute to the affinity of the interaction. Epitopes may also be conformational, that is, constructed of non-linear amino acids. In certain embodiments, epitopes may include determinants that are chemically active surface moieties of molecules such as amino acids, sugar side chains, phosphoryl groups, or sulfonyl groups, and in certain embodiments may have specific three-dimensional structural characteristics and / or charge characteristics.

According to a twenty-second aspect:

A method of producing an anti-human PCSK9 antibody, the method comprising immunizing a non-human vertebrate (e.g., a mouse or a rat) with a human PCSK9 having an amino acid sequence selected from the group consisting of amino acid sequences the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and isolating an antibody encoding a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3, and optionally producing a form f, c, r, p, m, e, h, aj or q the PCSK9 binding fragment or derivative of the isolated n antibody.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a twenty-third aspect:

The method of aspect 21 or 22, comprising the step of recovering a nucleic acid encoding the antibody, fragment, derivative or binding site, and optionally inserting the nucleic acid into an expression vector.

For example, the method comprises isolating a cell (eg, B cell, plasma load, plasma cell, or memory cell) comprising the nucleic acid, wherein the cell is obtained from a non-human vertebrate animal that has been immunized with the PCSK9 epitope.

According to a twenty-fourth aspect:

A kit for PCSK9 genotyping of a human, said kit comprising a nucleic acid having (i) a sequence of 10 or more (e.g., 10, 15, 20, 30, 40, 50, 60, 70, 80, 90 , 100 or more) contiguous nucleotides specifically hybridizing to a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or at least the catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridized with an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes with at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with an antisense sequence or an RNA transcript thereof hybridized; and / or (ii) a sequence of at least 10 or more (eg, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, or more) nucleotides of a nucleotide sequence selected from the group consisting from SEQ ID NO: 29-37, or comprises an antisense sequence or RNA version of these contiguous nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not in SEQ ID NO: 28 ,

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to a twenty-fifth aspect:

A kit for human PCSK9 genotyping or phenotyping, wherein the kit comprises a ligand according to any of aspects 1 to 19 or an antibody, fragment or derivative produced by the method of any one of aspects 21 to 23.

According to a twenty-sixth aspect:

Use of an anti-PCSK9 ligand which binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q in the manufacture of a medicament for the treatment and / or Prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, optionally for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated suffering in a human, as stated in aspect 18 or 19.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a twenty-seventh aspect:

Use of an anti-PCSK9 ligand that binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q in the manufacture of a medicament for targeting PCSK9 in a human for the treatment and / or prevention of a PCSK9-mediated disease or a condition mediated by PCSK9, optionally for targeting PCSK9 in a human, as recited in Aspects 18 or 19.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

The ligand may be any anti-PCSK9 ligand disclosed herein.

According to a twenty-eighth aspect:

Use according to aspect 26 or 27 wherein the ligand, human, disease or condition is according to any of aspects 1 to 19.

According to a twenty-ninth aspect:

A method for targeting a PCSK9 for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition in a human, the method comprising administering to a human an anti-PCSK9 ligand having a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, being targeted to a coded by the nucleotide sequence PCSK9.

The ligand may be any anti-PCSK9 ligand disclosed herein.

According to a thirtieth aspect:

The method of aspect 29, wherein the method comprises targeting a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q with the ligand for the treatment and / or prevention of the disease or suffering in the human being.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a thirty-first aspect:

A method of treating and / or preventing a PCSK9 mediated disease or a PCSK9 mediated disease in a human, the method comprising targeting a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e , h, aj, and q, by administering to humans a ligand that binds the PCSK9, thereby treating and / or preventing the disease or condition in humans.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

The ligand may be any anti-PCSK9 ligand disclosed herein.

According to a thirty-second aspect:

The method of aspect 31, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOs: 29-35 and 37; or selected from the group consisting of SEQ ID NOs: 29-32 and 34-37; or selected from the group consisting of SEQ ID NOs: 29-32, 34, 35 and 37. These are naturally occurring allelic (haplotype) sequences that do not code for 46L and that satisfy the criteria listed above. These groups include variants associated with elevated LDL-C.

In one example, the nucleotide sequence is SEQ ID NO: 34, which codes for a 425S associated with elevated LDL-C ( Pisciotta et al 2006 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31 and 37, which encode 670G, which is a marker of the severity of coronary atherosclerosis ( Chen et al 2005 ).

In one example, the nucleotide sequence is selected from the group consisting of SEQ ID NOS: 31, 32, 34, 35, 36 and 37; or selected from the group consisting of SEQ ID NOs: 31, 32, 34, 35 and 37. These are allelic (haplotype) sequences in which a naturally occurring combination of differences of SEQ ID NO: 28 (Form a) and meet the criteria listed below.

In one example, the nucleotide sequence is SEQ ID NO: 29.

In one example, the nucleotide sequence is SEQ ID NO: 30.

In one example, the nucleotide sequence is SEQ ID NO: 31.

In one example, the nucleotide sequence is SEQ ID NO: 32.

In one example, the nucleotide sequence is SEQ ID NO: 33.

In one example, the nucleotide sequence is SEQ ID NO: 34.

In one example, the nucleotide sequence is SEQ ID NO: 35.

In one example, the nucleotide sequence is SEQ ID NO: 36.

In one example, the nucleotide sequence is SEQ ID NO: 37.

According to a thirty-third aspect:

The method of any one of aspects 29 to 32, wherein the human is or has been genotyped as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof.

According to a thirty-fourth aspect:

The method of any one of aspects 29 to 33, wherein the human is or has been phenotyped as positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a thirty-fifth aspect:

The method of any one of aspects 29 to 34, wherein the method comprises human genotyping as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOS: 29-37 or the catalytic or C-terminal domain encoding sequence thereof in U.S. Patent Nos the sample comprises.

According to a thirty-sixth aspect:

The method of any one of aspects 29 to 35, wherein the method comprises human phenotyping as positive for a human PCSK9 sequence selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q includes.

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

According to a thirty-seventh aspect:

The method of any one of aspects 29 to 36, wherein the human is or has been genotyped as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain coding sequence thereof; wherein the human optionally as the nucleotide sequence of SEQ ID NO: 28 or the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or for the catalytic or C-terminal Domain coding sequence thereof has been or will be genotyped.

According to a thirty-eighth aspect:

The method of any one of aspects 29 to 37, wherein the human genome has been genotyped as homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof; becomes.

According to a thirty-ninth aspect:

The method of any one of aspects 29 to 38, wherein the method comprises genotyping the human for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof prior to administration of the ligand in humans, it being found that the ligand is capable of binding to a PCSK9 encoded by the selected sequence.

According to a fortieth aspect:

The method of any one of aspects 29 to 39, wherein the ligand, human, disease, or ailment is according to any one of aspects 1 to 19.

According to a forty-first aspect:

A method according to any of aspects 29 to 40 for the treatment and / or prevention of a disease or disease as recited in aspect 14 or 15, said method comprising administration of said ligand and a statin (eg, cerovastatin, atorvastatin, simvastatin, Pitavastine, rosuvastatin, fluvastatin, lovastatin or pravastatin) to humans.

According to a forty-second aspect:

The method of aspect 41, wherein the ligand and the statin are administered separately.

According to a forty-third aspect:

The method of aspect 41, wherein the ligand and statin are administered simultaneously.

According to a forty-fourth aspect:

The method of any one of aspects 29 to 43, wherein the ligand is administered by subcutaneous injection.

According to a forty-fifth aspect:

A method of PCSK9 genotyping a human nucleic acid sample, the method comprising identifying in the sample the presence of a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof ,

According to a forty-sixth aspect:

A method of PCSK9-typing a human protein sample, the method comprising identifying in the sample the presence of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q ,

In one example, the shapes are the mature shapes.

In one example, the shapes are the pro-shapes.

In one example, the method comprises recovering a human PCSK9 protein sample and then performing the identification step.

According to a forty-seventh aspect:

The method of aspect 45 or 46, comprising obtaining a serum, blood, faeces, hair, tissue, cell, urine or saliva sample from a human, wherein the nucleic acid or protein sample is recovered and in the step is used to identify the sequence.

According to a forty-eighth aspect:

The method according to any one of aspects 45 to 47, wherein a ligand according to any of aspects 1 to 19 is used to carry out the identification step.

According to a forty-ninth aspect:

A method for the treatment and / or prevention of cardiovascular disease or cardiovascular disease, or a disease or condition associated with elevated LDL cholesterol (e.g., hypercholesterolemia) in a human human patient, wherein the patient receives or has previously received statin treatment for the disease, the method comprising typing the patient using a method according to any one of items 45 to 48 and administering a ligand according to any one of aspects 1 to 19 wherein the human is being treated or the disease or the suffering is prevented; optionally also reducing or stopping the statin treatment.

In one example, the reduction or stopping comprises reducing the dose and / or the frequency of administration of statin.

According to a fiftieth aspect:

A diagnostic, therapeutic or prophylactic kit comprising a ligand capable of binding to or being determined to be capable of an amino acid sequence selected from SEQ ID NO: 4-27 and instructions for one Aspects 46 to 49 and / or a label or instructions that demonstrate administration of the ligand to a human as defined in any of aspects 1 to 19.

According to a fifty-first aspect:

A diagnostic, therapeutic or prophylactic kit comprising a nucleic acid probe comprising a nucleotide sequence that specifically hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, or an antisense sequence or an RNA sequence Transcript thereof and instructions for carrying out the method according to aspect 45, 47 or 48.

According to embodiments of any of the aspects described herein, the PCSK9 may be a human PCSK9, e.g. A mature, cleaved, autocatalyzed or active PCSK9. In one example, the disease is a cardiovascular disease such as hyperlipidemia.

In examples of the present invention, the ligand specifically binds to human PCSK9, e.g. For example, one or more of the rare PCSK9 variants disclosed herein (eg, one, two, three, more, or all of the mature forms f, c, r, p, m, e, h, aj, and q) and optionally also the a and / or a 'form. For example, the ligand binds specifically to the mature form f and / or c and form a.

Detection of such binding can be accomplished by any antibody binding assay known in the art, e.g. B. by surface plasmon resonance. The binding to each of these forms is for example with a Kd of at least 1 mM, 100 nM, 1 nM, 100 pM, 10 pM or 1 pM.

In one example, the ligand binds form a and a PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q, wherein the ligand that binds to the selected form, with a Kd value (determined by SPR) which is at least 60, 70, 80, 90 or 95% of the Kd value for the bond to form a. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form f, with the ligand that binds to form f doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form c, with the ligand that binds to form c doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form r, with the ligand that binds to form r doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90 or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form p, with the ligand that binds to form p doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form m, with the ligand that binds to form m doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form e, with the ligand that binds to form e doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form h, with the ligand that binds to form h doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form aj, with the ligand that binds to form aj doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In one example, the ligand binds form a and form q, with the ligand that binds to form q doing so with a Kd value (determined by SPR) that is at least 60, 70, 80, 90, or 95% of the Kd value. Value for binding to form a is. In one embodiment, both forms are mature forms. In one embodiment, both forms are pro-forms.

In examples of the present invention, the ligand neutralizes human PCSK9, e.g. For example, one or more of the rare PCSK9 variants disclosed herein (eg, one, two, three, more, or all of the mature forms f, c, r, p, m, e, h, aj, and q) and optionally also the a and / or a 'form. For example, the ligand neutralizes the mature form f and / or c and form a. The determination of neutralization can be made, for example, by any of US20120093818A1 (Amgen, Inc.) or US20110065902A1 (Regeneron Pharmaceuticals, Inc). Ligands of the invention which bind or target PCSK9 are useful in, for example, in US20120093818A1 and US20110065902A1 disclosed therapeutic and prophylactic applications, wherein these specific disclosures are hereby incorporated by reference in their entirety by reference for use in the present invention and possible inclusion in the claims.

In embodiments where the ligand is used for therapeutic applications, an antigen-binding protein may include one or more biological activities of PCSK9 (eg, one or more of the rare variants disclosed herein, and optionally also the a and / or a 'forms ), interfere with them or modulate them. In one embodiment, the ligand specifically binds to human PCSK9 (eg, one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form) and / or substantially inhibits the binding of human PCSK9 (e.g. B. one or more of the rare variants disclosed herein and optionally also the a and / or a 'form) to LDLR by at least 20%, e.g. 20% -40%, 40-60%, 60-80%, 80-85% or more (for example, by measuring binding in an in vitro competitive binding assay). In one example, the ligand is an antibody.

In one embodiment, the ligand has a Kd of less (the binding is narrower) than 10 ^-7 , 10 ^-8 , 10 ^-9 , 10 ^-10 , 10 ^-11 , 10 ^-12 , 10 ^-13 M for attachment to one , two or more of the rare variants disclosed herein, and optionally also the a and / or a 'form. In one example, the Kd is determined using SPR.

In one embodiment, in blocking the binding of LDLR to one or more of the rare PCSK9 variants (and optionally also the a and / or a 'forms) disclosed herein, the ligand has an IC 50 of less than 1 microM, 1000 nM to 100 nM, 100 nM to 10 nM, 10 nM to 1 nM, 1000 pM to 500 pM, 500 pM to 200 pM, less than 200 pM, 200 pM to 150 pM, 200 pM to 100 pM, 100 pM to 10 pM, 10 pM up to 1 pM.

In one embodiment, in blocking the binding of LDLR to the a- and / or a'-form of PCSK9, the ligand has an IC 50 of not more than 1000, 100, 90, 80, 70, 60, 50, 40, 30, 20 or 10 times more (ie more inhibitory) than the IC50 in blocking the binding of LDLR to one or more of the rare PCSK9 variants disclosed herein (e.g., one or more of the PCSK9 proteins having a sequence selected from SEQ ID NOs: 4 to 27). Additionally or alternatively, for example, the ligand has an IC50 in blocking the binding of LDLR to (i) the a and / or a 'form of less than 1 microM, 1000 nM to 100 nM, 100 nM to 10 nM, 10 nM to 1 nM, 1000 pM to 500 pM, 500 pM to 200 pM, less than 200 pM, 200 pM to 150 pM, 200 pM to 100 pM, 100 pM to 10 pM, 10 pM to 1 pM, e.g. In the range of 1 mM to 1 pM (eg, 1 mM to 100 pM, 10 nM to 100 pM, 1 nM to 10 pM, or 100 pM to 1 pM) and (ii) one or more PCSK9 proteins comprising a sequence selected from SEQ ID NO: 4 to 27 of less than 1 microM, 1000 nM to 100 nM, 100 nM to 10 nM, 10 nM to 1 nM, 1000 pM to 500 pM, 500 pM to 200 pM, less than 200 pM, 200 pM to 150 pM, 200 pM to 100 pM, 100 pM to 10 pM, 10 pM to 1 pM, e.g. In the range of 1 mM to 1 pM (eg, 1 mM to 100 pM, 10 nM to 100 pM, 1 nM to 10 pM, or 100 pM to 1 pM).

In one embodiment, the ligand binds to the a- and / or a'-form of PCSK9 having a binding affinity (Kd) greater than up to 10%, greater than up to 20%, greater than 40%, greater than or equal to 50% greater than 55% greater than 60% greater than 65% greater than 70% greater than 75% greater than 80% greater than 85 %, greater than or equal to 90%, greater than or equal to 95% or greater than 100% (ie, double) of binding to a PCSK9 comprising a sequence selected from SEQ ID NO: 4 to 27. Such binding measurements may using various binding assays known in the art, e.g. B. using the surface plasmon resonance (SPR), as measured by Biacore ^™, or using the Proteon XPR36 ^TM (Bio-Rad ^®), or using KinExA ^® (Sapidyne Instruments, Inc).

In one embodiment, surface plasmon resonance (SPR) is performed at 25 ° C. In another embodiment, the SPR is performed at 37 ° C.

In one embodiment, the SPR is performed at a physiological pH, such as pH 7, or at pH 7.6 (eg, using Hepes buffered saline at pH 7.6 (also referred to as HBS-EP)).

According to one embodiment, the SPR is at a physiological salt concentration, z. B. 150 mM NaCl performed.

In one embodiment, the SPR is at a surfactant concentration of not more than 0.05 vol .-%, z. In the presence of P20 (polysorbate 20, eg Tween-20 ™) at 0.05% and 3 mM EDTA.

In one example, the SPR is performed at 25 ° C or 37 ° C in a buffer at pH 7.6, 150 mM NaCl, 0.05% surfactant (eg P20) and 3 mM EDTA. The buffer may contain 10 mM Hepes. In one example, the SPR is performed at 25 ° C or 37 ° C in HBS-EP. HBS-EP is available from Teknova Inc (California, catalog number H8022).

• 1. Kuppeln von Anti-Maus-(oder einer anderen relevanten Wirbeltier)IgG (z. B. Biacore BR-1008-38) an einen Biosensor-Chip (z. B. GLM-Chip) wie z. B. durch primäre Aminkupplung;
• 2. Exponieren des Anti-Maus-IgG (Wirbeltier-Antikörpers) gegenüber einem Test-IgG-Antikörper zum Einfangen von Testantikörper auf dem Chip;
• 3. Leiten des Testantigens über die Einfangoberfläche des Chips in einer Konzentration von 1024 nM, 256 nM, 64 nM, 16 nM, 4 nM mit einem 0 nM (d. h. nur Puffer); und
• 4. Bestimmen der Bindungsaffinität des Testantikörpers zu Testantigen durch Oberflächenplasmonresonanz, z. B. unter einer oben diskutierten SPR-Bedingung (z. B. bei 25°C in physiologischem Puffer). Die SPR kann unter Verwendung eines beliebigen Standard-SPR-Geräts wie von BiacoreTM oder unter Verwendung des ProteOn XPR36TM (Bio-Rad^®) durchgeführt werden.

In one example, the affinity of the ligand, which is an antibody, is determined using SPR

• 1. Coupling of anti-mouse (or other relevant vertebrate) IgG (eg, Biacore BR-1008-38) to a biosensor chip (eg, GLM chip) such as a biosensor chip. By primary amine coupling;
• 2. exposing the anti-mouse IgG (vertebrate antibody) to a test IgG antibody for capturing test antibody on the chip;
• 3. Passing the test antigen across the capture surface of the chip at a concentration of 1024 nM, 256 nM, 64 nM, 16 nM, 4 nM with a 0 nM (ie only buffer); and
• 4. Determine the binding affinity of the test antibody to test antigen by surface plasmon resonance, e.g. Under a SPR condition discussed above (eg at 25 ° C in physiological buffer). The SPR can be performed using any standard SPR device, such as by BIAcore or by using the Proteon XPR36TM (Bio-Rad ^®).

The regeneration of the capture surface can be done with 10 mM glycine at a pH of 1.7. This removes the captured antibody and allows the surface to be used for another interaction. The binding data can be adapted to an inherent 1: 1 model using standard techniques, e.g. Using an inherent model of the ProteOn XPR36 ^™ analysis software.

In one embodiment, assaying or testing a ligand of the invention is at or substantially at a pH of 7 (eg, in in vitro assays and assays) and at or substantially at RT.

An example of an IgG2 heavy chain constant domain of an anti-PCSK9 antibody of the present invention has the amino acid sequence set forth in SEQ ID NO: 154, 3KK from US20120093818A1 is shown, the sequence of which is hereby incorporated by reference part of the present application.

An example of a heavy IgG4 heavy chain constant domain of an anti-PCSK9 antibody of the present invention has the amino acid sequence set forth in SEQ ID NO: 155, 3KK from US20120093818A1 is shown, the sequence and disclosure of which is incorporated herein by reference in its entirety by reference.

An example of a kappa light kappa constant domain constant of an anti-PCSK9 antibody has the amino acid sequence set forth in SEQ ID NO: 157, 3KK from US20120093818A1 is shown, the sequence and disclosure of which is incorporated herein by reference in its entirety by reference.

An example of a light lambda chain constant domain of an anti-PCSK9 antibody has the amino acid sequence set forth in SEQ ID NO: 156, 3KK from US20120093818A1 is shown, the sequence and disclosure of which is incorporated herein by reference in its entirety by reference.

In the examples of the present invention, the ligand binds mature PCSK9, e.g. A mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form.

In the examples of the present invention, the ligand binds the catalytic domain of PCSK9, e.g. From a mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form.

In the examples of the present invention, the ligand binds the pro domain of PCSK9, e.g. From a mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form.

According to some embodiments, the ligand binds to the V domain of PCSK9, e.g. From a mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form. In some embodiments, the ligand binds to the V domain of PCSK9 (eg, from a mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form) and prevents (or reduces, eg at least 10%) binding of PCSK9 to LDLR. In some embodiments, the ligand binds to the V domain of PCSK9 (eg, from a mature form of one or more of the rare variants disclosed herein, and optionally also the a and / or a 'form) and, although binding from PCSK9 to LDLR does not prevent (or reduce), prevent or reduce (e.g., by at least 10%) the ligand, the PCSK9-mediated deleterious effects on LDLR.

In examples of the present invention, the ligand is or comprises a complete human antibody. In one example, the ligand comprises human variable regions or humanized variable regions.

In one example, the ligand of the present invention specifically binds to an epitope of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q, wherein the epitope comprises at least one amino acid which is not in form a finds. The amino acid is, for example, selected from the group consisting of 46L, 53V, 425S, 443T, 474V, 619P and 670G (numbering as in SEQ ID NO: 1). For example, the amino acid is selected from the group consisting of 425S, 443T, 474V, 619P and 670G (numbering as in SEQ ID NO: 1). For example, the amino acid is selected from the group consisting of 425S and 443T (numbering as in SEQ ID NO: 1). For example, the amino acid is selected from the group consisting of 474V, 619P and 670G (numbering as in SEQ ID NO: 1). In one example, the PCSK9 shape is the mature shape. In one example, the PCSK9 mold is the pro-form. In one example, the ligand also binds specifically to form a and / or a '. According to one In one embodiment, the ligand specifically binds to an epitope of the form f PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form c PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form r PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form p PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form m PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form h PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form aj PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to an epitope of the form q PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a.

In one embodiment, the ligand specifically binds to the pro domain of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q. In one example, the ligand also binds specifically to the pro domain of the form a and / or a '. In one embodiment, the ligand specifically binds to the pro domain of the form f PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form c PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form r PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form p PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form m PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form h PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro-domain of the form aj PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the pro domain of the form q PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a.

In one embodiment, the ligand specifically binds to the catalytic domain of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q. In one example, the ligand also binds specifically to the catalytic domain of the form a and / or a '. In one embodiment, the ligand specifically binds to the catalytic domain of the form f PCSK9, where the Epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form c PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form r PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form p PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form m PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form h PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form aj PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the catalytic domain of the form q PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a.

In one embodiment, the ligand specifically binds to the C-terminal domain of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q. In one example, the ligand also binds specifically to the C-terminal domain of the form a and / or a '. In one embodiment, the ligand specifically binds to the C-terminal domain of the form f PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form c PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form r PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form p PCSK9, wherein the epitope comprises at least one amino acid that is not in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form m PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form h PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form aj PCSK9, wherein the epitope comprises at least one amino acid that is not in form a. In one embodiment, the ligand specifically binds to the C-terminal domain of the form q PCSK9, wherein the epitope comprises at least one amino acid that is not in form a.

In one embodiment, the ligand specifically binds to the substrate-binding groove of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q (see Cunningham et al., Nat Struct Mol Biol. May 2007; 14 (5): 413-9. Epub April 15, 2007, "Structural and biophysical studies of PCSK9 and its mutants linked to familial hypercholesterolemia" , which is hereby incorporated herein by reference in its entirety). In one example, the ligand also binds specifically to the substrate-binding groove of the form a and / or a '. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form f PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form c PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form r PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form p PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form m PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate binding groove of the form PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form h PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form aj PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a. In one embodiment, the ligand specifically binds to the substrate-binding groove of the form q PCSK9, wherein the epitope comprises at least one amino acid that is not found in form a.

It's up US20120093818A1 (Amgen, Inc), the entire disclosure of which is hereby incorporated by reference into the present application. The present patent application discloses relevant ligands for use in the present invention as well as examples and methods for preparing and testing ligands that can be used with respect to the present invention.

In one example, the ligand is one in Table 2 of US20120093818A1 (Amgen, Inc), or the ligand comprises such an antibody, or the ligand is a PCSK9-binding derivative thereof.

In one embodiment, the PCSK9-binding ligand of the invention is selected from those described in U.S. Pat US20120093818A1 (Amgen, Inc.), e.g. Paragraphs [0009] to [0014] and [0058] to [0063] of US20120093818A1 disclosed antigen binding proteins; all such disclosures (including sequences of such proteins) are hereby incorporated by reference in the same way as part of the present application as if detailed herein and for possible inclusion in one or more claims or for use in the present invention.

In this paragraph, the SEQ ID NOs are the same as in US20120093818A1 (Amgen, Inc), and these sequences are hereby incorporated by reference in the same manner as if they had been listed in detail herein and for possible inclusion in one or more claims or for use in the present invention. In some aspects, the ligand of the invention comprises an isolated antigen-binding protein that binds PCSK9, comprising: A) one or more hyper-variable complementarity regions (CDRH) selected from the group consisting of: (i) a CDRH1 selected from a CDRH1 in a sequence from the group consisting of SEQ ID NO: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49, 57, 50, 91, 64, 62, 89 , 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60; (ii) a CDRH2 from a CDRH2 in a sequence selected from the group consisting of SEQ ID NOs: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49 , 57, 50, 91, 64, 62, 89, 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60; (iii) a CDRH3 from a CDRH3 in a sequence selected from the group consisting of SEQ ID NOs: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49 , 57, 50, 91, 64, 62, 89, 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60; and (iv) a CDRH of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 4 amino acids; B) one or more hypervariable light chain regions (CDRL) selected from the group consisting of: (i) a CDRL1 from a CDRL1 in a sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 10, 12 , 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46; (ii) a CDRL2 from a CDRL2 in a sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 10, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46; (iii) a CDRL3 from a CDRL3 in a sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 10, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23 , 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46; and (iv) a CDRL of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 4 amino acids; or C) one or more CDRH from A) and one or more CDRL from B). According to some embodiments, the isolated antigen-binding protein comprises at least one CDRH from A) and at least one CDRL from B). According to some embodiments, the isolated antigen-binding protein comprises at least two CDRH from A) and at least two CDRL from B). According to some embodiments, the isolated antigen-binding protein comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2 and CDRL3. In some embodiments, the CDRH is selected from A) selected from at least one of the group consisting of: (i) a CDRH1 amino acid sequence selected from CDRH1 in a sequence selected from the group consisting of SEQ ID NOs: 67, 79, 89 and 49 ; (ii) a CDRH2 amino acid sequence selected from CDRH2 in a sequence selected from the group consisting of SEQ ID NOs: 67, 79, 89 and 49; (iii) a CDRH3 amino acid sequence selected from CDRH3 in a sequence selected from the group consisting of SEQ ID NOs: 67, 79, 89 and 49; and (iv) a CDRH of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 2 amino acids. In addition, the CDRL of B) is selected from at least one of the group consisting of: (i) a CDRL1 amino acid sequence selected from CDRL1 in a sequence selected from the group consisting of SEQ ID NOs: 12, 35, 32 and 23; (ii) a CDRL2 amino acid sequence selected from CDRL2 in a sequence selected from the group consisting of SEQ ID NOs: 12, 35, 32 and 23; (iii) a CDRL3 amino acid sequence selected from CDRL3 in a sequence selected from the group consisting of SEQ ID NOS: 12, 35, 32 and 23; and (iv) a CDRL of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 2 amino acids; or C) one or more CDRH from A) and one or more CDRL from B. According to some embodiments, the CDRH is selected from A) at least one selected from the group consisting of: (i) a CDRH1 amino acid sequence of the CDRH1 amino acid sequence in SEQ ID NO: 67; (ii) a CDRH2 amino acid sequence of the CDRH2 amino acid sequence in SEQ ID NO: 67; (iii) a CDRH3 amino acid sequence of the CDRH3 amino acid sequence in SEQ ID NO: 67; and (iv) a CDRH of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 2 amino acids; the CDRL of B) is selected from at least one of the group consisting of: (i) a CDRL1 amino acid sequence of the CDRL1 amino acid sequence in SEQ ID NO: 12; (ii) a CDRL2 amino acid sequence of the CDRL2 amino acid sequence in SEQ ID NO: 12; (iii) a CDRL3 amino acid sequence of the CDRL3 amino acid sequence in SEQ ID NO: 12; and (iv) a CDRL of (i), (ii) and (iii) containing one or more amino acid substitutions, deletions or insertions of not more than 2 amino acids; or C) one or more heavy chain CDRH from A) and one or more light chain CDRL from B). According to some embodiments, the antigen-binding protein A) comprises a CDRH1 of the CDRH1 sequence in SEQ ID NO: 67, a CDRH2 of the CDRH2 sequence in SEQ ID NO: 67, and a CDRH3 of the CDRH3 sequence in SEQ ID NO: 67, and B) a CDRL1 of the CDRL1 sequence in SEQ ID NO: 12, a CDRL2 of the CDRL2 sequence in SEQ ID NO: 12, and a CDRL3 of the CDRL3 sequence in SEQ ID NO: 12. According to some embodiments, the antigen binding protein comprises a heavy chain variable region (VH) region having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49, 57, 50, 91, 64, 62, 89, 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60, and / or a variable region light chain variable region (VL) having at least 80% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 10, 12, 13, 15, 16, 17, 18, 19 20, 21, 22, 23, 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46. In some embodiments, the VH has at least 90% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49, 57, 50, 91, 64 , 62, 89, 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60, and / or the VL has at least 90% sequence identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 5, 7, 9, 10, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46. According to some embodiments, the VH is selected from the group consisting of SEQ ID NOs: 74, 85, 71, 72, 67, 87, 58, 52, 51, 53, 48, 54, 55, 56, 49, 57, 50, 91, 64, 62, 89, 65, 79, 80, 76, 77, 78, 83, 69, 81 and 60, and / or the VL is selected from the group consisting of SEQ ID NO: 5, 7, 9, 10, 12, 13, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 26, 28, 30, 31, 32, 33, 35, 36, 37, 38, 39, 40, 42, 44 and 46.

In one example of an aspect of the invention, the PCSK9 targeting or PCSK9-binding ligand comprises AMG145 or 31H4, 16F12, 11F1, 8A3 or 21B12, disclosed in U.S. Pat US20120093818A1 (Amgen, Inc), or an antibody comprising the variable domains of AMG145, 31H4, 16F12, 11F1, 8A3 or 21B12, the disclosures (including sequences) of which are hereby incorporated herein by reference in the same manner as if detailed herein and for possible inclusion in one or more claims or for use in the present invention. Preferably, the PCSK9 targeting or PCSK9-binding ligand comprises or consists of AMG145.

In one example, AMG145 or another ligand of the invention is glycosylated and has e.g. B. human glycosylation (eg produced by a CHO, Cos or Hek293 cell). In one example, the ligand of the invention is produced in CHO.

It's up US20110065902A1 (Regeneron Pharmaceuticals, Inc), the entire disclosure of which is hereby incorporated herein by reference. The present patent application discloses relevant ligands for use in the present invention as well as examples and methods for preparing and testing ligands and determining the medical efficacy that may be used with respect to the present invention.

Reference is made to the following PCT applications, the entire disclosures of which are hereby incorporated by reference into the present application. These disclose relevant ligands for use in the present invention, as well as examples and methods of preparing and testing ligands, and determining the medical efficacy that may be used with respect to the present invention.
WO2008057457
WO2008057458
WO2008057459
WO2008063382
WO2008133647
WO2009100297
WO2009100318
WO2011037791
WO2011053759
WO2011053783
WO2008125623
WO2011072263
WO2009055783
WO2010029513
WO2011111007
WO2010077854
Antibody ligands to PCSK9 are for example in WO 2008/057457 . WO 2008/057458 . WO 2008/057459 . WO 2008/063382 . WO 2008/125623 and US 2008/0008697 described.

In one example, the ligand is one in the examples of US20110065902A1 (e.g., 316P or 300N), or the ligand comprises such antibody, or the ligand is a PCSK9-binding derivative thereof. All of these disclosures (including the sequences of such proteins and the corresponding nucleotide sequences) are hereby incorporated by reference in the same way as in the present application, as if they were detailed and included herein for possible inclusion in one or more claims or for use in the present invention. In one embodiment, the ligand is the variable domains of in US20110065902A1 or comprises antibody 316P or 300N, or it is or is such an antibody or a PCSK9-binding derivative thereof. The above reference is hereby incorporated by reference in its entirety part of the present application.

In one embodiment, the ligand is or comprises the variable domains of the antibody alirocumab or SAR236553 / REGN727 (Sanofi Aventis / Regeneron), or is such an antibody or PCSK9-binding derivative thereof (or he includes these). In one example, the antibody is glycosylated and has e.g. B. human glycosylation (eg produced by a CHO, Cos or Hek293 cell). Preferably, the ligand is alirocumab or SAR236553 / REGN727.

In one embodiment, the ligand is or comprises the variable domain of the antibody evolocumab, or is or includes such antibody or a PCSK9-binding derivative thereof. In one example, the antibody is glycosylated and has e.g. B. human glycosylation (eg produced by a CHO, Cos or Hek293 cell). Preferably, the ligand is evolocumab.

In one embodiment, the ligand is selected from evolocumab, 1D05-IgG2 (Merck & Co.), ALN-PCS02 (alnylam), RN316 (Pfizer-rinate), and alirocumab.

• 1. Ein Antikörper oder antigenbindendes Fragment davon, der/das spezifisch hPCSK9 bindet, wobei der Antikörper bzw. das antigenbindende Fragment die CDRs der schweren und der leichten Kette eines HCVR/LCVR-Aminosäuresequenzpaars mit den SEQ ID NO: 218/226 umfasst.
• 2. Der Antikörper bzw. das antigenbindende Fragment nach Konzept 1, der/das die CDRs der schweren und der leichten Kette der Aminosäuresequenzen mit den SEQ ID NO: 220, 222, 224, 228, 230 und 232 umfasst.
• 3. Der Antikörper bzw. das antigenbindende Fragment nach Konzept 2, der/das eine HCVR mit der Aminosäuresequenz der SEQ ID NO: 218 und eine LCVR mit der Aminosäuresequenz der SEQ ID NO: 226 umfasst.
• 4. Ein Antikörper oder ein antigenbindendes Fragment davon, der/das an das gleiche Epitop auf hPCSK9 bindet wie ein Antikörper, der die CDR-Aminosäuresequenzen der schweren und der leichten Kette mit SEQ ID NO: 220, 222, 224, 228, 230 und 232 umfasst.
• 5. Ein Antikörper oder ein antigenbindendes Fragment davon, der/das mit einem Antikörper, der die CDR-Aminosäuresequenzen der schweren und der leichten Kette mit SEQ ID NO: 220, 222, 224, 228, 230 und 232 umfasst, um Bindung an hPCSK9 konkurriert.

In one embodiment, the ligand is selected from the following (sequences and definitions according to US2011 / 0065902 , which is hereby incorporated herein by reference in its entirety): -

• An antibody or antigen-binding fragment thereof that specifically binds hPCSK9, wherein the antibody or antigen-binding fragment comprises the heavy and light chain CDRs of an HCVR / LCVR amino acid sequence pair having SEQ ID NOs: 218/226.
• 2. The antibody or antigen-binding fragment of Concept 1 comprising the CDRs of the heavy and light chain amino acid sequences of SEQ ID NOs: 220, 222, 224, 228, 230 and 232.
• 3. The antibody or antigen-binding fragment of Concept 2 comprising an HCVR having the amino acid sequence of SEQ ID NO: 218 and an LCVR having the amino acid sequence of SEQ ID NO: 226.
• 4. An antibody or antigen-binding fragment thereof which binds to the same epitope on hPCSK9 as an antibody comprising the heavy and light chain CDR amino acid sequences of SEQ ID NOs: 220, 222, 224, 228, 230 and 232 includes.
• 5. An antibody or antigen binding fragment thereof comprising an antibody comprising the heavy and light chain CDR amino acid sequences of SEQ ID NOs: 220, 222, 224, 228, 230 and 232 for binding to hPCSK9 competes.

• 1. Ein isoliertes neutralisierendes antigenbindendes Protein, das an ein PCSK9-Protein bindet, das die Aminosäuresequenz von SEQ ID NO: 1 umfasst, wobei das neutralisierende antigenbindende Protein die LDLR-senkende Wirkung von PCSK9 auf LDLR vermindert, wobei das antigenbindende Protein eine leichte Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 46 umfasst, und wobei das antigenbindende Protein eine schwere Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 60 umfasst.
• 2. Das isolierte neutralisierende antigenbindende Protein nach Konzept 2, wobei es sich bei dem antigenbindenden Protein um ein LDLR nicht kompetitiv neutralisierendes antigenbindendes Protein handelt.
• 3. Das isolierte neutralisierende antigenbindende Protein nach Konzept 2, wobei es sich bei dem antigenbindenden Protein um ein LDLR kompetitiv neutralisierendes antigenbindendes Protein handelt.
• 4. Ein antigenbindendes Protein, das selektiv an PCSK9 bindet, wobei das antigenbindende Protein mit einem Kd von weniger als 100 pM an PCSK9 bindet.
• 5. Ein antigenbindendes Protein, das an ein PCSK9-Protein von SEQ ID NO: 303 in einer ersten Weise bindet, wobei das antigenbindende Protein an eine Variante von PCSK9 in einer zweiten Weise bindet, wobei die PCSK9-Variante wenigstens eine Punktmutation in einer Position ausgewählt aus der Gruppe bestehend aus: 207, 208, 185, 181, 439, 513, 538, 539, 132, 351, 390, 413, 582, 162, 164, 167, 123, 129, 311, 313, 337, 519, 521 und 554 von SEQ ID NO: 303 aufweist, wobei die erste Weise einen ersten EC50, einen ersten Bmax, oder einen ersten EC50 und einen ersten Bmax umfasst, wobei die zweite Weise einen zweiten EC50, einen zweiten Bmax, oder einen zweiten EC50 und einen zweiten Bmax umfasst, und wobei der Wert für die erste Weise verschieden vom Wert für die zweite Weise ist, und wobei das antigenbindende Protein eine leichte Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 46 umfasst, und wobei das antigenbindende Protein eine schwere Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 60 umfasst.
• 6. Das antigenbindende Protein nach Konzept 6, wobei die erste Weise einen ersten Bmax umfasst, wobei die zweite Weise einen zweiten Bmax umfasst, der vom ersten Bmax verschieden ist, und wobei die PCSK9-Variante wenigstens eine Punktmutation ausgewählt aus der Gruppe bestehend aus: D162R, R164E, E167R, S123R, E129R, A311R, D313R, D337R, R519E, H521R und Q554R aufweist.
• 7. Das antigenbindende Protein nach Konzept 6, wobei das antigenbindende Protein an PCSK9 an einer Stelle bindet, die sich mit einer Stelle, an der LDLR an PCSK9 bindet, überlappt.
• 8. Ein Verfahren zur Herstellung eines antigenbindenden Proteins, das an ein PCSK9-Protein bindet, das die Aminosäuresequenz von SEQ ID NO: 1 umfasst, wobei das antigenbindende Protein die LDLR-senkende Wirkung von PCSK9 auf LDLR vermindert, wobei das Verfahren Folgendes umfasst: die Bereitstellung einer Wirtszelle, welche eine Nukleinsäuresequenz umfasst, die für das antigenbindende Protein codiert; und die Aufrechterhaltung der Wirtszelle unter Bedingungen, bei denen das antigenbindende Protein exprimiert wird, wobei das antigenbindende Protein eine leichte Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 46 umfasst, und wobei das antigenbindende Protein eine schwere Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 60 umfasst.
• 9. Ein Verfahren zur Behandlung oder Prävention eines mit erhöhten Serumcholesterinspiegeln in einem Subjekt assoziierten Leidens, wobei das Verfahren die Verabreichung einer wirksamen Menge eines isolierten neutralisierenden antigenbindenden Proteins gleichzeitig oder aufeinanderfolgend mit einem die Verfügbarkeit an LDLR-Protein erhöhenden Mittel an ein dessen bedürftiges Subjekt umfasst, wobei das isolierte antigenbindende Protein an ein PCSK9-Protein bindet, das die Aminosäuresequenz von SEQ ID NO: 1 umfasst, wobei das neutralisierende antigenbindende Protein die LDLR-senkende Wirkung von PCSK9 auf LDLR vermindert, wobei das antigenbindende Protein eine leichte Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 46 umfasst, und wobei das antigenbindende Protein eine schwere Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 60 umfasst.
• 10. Das Verfahren nach Konzept 10, wobei das Mittel, das die Verfügbarkeit an LDLR-Protein erhöht, ein Statin umfasst.
• 11. Ein antigenbindes Protein, das an PCSK9 bindet, wobei sich, wenn das antigenbindende Protein an PCSK9 gebunden ist, der Antikörper 8 Angström oder weniger von wenigstens einem der folgenden Reste von PCSK9 befindet: S153, S188, I189, Q190, S191, D192, R194, E197, G198, R199, V200, D224, R237, D238, K243, S373, D374, S376, T377, F379, I154, T187, H193, E195, I196, M201, V202, C223, T228, S235, G236, A239, G244, M247, I369, S372, C375 oder C378, wobei das antigenbindende Protein eine leichte Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 46 umfasst, und wobei das antigenbindende Protein eine schwere Kette umfasst, die eine Aminosäuresequenz von SEQ ID NO: 60 umfasst.

In one embodiment, the ligand is selected from the following (sequences and definitions according to US2012 / 0093818 , which is hereby incorporated herein by reference in its entirety): -

• An isolated neutralizing antigen binding protein that binds to a PCSK9 protein comprising the amino acid sequence of SEQ ID NO: 1, wherein the neutralizing antigen binding protein reduces the LDLR lowering effect of PCSK9 on LDLR, wherein the antigen binding protein is a light chain comprising an amino acid sequence of SEQ ID NO: 46, and wherein the antigen-binding protein comprises a heavy chain comprising an amino acid sequence of SEQ ID NO: 60.
• 2. The isolated neutralizing antigen binding protein of Concept 2, wherein the antigen binding protein is an LDLR non-competitively neutralizing antigen binding protein.
• 3. The isolated neutralizing antigen binding protein of Concept 2, wherein the antigen binding protein is an LDLR competitively neutralizing antigen binding protein.
• 4. An antigen-binding protein that selectively binds to PCSK9, with the antigen-binding protein binding to PCSK9 with a Kd of less than 100 pM.
• 5. An antigen-binding protein that binds to a PCSK9 protein of SEQ ID NO: 303 in a first manner, wherein the antigen-binding protein binds to a variant of PCSK9 in a second manner, the PCSK9 variant having at least one point mutation in one position selected from the group consisting of: 207, 208, 185, 181, 439, 513, 538, 539, 132, 351, 390, 413, 582, 162, 164, 167, 123, 129, 311, 313, 337, 519 , 521 and 554 of SEQ ID NO: 303, the first one comprising a first EC50, a first Bmax, or a first EC50 and a first Bmax, wherein the second way comprises a second EC50, a second Bmax, or a second EC50 and a second Bmax, and wherein the value for the first mode is different from the value for the second And wherein the antigen-binding protein comprises a light chain comprising an amino acid sequence of SEQ ID NO: 46, and wherein the antigen-binding protein comprises a heavy chain comprising an amino acid sequence of SEQ ID NO: 60.
• 6. The antigen-binding protein of Concept 6, wherein the first mode comprises a first Bmax, wherein the second mode comprises a second Bmax other than the first Bmax, and wherein the PCSK9 variant comprises at least one point mutation selected from the group consisting of: D162R, R164E, E167R, S123R, E129R, A311R, D313R, D337R, R519E, H521R and Q554R.
• 7. The antigen-binding protein of Concept 6, wherein the antigen-binding protein binds to PCSK9 at a site that overlaps a site where LDLR binds to PCSK9.
• 8. A method for producing an antigen-binding protein that binds to a PCSK9 protein comprising the amino acid sequence of SEQ ID NO: 1, wherein the antigen-binding protein reduces the LDLR-lowering effect of PCSK9 on LDLR, the method comprising: the provision of a host cell comprising a nucleic acid sequence encoding the antigen-binding protein; and maintaining the host cell under conditions wherein the antigen binding protein is expressed, wherein the antigen binding protein comprises a light chain comprising an amino acid sequence of SEQ ID NO: 46, and wherein the antigen binding protein comprises a heavy chain having an amino acid sequence of SEQ ID NO: 60.
• 9. A method for treating or preventing a condition associated with elevated serum cholesterol levels in a subject, the method comprising administering an effective amount of an isolated neutralizing antigen-binding protein concurrently or sequentially with an LDLR protein-enhancing agent to a subject in need thereof wherein the isolated antigen-binding protein binds to a PCSK9 protein comprising the amino acid sequence of SEQ ID NO: 1, wherein the neutralizing antigen-binding protein reduces the LDLR-lowering effect of PCSK9 on LDLR, wherein the antigen-binding protein comprises a light chain an amino acid sequence of SEQ ID NO: 46, and wherein the antigen-binding protein comprises a heavy chain comprising an amino acid sequence of SEQ ID NO: 60.
• 10. The method of Concept 10, wherein the agent that increases the availability of LDLR protein comprises a statin.
• 11. An antigen binding protein that binds to PCSK9, wherein when the antigen binding protein is bound to PCSK9, the antibody is 8 angstroms or less of at least one of the following residues of PCSK9: S153, S188, I189, Q190, S191, D192 , R194, E197, G198, R199, V200, D224, R237, D238, K243, S373, D374, S376, T377, F379, I154, T187, H193, E195, I196, M201, V202, C223, T228, S235, G236 , A239, G244, M247, I369, S372, C375 or C378, wherein the antigen-binding protein comprises a light chain comprising an amino acid sequence of SEQ ID NO: 46, and wherein the antigen-binding protein comprises a heavy chain having an amino acid sequence of SEQ ID NO: 60 includes.

The ligand may be used for the treatment, therapy, prophylaxis and / or diagnosis of one or more diseases or conditions or conditions of susceptibility thereto, such diseases or conditions as described in U.S. Pat US20120093818A1 (Amgen, Inc) and US20110065902A1 (Regeneron Pharmaceuticals, Inc) include, e.g. A disease or condition described in paragraphs [0375] to [0383] of US20120093818A1 is disclosed, the disclosure of which is incorporated herein by reference in its entirety for inclusion in any one or more of the claims.

The ligand can be a human like in US20120093818A1 (Amgen, Inc.) or US20110065902A1 characterized as described; these documents being incorporated herein by reference in their entirety.

The ligand can be found in an in US20120093818A1 (Amgen, Inc.) or US20110065902A1 disclosed form or combination, this disclosure is incorporated herein by reference. For example, the ligand with a drug, excipients, diluents or carriers as in US20120093818A1 (Amgen, Inc.) or US20110065902A1 (eg as in paragraphs [0384] to [0412] of US20120093818A1 This disclosure is incorporated herein by reference, and the present invention also relates to the corresponding pharmaceutical compositions comprising the combination of a ligand of this invention and such other agent. The above references are incorporated herein by reference in their entirety.

The ligand can be in a like in US20120093818A1 (Amgen, Inc.) or US20110065902A1 , z. In paragraphs [0413] to [0415] of US20120093818A1 , Diagnostic methods are used, this disclosure is incorporated herein by reference. The above references are incorporated herein by reference in their entirety.

Diagnostic applications

According to some embodiments, the ligand of the invention is a diagnostic tool. The ligand can be used to study the amount of PCSK9 present in a sample and / or subject. As those skilled in the art will appreciate, such ligands need not be neutralizing ligands. In some embodiments, the diagnostic ligand is not a neutralizing ligand. In some embodiments, the diagnostic ligand binds to an epitope other than that to which a neutralizing ligand binds. According to some embodiments, the two ligands do not compete with each other.

According to some embodiments, the ligands of the invention are used or provided in an assay kit and / or method for detecting PCSK9 in mammalian tissues or cells for screening / diagnosis for a disease or disease associated with changes in PCSK9 levels. The kit includes a ligand that binds PCSK9 and means for indicating binding of the ligand to PCSK9, if present, and optionally, the levels of PCSK9 protein. Various means can be used to indicate the presence of a ligand. For example, one can attach fluorophores, other molecular probes or enzymes to the ligand and observe the presence of the ligand in several ways. The method of screening for such diseases may include the use of the kit or simply the application of one of the disclosed ligands and the determination of whether the ligand binds to PCSK9 in a sample. It will be appreciated by those skilled in the art that high or elevated levels of PCSK9 result in larger amounts of the ligand binding to PCSK9 in the sample. The degree of ligand binding can thus be used to determine how much PCSK9 is present in a sample. Subjects or samples with an amount of PCSK9 that is above a predetermined amount (e.g., an amount or range that a subject would have without a PCSK9 related disease) may be considered to be at a PCSK9 mediated level Illness be characterized. According to some embodiments, the invention provides a method of administering the ligand to a statin-occupying subject to determine if the statin has increased the amount of PCSK9.

In some embodiments, the ligand is a non-neutralizing ligand used to detect the amount of PCSK9 in a subject receiving ABP and / or statin treatment.

According to some embodiments, the ligand of the invention may bind specifically to human PCSK9 (eg, one, two or more rare form variants disclosed herein) and is characterized by at least one of the following: (i) the ability to reduce serum total cholesterol by at least about 25%. 35% and to maintain the reduction over a period of at least 24 days as compared to a level before administration of the dose; (ii) the ability to reduce serum LDL cholesterol by at least about 65-80% and to maintain the reduction over a period of at least 24 days compared to a level prior to the administration of the dose; (iii) the ability to reduce serum LDL cholesterol by at least about 40-70% and to maintain the reduction over a period of at least 60 or 90 days compared to a level prior to the administration of the dose; (iv) the ability to reduce serum triglyceride content by at least about 25-40% compared to the level prior to administration of the dose; (v) no reduction in serum HDL cholesterol or no reduction in serum HDL cholesterol by more than 5% compared to the level before dose administration. In accordance with some embodiments, an isolated nucleic acid molecule encoding the ligand is provided. According to some embodiments, an expression vector comprising the nucleic acid molecule is provided. According to some embodiments, there is provided a pharmaceutical composition which may comprise the ligand and a pharmaceutically acceptable carrier. According to some embodiments, there is provided a method of treating a disease or condition that can be alleviated, improved, inhibited or prevented with a PCSK9 antagonist ligand of the present invention. The method may comprise administering a therapeutic amount of the pharmaceutical composition or ligand to a subject in need thereof. In some embodiments, the subject is a human subject suffering from hypercholesterolemia or hyperlipidemia, in which LDL apheresis who has been identified as heterozygous for familial hypercholesterolemia, statin intolerant or not statinally-responsive, or at risk of occurrence of hypercholesterolemia, dyslipidemia, cholestatic liver disease, nephrotic syndrome, hypothyroidism, obesity, atherosclerosis and cardiovascular disease. In accordance with some embodiments, a subject is provided with a method of providing a treatment or therapy. According to some embodiments, the method comprises reducing serum cholesterol by at least 40-70% for at least 60 to 90 days. According to some embodiments, there is provided a method of obtaining a treatment or therapy, which method may comprise administering a ligand at a frequency of once every 60 to 90 days.

In one aspect, the invention provides a ligand of the invention which is a human antibody or an antigen-binding fragment of a human antibody, or which comprises such an antibody or fragment specific to human proprotein convertase subtilisin / Kexin type 9 (hPCSK9, e.g., one, two or more rare form variants disclosed herein, and optionally form a and / or form a ') binds and inhibits, characterized by the ability to reduce serum LDL cholesterol in one 40-80% over a period of 24, 60 or 90 days compared to a pre-dose level, with little or no reduction in serum HDL cholesterol and / or with little or no measurable effect liver function as determined by ALT and AST measurements.

• (i) die Fähigkeit zum Reduzieren des Serumgesamtcholesterins um wenigstens etwa 25–35% und zum Aufrechterhalten der Reduzierung über einen Zeitraum von wenigstens 24 Tagen im Vergleich zu einem Spiegel vor der Verabreichung der Dosis, vorzugsweise beträgt die Reduzierung des Serumgesamtcholesterins wenigstens etwa 30–40%;
• (ii) die Fähigkeit zum Reduzieren des Serum-LDL-Cholesterins um wenigstens etwa 65–80% und zum Aufrechterhalten der Reduzierung über einen Zeitraum von wenigstens 24 Tagen im Vergleich zu einem Spiegel vor der Verabreichung der Dosis;
• (iii) die Fähigkeit zur Reduzierung des Serumtriglyceridgehalts um wenigstens etwa 25–40% im Vergleich zum Spiegel vor der Verabreichung der Dosis;
• (iv) keine Reduzierung des Serum-HDL-Cholesterins oder eine Reduzierung des Serum-HDL-Cholesterins um nicht mehr als 5% im Vergleich zum Spiegel vor der Verabreichung der Dosis.

In one embodiment, the ligand of the invention comprises an antibody or an antigen-binding fragment of an antibody that specifically binds to hPCSK9 and is characterized by at least one of the following:

• (i) the ability to reduce serum total cholesterol by at least about 25-35% and maintain the reduction over a period of at least 24 days compared to a pre-dose level, preferably, the total serum cholesterol reduction is at least about 30-40 %;
• (ii) the ability to reduce serum LDL cholesterol by at least about 65-80% and to maintain the reduction over a period of at least 24 days compared to a level prior to the administration of the dose;
• (iii) the ability to reduce serum triglyceride content by at least about 25-40% compared to the level prior to the administration of the dose;
• (iv) no reduction in serum HDL cholesterol or no reduction in serum HDL cholesterol by more than 5% compared to the level before dose administration.

Please refer US2011 / 0065902 for definitions of these terms and optional features, the disclosure of which is incorporated herein by reference in its entirety.

In one embodiment, the invention comprises an antibody or an antigen-binding fragment of an antibody that specifically binds to hPCSK9 and is characterized by at least one of the following:

• (i) the ability to reduce serum LDL cholesterol by at least about 40-70% and to maintain the reduction over a period of at least 60 or 90 days compared to a level prior to administration of the dose;
• (ii) the ability to reduce serum triglyceride content by at least about 25-40% compared to the level prior to the administration of the dose;
• (iii) no reduction in serum HDL cholesterol or no reduction in serum HDL cholesterol by more than 5% compared to the level before dose administration.

In one embodiment, the antibody or antigen binding fragment is characterized as having increased binding affinity (KD) for hPCSK9 at pH 5.5 compared to KD at pH 7.4 , measured by plasmon surface resonance. According to a special In the embodiment, the antibody or fragment thereof exhibits at least a 20-fold, at least 40-fold, or at least a 50-fold increased affinity for PCSK9 at an acidic pH compared to a neutral pH as measured by surface plasmon resonance.

In one embodiment, the antibody or antigen-binding fragment is characterized as having no enhanced binding affinity for PCSK9 at an acidic pH as compared to a neutral pH as measured by plasmon surface resonance. According to a specific embodiment, the antibody or the fragment thereof exhibits a reduced binding affinity at an acidic pH.

In another embodiment, the antibody or antigen binding fragment binds human PCSK9, human PCSK9 with the GOF mutation D374Y, Java monkey PCSK9, rhesus monkey PCSK9, mouse PCSK9, rat PCSK9 and hamster PCSK9.

In one embodiment, the antibody or antigen binding fragment binds human PCSK9 and monkey PCSK9, but not mouse PCSK9, rat PCSK9, or hamster PCSK9.

In one embodiment, the invention includes an antibody or antigen binding fragment of an antibody comprising one or more of a Heavy Chain Variable Region (HCVR), a Light Chain Variable Region (LCVR) variable region ), HCDR1, HCDR2, HCDR3, disclosed in any of paragraphs [023] - [037] of US2011 / 0065902 , the disclosure of which is incorporated herein by reference in its entirety.

In a related embodiment, the invention encompasses an antibody or antigen-binding fragment of an antibody that specifically binds hPCSK9, the antibody or fragment comprising heavy and light chain CDR domains that are in the heavy and light chain sequence pairs selected from the group consisting of SEQ ID NO (with the sequence numbering US2011 / 0065902 2/10, 18/20, 22/24, 26/34, 42/44, 46/48, 50/58, 66/68, 70/72, 74/82, 90/92, 94/96, 98/106, 114/116, 118/120, 122/130, 138/140, 142/144, 146/154, 162/164, 166/168, 170/178, 186/188, 190/192, 194 / 202, 210/212, 214/216, 218/226, 234/236, 238/240, 242/250, 258/260, 262/264, 266/274, 282/284, 286/288, 290/298, 306/308, 310/312, 314/322, 330/332, 334/336, 338/346, 354/356, 358/360, 362/370, 378/380, 382/384, 386/394, 402 / 404, 406/408, 410/418, 426/428, 430/432, 434/442, 450/452, 454/456, 458/466, 474/476, 478/480, 482/490, 498/500, 502/504, 506/514, 522/524, 526/528, 530/538, 546/548, 550/552, 554/562, 570/572, 574/576, 578/586, 594/596, 598 / 600, 602/610, 618/620, 622/624, 626/634, 642/644, 646/648, 650/658, 666/668, 670/672, 674/682, 690/692, 694/696, 698/706, 714/716, 718/720, 722/730, 738/740 and 742/744 are included. In one embodiment, the CDR sequences in HCVR and LCVR are selected from the amino acid sequence pairs of SEQ ID NOs: 50/58, 66/68, 70/72, 74/82, 90/92, 94/96, 122/130, 138 / 140, 142/144, 218/226, 234/236, 238/240, 242/250, 258/260, 262/264, 314/322, 330/332 and 334/336. According to more specific embodiments, the CDR sequences are contained in HCVR / LCVR sequences selected from SEQ ID NOS: 90/92 and 218/226. The above references are incorporated herein by reference in their entirety.

In one example, the invention is characterized by a pharmaceutical composition comprising a ligand of the invention wherein the ligand comprises or consists of a recombinant human antibody or a fragment thereof specifically binding to hPCSK9, and a pharmaceutically acceptable carrier. In one embodiment, the invention is characterized by a composition which is a combination of the ligand of the invention (eg, an antibody or an antigen-binding fragment of an antibody) and a second therapeutic agent. The second therapeutic agent may be any agent which is advantageously combined with the ligand of the invention, for example, an agent capable of inducing cellular depletion of cholesterol synthesis by inhibiting 3-hydroxy-3-methylglutaryl (HMG ) Coenzyme A (CoA) reductase, such as cerovastatin, atorvastatin, simvastatin, pitavastine, rosuvastatin, fluvastatin, lovastatin, pravastatin, etc .; is able to inhibit cholesterol intake and / or bile acid recovery; is capable of increasing lipoprotein catabolism (such as niacin); and / or activators of the LXR transcription factor that plays a role in cholesterol elimination, such as 22-hydroxycholesterol.

In one example, the invention provides a method of inhibiting hPCSK9 activity using the anti-PCSK9 ligand of the invention (e.g., an antibody or antigen-binding portion of the antibody of the present invention), wherein the therapeutic methods comprise administering a therapeutically effective amount a pharmaceutical composition comprising an antibody according to the invention or an antigen-binding fragment of an antibody according to the invention. The disease being treated is any disease or condition that is improved, alleviated, inhibited or prevented by the removal, inhibition or reduction of PCSK9 activity. Specific populations that can be treated with the therapeutic methods of the invention include subjects identified as having LDL apheresis, subjects with Gain of Function Mutations ("GOF"), subjects with heterozygous familial hypercholesterolemia (Heterozygous Familial Hypercholesterolemia, heFH); Subjects with primary hypercholesterolemia who are statin intolerant or statin uncontrolled; and subjects at risk of hypercholesterolemia who may be treated preventively. Other indications include dyslipidemia associated with secondary causes such as type 2 diabetes mellitus, cholestatic liver disease (primary biliary cirrhosis), nephrotic syndrome, hypothyroidism, obesity; and the prevention and treatment of atherosclerosis and cardiovascular diseases.

In specific embodiments of the method according to the invention, the ligand according to the invention (for example anti-hPCSK9 antibody or antibody fragment according to the invention) is suitable for reducing elevated total cholesterol, non-HDL cholesterol, LDL cholesterol and / or apolipoprotein B (apolipoprotein B100).

The ligand according to the invention (eg the antibody or the antigen-binding fragment) can be used alone or in combination with a second agent, for example an HMG-CoA reductase inhibitor and / or another lipid-lowering medicament.

The term "isolated" in reference to a ligand, an antibody or a protein, for example, in one aspect, configuration, example or embodiment, means that a subject ligand, a subject antibody, is in question standing protein, etc. (1) is free of at least some other proteins with which it would normally be found, (2) is substantially free of other proteins from the same source, e.g. (4) of at least about 50 percent of polynucleotides, lipids, carbohydrates, or other materials with which it is associated in nature is separated was (5) functionally associated with a polypeptide with which it is not associated in nature (by covalent or noncovalent interaction) or (6) does not occur naturally. Typically, an "isolated" ligand, an "isolated" antibody, an "isolated" protein, etc. will constitute at least about 5%, at least about 10%, at least about 25%, or at least about 50% of a given sample. Genomic DNA, cDNA, mRNA or other RNA of synthetic origin or any combination thereof may encode such isolated ligand, such isolated antibody, such isolated protein, etc. Preferably, the isolated ligand, isolated antibody, isolated protein, etc. are substantially free of proteins or polypeptides or other contaminants found in its native environment that would interfere with its therapeutic, diagnostic, prophylactic, research, or other uses.

For example, an "isolated" antibody is one that has been identified, separated and / or recovered from a component of its production environment (eg, natural or recombinant). Preferably, the isolated polypeptide is free of association with all other components of its production environment, e.g. B. so that the antibody has been isolated to an FDA approved or approved standard. Contaminating components of its production environment, such as those derived from recombinant transfected cells, are materials that would typically interfere with research, diagnostic or therapeutic applications of the antibody, and may include enzymes, hormones and other proteinaceous or non-proteinaceous solutes. According to preferred embodiments, the polypeptide is purified: (1) more than 95% by weight of the antibody, for example as determined by the Lowry method, and in some embodiments more than 99% by weight; (2) to a degree sufficient to obtain at least 15 residues of an N-terminal or internal amino acid sequence by application of a Spinning Cup Sequenator; or (3) homogeneity by SDS-PAGE under non-reducing or reducing conditions with Coomassie blue. or preferably silver staining. Isolated antibodies include the antibody in situ within recombinant cells because at least one component will not be present in the natural environment of the antibody. Usually, an isolated polypeptide or isolated antibody is prepared by at least one purification step.

immunoconjugates

The invention encompasses the ligand (eg, antibody) conjugated to a therapeutic moiety ("immunoconjugate") such as a cytotoxin, a chemotherapeutic agent, an immunosuppressant, or a radioisotope. Cytotoxic agents include all agents that damage cells. Examples of suitable cytotoxic agents and chemotherapeutic agents for forming immunoconjugates are known in the art, see, for example WO 05/103081 , which is hereby incorporated by reference in its entirety by reference.

Bispecific antibodies

The antibodies of the present invention may be monospecific, bispecific or multispecific. Multispecific mAbs may be specific for different epitopes on a target polypeptide or contain antigen binding domains specific for more than one target polypeptide. See, for example, B. Tutt et al. (1991) J. Immunol. 147: 60-69 , The human anti-PCSK9 (e.g., anti-PCSK9) mAbs may be linked to another functional molecule, e.g. Another peptide or protein, or be expressed together. For example, an antibody or fragment thereof may be operably linked (eg, by chemical coupling, genetic fusion, non-covalent association, or otherwise) with one or more other molecular entities, such as another antibody or antibody fragment, to produce a bispecific or receives a multispecific antibody with a second binding specificity.

In an exemplary bispecific antibody format that can be used in the present invention, a first immunoglobulin (Ig) CH3 domain and a second Ig CH3 domain are used wherein the first and second Ig CH3 domains are in at least one amino acid, and wherein at least one amino acid difference reduces the binding of the bispecific antibody to protein A as compared to a bispecific antibody lacking the amino acid difference. In one embodiment, the first Ig CH3 domain binds protein A and the second Ig CH3 domain contains a mutation that reduces or eliminates protein A binding, such as an H95R modification (according to IMGT exon numbering; H435R according to EU numbering). The second CH3 may further comprise a Y96F modification (according to IMGT; Y436F according to EU). Other modifications that can be found in the second CH3 include the following: D16E, L18M, N44S, K52N, V57M, and V821 (according to EU, IMGT, D356E, L358M, N384S, K392N, V397M, and V422I) in the case of IgG1 antibodies; N44S, K52N and V82I (IMGT; N384S, K392N and V422I according to EU) in the case of IgG2 antibodies; and Q15R, N44S, K52N, V57M, R69K, E79Q and V82I (according to IMGT, Q355R, N3845, K392N, V397M, R409K, E419Q and V422I in the EU) in the case of IgG4 antibodies. Variations of the bispecific antibody format described above are contemplated within the scope of the present invention.

treatment population

The invention provides therapeutic methods for treating a human patient in need of a composition or ligand according to the invention. While lifestyle changes and conventional drug treatment are often successful in reducing cholesterol levels, not all patients are able to achieve the recommended target cholesterol levels through such approaches. Various conditions, such as familial hypercholesterolemia (FH), appear to be resistant to lowering LDL-C levels, despite aggressive use of conventional therapies. Homozygous and heterozygous familial hypercholesterolemia (hoFH, heFH) is a condition associated with premature atherosclerotic vascular disease. However, patients diagnosed with hoFH are largely unresponsive to conventional drug therapy and have limited treatment options. Specifically, treatment with statins that reduce LDL-C by inhibiting cholesterol synthesis and upregulating the hepatic LDL receptor could have little effect in patients who do not have LDL receptors or are deficient. A mean LDL-C reduction of only less than about 20% has recently been reported for statin-topped patients with genotype-confirmed hoFH. The addition of ezetimibe 10 mg / day to this protocol resulted in an overall reduction in LDL-C levels of 27%, which is still far from optimal. Likewise, many patients do not respond to statins, are ill-timed with statin therapy or can not tolerate statin therapy; In general, these patients are unable to control cholesterol with alternative treatments. There is a great unmet medical need for new treatments that address the shortcomings of current treatment options.

Specific populations that can be treated with the therapeutic methods of the invention include subjects identified as having LDL apheresis, subjects with PCSK9 activating (GOF) mutations, heterozygous familial hypercholesterolemia (heFH); Subjects with primary hypercholesterolemia who are statin intolerant or statin uncontrolled; and subjects at risk of hypercholesterolemia who may be treated preventively.

Therapeutic administration and formulations

The invention provides therapeutic compositions comprising the anti-PCSK9 ligands, antibodies or antigen-binding fragments thereof of the present invention. The administration of therapeutic compositions of the invention is administered with suitable carriers, excipients, and other agents incorporated in formulations to provide better transfer, delivery, tolerance, and the like. A variety of suitable formulations are found in the formulation collection known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa. These formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, (cationic or anionic) lipid-containing vesicles (such as LIPOFECTINT ^™ ), DNA conjugates, anhydrous resorption pastes, oil-in-water and water-in. Oil emulsions, emulsion carbowax (polyethyleneglycols of different molecular weights), semi-solid gels and semi-solid mixtures containing Carbowax. See also Powell et al. "Compendium of Excipients for Parenteral Formulations" PDA (1998) J Pharm Sci Technol 52: 238-311 ,

The dose may vary depending on the age and size of a subject to be administered, the target disease, the conditions, the route of administration, and the like. If one uses the ligand, z. Antibodies, the present invention for the treatment of various conditions and diseases associated with PCSK9, including hypercholesterolemia, diseases associated with LDL and apolipoprotein B, and disorders of lipid metabolism and the like in an adult patient, it is advantageous to use the ligand or To administer antibodies of the present invention intravenously, usually at a single dose of about 0.01 to about 20 mg / kg of body weight, more preferably about 0.02 to about 7, about 0.03 to about 5, or about 0.05 to about 3 mg / kg body weight. Frequency and duration of treatment can be adjusted according to the severity of the condition.

Various delivery systems are known which can be used to administer the pharmaceutical composition of the present invention; Thus, the composition invention provides the ligand z. By encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, receptor-mediated endocytosis (see e.g. Wu et al. (1987) J. Biol. Chem. 262: 4429-4432 ) ready. Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucosal linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.), and may be co-administered with other bioactive agents. The administration may be systemic or local.

The pharmaceutical composition can also be administered in a vesicle, in particular a liposome (see Langer (1990) Science 249: 1527-1533 ; Treat et al. (1989) in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (ed.), Liss, New York, pp. 353-365 ; Lopez-Berestein, ibid., Pp. 317-327 ; see general ibid.).

In certain situations, the pharmaceutical composition may be administered in a controlled release system. According to one embodiment, a pump may be used (see Langer, above; Sefton (1987) CRC Crit. Ref. Biomed. Closely. 14: 201 ). In another embodiment, one may use polymeric materials; please refer Medical Applications of Controlled Release, Langer and Wise (ed.), CRC Pres., Boca Raton, Fla. (1974) , In yet another embodiment, a controlled release system may be placed near the target of the composition, thereby still requiring a fraction of the systemic dose (see, e.g. Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138, 1984 ).

The injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc. These injectable preparations can be prepared by publicly known methods. The injectable preparations can be prepared, for example, by z. For example, the antibody described above or its salt may be dissolved, suspended or emulsified in a sterile aqueous medium or oily medium conventionally used for injections. As the aqueous medium for injection there are, for example, physiological saline, an isotonic solution containing glucose and other excipients, etc., which are used in combination with a corresponding solubilizing agent such as an alcohol (e.g., ethanol), a polyhydric alcohol (e.g. Propylene glycol, polyethylene glycol), a nonionic surfactant [e.g. Polysorbate 80, HCO-50 (polyoxyethylene (50 moles) adduct of hydrogenated castor oil), etc., can be used. As an oily medium z. B. Sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc. The injection prepared in this way is preferably filled into a corresponding ampoule. A pharmaceutical composition of the present invention can be administered subcutaneously or intravenously with a standard needle and syringe. Moreover, from the viewpoint of subcutaneous administration in the administration of a pharmaceutical composition of the present invention, a pen-shaped administering device is often used. Such a stick-shaped administering device is reusable or for single use. A reusable stick-shaped delivery device generally uses a replaceable cartridge containing a pharmaceutical composition. After the entire pharmaceutical composition in the cartridge has been administered and the cartridge is empty, the empty cartridge can be easily discarded and replaced with a new cartridge containing the pharmaceutical composition. The pen-shaped administering device can then be reused. In a pen-shaped disposable delivery device, there is no replaceable cartridge. Rather, the pen-shaped disposable delivery device is prefilled with the pharmaceutical composition residing in a reservoir in the device. After the pharmaceutical composition has been emptied from the reservoir, the entire device is discarded.

Numerous reusable pen and autoinjector delivery devices find application in the subcutaneous administration of a pharmaceutical composition of the present invention. Examples include, but are not limited to, AUTOPEN ^™ (Owen Mumford, Inc., Woodstock, UK), DISETRONIC ^™ pen (Disetronic Medical Systems, Burghdorf, Switzerland), HUMALOG MIX 75/25 ^™ pen, HUMALOG ^™ pen, HUMALIN 70/30 ^™ pen (Eli Lilly and Co., Indianapolis, Ind., USA), NOVOPEN ^™ I, II and III (Novo Nordisk, Copenhagen, Denmark), NOVOPEN JUNIOR ^™ (Novo Nordisk, Copenhagen, Denmark), BD ^™ pen (Becton Dickinson, Franklin Lakes, NJ, USA), OPTIPENT ^™ OPTIPEN PRO ^™ , OPTIPEN STARLET ^™ , and OPTICLIKT ^™ (sanofi-aventis, Frankfurt, Germany), to name a few. Examples of single-use pen-shaped delivery devices include, but are not limited to, subcutaneous administration of a pharmaceutical composition of the present invention, the SOLOSTAR ^™ pen (sanofi-aventis), the FLEXPEN ^™ (Novo Nordisk), and the KWIKPEN ^™ ( Eli Lilly).

Advantageously, the above-described pharmaceutical compositions for oral or parenteral use are prepared as dosage forms in a unit dose suitable for receiving a dose of the active ingredients. Such dosage forms in a unit dose include, for example, tablets, pills, capsules, injection preparations (ampoules), suppositories, etc. The amount of antibody mentioned above is generally about 5 to about 500 mg per dosage form in a unit dose; in particular, in one form for injection, the above-mentioned antibody is preferably contained in an amount of about 5 to about 100 mg, and in the other dosage forms in an amount of about 10 to about 250 mg.

The invention provides therapeutic methods in which the ligand of the invention, for. , The antibody or antibody fragment is useful in the treatment of hypercholesterolemia associated with various conditions involving hPCSK9. The anti-PCSK9 ligands of the invention, e.g. As antibodies or antibody fragments, are particularly suitable for the treatment of hypercholesterolemia and the like. Combination therapies may use the anti-PCSK9 ligand of the present invention in conjunction with, for example, one or more agents which: (1) cellularly deplete cholesterol synthesis by inhibiting 3-hydroxy-3-methylglutaryl (HMG) coenzyme A (CoA); Reductase such as cerivastatin, atorvastatin, simvastatin, pitavastatin, rosuvastatin, fluvastatin, lovastatin, pravastatin; (2) inhibit cholesterol uptake and / or bile acid recovery; (3) increase lipoprotein catabolism (such as niacin); and activators of the LXR transcription factor that play a role in cholesterol elimination, such as 22-hydroxycholesterol or fixed combinations such as ezetimibe plus simvastatin; a statin with a bile resin (eg, cholestyramine, colestipol, colesevelam), a fixed combination of niacin plus a statin (eg, niacin with lovastatin); or with other lipid-lowering agents such as omega-3-fatty acid ethyl esters (for example, Omacor).

Ligands of the invention are useful, for example, in assays for specific binding, genotyping or phenotyping of humans, for affinity purification of PCSK9 and for screening assays for identifying other antagonists of PCSK9 activity. Some of the ligands of the invention are useful for inhibiting the binding of PCSK9 to a related human receptor or protein, or for inhibiting PCSK9-mediated activities.

The invention includes anti-PCSK9 (e.g., PCSK9) antibody ligands having a modified glycosylation pattern. In some applications, modification to remove unwanted glycosylation sites may be useful, or e.g. B. Removing a Fucosegruppierung to increase the antibody-dependent cell-mediated cytotoxicity (Antibody-Dependent Cellular Cytotoxicity, ADCC) (see Shield et al. (2002) JBC 277: 26733 ). In other applications, galactosylation can be modified to modify complement-dependent cytotoxicity (CDC).

In one example, the invention is characterized by a pharmaceutical composition comprising a ligand of the invention wherein the ligand is a recombinant human antibody or a fragment thereof which specifically binds the PCSK9 (e.g., a rare variant described herein) or consists thereof, and a pharmaceutically acceptable carrier. In one embodiment, the invention is characterized by a composition which is a combination of an antibody ligand of the invention or an antigen-binding fragment of an antibody of the invention and a second therapeutic agent of the invention. The second therapeutic agent may be an antiinflammatory, antiangiogenic, analgesic, diuretic, chemotherapeutic, anticancer, vasodilator, vasoconstrictor, statin, beta-blocker, nutrient, adjuvant, antiobesity agent, and an antidiabetic act.

"Pharmaceutically acceptable" refers to the use in animals including humans by a federal or US state government approved or eligible or listed in the US Pharmacopoeia or any other generally recognized pharmacopeia. A "pharmaceutically acceptable carrier, pharmaceutically acceptable excipient, or pharmaceutically acceptable adjuvant" refers to a carrier, excipient or adjuvant which is administered to a subject together with an agent, e.g. , Any of the antibodies described herein or any of the antibody chains described herein, and which does not disrupt the pharmacological activity thereof and is non-toxic when administered at doses sufficient to administer a therapeutic amount of the agent.

In one example, the invention provides a method of inhibiting PCSK9 activity using the anti-PCSK9 ligand of the present invention (e.g., an antibody or antigen-binding portion of the antibody of the invention), wherein the therapeutic method comprises administering a therapeutically effective amount a pharmaceutical composition comprising the ligand. The disease being treated is any disease or condition that is improved, alleviated, inhibited or prevented by the removal, inhibition or reduction of PCSK9 activity.

By the term "therapeutically effective amount" is meant an amount that produces the desired effect for which it is administered. The exact amount depends on the purpose of the treatment and can be determined by those skilled in the art using known techniques (see, for example, Lloyd (1999) The Art, Science and Technology of Pharmaceutical Compounding).

Genotyping and phenotyping

• 1 Verfahren auf Hybridisierungsbasis
• 1.1 Dynamische allelspezifische Hybridisierung
• 1.2 ”Molecular Beacons”
• 1.3 SNP-Mikroarrays
• 2 Verfahren auf Enzymbasis
• 2.1 Restriktionsfragmentlängenpolymorphismus
• 2.2 Verfahren auf PCR-Basis
• 2.3 Flap-Endonuklease
• 2.4 Primer-Erweiterung
• 2.5 5'-Nuklease
• 2.6 Oligonukleotidligationsassay
• 3 Andere auf physikalischen Eigenschaften von DNA basierende Post-Amplifizierungs-Methoden
• 3.1 Einzelstrang-Konformations-Polymorphismus
• 3.2 Temperaturgradienten-Gelelektrophorese
• 3.3 Denaturierende Hochleistungsflüssigchromatographie
• 3.4 Hochauflösendes Schmelzen des gesamten Amplikons
• 3.5 Anwendung von DNA-fehlpaarungsbindenden Proteinen
• 3.6 SNPlex (SNPlex^TM ist eine von Applied Biosystems vertriebene geschützte Genotypisierungs-Plattform).

The person skilled in the art will be familiar with techniques that can be used for accurate genotyping and application of the invention. These include the following.

• 1 method based on hybridization
• 1.1 Dynamic allele-specific hybridization
• 1.2 "Molecular Beacons"
• 1.3 SNP microarrays
• 2 Enzyme-based methods
• 2.1 Restriction fragment length polymorphism
• 2.2 PCR-based methods
• 2.3 Flap endonuclease
• 2.4 primer extension
• 2.5 5'-nuclease
• 2.6 oligonucleotide ligation assay
• 3 Other post-amplification methods based on physical properties of DNA
• 3.1 single-stranded conformational polymorphism
• 3.2 Temperature gradient gel electrophoresis
• 3.3 Denaturing High Performance Liquid Chromatography
• 3.4 High-resolution melting of the entire amplicon
• 3.5 Application of DNA mismatch-binding proteins
• 3.6 SNPlex (SNPlex ^™ is a proprietary genotyping platform distributed by Applied Biosystems).

Next generation sequencing technologies such as pyrosequencing is also useful.

Reference is also made to GB2444410A and the genotyping method disclosed therein, which is incorporated herein by reference in its entirety.

Miniaturization assays, such as microarrays with oligonucleotide reagents immobilized on small surfaces, are frequently proposed for large-scale mutation analysis and high-throughput genotyping (large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome (US Pat. Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M , Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R, Chee M, Lander ES, Science. May 15, 1998; 280 (5366): 1077-82 ). Other high-throughput methods differentiate between alleles by differential hybridization, primer extension, ligation and cleavage of an allele-specific probe ( Reviewing Accessing genetic variation: genotyping single nucleotide polymorphisms, Syvänen AC, Nat Rev Genet. Dec. 2001; 2 (12): 930-42 ; Review Techniques patents for SNP genotyping, Twyman RM, Primrose SB, Pharmacogenomics. Jan. 2003; 4 (1): 67-79 ).

One approach to large-scale, fully automatic SNP analysis is the "homogeneous" assay, that is, a single phase assay with no separation steps that allows for continuous validation during amplification. The TaqMan ^™ Assay (Applied Biosystems), originally developed for quantitative real-time PCR, is a homogeneous, single-step assay used in determining the mutational status of DNA (see, eg, AA Komar (ed.), Single Nucleotide Polymorphisms, Methods in Molecular Biology 578, DOI 10.1007 / 978-1-60327-411-1_19, Humana Press, part of Springer Science + Business Media, LLC ; and Single Nucleotide Polymorphisms, Methods in Molecular Biology, Volume 578, 2009, pp. 293-306, The TaqMan Method for SNP genotyping, Gong-Qing Shen et al ). The TaqMan SNP Genotyping Assay utilizes the 5 'exonuclease activity of AmpliTaq Gold ^™ DNA polymerase to cleave a doubly labeled probe hybridized to the SNP-containing sequence of ssDNA. The cleavage separates a 5 'fluorophore from a 3' quencher, resulting in a detectable fluorescent signal. The use of two allele-specific probes carrying different fluorophores allows SNP determination in the same tube without post-PCR processing. The genotype is determined from the ratio of the intensities of the two fluorescent samples at the end of the amplification. Thus, instead of using the full set of real-time PCR data as in quantitative studies, only the endpoint data is used.

The TaqMan SNP genotyping in an automated manner with high throughput is facilitated through the use of validated pre-made TaqMan ^® -Genotypisierungsassays, but you can also custom TaqMan ^® assays use (Genotyping high throughput with single nucleotide polymorphisms, Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Olivier M, Pesich R, Hebert J, Chen YD, Dzau VJ, Curb D, Olshen R, Risch N, Cox DR, Botstein D, Genome Res. July 2001 ; 11 (7): 1262-8 ; Assessment of two flexible and compatible SNP Genotyping Platforms: TaqMan SNP Genotyping Assays and the SNPlex Genotyping System, De la Vega FM, Lazaruk KD, Rhodes MD, Wenz MH, Mutat Res. 3 June 2005; 573 (1-2): 111-35 ). The results of the assay can be automatically determined by genotyping software supplied with the real-time thermal cycler (eg Bio-Rad's IQ software, Sequence Detection Software by Applied Biosystems).

Single nucleotide polymorphisms (SNPs) can be determined with TaqMan ^™ real-time PCR assays (Applied Biosystems) and commercial software that maps genotypes based on reporter probe signals at the end of the amplification. An algorithm for automatic genotype calling of SNPs using all the collected TaqMan real-time data is available ( Callegaro et al, Nucleic Acids Res. 2006; 34 (7): e56, published online on April 14, 2006. doi: 10.1093 / nar / gkl185 , PMCID: PMC1440877). The algorithm is unique in that it classifies samples according to the behavior of blank (no DNA samples) forming clusters of heterozygous samples. This classification procedure eliminates the need for positive controls and allows for accurate genotyping even in the absence of a genotype class, for example, when an allele is rare.

Those skilled in the art will be familiar with techniques that can be used to accurately phenotype and practice the invention. These include the use of amino acid sequencing of the isolated target protein and the comparison of the sequences of different variants (eg with the most frequently occurring variant). To identify a particular variant, one can also make use of an antibody which binds under stringent conditions specifically and selectively in the region of an SNP. In another method, the genotype is determined and a corresponding amino acid sequence (phenotype) determined, for. By computer translation.

For convenience, the meanings of some of the terms and terms used in the specification, examples, and appended claims are listed below. Unless otherwise stated or obvious from the context, the following terms and expressions include the meanings listed below. The definitions are provided to aid in the description of particular embodiments, and are not intended to limit the claimed invention, as the scope of the invention is limited only by the claims. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Should there be an apparent discrepancy between the manner in which a term is used in the art and the definitions given herein, the definition provided in the description should be given precedence.

For convenience, certain terms used herein, in the description, examples and appended claims, are collected here.

The terms "reduce", "reduce" or "reduce" are all used herein to refer to a decrease by a statistically significant amount. In accordance with some embodiments, reducing, reducing or decreasing typically means a reduction of at least 10% compared to the comparison level (e.g., the absence of a given treatment) and may, for example, be reduced by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, "reduction" does not include a complete reduction compared to a comparison mirror. A reduction is preferably made down to a level that is recognized to be within the normal range for an individual without a given disease. For example, for purposes of lowering or reducing cholesterol, a reduction of about 5-10 points may be considered a "reduction" or "reduction."

In certain aspects of all embodiments of the invention, the term "inhibition" is used. Inhibition refers to and refers to a reduction of at least 10% compared to a comparative level (e.g., the absence of a given treatment) and may, for example, be reduced by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more including 100% inhibition compared to a comparison level. "Complete inhibition" refers to a 100% inhibition compared to a comparison level.

The terms "increased", "increase", "enhance" or "activate" are all used herein to refer to an increase by a statistically significant amount. According to some embodiments, the terms "increased," "increase," "enhance," or "activate" may include an increase of at least 10% compared to a comparison level, for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or an increase between 10 100% compared to a comparative mirror, or at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times, increasing any increase between 2-fold and 10-fold or more compared to a comparison mirror mean. In the context of a marker or symptom, an "increase" is a statistically significant increase in such a level.

As the term is used herein, "substantially" refers to the qualitative condition that a complete or nearly complete degree or degree of feature or feature of interest is shown. It will be appreciated by those of ordinary skill in the biology arts that biological and chemical phenomena rarely, if ever, are complete and / or exhaustive, or achieve or avoid an absolute result. The term "essentially" is therefore intended to express the possible lack of completeness peculiar to many biological and chemical phenomena. To avoid doubts, "substantially" may here refer to a degree or degree of interest characteristic or property of at least 90%, e.g. At least 90%, at least 92%, at least 95%, at least 98%, at least 99% or more.

As the term is used herein, "subject" refers to a human or an animal. Usually, the animal is a vertebrate, such as a primate, a rodent, a pet, or a game bird. The primates include chimpanzees, Javaaner monkeys, spider monkeys and macaques, eg. B. rhesus monkeys. The rodents include mice, rats, woodchucks, ferrets, rabbits and hamsters. According to some embodiments, the subject is a mammal, e.g. B. a primate, z. For example, a human. The terms "individual", "patient" and "subject" are used interchangeably herein. According to some embodiments, the subject may be a non-human vertebrate, e.g. A primate, a rodent, a mouse, a rat, a pig, a sheep, a zebrafish, a frog, etc.

The subject is preferably a mammal. The mammal may be a human, a nonhuman primate, a mouse, a rat, a dog, a cat, a horse or a cow, these examples being non-limiting. Non-human mammals may be advantageously used as subjects having animal models of a disease or condition, e.g. As a cardiovascular disease represent. A subject can be male or female.

A subject may be one who has previously been diagnosed or found to be suffering from or has a condition requiring treatment, or one or more complications associated with such a condition, and who may be have already undergone treatment for the condition or the one or more complications associated with the condition. Alternatively, the subject may also be one who has not yet been diagnosed with the condition or the one or more complications associated with the condition. For example, the subject may be one having one or more risk factors for the condition or the one or more complications associated with the condition, or a subject having no risk factors.

A subject in need of treatment for a particular affliction or "needy person" may be a subject suffering from such a disease, such as a patient. B. has elevated cholesterol levels, in which such a condition has been diagnosed or in which there is a risk of the occurrence of the disease.

As used herein, the terms "protein" and "polypeptide" are used interchangeably to refer to a series of amino acid residues joined together by peptide bonds between the alpha-amino and carboxyl groups of adjacent residues. The terms "protein" and "polypeptide" refer to a polymer of amino acids with natural amino acids. When referring to "modified polypeptides", it refers to polypeptides that include modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogs, regardless of their size or function. "Protein" and "polypeptide" are often used in reference to relatively large polypeptides, while the term "peptide" is often used in reference to small polypeptides, but the use of these terms in the prior art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Exemplary polypeptides or proteins thus include gene products, naturally occurring proteins of the indicated sequence. One can also use peptide homologs, peptide-tortohols, peptide paralogues, peptide fragments, and other equivalents, variants, fragments, and analogs of the peptides, as one of ordinary skill in the art will be familiar with these terms.

As used herein, the term "nucleic acid" or "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule comprising units of ribonucleic acid, deoxyribonucleic acid. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid may be a nucleic acid strand of a denatured double-stranded DNA. Alternatively, it may be a single-stranded nucleic acid that is not derived from a double-stranded DNA. In one aspect, the nucleic acid may be DNA. In another aspect, the nucleic acid may be RNA. Suitable nucleic acid molecules are DNA including genomic DNA or cDNA. Other suitable nucleic acid molecules are RNA, including mRNA. In some aspects, one can also use analogs of nucleic acids.

As used herein, the term "nucleic acid probe" refers to an isolated oligonucleotide molecule having a nucleic acid sequence capable of hybridizing to a target nucleic acid sequence, e.g. B. specifically hybridized with the target sequence. In some embodiments, a nucleic acid probe may further comprise a detectable marker. According to some embodiments, a nucleic acid probe may be bound to a solid surface. In some embodiments, a nucleic acid has a length of about 5 nt to about 100 nt.

As used herein, the term "siRNA" refers to a nucleic acid that forms an RNA molecule comprising two distinct RNA strands that are substantially complementary to each other. Typically, the siRNA has a length of at least about 15-40 nucleotides (eg, the complementary sequences of the double-stranded siRNA are each about 15-40 nucleotides in length and the double-stranded siRNA is about 15-40 base pairs in length, preferably about 19-25 base nucleotides, e.g., 19, 20, 21, 22, 23, 24, or 25 nucleotides in length). According to some embodiments, an siRNA may have truncated ends. In some embodiments, an siRNA on the individual strands may have a 3 'and / or 5' overhang of about 0, 1, 2, 3, 4, or 5 nucleotides in length. The length of the overhang is independent between the two strands, d. H. the length of the overhang on the one strand does not depend on the length of the overhang on the second strand. The siRNA molecules may also include a 3'-hydroxy group. According to some embodiments, the siRNA may comprise a 5'-phosphate group. An siRNA has the ability to reduce or inhibit the expression of a gene or target RNA when the siRNA is in the same cell as the target gene, e.g. As the target RNA, is present or expressed therein. In siRNA-dependent post-transcriptional silencing of gene expression, the target RNA molecule is cut at one site through the siRNA.

As used herein, "PCSK9" or "Proprotein Convertase Subtilisin / Kexin Type 9" refers to a serine protease involved in the regulation of the low density lipoprotein receptor (LDLR) receptor protein receptor protein ( Horton et al., 2007; Seidah and Prat, 2007 ). It has been shown that PCSK9 interacts directly with the LDLR protein, is endocytosed together with the LDLR, and is immunofluoresced with the LDLR along the endosomal pathway ( Lagace et al., 2006 ). PCSK9 is a prohormone proprotein convertase from the subtilisin (S8) family of serine proteases ( Seidah et al., 2003 ). The sequence of PCSK9 of various types is known, e.g. B. human PCSK9 (NCBI Gene ID No: 255738). Nucleotide and polypeptide sequences for a variety of PCSK9 isoforms are provided herein, e.g. SEQ ID NO: 1-37.

PCSK9 exists both as a pro form and as a mature form. Autocatalysis of the PCSK9 pro-form occurs between Gln152 and Ser153 (VFAQ | SIP (SEQ ID NO: 67)) ( Naureckiene et al., 2003 ) and has been shown to be necessary for its secretion from cells ( Seidah et al., 2003 ). The inactive form prior to this cleavage may be referred to herein as "inactive,""pro-form," or "unprocessed" form of PCSK9. The C-terminal fragment generated by the autocatalysis event may be referred to herein as "mature", "cleaved", "processed" or "active" PCSK9. Examples of pro-form and mature PCSK9 isoforms are provided herein, see e.g. SEQ ID NO: 1-27.

As used herein, "catalytic domain" of PCSK9 refers to the portion of a PCSK9 polypeptide corresponding to positions 153 to 449 of PCSK9, e.g. SEQ ID NO: 1. As used herein, "C-terminal domain" of PCSK9 refers to the portion of a PCSK9 polypeptide corresponding to positions 450-692 of PCSK9, e.g. From SEQ ID NO: 1.

As used herein, a "PCSK9 mediated" disease refers to a disease or condition caused or characterized by a change in PCSK9, e.g. A change in the level of expression, a change in activity and / or the presence of a variant or mutation of PCSK9. Non-limiting examples of such diseases or conditions may include, for example, lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension, and cardiovascular disease or cardiovascular disease. An example is the disease or the condition an inflammatory or autoimmune disease or condition. Methods for identifying and / or diagnosing such diseases and conditions are well known to those of ordinary skill in the medical arts.

A subject at risk for the presence or onset of a PCSK9 mediated disease or condition may be a subject who exhibits one or more signs or symptoms of such a disease or condition, or one or more risk factors for such a disease or condition is present, e.g. Obesity, elevated cholesterol levels, one or more genetic polymorphisms known to predispose them to the disease or condition, e.g. Elevated cholesterol levels, such as having a mutation in the LDLR gene (encoding the low density lipoprotein receptor) or APOB gene (encoding apolipoprotein B) or in the PCSK9 gene and / or having a family history thereof Illness or disease.

As used herein, "ligand" refers to a molecule that binds to a second molecule or receptor, e.g. B. can specifically bind. In some embodiments, a ligand may be z. Example, an antibody, an antibody fragment, a part of an antibody and / or an affibody act.

The term "variant" as used herein refers to a peptide or nucleic acid derived from the polypeptide or nucleic acid (e.g., the most abundant in humans, e.g. which differs in one such database as disclosed herein, such as the 1000 Genomes Project database) by one or more amino acid deletions, additions, but retains one or more specific functions or biological activities of the naturally occurring molecule. Amino acid substitutions include changes in which one amino acid is replaced by another naturally occurring amino acid residue. Such substitutions may be termed "conservative", in which case an amino acid residue contained in a polypeptide is replaced by another naturally occurring amino acid of similar character in terms of polarity, side-chain functionality or size. Such conservative substitutions are well known in the art. Substitutions encompassed by the present invention may also be "non-conservative," where an amino acid residue present in one peptide is replaced by an amino acid having other properties, such as a naturally occurring amino acid from another group (U.S. for example, a charged or hydrophobic amino acid is replaced by alanine) or, alternatively, a naturally occurring amino acid is replaced with a non-conventional amino acid. In some embodiments, amino acid substitutions are conservative. Also encompassed by the term variant when used in reference to a polynucleotide or polypeptide refers to a polynucleotide or polypeptide whose primary, secondary or tertiary structure may differ from a comparative polynucleotide or polypeptide (eg, as compared to a wild-type Polynucleotide or polypeptide).

Variants of PCSK9 are provided elsewhere. Variants of PCSK9 may include the forms described herein as a, f, c, r, p, m, e h, a j and q. Sequences of these variants are provided here, see e.g. SEQ ID NO: 1-27 and Tables 1, 2 and 5.

In some aspects, one can isolate or generate "synthetic variants", "recombinant variants" or "chemically modified" polynucleotide variants or polypeptide variants using methods well known in the art. "Modified variants" may include conservative or non-conservative amino acid changes as described below. Polynucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the comparison sequence. Some aspects include, but are not limited to, insertion variants, deletion variants, or substituted variants with substitutions of amino acids, including insertions and substitutions of amino acids and other molecules that are not normally present in the peptide sequence that is the basis for the variant, for example. the insertion of ornithine, which does not normally occur in human proteins. When referring to a polypeptide, the term "conservative substitution" refers to a change in the amino acid composition of the polypeptide that does not significantly alter the activity of the polypeptide. Conservative substitution, for example, refers to the replacement of one amino acid residue for another amino acid residue of similar chemical properties. Conservative amino acid substitutions include the replacement of a leucine for an isoleucine or valine, an aspartate for a glutamate or a threonine for a serine.

"Conservative amino acid substitutions" result from the replacement of one amino acid for another with similar structural and / or chemical properties as the replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate or a threonine with a serine. Thus, a "conservative substitution" of a particular amino acid sequence refers to the substitution of the amino acids that are not critical for polypeptide activity, or the substitution of amino acids for other amino acids with similar properties (eg, acidic, basic, positive or negative , polar or nonpolar, etc.) so that even the substitution of critical amino acids does not diminish the activity of the peptide (ie, the ability of the peptide to cross the blood brain barrier (BBB)). Tables for conservative substitutions that provide functionally similar amino acids are well known in the art. For example, the following six groups each contain amino acids that are conservative substitutions for each other: 1) alanine (A), serine (S), threonine (T); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); and 6) phenylalanine (F), tyrosine (Y), tryptophan (W). (See also Creighton, Proteins, WH Freeman and Company (1984) , which is hereby incorporated herein by reference in its entirety.) In accordance with some embodiments, individual substitutions, deletions or additions in which a single amino acid or a small percentage of amino acids is altered, added or deleted may also be considered "conservative substitutions.""If the change does not reduce the activity of the peptide. Insertions or deletions typically range from about 1 to 5 amino acids. The choice of conservative amino acids can be based on the position of the amino acid to be replaced in the peptide, for example, if the amino acid is on the outside of the peptide and exposed to solvents or is inside and not accessible to solvents.

In alternative embodiments, one can select the amino acid that replaces an existing amino acid based on the position of the amino acid present, ie its exposure to solvents (ie, when the amino acid is exposed to solvents or is present on the outer surface of the peptide or polypeptide, unlike amino acids that are inside and not accessible to solvents). The selection of such conservative amino acid substitutions are well known in the art, such as in U.S. Pat Dordo et al., J. Mol. Biol. 1999, 217, 721-739 and Taylor et al, J. Theor. Biol. 119 (1986); 205-218 and S. French and B. Robson, J. Mol. Evol. 19 (1983) 171 disclosed. Accordingly, one may select conservative amino acid substitutions that are suitable for amino acids on the outside of a protein or peptide (ie, amino acids exposed to a solvent); For example, but not by way of limitation, substitutions of Y for F, T for S or K, P for A, E for D or Q, N for D or G, R for K, G for N or A, T to S or K, D to N or E, I to L or V, F to Y, S to T or A, R to K, G to N or A, K to R, A to S, K or P.

In alternative embodiments, conservative amino acid substitutions may also be selected, including those suitable for amino acids within a protein or peptide, for example, one may make appropriate conservative substitutions for amino acids located within a protein or peptide (ie, the amino acids are not solvent exposed), for example, but not by way of limitation, the following conservative substitutions can be made: where Y is replaced by F, T to A or S, I to L or V, W to Y, M to L , N to D, G to A, T to A or S, D to N, I to L or V, F to Y or L, S to A or T and A to S, G, T or V. According to some embodiments not even conservative amino acid substitutions fall under the term variants.

As used herein, an "antibody" refers to IgG, IgM, IgA, IgD or IgE molecules or antigen-specific fragments thereof (including, but not limited to, a Fab, F (ab ') ₂ , Fv, disulfide-linked Fv, scFv, single domain antibody, closed-conformation multispecific antibody, disulfide-linked scfv, diabody), whether derived from a species naturally producing an antibody, or produced by recombinant DNA technology; whether isolated from serum, B cells, hybridomas, transfectomas, yeast or bacteria. Antibodies can be humanized by routine methods.

As described herein, an "antigen" is a molecule bound by a binding site on an antibody agent. Typically, antigens are bound by antibody ligands and are capable of eliciting an antibody response in vivo. An antigen can be a polypeptide, a protein, a nucleic acid or another molecule or a part thereof. The term "antigenic determinant" refers to an epitope on the antigen recognized by an antigen-binding molecule, more specifically, the antigen-binding site of the molecule.

As used herein, "antibody fragment" refers to a polypeptide that includes at least one immunoglobulin variable domain or immunoglobulin variable domain sequence and specifically binds to a given antigen. An antibody fragment may comprise an antibody or a polypeptide comprising an antigen-binding domain of an antibody. According to some embodiments, an antibody fragment may comprise a monoclonal antibody or a polypeptide comprising an antigen binding domain of a monoclonal antibody. For example, an antibody may include a heavy (H) heavy chain variable region (abbreviated as VH herein) and a light (L) chain variable region (abbreviated as VL herein). In another example, an antibody includes two heavy (H) chain variable regions and two light (L) chain variable regions. The term "antibody fragment" includes antigen-binding fragments of antibodies (e.g., single chain antibodies, Fab and sFab fragments, F (ab ') 2, Fd fragments, Fv fragments, scFv, and domain antibody (dAb) fragments (see eg de Wildt et al., Eur. J. Immunol. 1996; 26 (3): 629-39 ; which is incorporated herein by reference in its entirety) as well as complete antibodies. An antibody may have the structural features of IgA, IgG, IgE, IgD, IgM (as well as subtypes and combinations thereof). Antibodies can be from any source including mouse, rabbit, pig, rat and primate (human and non-human primate) and primed antibodies. Antibodies also include midibodies, humanized antibodies, chimeric antibodies and the like.

As used herein, "variable domain of an antibody" refers to the sections of the light and heavy chains of antibody molecules, the amino acid sequences of Complementarity Determining Regions (CDRs, ie, CDR1, CDR2 and CDR3), and framework regions (Framework Regions). FRs). VH refers to the variable domain of the heavy chain. VL refers to the variable domain of the light chain. According to the methods used in the present invention, the amino acid positions assigned to the CDRs and FRs can be determined according to Kabat ( Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md., 1987 and 1991 )) or according to the IMGT nomenclature.

D domain or region refers to the diversity domain or region (D = diversity) of an antibody chain. J domain or region refers to the junction domain (J = Joining) of an antibody chain.

An antibody "gene segment", z. A VH gene segment, D gene segment or JH gene segment, refers to an oligonucleotide having a nucleic acid sequence encoding that portion of an antibody, a VH gene segment, e.g. B. is an oligonucleotide comprising a nucleic acid sequence encoding a polypeptide VH domain.

The VH and VL regions can be further subdivided into hypervariability regions called "Complementarity Determining Regions"("CDR"), between which are more conserved regions called "Framework Regions"("FR") become. The extent of the backbone region and the CDRs was precisely defined (see IMGT or Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917 ; which by reference in their entirety become part of the present application). Each VH and VL typically consists of three CDRs and four FR located from the amino terminus to the carboxy terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

By the terms "antigen-binding fragment" or "antigen-binding domain" used interchangeably herein is meant one or more fragments of an unabridged antibody which retain the ability to bind specifically to the target of interest. Examples of binding fragments that fall within the term "antigen-binding fragment" of an unabridged antibody include (i) a Fab fragment, a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) an F (ab ') 2 fragment, a bivalent fragment which includes the two Fab fragments linked via a disulfide bridge in the hinge region; (iii) an Fd fragment consisting of the VH and CH1 domains; (iv) an Fv fragment consisting of the VL and VH domains of a single arm of an antibody, (v) a dAb fragment ( Ward et al., (1989) Nature 341: 544-546 ; which is incorporated herein by reference in its entirety) consisting of a VH or VL domain; and (vi) an isolated complementarity determining region (CDR) in which the specific antigen-binding functionality has been preserved.

As used herein, the term "antibody binding site" refers to a polypeptide or domain that comprises one or more CDRs of an antibody and is capable of binding an antigen. For example, the polypeptide comprises a CDR3 (eg, HCDR3). The polypeptide includes, for example, CDRs 1 and 2 (e.g., HCDR1 and 2) or CDRs 1-3 of a variable domain of an antibody (e.g., HCDRs1-3). In one example, the antibody binding site is provided by a single variable domain (e.g., a VH or VL domain). In another example, the binding site comprises a VH / VL pair or two or more such pairs.

As used herein, the term "specific binding" refers to a chemical interaction between two molecules, compounds, cells and / or particles wherein the first entity binds to the second target entity with greater specificity and affinity than binds it to a third entity, which is a non-target. For example, in a diagnostic test, the specific binding of a ligand can distinguish between two PCSK9 protein variants as described herein. According to some embodiments, specific binding may have an affinity of the first entity to the second entity that is at least 10-fold, at least 50-fold, at least 100-fold, at least 500-fold, at least 1000-fold, or greater than the affinity for the third -Target structure is refer. In the context of oligonucleotide strands that interact via hybridization, a specific binding may be a "specific hybridization".

In addition, and as described herein, a recombinant human / humanized antibody can be further optimized to reduce potential immunogenicity while maintaining functional activity for human therapy. In this regard, functional activity means a polypeptide capable of exhibiting one or more of the functional activities associated with a recombinant antibody or antibody reagent thereof as described herein. Such functional activities include, for example, the ability to bind a target molecule.

The term "immunizing" refers to the step or steps of administering one or more antigens to an animal to form antibodies in the animal. In general, immunization involves injecting the antigen or antigens into the animal. In an immunization, the antigen or antigens can be administered once or several times. Suitable methods are the known in the art Prime Boost and RIMMS methods.

As used herein, "affibody" refers to a relatively small synthetic protein molecule that has high binding affinity for a target protein (eg, for PCSK9 or a variant thereof). Affibodies are composed of a three-helix bundle domain derived from the IgA-binding domain of protein A from staphylococci. The protein domain consists of a sequence of 58 amino acids with 13 randomized amino acids, resulting in different affibody variants. Although they are significantly smaller than an antibody (an affibody weighs about 6 kDa, while an antibody usually weighs about 150 kDa), an affibody molecule functions like an antibody because its binding site, in terms of surface area, is approximately equivalent to the binding site of an antibody is.

As used herein, "VH3-23 * 04" refers to a human VH domain variant comprising the polypeptide sequence of SEQ ID NO: 38. In contrast to the control sequence, VH3-23 * 04 has a valine residue instead of a leucine residue (see 3 and 4 ; L24V, the numbering includes the signal sequence; Valine in position 5 is in 4 shown) as a result of the presence of rs56069819 SNP in the VH domain-encoding nucleic acid sequence. As used herein, "rs56069819" refers to a mutation or variant in a VH gene segment from adenosine to cytosine (or thymine to guanine, depending on which strand of the DNA is read), resulting in VH3-23 * 04 coding VH domain leads. Rs56069819 is in 4 and SEQ ID NO: 39 showing the T-> G mutation (note that the dbSNP entry for RS5606819 shows the other strand comprising the A> C mutation). Furthermore, there is a description of VH3-23 * 04 z. B. in the U.S. Patent Publication 2013/0071405 ; which is incorporated herein by reference in its entirety.

As used herein, "determining" or "determining" refers to a determination, e.g. B. by a quantitative or qualitative analysis. As used herein, "determined" may refer to a determination based on previously obtained information or concurrently obtained information.

In accordance with some aspects of all embodiments of the invention, a selection may include automation such as a computer-implemented software program when inputting the relevant data how ethnicity or a sequence of SNP data can make the determination based on the instructions deposited here.

As used herein, "performing an assay" refers to the analysis, evaluation, quantification, measurement or characterization of an analyte, e.g. Measuring the level of an analyte in a sample, identifying an analyte, or detecting the presence or absence of an analyte in a sample. In some embodiments, performing an assay refers to detecting the presence or absence of the analyte of interest. In accordance with some embodiments, performing an assay refers to quantifying the amount of an analyte, e.g. B. providing the concentration or frequency of an analyte. In accordance with some embodiments, performing an assay refers to counting the number of molecules of an analyte present in a sample and / or specimen, e.g. For determining the copy number of an analyte.

As used herein, "multiplexing" refers to the simultaneous performance of a method or process having two or more, typically three or more, different target sequences, e.g. With two or more isoforms of PCSK9 or PCSK9 and another target, in the same reaction vessel. Multiplex analysis typically includes analysis of 10-50; 10-100; 10-1000, 10-5000, 10-10000 reactions in a multiplex format such as a multiwall, array or multichannel response.

Often, the analysis or multiplex analysis is also done automatically with robots and software typically performed by a computer and may involve handling of samples by a robot, automatic or robotic selection of positive or negative results, presence or absence testing Absence of a target such as a nucleic acid polymorphism or a protein variant.

The term "biological sample" or "test sample" as used herein refers to a sample taken from a biological organism, e.g. B. a sample from a subject. Exemplary biological samples include, but are not limited to, a biofluid sample; Serum; Plasma; Urine; Saliva; Hair, epithelial cells, skin, a tumor biopsy and / or tissue sample, etc. The term also includes a mixture of the above-mentioned samples. The term "test sample" or "biological sample" also includes untreated or pretreated (or preprocessed) biological samples. For analysis of nucleic acids, the biological sample should typically comprise at least one cell comprising nucleic acids.

The test sample can be obtained by taking a cell sample from a subject, but can also be done using previously isolated cells (eg, isolated at a previous time and isolated by the same or another person). In addition, the test sample may be a freshly drawn or previously sampled, chilled, frozen or otherwise conserved sample.

In some embodiments, the test sample may be an untreated test sample. As used herein, "untreated test sample" refers to a test sample that has not been sample pre-treated except for dilution and / or suspension in a solution. Exemplary methods of treating a test sample include, but are not limited to, centrifuging, filtering, sonicating, homogenizing, heating, freezing and thawing, and combinations thereof. According to some embodiments, the test sample may be a frozen test sample, e.g. As a frozen tissue act. The frozen sample may be thawed prior to using the methods, assyas, and systems described herein. After thawing, a frozen sample may be centrifuged before being subjected to the methods described here, assyas, and systems. In some embodiments, the test sample is a test sample clarified by, for example, centrifuging and removing a supernatant containing the clarified test sample. In some embodiments, a test sample may be a pretreated test sample, for example a supernatant or filtrate obtained from a treatment selected from the group consisting of centrifugation, filtration, thawing, purification, and any combinations thereof. According to some embodiments, the test sample may be treated with a chemical and / or biological reagent. With chemical and / or biological reagents, the stability of the sample including biological molecules (eg, nucleic acid and protein) therein can be protected and / or maintained during treatment. An exemplary reagent is a protease inhibitor that is generally used to protect or maintain the stability of protein during processing. Those skilled in the art are well-versed in methods and procedures suitable for preprocessing biological samples needed for determination of the level of expression product as described herein.

As used herein, "genotyping" refers to a method of determining the specific allelic composition of a cell and / or subject at one or more positions in the genome, e.g. By determining the nucleic acid sequence at this position. Genotyping refers to nucleic acid analysis and / or analysis at the nucleic acid level. As used herein, "phenotyping" refers to a method of determining the identity and / or composition of an expression product of a cell and / or subject, e.g. By determining the polypeptide sequence of an expression product. Phenotyping refers to protein analysis and / or analysis at the protein level.

As used herein, the term "nucleic acid amplification" refers to the production of additional copies of a nucleic acid sequence and is typically performed using the polymerase chain reaction (PCR) or ligase chain reaction (LCR) well known in the art ) Technologies ( CW Dieffenbach and GS Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, USA ). Other methods of amplification are also contemplated in aspects of the invention.

The term "allele-specific amplification" refers to a reaction (eg, PCR reaction) in which at least one of the primers (eg, allele-specific primers) is selected from a polymorphic gene region (eg, single nucleotide polymorphism) the polymorphism is at or near the 3 'end of the primer. A mismatch primer will not initiate amplification while a suitable primer will initiate amplification. The appearance of an amplification product is indicative of the presence of the polymorphism.

As used herein, "sequencing" refers to the determination of the exact order of the nucleotide bases in a strand of DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) or the precise order of amino acid residues or peptides in a protein. Nucleic acid sequencing can be done by Sanger sequencing or next generation high-throughput sequencing.

As used herein, "next generation sequencing" refers to oligonucleotide sequencing technologies that are capable of sequencing oligonucleotides at rates above those achievable with conventional sequencing methods (eg, Sanger sequencing) Thousands to millions of sequencing reactions are performed and read out simultaneously. Non-limiting examples of next-generation sequencing methods / platforms include Massively Parallel Signature Sequencing (Lynx Therapeutics), 454 Pyro-Sequencing (454 Life Sciences / Roche Diagnostics), and reversible dye-terminator sequencing on a solid phase (Solexa / Illumina) SOLiD Technology (Applied Biosystems); Ion Semiconductor Sequencing (ION Torrent), DNA Nanoball Sequencing (Complete Genomics), and technologies available from Pacific Biosciences, Intelligen Bio-systems, Oxford Nanopore Technologies, and Helicos Biosciences. Next generation sequencing technologies and the limitations and design parameters of associated sequencing primers are well known in the art (see, eg, US Pat. Shendure, et al., "Next-generation DNA sequencing", Nature, 2008, Vol. 26, No. 10, 1135-1145 ; Mardis, "The impact of next-generation sequencing technology on genetics," Trends in Genetics, 2007, Vol. 24, No. 3, pp. 133-141 ; Su, et al., "Next-generation sequencing and its applications in molecular diagnostics." Expert Rev Mol. Diagn., 2011, 11 (3): 333-43 ; Zhang et al., "The impact of next-generation sequencing on genomics," J Genet Genomics, 2011, 38 (3): 95-109 ; ( P. Nyren et al. Anal Biochem 208: 17175 (1993) ; DR Bentley, Curr Opin Genet Dev 16: 545-52 (2006) ; RL Strausberg et al. Drug Disc Today 13: 569-77 (2008) ; U.S. Patent No. 7,282,337 ; U.S. Patent No. 7,279,563 ; U.S. Patent No. 7,226,720 ; U.S. Patent No. 7,220,549 ; U.S. Patent No. 7,169,560 ; U.S. Patent No. 6,818,395 ; U.S. Patent No. 6,911,345 ; US Pat. No. 2006/0252077 . 2007/0070349 and 20070070349 ; which are hereby incorporated by reference in their entirety part of the present application).

As used herein, "nucleic acid hybridization" refers to the mating of complementary RNA and DNA strands, as well as the pairing of complementary DNA single strands. According to some embodiments, nucleic acid hybridization may be directed to a method for determining a nucleic acid sequence and / or identity by hybridizing a nucleic acid sample to a probe, e.g. Northern blot or Southern blot analysis or microarray analysis.

As used herein, the terms "treating,""treating,""treating," or "enhancing" refer to therapeutic treatments whose purpose is to reverse the progression or severity of a disease associated with a disease or disease alleviate, improve, inhibit, slow or stop. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a disease, illness or disease. Treatment is generally "effective" if one or more symptoms or clinical markers are reduced. Alternatively, treatment is "effective" if the progression of a disease is reduced or arrested. That is, "treatment" includes not only improving symptoms or markers, but also stopping or at least slowing the progression or worsening of symptoms as compared to what would be expected in the absence of treatment. Useful or desirable clinical results include, but are not limited to, alleviating one or more symptoms, reducing the extent of the disease, stabilizing (ie not exacerbating) the disease state, delaying or slowing the progression of the disease, ameliorating or alleviating it disease status, remission (in whole or in part) and / or reduced mortality, whether detectable or not. The term "treatment" of a disease also includes providing relief of the symptoms or side effects of the disease (including palliative treatment). For effective treatment, complete healing is not required. The method may also include healing according to certain aspects.

As used herein, the term "pharmaceutical composition" refers to the active ingredient in combination with a pharmaceutically acceptable carrier, e.g. A carrier conventionally used in the pharmaceutical industry. The term "pharmaceutically acceptable" is used herein to refer to the compounds, materials, compositions and / or dosage forms which, in the context of a thorough medical evaluation, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, Irritation, allergic reactions or other problems or complications are appropriate, with a reasonable benefit-risk balance.

As used herein, the term "administering" refers to the placement of a compound as disclosed herein in a subject by a method or route that results in at least partial administration of the agent at a desired location. The pharmaceutical compositions comprising the compounds disclosed herein can be administered by any suitable route that results in the subject of effective treatment.

Multiple compositions may be administered separately or simultaneously. Separate administration refers to administering the two compositions at different times, e.g. B. at intervals of at least 10, 20, 30 or 10-60 minutes, or at intervals of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12 hours. It is also possible to administer compositions at intervals of 24 or even more frequently. Alternatively, two or more compositions may be administered simultaneously, e.g. B. at intervals of less than 10 or less than 5 minutes. Co-administered compositions can be administered in some aspects as a mixture with or without similar or different time release mechanisms for the individual components.

As used herein, "contacting" refers to any suitable means for administering an agent to a complex, enzyme or cell, or for exposing an agent to a complex, enzyme or cell. Exemplary methods of administration include, but are not limited to, direct administration to cell culture medium, perfusion, injection or other method of administration well known to those skilled in the art.

As used herein, "winning" refers to any method of acquiring, securing, procuring or possessing, e.g. B. a sample. Obtaining a biological sample from a subject can be the physical removal of a sample from a subject (e.g., a blood sample or a sample of hair or saliva) with or without the subject's active participation; receiving a sample from a subject (the subject, for example, collecting and providing a sample of saliva or hair, eg in a container provided for the purpose); or obtaining a sample from a storage facility, medical facility, or medical care provider. Gain from the human or subject refers to an active step z. B. the blood collection or the removal of a tissue or cell sample.

As used herein, "cholesterol level" refers to a level of one or more selected from total cholesterol, LDL cholesterol, HDL cholesterol, and / or triglycerides. Cholesterol levels can be the levels of cholesterol in the blood of a subject.

As used herein with reference to cholesterol levels, "maintaining" refers to preventing the level from deteriorating (eg, increasing). In some embodiments, maintenance of a particular level refers to a method that results in the cholesterol level increasing by no more than 10% over time.

Maintenance may also relate to the maintenance of a previously obtained level. For example, if a person has undergone statin treatment, one can maintain the level of cholesterol achieved through the use of statin treatment.

According to some embodiments, the cholesterol levels of the subject treated according to the methods described herein have been previously reduced. As used herein, "previously reduced" indicates that the subject has previously experienced a reduction in cholesterol levels. The reduction may be due to the administration of a pharmaceutical composition (e.g., the administration of a composition as described herein or another composition, eg, a statin) or to another cause, e.g. B. a change in diet and / or exercise may be due.

An existing treatment for high cholesterol is the administration of a statin. As used herein, "statins" (also known as HMG-CoA reductase inhibitors) are inhibitors of the enzyme HMG-CoA reductase, which mediates cholesterol production in the liver. Statins prevent the binding of HMG-CoA to the enzyme by competitive binding of HMG-CoA reductase and thus inhibit the activity of reductase (eg, the production of mevalonate). Non-limiting examples of statins may include atorvastatin (LIPITOR ^™ ), fluvastatin (LESCOL ^™ ), lovastatin (MEVACOR ^™ , ALTOCOR ^™ ), pitavastatin (LIVALO ^™ ), pravastatin (PRAVACHOL ^™ ), rosuvastatin (CRESTOR ^™ ), and simvastatin (ZOCOR ^™ ) , Statins may be used in combination with other agents, e.g. The combination of ezetimibe and simvastatin.

Some subjects are or become resistant to statin treatment. As used herein, "resistant to statin treatment" or "reduced response to statin treatment" refers to a subject that has a statistically significant lower response to the administration of a statin compared to a control level. In the comparison mirror, it may be z. For example, the average response of a population of subjects or the levels of the individual subject at an earlier time. A reaction to a statin treatment can be easily measured by the skilled person, z. B. Measurement of cholesterol levels, changes in cholesterol levels and / or HMG-CoA reductase activity.

As used herein, the term "detectable label" refers to a molecule or moiety that can be detected, e.g. B. measure and / or can be determined as present or absent. Detectable markers may include, for example, a light-absorbing dye, a fluorescent dye or a radioactive marker. Detectable markers, methods for detection thereof, and methods for incorporation into reagents (eg, antibody and nucleic acid probes) are well known in the art.

According to some embodiments, detectable labels may include markers that can be detected by spectroscopic, photochemical, biochemical, immunochemical, electromagnetic, radiochemical or chemical means such as fluorescence, chemiluminescence or chemiluminescence or other suitable means. The detectable markers used in the methods described herein may be primary markers (where the marker includes a moiety that is directly detectable or that produces a direct detectable moiety) or secondary markers (where the detectable marker is labeled to yield a detectable marker) Signal binds to another grouping, as is usually the case, for example, with immunological labeling with secondary and tertiary antibodies). The detectable label may be covalently or non-covalently bound to the reagent. Alternatively, a detectable label may be bound as such by direct labeling of a molecule that binds to the reagent via a ligand-receptor binding pairing or other such specific recognition molecule. Detectable markers may include, but are not limited to, radioisotopes, bioluminescent compounds, chromophores, antibodies, chemiluminescent compounds, fluorescent compounds, metal chelates, and enzymes.

In other embodiments, the detectable label may be a fluorescent compound. If the fluorescent marker is exposed to light of the correct wavelength, its presence can then be detected by fluorescence. According to some embodiments, a detectable label may be a fluorescent dye molecule or fluorophore including, but not limited to, fluorescein, phycoerythrin, phycocyanin, o-phthaldehyde, fluorescamine, Cy3 ^™ , Cy5 ^™ , allophycocyanin, Texas Red, peridenin chlorophyll , Cyanine, tandem conjugates such as phycoerythrin Cy5 ^™ , green fluorescent protein, rhodamine, fluorescein isothiocyanate (FITC) and Oregon Green ^™ , rhodamine and derivatives (e.g., Texas Red and tetrarhodimine isothiocyanate (TRITC)), biotin, phycoerythrin, AMCA, CyDyes ^TM , 6-Carboxythiorescein (commonly known by the abbreviations FAM and F, respectively), 6-carboxy-2 ', 4', 7 ', 4,7-hexachlorofluorescein (HEX), 6-carboxy-4', 5'-dichloro -2 ', 7'-dimethoxyfluorescein (JOE or J), N, N, N', N'-tetramethyl-o-carboxyrhodamine (TAMRA or T), 6-carboxy-X-rhodamine (ROX or R) , 5-carboxyhodamine-6G (R6G5 or G5), 6-carboxyhodamine-6G (R6G6 and G6, respectively) and rhodamine 110; Cyanine dyes, e.g. Cy3, Cy5 and Cy7 dyes; Coumarins, e.g. B. umbelliferone; Benzimidfarbstoffe, z. Hoechst 33258; Phenanthridine dyes, e.g. B. Texas Red; Ethidiumfarbstoffe; acridine; Carbazolfarbstoffe; phenoxazine; porphyrin; Polymethine dyes, e.g. Cyanine dyes such as Cy3, Cy5, etc .; BODIPY dyes and quinoline dyes act. According to some embodiments, a detectable label may be a radiolabel including, but not limited to, ³ H, ¹²⁵ I, ³⁵ S, ¹⁴ C, ³² P and ³³ P. In some embodiments, a detectable label may be an enzyme including, but not limited to, horseradish peroxidase and alkaline phosphatase. For example, an enzymatic label can produce a chemiluminescent signal, a color signal or a fluorescent signal. Enzymes contemplated for use as a detectable marker include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta-V steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triosephosphate isomerase, horseradish peroxidase, alkaline phosphatase , Asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-VI-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. According to some embodiments, a detectable label is a chemiluminescent label including, but not limited to, lucigenin, luminol, luciferin, isoluminol, acridinium acridinium ester, imidazole, acridinium salt and oxalate ester. According to some embodiments, a detectable label may be a spectral colorimetric marker including, but not limited to, colloidal gold or colored glass or plastic beads (eg, polystyrene, polypropylene, and latex).

According to some embodiments, reagents may also be labeled with a detectable tag such as c-Myc, HA, VSV-G, HSV, FLAG, V5, HIS or biotin. It is also possible to use other detection systems, for example a biotin-streptavidin system. In this system, the antibodies which are immunoreactive with (ie specific for) the biomarker of interest are biotinylated. The amount of biotinylated antibody bound to the biomarker is determined with a streptavidin-peroxidase conjugate and a chromogenic substrate. Such streptavidin-peroxidase detection kits are commercially available, e.g. From DAKO; Carpinteria, CA, USA. It is also possible to detectably label a reagent with fluorescence emitting metals such as ¹⁵² Eu and others of the lanthanide series. These metals can be attached to the reagent with metal chelating groups such as diethylenetriamine pentaacetic acid (DTPA) or ethylenediaminetetraacetic acid (EDTA).

As used herein, "regulatory number" or "drug regulatory number" refers to one of a regulatory agency when determining the authority that markets a particular medical product and / or medical composition in the region for which the regulatory authority is responsible or may be offered for sale, issued number. As used herein, "regulatory authority" refers to one of the candidates for the audit, e.g. The safety and efficacy of a medical product and / or medical composition, and the control of the sale / marketing of such products and / or compositions in a given region. The Food and Drug Administration (FDA) in the US and the European Medicines Agency (EPA) in Europe are just two examples of such regulatory agencies. Other non-limiting examples may include SDA, MPA, MHPRA, IMA, ANMAT, Hong Kong Department of Health Drug Office, CDSCO, Medsafe and KFDA.

As used herein, "injection device" refers to a device intended for the administration of injections, wherein an injection includes the steps of temporarily fluidly coupling the injection device to the tissue of a subject, typically the subcutaneous tissue. Injection further includes administering an amount of liquid drug to the tissue and disengaging or removing the injection device from the tissue. According to some embodiments an injection device is an intravenous device, or IV device, which is a type of injection device used when the target tissue is the blood in the bloodstream, e.g. B. the blood in a vein. A common but non-limiting example of an injection device is a needle and syringe.

As used herein, "buffer" refers to a chemical agent that is capable of accepting a certain amount of an acid or base without greatly changing the pH.

As used herein, "packaging" refers to how the components are arranged and / or fixed in a unit suitable for distribution and / or use. The packaging can z. As boxes, bags, syringes, ampoules, vials, tubes, hinged packaging, barriers and / or containers to maintain sterility, labeling, etc. include.

As used herein, "instructions" refers to a representation of written, printed, or graphic material on the immediate container of an article, for example, the written material displayed on a vial containing a pharmaceutical agent, or composition details, and the use of a product of interest contained in a kit containing a composition of interest. Instructions explain the treatment procedure as contemplated for administration or performance.

As used herein, "solid surface" refers to an object that is suitable for attaching biomolecules. Non-limiting examples of a solid surface may include a particle (including, but not limited to, an agarose or latex bead or an agarose or latex particle or a magnetic particle), a bead, a nanoparticle, a polymer, a substrate, a microscope slide, a coverslip, a plate, a plate, a depression, a membrane and / or a grid. The solid surface may include many different materials including, but not limited to, polymers, plastics, resins, polysaccharides, silicon, or silica-based materials, carbon, metals, inorganic glasses, and membranes.

As used herein, "classification" of a subject, e.g. B. Classifying the descent of the subject to determine whether the subject has biological ancestors that originated from a particular geographic region and therefore is likely to have certain genetic variants found in the populations that are have colonized this region historically. A classification can z. For example, obtaining information about the family of the subject, interviewing the subject or a family member about their biological lineage, and / or genetic testing. The classification may be made on the basis used for the 1000 Genomes Project, which will be familiar to those skilled in the art. According to some embodiments, the subject may be classified as of a particular lineage if at least the genome of the subject comprises a substantial number of different alleles sharing it with other humans of that lineage (eg, as determined in relation to the database of the 1000 Genome Project ), for example, shares at least 10, 20, 30, 40, 50 or 100 or more alleles. Abbreviations for certain lineages can be found in Table 4.

The term "statistically significant" or "significant" refers to statistical significance and generally means a difference of two standard deviations (2SD) or more.

Except in the embodiments or where otherwise indicated, all numbers expressing amounts of ingredients or reaction conditions employed herein are to be understood to be modified by the term "about", respectively. The term "about" may mean percentages ± 1%.

As used herein, the term "comprising" or "comprising" is used with respect to compositions, methods and the particular component (s) thereof that are essential to the process or composition, but are open-ended for inclusion of unlisted elements, whether essential or not.

The term "consisting of" refers to compositions, methods, and the particular component (s) thereof as described herein to the exclusion of all elements not included in the description of the embodiment.

As used herein, "consisting essentially of" refers to the elements required for a given embodiment. The term allows the presence of elements that the do not significantly affect the basic and new or functional characteristics of the embodiment.

The singular expressions "a", "an" and "the", "the" and "the" include plural referents unless the context clearly indicates otherwise. Similarly, the word "or" should include "and" unless the context clearly dictates otherwise. While methods and materials similar or equivalent to those described herein may be used in the practice or testing of the present disclosure, suitable methods and materials are described below. With the abbreviation "z. For example, "a non-limiting example is referred to herein. The abbreviation "z. B. "is thus synonymous with the term" for example ".

Definitions of conventional terms of cell biology and molecular biology can be found in The Merck Manual of Diagnosis and Therapy, 19th Edition, published by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0) ; Robert S. Porter et al. (Ed.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9) ; Benjamin Lewin, Genes X, edited by Jones & Bartlett Publishing, 2009 (ISBN-10: 0763766321) ; Kendrew et al. (Ed.) "Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) and Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., Eds.

Unless otherwise stated, the present invention has been practiced using standard techniques, such as those described in U.S. Patent Nos. 5,496,074; Sambrook et al., Molecular Cloning: A Laboratory Manual (4th Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) ; Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995). ; or Methods in Enzymology: Guide to Molecular Cloning Techniques Vol. 152, SL Berger and AR Kimmel ed., Academic Press Inc., San Diego, USA (1987) ; Current Protocols in Protein Science (CPPS) (John E. Coligan, et al., Eds., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et al., Eds. , John Wiley and Sons, Inc.) and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, edited by: Wiley-Liss; 5th edition (2005) . Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes Ed., Academic Press, 1st Edition, 1998) are all hereby incorporated by reference in their entirety part of the present application.

Other terms are defined herein in the descriptions of the various aspects of the invention.

All patents and other publications, including references, granted patents, patent applications, and co-pending patent applications cited in the present application are incorporated herein by reference for purposes of disclosure and disclosure; For example, the techniques described in such publications could be those that could be used in conjunction with the technology described herein. These publications are provided herein solely for their disclosure prior to the filing date of the present application. In this regard, nothing should be construed as an admission that the inventors are not entitled to pre-date such disclosure for the purposes of the present invention or for any other reason. All information on dates or representations on the content of these documents is based on the information available to the applicants and does not constitute an admission of the correctness of the data or contents of these documents.

The description of the embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. Specific embodiments of and examples of the disclosure are described herein for purposes of illustration, but various equivalent modifications are possible within the scope of the disclosure, as those skilled in the art will appreciate. For example, if method steps or functions are listed in a particular order, in alternative embodiments one may perform functions in a different order or perform functions substantially in parallel. The teachings of the disclosure provided herein may be applied to other regulations or methods as appropriate. The various embodiments described herein may be combined to provide further embodiments. Aspects of the disclosure may, if necessary, be modified to employ the compositions, functions, and concepts of the above references and application to provide still further embodiments of the disclosure. In addition, due to considerations of biological functional equivalence, some changes in protein structure may be made without affecting the nature or extent of the biological or chemical action. These and other changes may be in light of the detailed description of the revelation. All such modifications are intended to be within the scope of the appended claims.

Specific elements of any of the above embodiments may be combined or replaced with elements in other embodiments. Further, while advantages associated with certain embodiments of the disclosure have been described in conjunction with these embodiments, other embodiments may also provide such advantages, and not all embodiments necessarily must provide such advantages to be within the scope of the disclosure.

It should be understood that particular configurations, aspects, examples, clauses, and embodiments described herein are shown for purposes of illustration and not as limitations of the invention. The main feature of the present invention may be employed in various embodiments without departing from the scope of the invention. One skilled in the art will recognize or be able to identify numerous equivalents of the specific rules described herein using no more than routine experimentation. Such equivalents are considered to fall within the scope of the present invention and are covered by the claims. All publications and patent applications mentioned in the specification are indicative of the level of skill of the person skilled in the art to which the present invention pertains. All publications and patent applications become part of the application by reference to the same extent as if the individual publications or patent applications were specifically and individually indicated to be incorporated by reference into the application. The use of the word "a" or "an" in connection with the term "comprising" in the claims and / or the description may mean "a number [s]" but is also meant to mean "a (e ) or more "," at least one "and" one or more than one ". When the term "or" is used in the claims, it is intended to mean "and / or" unless expressly stated that it refers to alternatives only or that the alternatives are mutually exclusive, although the disclosure supports a definition which does not warrant refers only to alternatives and "and / or". The term "about" is used throughout the application to show that a value includes the error variation inherent in the device, the method used to determine the value, or the variation that exists between the subjects of the study.

As used in the present specification and claims, the words "comprising" (and including all forms of such as "comprising" and "comprising") are "having" (and having all forms of "having" and " has " including " (and including all forms of including such as " including " and " including ") and " including " (and including all forms of including such as " includes " listed elements or process steps are not sufficient.

All parts of the present disclosure may be read in combination with any other part of the disclosure, unless the context clearly indicates otherwise.

All of the compositions and / or methods disclosed and claimed herein can be made and practiced without undue experimentation in light of the present disclosure. The compositions and methods of the present invention have been described in terms of preferred embodiments; however, it will be apparent to those skilled in the art that variations may be applied to the compositions and / or methods and to the steps or order of steps of the method described herein without departing from the spirit, and scope of the invention. All such similar substitutions and modifications as would be obvious to those skilled in the art are deemed to belong to the spirit, scope and concept of the invention as defined in the appended claims.

The present invention will be described in more detail in the following non-limiting examples.

The invention addresses the need to treat humans with naturally occurring, less abundant natural PCSK9 alleles, genotypes and phenotypes (rarer protein forms). In this regard, the invention provides the following aspects.

According to a first aspect:

• a. die Auswahl eines Menschen, welcher (i) eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz davon, die für die katalytische Domäne oder C-terminale Domäne eines PCSK9-Proteins codiert, umfasst; und
• b. die Verabreichung eines Antikörpers oder Antikörperfragments, der/das spezifisch eine oder mehrere PCSK9-Aminosäuresequenzen bindet, die durch die Nukleotidsequenz codiert werden, die sich in dem Menschen befindet, an diesen Menschen.

A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a person in need thereof, comprising:

• a. selecting a human having (i) a proprotein convertase subtilisin / kexin type 9 (PCSK9) nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein; and
• b. the administration of an antibody or antibody fragment that specifically binds one or more PCSK9 amino acid sequences encoded by the nucleotide sequence that resides in the human to that human.

In one example, step (a) comprises selecting a human comprising a PCSK9 protein encoded by the nucleotide sequences of (i) or (ii).

In one example, the antibody or antibody fragment specifically binds the PCSK9 amino acid sequence. In one example, the antibody or antibody fragment binds a second PCSK9 protein comprising an amino acid sequence encoded by (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein. In one example, the antibody comprises a VH domain derived from the recombination of a human VH gene segment, human D gene segments, and a human JH segment, wherein the VH gene segment comprises a nucleotide sequence encoding a single nucleotide polymorphism with nucleotide C, such as shown in rs56069819 (CTGTACCAAGCCTCCCCCAGACTCCA [A / C] CAGCTGCACCTCACACTGGACACCT) (SEQ ID NO: 68). In one example, the VH gene segment is VH3-23 * 04 (SEQ ID NO: 38) encoded by a sequence comprising SEQ ID NO: 39. In one example, the antibody comprises a VH domain, wherein the VH domain comprises the backbone 1 sequence of SEQ ID NO. 40 includes.

In one example, it has been determined that the human comprises the nucleotide sequence of (i) and / or (ii). In one example, it has been determined that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of (i) and / or (ii). In one example, the method further comprises the step of determining that the human comprises the nucleotide sequence of (i) and / or (ii).

• c. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die für die katalytische Domäne oder die C-terminale Domäne codierende Sequenz davon, oder spezifisch mit einer Antisense-Sequenz der Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die katalytische oder C-terminale Domäne codierende Sequenz davon vorhanden ist; und/oder
• d. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist und so einen Komplex bildet, wenn eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9-Proteinvariante umfasst.

In one example, the detection step is performed prior to administration of the antibody to humans. In one example, the method further comprises the step of determining that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of (i) and / or (ii). In one example, the detection step is performed prior to administration of the antibody to humans. In one example, the step of determining comprises examining a human biological sample for (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence encoding the catalytic domain or C-terminal domain of the variant PCSK9 protein. In one example, the assay involves contacting the biological sample with

• c. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides which can specifically hybridize to and identify with a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NOs: 29-37 or at least those for catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridized to an antisense sequence of the sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or hybridizing with an antisense sequence to form a complex when at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof is present; and or
• d. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence of these contiguous nucleotides, wherein the sequence of contiguous nucleotides comprises at least one Nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 is present; and determining the presence or absence of the complex, wherein determining the presence of the complex determines that the human comprises the variant PCSK9 protein.

In one example, the assay comprises nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization, and allele specific amplification. In one example, the study is done in one Multiplex format. In an example, the method further comprises recovering the biological sample from the human. In one example, the biological sample comprises serum, blood, feces, tissue, a cell, urine and / or saliva of the human.

In one example, the human is substantially resistant to statin treatment, or it has been further found that the human is substantially resistant to statin treatment. In one example, the human receives statin treatment or has received statin treatment, or shows decreased response to statin treatment.

In one example, a statin is also administered to the human. In one example, the antibody or antibody fragment and statin are administered separately or simultaneously.

In one example, the human is heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOS: 29-37 and / or the nucleotide sequence thereof encoding the catalytic domain or C-terminal domain coding sequence of a PCSK9 protein. In one example, the human further comprises the nucleotide sequence of SEQ ID NO: 28 and / or the catalytic domain or C-terminal domain encoding sequence thereof.

In one example, the human is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the catalytic domain or C-terminal domain encoding sequence thereof.

In one example, humans have selected at least one condition from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.

In one example, the method comprises at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Treats or prevents hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.

• 1. Ein Verfahren zur Behandlung und/oder Prävention einer Krankheit und/oder eines Leidens, die bzw. das durch Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) vermittelt wird, in einem Menschen, von dem festgestellt wurde, dass er eine PCSK9-Proteinvariante umfasst, oder der so ausgewählt wurde, dass er eine PCSK9-Proteinvariante umfasst, wobei man bei dem Verfahren dem Menschen zur Behandlung und/oder Prävention der Krankheit bzw. des Leidens einen Liganden verabreicht, der die PCSK9-Proteinvariante bindet.
• Alternativ dazu stellt Absatz 1 Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine wie hier definierte Mutation (z. B. I474V oder E670G) in SEQ ID NO: 1 umfasst, wobei der Antikörper eine VH-Domäne umfasst, die durch Rekombination eines humanen VH-Segments, eines humanen D-Gensegments und eines humanen JH-Segments gewonnen wird, wobei das humane VH-Segment für ein Valin an der Aminosäure codiert, die der Position 5 der SEQ ID NO: 40 entspricht, und wobei der Mensch (i) ein VH-Gensegment, das für das Grundgerüst 1 von SEQ ID NO: 40 codiert, und (ii) eine Nukleotidsequenz umfasst, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation in SEQ ID NO: 1 umfasst, an den Menschen umfasst.
• Alternativ dazu stellt Absatz 1 Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine wie hier definierte Mutation (z. B. I474V oder E670G) in SEQ ID NO: 1 umfasst, wobei der Antikörper eine VL-Domäne umfasst, die durch Rekombination eines humanen VL-Segments und eines humanen JL-Segments gewonnen wird, wobei das humane VL-Segment ein hier offenbartes Vλ oder Vκ ist und wobei der Mensch (i) das VL-Gensegment und (ii) eine Nukleotidsequenz umfasst, die für eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation in SEQ ID NO: 1 umfasst, an den Menschen umfasst.
• Alternativ dazu stellt Absatz 1 Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine wie hier definierte Mutation (z. B. I474V oder E670G) in SEQ ID NO: 1 umfasst, wobei der Antikörper eine C-Domäne umfasst, die durch ein hier offenbartes humanes CH-, Cλ- oder Cκ-Gensegment codiert wird, und wobei der Mensch (i) das C-Gensegment und (ii) eine Nukleotidsequenz umfasst, die für eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation in SEQ ID NO: 1 umfasst, an den Menschen umfasst.
• 2. Das Verfahren nach Absatz 1, wobei die PCSK9-Proteinvariante ausgewählt ist aus der aus den PCSK9-Proteinvariantenformen f, c, r, p, m, e, h, aj und q bestehenden Gruppe.
• 3. Das Verfahren nach Absatz 2, wobei es sich bei der Variante um reife PCSK9 handelt.
• 4. Das Verfahren nach Absatz 1, 2 oder 3, bei dem man ferner eine biologische Probe des Menschen auf die PCSK9-Proteinvariantenform untersucht.
• 5. Ein Verfahren zur Behandlung und/oder Prävention einer Krankheit oder eines Leidens, die bzw. das durch Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante vermittelt wird, codiert durch (i) eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz, die für die katalytische Domäne oder C-terminale Domäne davon in einem Menschen codiert, von dem festgestellt wurde, dass er (i) die Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37; und/oder (ii) die Nukleotidsequenz davon, die für die katalytische Domäne oder die C-terminale Domäne eines PCSK9-Proteins codiert, umfasst und/oder als diese umfassend ausgewählt ist, wobei man bei dem Verfahren dem Menschen einen Liganden verabreicht, der die PCSK9-Proteinvariante bindet, zur Behandlung und/oder Prävention der Krankheit bzw. des Leidens.
• 6. Das Verfahren nach Absatz 5, bei dem man ferner eine biologische Probe des Menschen auf (i) eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz davon, die für die katalytische Domäne oder C-terminale Domäne eines PCSK9-Proteins codiert, untersucht.
• 7. Das Verfahren nach Absatz 6, bei dem die Untersuchung Nukleinsäureamplifikation und/oder eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation, Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst.
• 8. Das Verfahren nach Absatz 6, wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 9. Das Verfahren nach einem der Absätze 1–8, welches ferner die Gewinnung der biologischen Probe von dem Menschen umfasst.
• 10. Das Verfahren nach einem der Absätze 1–9, wobei ferner von dem Menschen festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung der Krankheit oder des Leidens ist, und/oder der Mensch dahingehend ausgewählt wurde.
• 11. Das Verfahren nach einem der Absätze 1–10, wobei der Ligand aus einem Antikörper, einem Teil eines Antikörpers, einem Antikörperfragment oder einem Affibody ausgewählt ist.
• 12. Das Verfahren nach Absatz 11, wobei es sich bei dem Liganden um einen Antikörper oder ein Antikörperfragment handelt, der bzw. das spezifisch an eine humane PCSK9 ausgewählt aus den Formen f, c, m, e, h, p, q und aj bindet, wobei der Antikörper bzw. das Antikörperfragment eine VH-Domäne umfasst, die sich aus der Rekombination eines humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments ableitet, wobei das VH-Gensegment eine Nukleotidsequenz umfasst, die SNP rs56069819 (SEQ ID NO: 41) umfasst.
• 13. Der Ligand nach Absatz 12, wobei es sich bei dem VH-Gensegment um VH3-23*04 handelt.
• 14. Das Verfahren nach einem der Absätze 1–13, wobei die Verabreichung ferner die Verabreichung eines Statins an den Menschen umfasst.
• 15. Das Verfahren nach einem der Absätze 1–14, wobei der Ligand und das Statin getrennt oder gleichzeitig verabreicht werden.
• 16. Das Verfahren nach einem der Absätze 1–15, wobei die biologische Probe Serum, Blut, Kot, Haar, Gewebe, Zellen, Urin und/oder Speichel des Menschen umfasst.
• 17. Das Verfahren nach einem der Absätze 1–16, wobei der Mensch heterozygot für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 und/oder die Nukleotidsequenz davon, die für eine die katalytische Domäne oder C-terminale Domäne codierende Sequenz eines PCSK9-Proteins codiert, ist.
• 18. Das Verfahren nach einem der Absätze 1–17, wobei der Mensch die Nukleotidsequenz von SEQ ID NO: 28 und/oder die für die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon umfasst.
• 19. Das Verfahren nach einem der Absätze 1–18, wobei der Mensch homozygot für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 und/oder die Nukleotidsequenz davon, die für eine die katalytische Domäne oder C-terminale Domäne codierende Sequenz eines PCSK2-Proteins codiert, ist.
• 20. Das Verfahren nach einem der Absätze 1–19, wobei, wenn festgestellt wird, dass der Mensch Folgendes umfasst und/oder der Mensch so ausgewählt wird, dass er Folgendes umfasst:
• a. SEQ ID NO: 29 und als ASW-, YRI-, GBR-, TSI-, CLM-, LWK-, MXL-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 29 codiert wird; oder
• b. SEQ ID NO: 30 und als ASW-, YRI-, GBR-, TSI-, CLM-, CHB-, LWK-, CHS-, JPT-, PUR-, FIN- oder CEU-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 30 codiert wird; oder
• c. SEQ ID NO: 32 und als ASW-, GBR-, TSI-, CLM-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 32 codiert wird; oder
• d. SEQ ID NO: 33 und als LWK-, ASW-, YRI- oder CLM-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 33 codiert wird; oder
• e. SEQ ID NO: 34 und als LWK-, ASW- oder YRI-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 34 codiert wird; oder
• f. SEQ ID NO: 35 und als PUR-, TSI-, FIN- oder CEU-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 35 codiert wird; oder
• g. SEQ ID NO: 36 und als LWK-, ASW- oder YRI-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 36 codiert wird; oder
• h. SEQ ID NO: 37 und als CHS-, ASW-, JPT-, PUR- oder CHB-Abstammung klassifiziert ist, dem Menschen dann ein Ligand verabreicht wird, der diese PCSK9-Proteinvariante spezifisch bindet, die eine Variante umfasst, die durch SEQ ID NO: 37 codiert wird.
• 21. Das Verfahren nach einem der Absätze 1–19, wobei, wenn festgestellt wird, dass der Mensch Folgendes umfasst und/oder der Mensch so ausgewählt wird, dass er Folgendes umfasst:
• a. PCSK9-Proteinform f, und als ASW-, YRI-, GBR-, TSI-, CLM-, LWK-, MXL-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform f über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• b. PCSK9-Proteinform c, und als ASW-, YRI-, GBR-, TSI-, CLM-, CHB-, LWK-, CHS-, JPT-, PUR-, FIN- oder CEU-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform c über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• c. PCSK9-Proteinform p, und als ASW-, GBR-, TSI-, CLM-, JPT-, PUR-, IBS-, FIN- oder CEU-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform p über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• d. PCSK9-Proteinform m, und als LWK-, ASW-, YRI- or CLM-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform m über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• e. PCSK9-Proteinform e, und als LWK-, ASW- oder YRI-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform e über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• f. PCSK9-Proteinform h, und als PUR-, TSI-, FIN- oder CEU-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform h über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• g. PCSK9-Proteinform aj, und als LWK-, ASW- oder YRI-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform aj über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird; oder
• h. PCSK9-Proteinform q, und als CHS-, ASW-, JPT-, PUR- or CHB-Abstammung klassifiziert wird, dann ein Ligand verabreicht wird, der spezifisch die PCSK9-Proteinform q über eine Zeitspanne und in einer Menge ausreichend für die Behandlung und/oder Prävention der Krankheit oder des Leidens in dem Menschen bindet, wodurch die Krankheit bzw. das Leiden in dem Menschen behandelt und/oder verhindert wird.
• 22. Das Verfahren nach einem der Absätze 1–21, wobei der Ligand zur spezifischen Bindung der PCSK9-Proteinvariante oder einer für die PCSK9-Proteinvariante codierenden Nukleinsäure fähig ist.
• 23. Das Verfahren nach einem der Absätze 1–21, wobei der Ligand zwei oder mehr humane PCSK9-Proteinvarianten oder Fragmente davon ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 4–27 bindet.
• 24. Das Verfahren nach Absatz 23, wobei der Ligand spezifisch zwei oder mehr humane PCSK9-Proteine oder Fragmente davon bindet, wobei wenigstens eines der Proteinfragmente eine Aminosäuresequenz ausgewählt aus SEQ ID NO: 4–14, 18–23, 26 und 27 umfasst.
• 25. Das Verfahren nach einem der Absätze 4 und 6–23, wobei das in der Probe untersuchte humane PCSK9-Protein in der reifen Form vorliegt.
• 26. Das Verfahren nach einem der Absätze 4 und 6–24, wobei das in der Probe untersuchte humane PCSK9-Protein in der Pro-Form vorliegt.
• 27. Das Verfahren nach Absatz 1–26, wobei die Krankheit bzw. das Leiden ausgewählt ist aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie; Dyslipidämie; Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, periphärer Gefäßkrankheit, Klaudikation, Typ-II-Diabetes, Bluthochdruck und einer Herz-Kreislauf-Krankheit oder einem Herz-Kreislauf-Leiden.
• 28. Ein Kit zum Genotypisieren einer Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Genvariante in einer Nukleinsäureprobe von einem Menschen, der an einer durch PCSK9 vermittelten Krankheit leidet oder bei dem das Risiko einer solchen Krankheit besteht, wobei das Kit Folgendes umfasst
• a. wenigstens eine Nukleinsäuresonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37 und der Sequenz davon, die für eine katalytische Domäne oder die C-terminale Domäne eines PCSK9-Proteins codiert, oder die spezifisch mit einer Antisense-Sequenz der Nukleotidsequenz hybridisieren und die Anwesenheit dieser in einer biologischen Probe identifizieren kann, wobei die Nukleinsäuresonde mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 oder einer Antisense-Sequenz davon; und/oder
• b. wenigstens zwei Nukleinsäuresonden, die wenigstens zwei Sequenzen umfassen, jeweils mit wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfassend, wobei wenigstens eine der Oligonukleotidsonden wenigstens ein Nukleotid umfasst, das in der ausgewählten Nukleotidsequenz vorhanden ist, aber nicht in SEQ ID NO: 28 oder einer Antisense-Sequenz davon, und
• c. gegebenenfalls wenigstens eines der Folgenden: einen oder mehrere Puffer, Verpackungen, Etiketten und/oder Instruktionen für das PCSK9-Genotypisieren in einer biologischen Probe, die Nukleinsäuren aus einem Menschen umfasst.
• 29. Das Kit nach Absatz 28, wobei die Nukleinsäuresonde an einer festen Oberfläche gebunden ist.
• 30. Das Kit nach einem der Absätze 28–29, welches ferner ein nachweisbares Etikett umfasst, das an der Nukleinsäuresonde angebracht ist.
• 31. Ein Kit zum Phänotypisieren von Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Protein in einer biologischen Probe, wobei das Kit eine Mehrzahl an Antikörpern oder Teilen oder Fragmenten von Antikörpern umfasst, wobei der Antikörper bzw. das Antikörperfragment oder der Teil des Antikörpers jeweils spezifisch ist für eine PCSK9-Proteinvariante ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst; und gegebenenfalls wenigstens eines der Folgenden: einen oder mehrere Puffer, Verpackungen und/oder Etiketten oder Instruktionen oder ein Etikett für das PCSK9-Phänotypisieren in einer biologischen Probe, die PCSK9 aus einem Menschen umfasst.
• 32. Das Kit nach Absatz 31, welches ferner ein Statin umfasst.
• 33. Eine pharmazeutische Zusammensetzung, welche einen Liganden umfasst, der dazu fähig ist, Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Varianten ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon spezifisch zu binden, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst.
• 34. Die pharmazeutische Zusammensetzung nach Absatz 33, wobei es sich bei dem Liganden um einen Antikörper, einen Teil eines Antikörpers, ein Antikörperfragment oder einen Affibody spezifisch für die PCSK9-Variante ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon handelt, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst.
• 35. Die pharmazeutische Zusammensetzung nach einem der Absätze 33–34, welches ferner ein Statin umfasst.
• 36. Die pharmazeutische Zusammensetzung nach Absatz 35, wobei es sich bei dem Statin um Atorvastatin handelt.
• 37. Ein Arzneimittelverabreichungssystem, welches die pharmazeutische Zusammensetzung nach Absatz 33 oder 34 und ein Injektions- bzw. IV-Gerät umfasst.
• 38. Ein Kit, umfassend die pharmazeutische Zusammensetzung nach Absatz 33, Verpackung und Instruktionen oder Etiketten zur Verabreichung des Liganden an einen Menschen, der an einer durch PCSK9 vermittelten Krankheit oder einem solchen Leiden leidet oder bei dem das Risiko einer solchen Krankheit bzw. eines solchen Leidens besteht, wobei der Mensch eine PCSK9-Proteinvariantenform exprimiert, die ausgewählt ist aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder einer katalytischen oder C-terminalen Domäne oder einem Peptid davon.
• 39. Das Kit nach Absatz 38, wobei die Instruktionen oder das Etikett auf eine Verabreichung mit einem Statin und/oder an einen Menschen, bei dem eine Statinbehandlung indiziert ist oder dem ein Statin verabreicht wurde oder der eine reduzierte Reaktion auf eine Statinbehandlung zeigt, hinweist.
• 40. Das Kit nach Absatz 38 oder 39, wobei festgestellt wurde, dass der Mensch resistent gegenüber einer Behandlung mit Statinen ist, und/oder der Mensch als resistent gegenüber einer Behandlung mit Statinen ausgewählt wurde.
• 41. Das Kit nach Absatz 39 oder 40, wobei die Instruktionen oder das Etikett auf eine Verabreichung an einen Menschen, der Statin erhalten hat, hinweisen, und ferner die Anweisung geben, die Verabreichung von Statin an den Menschen zu reduzieren.
• 42. Das Kit nach Absatz 38, welches ferner wenigstens einen Puffer, Verpackung und/oder Instruktionen oder ein Etikett zum PCSK9-Genotypisieren in einer von einem Menschen erhaltenen biologischen Probe umfasst.
• 43. Das Kit nach Absatz 38, wobei das Etikett eine von einer Zulassungsbehörde herausgegebene Arzneimittelzulassungsnummer umfasst.
• 44. Das Kit nach Absatz 43, wobei die Zulassungsbehörde aus FDA und EMA ausgewählt ist.
• 45. Das Kit nach Absatz 38, wobei das Etikett oder die Instruktionen ferner Anweisungen zur Verabreichung von Alirocumab oder Evolocumab an den Menschen umfassen.
• 46. Das Kit nach einem der Absätze 38–45, welches ferner ein IV- bzw. Injektionsgerät umfasst, das gegebenenfalls Alirocumab oder Evolocumab umfasst.
• 47. Ein Kit zur Behandlung und/oder Prävention einer Krankheit oder eines Leidens, die bzw. das durch Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) in einem Menschen vermittelt wird, von dem festgestellt wurde, dass er eine PCSK9-Proteinvariante umfasst, und/oder der als solcher ausgewählt wurde, wobei das Kit (a) Alirocumab oder Evolocumab in einem verschlossenen Behälter und (b) ein Etikett oder Instruktionen, aus denen die Verabreichung des Alirocumab oder Evolocumab an einen Menschen, der eine PCSK9-Proteinvariantenform ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon exprimiert, hervorgeht, umfasst.
• 48. Das Kit nach Absatz 47, wobei aus dem Etikett ferner hervorgeht, dass, wenn dem Menschen Statin verabreicht worden ist oder wird, die Statinbehandlung fortgesetzt werden sollte.
• 49. Das Kit nach Absatz 47, wobei aus dem Etikett ferner hervorgeht, dass, wenn dem Menschen Statin verabreicht worden ist oder wird, die Statinbehandlung reduziert oder abgebrochen werden sollte.
• 50. Ein Verfahren zur Behandlung und/oder Prävention einer Krankheit und/oder eines Leidens, die bzw. das durch Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) in einem Menschen vermittelt wird, wobei das Verfahren Folgendes umfasst
• a. die Untersuchung einer biologischen Probe des Menschens auf das Vorhandensein einer oder mehrerer PCSK9-Proteinvarianten ausgewählt aus der Gruppe bestehend aus den PCSK9-Formen f, c, r, p, m, e, h, aj und q; und
• b. die Verabreichung einer therapeutisch wirksamen Menge eines humane PCSK9 bindenden Liganden an den Menschen, wenn eine oder mehrere der PCSK9-Formen f, c, r, p, m, e, h, aj und q nachgewiesen werden.
• 51. Das Verfahren nach Absatz 50, wobei der Ligand spezifisch eine oder mehrere der PCSK9-Formen f, c, r, p, m, e, h, aj und q bindet.
• 52. Ein Verfahren zur Behandlung und/oder Prävention einer Krankheit oder eines Leidens, die bzw. das durch Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) in einem Menschen vermittelt wird, wobei das Verfahren Folgendes umfasst
• a. die Untersuchung einer biologischen Probe des Menschens auf das Vorhandensein einer oder mehrerer PSCK9-Nukleinsäurevarianten ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon; und
• b. die Verabreichung einer therapeutisch wirksamen Menge eines humane PCSK9 bindenden Liganden an den Menschen, wenn eine oder mehrere der PCSK9-Nukleinsäurevarinanten nachgewiesen werden.
• 53. Das Verfahren nach Absatz 52, wobei der Ligand spezifisch eine oder mehrere der PCSK9-Formen f, c, r, p, m, e, h, aj und q bindet.
• 54. Ein Verfahren zur Auswahl eines Menschen für die Behandlung und/oder Prävention einer Krankheit, die durch ein Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Protein vermittelt wird, mit einem humane PCSK9 bindenden Liganden, umfassend:
• a. die Untersuchung einer von dem Menschen entnommenen biologischen Probe auf das Vorhandensein einer PCSK9-Proteinvariante ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q; und
• b. die Auswahl des Menschen für die Behandlung mit dem humane PCSK9 bindenden Liganden, wenn wenigstens eine der PCSK9-Proteinvarianten ausgewählt aus der Gruppe bestehend aus den PCSK9-Formen f, c, r, p, m, e, h, aj und q nachgewiesen wird.
• 55. Das Verfahren nach Absatz 54, wobei der Mensch für eine Statinbehandlung indiziert ist oder dem Menschen Statin verabreicht wurde.
• 56. Das Verfahren nach Absatz 54 oder 55, wobei der Mensch als im Wesentlichen resistent gegenüber einer Statinbehandlung identifiziert wurde oder ein reduziertes Ansprechen auf eine Statinbehandlung zeigt.
• 57. Das Verfahren nach einem der Absätze 54–56, wobei die Krankheit bzw. das Leiden ausgewählt ist aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie; Dyslipidämie; Hypercholesterinämie, Herzanfall, Schlaganfall, koronarer Herzkrankheit, Atherosklerose, periphärer Gefäßkrankheit, Klaudikation, Typ-II-Diabetes, Bluthochdruck und einer Herz-Kreislauf-Krankheit oder einem Herz-Kreislauf-Leiden.
• 58. Das Verfahren nach einem der Absätze 54–57, wobei der verabreichte, an humane PCSK9 bindende Ligand spezifisch für die nachgewiesene PCSK9-Form ist.
• 59. Das Verfahren nach einem der Absätze 54–58, wobei die PCSK9-Proteinform eine Aminosäuresequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 4–27 umfasst.
• 60. Das Verfahren nach einem der Absätze 54–59, wobei die PCSK9-Proteinform die reife PCSK9-Form umfasst.
• 61. Ein Assay zur Auswahl eines Menschen, der an einer von einem Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Protein vermittelten Krankheit oder einem solchen Leiden leidet, als geeignet für eine Behandlung mit einem humane PCSK9 bindenden Liganden, wobei das Verfahren Folgendes umfasst
• a. das Inkontaktbringen einer biologischen Probe von dem Menschen mit wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die für die katalytische Domäne oder die C-terminale Domäne codierende Sequenz davon, oder spezifisch mit einer Antisense-Sequenz der Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon vorhanden ist; und/oder
• b. den Nachweis des Vorhandenseins oder der Abwesenheit des Komplexes; und
• c. die Auswahl des Menschen als geeignet für die Behandlung mit dem humane PCSK9 bindenden Liganden, wenn das Vorhandensein wenigstens eines Komplexes umfassend eine PCSK9-Form, die durch SEQ ID NO: 29–37 codiert wird, oder die für die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon nachgewiesen wird.
• 62. Ein Assay zur Auswahl eines Menschen als geeignet für die Behandlung mit einem humane Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindenden Liganden, wobei das Verfahren Folgendes umfasst
• a. das Inkontaktbringen einer biologischen Probe von einem Menschen mit einer durch PCSK9 vermittelten Krankheit oder einem solchen Leiden mit einem oder mehreren Antikörpern, Teilen eines Antikörpers oder Antikörperfragmenten, die dazu fähig sind, eine PCSK9-Variantenform ausgewählt aus der Gruppe bestehend aus den PCSK9-Formen f, c, r, p, m, e, h, aj und q unter Bildung eines Komplexes zu binden, wenn eine oder mehrere PCSK9-Formen f, c, r, p, m, e, h, aj und q vorhanden sind;
• b. den Nachweis des Vorhandenseins oder der Abwesenheit des Komplexes; und
• c. die Auswahl des Menschen als geeignet für die Behandlung mit dem humanen PCSK9 bindenden Liganden, wenn das Vorhandensein wenigstens eines die PCSK9-Form f, c, r, p, m, e, h, aj und q umfassenden Komplexes nachgewiesen wird.
• 63. Das Verfahren nach Absatz 61 oder 62, wobei die Krankheit bzw. das Leiden ausgewählt ist aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie; Dyslipidämie; Hypercholesterinämie, Herzanfall, Schlaganfall, koronarer Herzkrankheit, Atherosklerose, periphärer Gefäßkrankheit, Klaudikation, Typ-II-Diabetes, Bluthochdruck und einer Herz-Kreislauf-Krankheit oder einem Herz-Kreislauf-Leiden.
• 64. Der Assay nach einem der Absätze 61–63, wobei der an humane PCSK9 bindende Ligand spezifisch für die nachgewiesene PCSK9-Form ist.
• 65. Der Assay nach einem der Absätze 61–64, welcher ferner die Amplifizierung von Nukleinsäuren aus der biologischen Probe umfasst.
• 66. Der Assay nach einem der Absätze 61–65, welcher ferner die Isolierung von Nukleinsäuren aus der biologischen Probe umfasst.
• 67. Der Assay nach einem der Absätze 61–66, welcher ferner die Verabreichung des PCSK9-bindenden Liganden an den Menschen umfasst.
• 68. Ein Verfahren zur Herstellung einer Anti-Human-Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Antikörper-Bindungsstelle, wobei das Verfahren die Gewinnung einer Mehrzahl von Anti-PCSK9-Antikörper-Bindungsstellen, die Durchmusterung der Antikörper-Bindungsstellen auf Bindung an eine aus der aus den Formen f, c, r, p, m, e, h, aj und q ausgewählte humane PCSK9 oder eine katalytische oder C-terminale Domäne oder ein Peptid davon, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst, und Isolieren einer Antikörper-Bindungsstelle, die im Durchmusterungsschritt bindet, und gegebenenfalls Herstellen eines die Form f, c, r, p, m, e, h, aj oder q des PCSK9 bindenden Fragments oder Derivats des isolierten Antikörpers umfasst.
• 69. Ein Verfahren zur Herstellung eines Anti-Human-Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Antikörpers, wobei das Verfahren die Immunisierung eines nicht menschlichen Wirbeltieres mit einer humanen PCSK9 umfasst, die eine Aminosäuresequenz ausgewählt aus der Gruppe bestehend aus den Aminosäuresequenzen der Formen f, c, r, p, m, e, h, aj und q oder einer katalytischen oder C-terminalen Domäne oder eines Peptids davon, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst, und das Isolieren eines Antikörpers, der an eine humane PCSK9 ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon bindet, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3 umfasst, und gegebenenfalls Herstellen eines die Form f, c, r, p, m, e, h, aj oder q des PCSK9 bindenden Fragments oder Derivats des isolierten Antikörpers umfasst.
• 70. Das Verfahren nach Absätzen 68–69, wobei es sich bei dem nicht humanen Wirbeltier um eine Maus oder eine Ratte handelt.
• 71. Das Verfahren nach einem der Absätze 68–70, welches den Schritt der Gewinnung einer Nukleinsäure umfasst, die für den Antikörper, das Fragment, das Derivat oder die Bindungsstelle codiert, und gegebenenfalls Insertieren der Nukleinsäure in einem Expressionsvektor.
• 72. Ein Kit zum Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Genotypisieren eines Menschen, wobei das Kit eine Nukleinsäure umfasst, die (i) eine Sequenz aufeinanderfolgender Nukleotide umfasst, die spezifisch mit einer Nukleotidsequenz hybridisiert, die ausgewählt ist aus der Gruppe bestehend aus SEQ ID NO: 29–37 oder wenigstens der für die katalytische Domäne oder die C-terminale Domäne codierenden Sequenz davon hybridisiert, oder spezifisch mit einer Antisense-Sequenz oder einem RNA-Transkript der Sequenz hybridisiert, wobei die Sequenz aufeinanderfolgender Nukleotide mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz oder einem RNA-Transkript davon hybridisiert; und/oder (ii) eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus SEQ ID NO: 29–37 umfasst, oder eine Antisense-Sequenz oder RNA-Version dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist.
• 73. Ein Kit zum Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Genotypisieren oder -Phänotypisieren eines Menschen, wobei das Kit einen Ligandenantikörper umfasst, der an eine humane PCSK9 ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q oder eine katalytische oder C-terminale Domäne oder ein Peptid davon bindet, die bzw. das eine Aminosäurevariation von der entsprechenden Sequenz von SEQ ID NO: 1, 2 oder 3, oder einen Antikörper, ein Fragment oder ein Derivat produziert durch das Verfahren nach einem der Absätze 68–71 umfasst.
• 74. Ein Verfahren zum Targeting einer Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) zur Behandlung und/oder Prävention einer durch PCSK9 vermittelten Krankheit oder eines durch PCSK9 vermittelten Leidens bei einem Menschen, wobei das Verfahren die die Verabreichung eines Anti-PCSK9-Liganden an einen Menschen umfasst, der eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus SEQ ID NO: 29–37 umfasst, wobei auf eine durch die Nukleotidsequenz codierte PCSK9 gezielt wird.
• 75. Das Verfahren nach Absatz 74, wobei das Verfahren das Targeting einer humanen PCSK9 ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q mit dem Liganden zur Behandlung und/oder Prävention der Krankheit bzw. des Leidens in dem Menschen umfasst.
• 76. Ein Verfahren zur Behandlung und/oder Prävention einer durch Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) vermittelten Krankheit oder eines durch PCSK9 vermittelten Leidens bei einem Menschen, wobei das Verfahren das Targeting einer humanen PCSK9 ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q durch Verabreichung eines Liganden, der die PCSK9 bindet, an den Menschen umfasst, wodurch die Krankheit bzw. das Leiden bei dem Menschen behandelt und/oder verhindert wird.
• 77. Das Verfahren nach Absatz 76, wobei das Genom des Menschen eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 umfasst.
• 78. Das Verfahren nach einem der Absätze 74 bis 77, wobei der Mensch als positiv für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder die für die katalytische oder C-terminale Domäne codierende Sequenz davon genotypisiert wurde oder wird.
• 79. Das Verfahren nach einem der Absätze 74 bis 78, wobei der Mensch als positiv für eine humane PCSK9 ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q phänotypisiert wurde oder wird.
• 80. Das Verfahren nach einem der Absätze 74–79, wobei das Verfahren das Genotypisieren des Menschen als positiv für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder die für die katalytische oder C-terminale Domäne codierende Sequenz davon genotypisiert wurde oder wird.
• 81. Das Verfahren nach einem der Absätze 74–80, wobei das Verfahren das Phänotypisieren des Menschen als positiv für eine humane PCSK9-Sequenz ausgewählt aus der Gruppe bestehend aus den Formen f, c, r, p, m, e, h, aj und q umfasst.
• 82. Das Verfahren nach einem der Absätze 74 bis 81, wobei der Mensch als heterozygot für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder die katalytische oder C-terminale Domäne codierende Sequenz davon genotypisiert wurde oder wird; wobei der Mensch gegebenenfalls als die Nukleotidsequenz von SEQ ID NO: 28 oder die katalytische oder C-terminale Domäne codierende Sequenz davon und eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NOs: 29–37 oder die für die katalytische oder C-terminale Domäne codierende Sequenz davon umfassend genotypisiert wurde oder wird.
• 83. Das Verfahren nach einem der Absätze 74 bis 82, wobei das Genom des Menschen als homozygot für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder die für die katalytische oder C-terminale Domäne codierende Sequenz davon genotypisiert wurde oder wird.
• 84. Das Verfahren nach einem der Absätze 74 bis 83, wobei das Verfahren das Genotypisieren des Menschen für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder die katalytische oder C-terminale Domäne codierende Sequenz davon vor der Verabreichung des Liganden an den Menschen umfasst, wobei festgestellt wird, dass der Ligand zur Bindung an eine durch die ausgewählte Sequenz codierte PCSK9 fähig ist.
• 85. Das Verfahren nach einem der Absätze 74 bis 84, welches ferner die Verabreichung des Liganden und eines Statins (z. B. Atorvastatin) an den Menschen umfasst.
• 86. Das Verfahren nach Absatz 85, wobei der Ligand und das Statin getrennt verabreicht werden.
• 87. Das Verfahren nach Absatz 85, wobei der Ligand und das Statin gleichzeitig verabreicht werden.
• 88. Das Verfahren nach einem der Absätze 74 bis 87, wobei der Ligand durch subkutane Injektion verabreicht wird.
• 89. Ein Verfahren zur Reduzierung des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, umfassend:
• a. die Auswahl eines Menschen, welcher (i) eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz davon, die für die katalytische Domäne oder C-terminale Domäne eines PCSK9-Proteins codiert, umfasst; und
• b. die Verabreichung eines Antikörpers oder Antikörperfragments, der/das spezifisch eine oder mehrere PCSK9-Aminosäuresequenzen bindet, die durch die Nukleotidsequenz codiert werden, die sich in dem Menschen befindet, an diesen Menschen.
• 90. Das Verfahren nach Absatz 89, wobei Schritt (a) die Auswahl eines Menschen umfasst, der ein PCSK9-Protein umfasst, das durch die Nukleotidsequenzen von (i) oder (ii) codiert wird.
• 91. Das Verfahren nach Absatz 89 oder 90, wobei der Antikörper oder das Antikörperfragment spezifisch die PCSK9-Aminosäuresequenz bindet.
• 92. Das Verfahren nach Absatz 89 oder 90, wobei der Antikörper oder das Antikörperfragment ein zweites PCSK9-Protein bindet, welches eine Aminosäuresequenz umfasst, die codiert wird durch (i) eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz davon, die für die katalytische Domäne oder C-terminale Domäne eines PCSK9-Proteins codiert.
• 93. Das Verfahren nach Absatz 89 oder 90, wobei der Antikörper eine VH-Domäne umfasst, die sich aus der Rekombination eines humanen VH-Gensegments, humaner D-Gensegmente und eines humanen JH-Segments ableitet, wobei das VH-Gensegment eine Nukleotidsequenz umfasst, die einen Einzelnukleotidpolymorphismus mit Nukleotid C wie in rs56069819 gezeigt (SEQ ID NO 41) umfasst.
• 94. Das Verfahren nach Absatz 93, wobei es sich bei dem VH-Gensegment um VH3-23*04 handelt.
• 95. Das Verfahren nach einem der Absätze 89–93, wobei der Antikörper eine VH-Domäne umfasst, wobei die VH-Domäne die Grundgerüst-1-Sequenz von SEQ ID NO: 38 umfasst.
• 96. Das Verfahren nach einem der Absätze 89–95, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz von (i) und/oder (ii) umfasst.
• 97. Das Verfahren nach einem der Absätze 89–96, wobei festgestellt wurde, dass der Mensch eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante umfasst, die durch die Nukleotidsequenz von (i) und/oder (ii) codiert wird. Das Verfahren nach einem der Absätze 89–97, welches den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz von (i) und/oder (ii) umfasst.
• 98. Das Verfahren nach Absatz 98, wobei der Feststellungsschritt vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 99. Das Verfahren nach einem der Absätze 89–99, welches den Schritt der Feststellung umfasst, dass der Mensch eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante umfasst, die durch die Nukleotidsequenz von (i) und/oder (ii) codiert wird.
• 100. Das Verfahren nach Absatz 100, wobei der Feststellungsschritt vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 101. Das Verfahren nach Absatz 100 oder 101, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe des Menschen auf (i) eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37; und/oder (ii) eine Nukleotidsequenz, die für die katalytische Domäne oder C-terminale Domäne einer PCSK9-Proteinvariante codiert, umfasst.
• 102. Das Verfahren nach Absatz 102, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens der für die katalytische Domäne oder die C-terminale Domäne codierenden Sequenz davon, oder spezifisch mit einer Antisense-Sequenz der Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 oder wenigstens die katalytische oder C-terminale Domäne codierenden Sequenz davon vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die ausgewählt ist aus der Gruppe bestehend aus den SEQ ID NO: 29–37, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist und so einen Komplex bildet, wenn eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9-Proteinvariante umfasst.
• 103. Das Verfahren nach Absatz 102 oder 103, bei dem die Untersuchung Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation, Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst.
• 104. Das Verfahren nach einem der Absätze 102–104, wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 105. Das Verfahren nach einem der Absätze 102–105, welches ferner die Gewinnung der biologischen Probe von dem Menschen umfasst.
• 106. Das Verfahren nach einem der Absätze 89–106, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 107. Das Verfahren nach einem der Absätze 89–107, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 108. Das Verfahren nach einem der Absätze 89–108, wobei dem Menschen ferner ein Statin verabreicht wird.
• 109. Das Verfahren nach einem der Absätze 89–108, wobei der Antikörper oder das Antikörperfragment und das Statin getrennt oder gleichzeitig verabreicht werden.
• 110. Das Verfahren nach einem der Absätze 106–110, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 111. Das Verfahren nach einem der Absätze 89–111, wobei der Mensch heterozygot ist für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 und/oder die Nukleotidsequenz davon, die für die katalytische Domäne oder C-terminale Domäne codierende Sequenz eines PCSK9-Proteins codiert.
• 112. Das Verfahren nach einem der Absätze 89–112, wobei der Mensch ferner die Nukleotidsequenz von SEQ ID NO: 28 und/oder die für die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon umfasst.
• 113. Das Verfahren nach einem der Absätze 89–113, wobei der Mensch homozygot für eine Nukleotidsequenz ausgewählt aus der Gruppe bestehend aus den SEQ ID NO: 29–37 und/oder die für die katalytische Domäne oder C-terminale Domäne codierende Sequenz davon ist.
• 114. Das Verfahren nach einem der Absätze 89–114, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie; Dyslipidämie; Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, periphärer Gefäßkrankheit, Klaudikation, Typ-II-Diabetes, Bluthochdruck und einer Herz-Kreislauf-Krankheit oder einem Herz-Kreislauf-Leiden diagnostiziert wurde.
• 115. Das Verfahren nach einem der Absätze 89–115, wobei bei dem Verfahren bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie; Dyslipidämie; Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, periphärer Gefäßkrankheit, Klaudikation, Typ-II-Diabetes, Bluthochdruck und einer Herz-Kreislauf-Krankheit oder einem Herz-Kreislauf-Leiden behandelt oder verhindert wird.

Some embodiments of the technology described herein may be defined according to one of the following numbered paragraphs:

• 1. A method for the treatment and / or prevention of a disease and / or a condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human identified as having a variant PCSK9 protein or which has been selected to comprise a variant of PCSK9 protein, wherein the method comprises administering to humans a ligand that binds the PCSK9 protein variant to treat and / or prevent the disease or condition.
• Alternatively, paragraph 1 provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- terminal domain comprising a mutation as defined herein (eg, I474V or E670G) in SEQ ID NO: 1, wherein the antibody comprises a VH domain obtained by recombination of a human VH segment, a human D gene segment and a human JH segment, wherein the human VH segment encodes a valine at the amino acid corresponding to position 5 of SEQ ID NO: 40, and wherein the human is (i) a VH gene segment encoding the human VH segment Framework 1 is encoded by SEQ ID NO: 40, and (ii) comprises a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain sst, which comprises the mutation in SEQ ID NO: 1, in humans.
• Alternatively, paragraph 1 provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- terminal domain comprising a mutation as defined herein (eg, I474V or E670G) in SEQ ID NO: 1, wherein the antibody comprises a VL domain obtained by recombination of a human VL segment and a human JL segment is obtained, the human VL segment is a Vλ or Vκ disclosed herein and wherein the human comprises (i) the VL gene segment and (ii) a nucleotide sequence coding for a proprotein convertase subtilisin / kexin type 9 (PCSK9) which is a C-terminal domain comprising the mutation in SEQ ID NO: 1 comprises in humans.
• Alternatively, paragraph 1 provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- a terminal domain comprising a mutation as defined herein (eg, I474V or E670G) in SEQ ID NO: 1, wherein the antibody comprises a C domain which is linked by a human CH, Cλ or Cκ human, as disclosed herein. Gene segment, and wherein the human comprises (i) the C gene segment and (ii) a nucleotide sequence coding for a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the mutation in SEQ ID NO: 1 includes, encompassing humans.
• 2. The method of paragraph 1, wherein the PCSK9 protein variant is selected from the group consisting of the PCSK9 protein variant forms f, c, r, p, m, e, h, aj and q.
• 3. The method of paragraph 2, wherein the variant is mature PCSK9.
• 4. The method of paragraph 1, 2 or 3, further comprising assaying a human biological sample for the PCSK9 variant protein form.
• 5. A method of treating and / or preventing a disease or condition mediated by the proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by (i) a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37; and / or (ii) a nucleotide sequence encoding the catalytic domain or C-terminal domain thereof in a human that has been found to be (i) the nucleotide sequence selected from the group consisting of SEQ ID NO: 29- 37; and / or (ii) the nucleotide sequence thereof which encodes the catalytic domain or the C-terminal domain of a PCSK9 protein, and / or is selected as comprising, wherein the method comprises administering to humans a ligand comprising the PCSK9 protein variant binds for the treatment and / or prevention of the disease or condition.
• 6. The method of paragraph 5, further comprising: a human biological sample for (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein.
• 7. The method of paragraph 6, wherein the assay comprises nucleic acid amplification and / or one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization, and allele specific amplification.
• 8. The procedure referred to in paragraph 6, whereby the examination is carried out in a multiplex format.
• 9. The method of any one of paragraphs 1-8, further comprising recovering the biological sample from the human.
• 10. The method of any one of paragraphs 1-9, further comprising determining that the human is substantially resistant to statin treatment of the disease or condition, and / or selecting the human to do so.
• 11. The method of any one of paragraphs 1-10, wherein the ligand is selected from an antibody, a portion of an antibody, an antibody fragment or an affibody.
• 12. The method of paragraph 11, wherein the ligand is an antibody or antibody fragment specific to a human PCSK9 selected from the forms f, c, m, e, h, p, q, and aj wherein the antibody or antibody fragment comprises a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment comprises a nucleotide sequence, the SNP rs56069819 (SEQ ID NO: 41).
• 13. The ligand of paragraph 12, wherein the VH gene segment is VH3-23 * 04.
• 14. The method of any one of paragraphs 1-13, wherein the administration further comprises administering a statin to a human.
• 15. The method of any one of paragraphs 1-14, wherein the ligand and the statin are administered separately or simultaneously.
• 16. The method of any one of paragraphs 1-15, wherein the biological sample comprises human serum, blood, faeces, hair, tissue, cells, urine and / or saliva.
• 17. The method of any one of paragraphs 1-16, wherein the human is heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the nucleotide sequence thereof which is for one of the catalytic domain or C-terminal Is encoding domain coding sequence of a PCSK9 protein.
• 18. The method of any of paragraphs 1-17, wherein the human comprises the nucleotide sequence of SEQ ID NO: 28 and / or the catalytic domain or C-terminal domain encoding sequence thereof.
• 19. The method of any one of paragraphs 1-18, wherein the human is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOS: 29-37 and / or the nucleotide sequence thereof which is for one of the catalytic domain or C-terminal Is encoding domain coding sequence of a PCSK2 protein.
• 20. The method of any one of paragraphs 1-19, wherein if it is determined that the human comprises and / or the human is selected to include:
• a. SEQ ID NO: 29 and classified as ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN, or CEU ancestry, then human Ligand that specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 29; or
• b. SEQ ID NO: 30 and is classified as ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN, or CEU ancestry, then human Ligand which specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 30; or
• c. SEQ ID NO: 32 and classified as ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU, then administered to humans a ligand encoding this PCSK9 protein variant specifically binds that comprises a variant encoded by SEQ ID NO: 32; or
• d. SEQ ID NO: 33 and classified as LWK, ASW, YRI or CLM lineage, then administering to humans a ligand that specifically binds that PCSK9 protein variant comprising a variant represented by SEQ ID NO: 33 is encoded; or
• e. SEQ ID NO: 34 and classified as LWK, ASW or YRI descent, then administering to humans a ligand specifically binding that PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 34; or
• f. SEQ ID NO: 35 and classified as PUR, TSI, FIN, or CEU, then administering to humans a ligand specifically binding that PCSK9 protein variant comprising a variant represented by SEQ ID NO: 35 is encoded; or
• G. SEQ ID NO: 36 and classified as LWK, ASW or YRI descent, then administering to humans a ligand specifically binding that PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 36; or
• H. SEQ ID NO: 37 and classified as CHS, ASW, JPT, PUR or CHB descent, the human then is administered a ligand that specifically binds this PCSK9 protein variant comprising a variant represented by SEQ ID NO: 37 is coded.
• 21. The method of any one of paragraphs 1-19, wherein if it is determined that the human comprises and / or the human is selected to include:
• a. PCSK9 protein form f, and classified as ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU, then administered a ligand specifically, the PCSK9 protein form f over a period of time and in an amount sufficient to treat and / or prevent the disease or condition in which it is treating and / or preventing the disease or condition in the human; or
• b. PCSK9 protein form c, and classified as ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN, or CEU, then administered a ligand which specifically binds the PCSK9 protein form c over a period of time and in an amount sufficient for the treatment and / or prevention of the disease or condition in the human thereby treating and / or preventing the disease or condition in the human ; or
• c. PCSK9 protein form p, and classified as ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU, then administering a ligand specifically encoding the PCSK9 protein form p over a period of time and in sufficient quantity for the treatment and / or prevention of the disease or condition in the human thereby treating and / or preventing the disease or condition in the human; or
• d. PCSK9 protein form m, and classified as LWK, ASW, YRI or CLM lineage, then administered a ligand specific for the PCSK9 protein form over a period of time and in an amount sufficient for treatment and / or prevention the disease or condition in which human beings bind, thereby treating and / or preventing the disease or condition in the human; or
• e. PCSK9 protein form e, and classified as LWK, ASW or YRI descent, then administering a ligand that specifically produces the PCSK9 protein form e over a period of time and in an amount sufficient for the treatment and / or prevention of the disease or the suffering in which human beings bind, thereby treating and / or preventing the disease or suffering in the human being; or
• f. PCSK9 protein form h, and classified as PUR, TSI, FIN or CEU, then administered a ligand specific for the PCSK9 protein form h over a period of time and in an amount sufficient for treatment and / or prevention the disease or condition in which human beings bind, thereby treating and / or preventing the disease or condition in the human; or
• G. PCSK9 protein form aj and classified as LWK, ASW or YRI descent, then administering a ligand that specifically contains the PCSK9 protein form aj for a period of time and in an amount sufficient for the treatment and / or prevention of the disease or the suffering in which human beings bind, thereby treating and / or preventing the disease or suffering in the human being; or
• H. PCSK9 protein form q, and classified as CHS, ASW, JPT, PUR or CHB descent, then administered a ligand specific to the PCSK9 protein form q over a period of time and in an amount sufficient for treatment and / or prevention of the disease or condition in the human, thereby treating and / or preventing the disease or condition in the human.
• 22. The method of any of paragraphs 1-21, wherein the ligand is capable of specifically binding the PCSK9 protein variant or a nucleic acid encoding the PCSK9 protein variant.
• 23. The method of any one of paragraphs 1-21, wherein the ligand binds two or more human PCSK9 protein variants or fragments thereof selected from the group consisting of SEQ ID NOs: 4-27.
• 24. The method of paragraph 23, wherein the ligand specifically binds two or more human PCSK9 proteins or fragments thereof, wherein at least one of the protein fragments comprises an amino acid sequence selected from SEQ ID NOS: 4-14, 18-23, 26, and 27.
• 25. The method of any one of paragraphs 4 and 6-23, wherein the human PCSK9 protein assayed in the sample is in the mature form.
• 26. The method of any one of paragraphs 4 and 6-24, wherein the human PCSK9 protein assayed in the sample is in the pro-form.
• 27. The method of paragraph 1-26, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 28. A kit for genotyping a proprotein convertase subtilisin / kexin type 9 (PCSK9) gene variant in a nucleic acid sample from a human suffering or at risk of developing a PCSK9-mediated disease, the kit comprising
• a. at least one nucleic acid probe comprising a sequence of at least 10 contiguous nucleotides that can specifically hybridize to and identify with a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NOs: 29-37 and the sequence thereof, which encodes a catalytic domain or the C-terminal domain of a PCSK9 protein, or which can specifically hybridize with an antisense sequence of the nucleotide sequence and identify the presence thereof in a biological sample, wherein the nucleic acid probe hybridizes to at least one nucleotide that is present in the selected sequence is present but not in SEQ ID NO: 28 or an antisense sequence thereof; and or
• b. at least two nucleic acid probes comprising at least two sequences each comprising at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or an antisense sequence of these contiguous nucleotides, at least one of the oligonucleotide probes comprising at least one nucleotide which is present in the selected nucleotide sequence but not in SEQ ID NO: 28 or an antisense sequence thereof, and
• c. optionally at least one of the following: one or more buffers, packages, labels and / or instructions for PCSK9 genotyping in a biological sample comprising nucleic acids from a human.
• 29. The kit of paragraph 28, wherein the nucleic acid probe is bound to a solid surface.
• 30. The kit of any of paragraphs 28-29, further comprising a detectable label attached to the nucleic acid probe.
• 31. A kit for phenotyping proprotein convertase subtilisin / kexin type 9 (PCSK9) protein in a biological sample, said kit comprising a plurality of antibodies or parts or fragments of antibodies, said antibody or antibody fragment or part of said antibody Each antibody is specific for a PCSK9 protein variant selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3; and optionally at least one of the following: one or more buffers, packages and / or labels or instructions or a label for PCSK9 phenotyping in a biological sample comprising human PCSK9.
• 32. The kit according to paragraph 31, which further includes a statin.
• 33. A pharmaceutical composition comprising a ligand capable of producing proprotein convertase subtilisin / kexin type 9 (PCSK9) variants selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof specifically comprising an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3.
• 34. The pharmaceutical composition of paragraph 33, wherein the ligand is an antibody, a portion of an antibody, an antibody fragment or an affibody specific for the PCSK9 variant selected from the group consisting of the forms f, c, r, p , m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof, which comprises an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3.
• 35. The pharmaceutical composition of any one of paragraphs 33-34, further comprising a statin.
• 36. The pharmaceutical composition according to paragraph 35, wherein the statin is atorvastatin.
• 37. A drug delivery system comprising the pharmaceutical composition of paragraph 33 or 34 and an injection or IV device.
• 38. A kit comprising the pharmaceutical composition of paragraph 33, packaging and instructions or labels for administering the ligand to a human suffering from or at risk of developing a PCSK9 mediated disease or condition Suffering, wherein the human expresses a PCSK9 variant protein form, which is selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide from that.
• 39. The kit of paragraph 38, wherein the instructions or label are for administration with a statin and / or to a human being statin-treated or statin-administered or having a reduced response to statin treatment ,
• 40. The kit according to paragraph 38 or 39, wherein it has been established that humans are resistant to treatment with statins and / or that humans have been selected as resistant to treatment with statins.
• 41. The kit according to paragraph 39 or 40, wherein the instructions or the label indicate administration to a human receiving the statin, and further instruct the instruction to reduce the administration of statin to the human.
• 42. The kit of paragraph 38, further comprising at least one buffer, package, and / or instructions or label for PCSK9 genotyping in a biological sample obtained from a human.
• 43. The kit of paragraph 38, wherein the label includes a drug approval number issued by an approval authority.
• 44. The kit according to paragraph 43, wherein the approval authority is selected from FDA and EMA.
• 45. The kit of paragraph 38, wherein the label or instructions further include instructions for administering alirocumab or evolocumab to a human.
• 46. The kit of any of paragraphs 38-45, further comprising an IV or injection device, optionally comprising alirocumab or evolocumab.
• 47. A kit for the treatment and / or prevention of a disease or condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human identified as having a variant PCSK9 protein, and / or selected as such, the kit comprising (a) alirocumab or evolocumab in a sealed container, and (b) a label or instructions from which administration of alirocumab or evolocumab to a human having a PCSK9 protein variant form selected from the A group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof is expressed.
• 48. The kit referred to in paragraph 47, the label further indicating that, if statin has been or is being administered to a person, statin treatment should be continued.
• 49. The kit referred to in paragraph 47, the label further indicating that, if statin has been or is being administered to a person, statin treatment should be reduced or discontinued.
• 50. A method for the treatment and / or prevention of a disease and / or a condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human, the method comprising
• a. examining a human biological sample for the presence of one or more PCSK9 protein variants selected from the group consisting of the PCSK9 forms f, c, r, p, m, e, h, aj and q; and
• b. the administration to humans of a therapeutically effective amount of a human PCSK9 binding ligand when one or more of the PCSK9 forms f, c, r, p, m, e, h, aj and q is detected.
• 51. The method of paragraph 50, wherein the ligand specifically binds one or more of the PCSK9 forms f, c, r, p, m, e, h, aj, and q.
• 52. A method for the treatment and / or prevention of a disease or condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human, the method comprising
• a. assaying a human biological sample for the presence of one or more PSCK9 nucleic acid variants selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic domain or C-terminal domain encoding sequence thereof; and
• b. the administration to humans of a therapeutically effective amount of a human PCSK9 binding ligand when one or more of the PCSK9 nucleic acid marinals is detected.
• 53. The method of paragraph 52, wherein the ligand specifically binds one or more of the PCSK9 forms f, c, r, p, m, e, h, aj, and q.
• 54. A method of selecting a human for the treatment and / or prevention of a disease mediated by a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein with a human PCSK9 binding ligand, comprising:
• a. examining a biological sample taken from a human for the presence of a PCSK9 protein variant selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q; and
• b. human selection for treatment with the human PCSK9 binding ligand if at least one of the PCSK9 protein variants selected from the group consisting of the PCSK9 forms f, c, r, p, m, e, h, aj and q is detected ,
• 55. The method of paragraph 54, wherein the human is indicated for statin treatment or has been administered statin to the human.
• 56. The method of paragraph 54 or 55, wherein the human has been identified as being substantially resistant to statin treatment or shows a reduced response to statin treatment.
• 57. The method of any one of paragraphs 54-56, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 58. The method of any one of paragraphs 54-57, wherein the administered human PCSK9 binding ligand is specific for the detected PCSK9 form.
• 59. The method of any of paragraphs 54-58, wherein the PCSK9 protein form comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4-27.
• 60. The method of any one of paragraphs 54-59, wherein the PCSK9 protein form comprises the mature PCSK9 form.
• 61. An assay for selecting a human suffering from a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein-mediated disease or condition as appropriate for treatment with a human PCSK9-binding ligand, the method comprising includes
• a. contacting a biological sample from the human with at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides that can specifically hybridize to and identify a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NO : 29-37 or at least the catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridizing to an antisense sequence of the sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence, but is not present in SEQ ID NO: 28 or hybridizes with an antisense sequence to form a complex when at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic domain or C-terminal ones Domain encoding sequence thereof is present; and or
• b. proof of the presence or absence of the complex; and
• c. human selection as appropriate for treatment with the human PCSK9 binding ligand, if the presence of at least one complex comprising a PCSK9 form encoded by SEQ ID NO: 29-37, or those for the catalytic domain or C-terminal Domain coding sequence thereof is detected.
• 62. An assay for selecting a human suitable for treatment with a human proprotein convertase subtilisin / kexin type 9 (PCSK9) binding ligand, the method comprising
• a. contacting a biological sample from a human with a PCSK9 mediated disease or condition with one or more antibodies, portions of antibody or antibody fragments capable of producing a PCSK9 variant form selected from the group consisting of the PCSK9 forms f to bind c, r, p, m, e, h, aj and q to form a complex when one or more PCSK9 forms f, c, r, p, m, e, h, aj and q are present;
• b. proof of the presence or absence of the complex; and
• c. human selection as appropriate for treatment with the human PCSK9-binding ligand if the presence of at least one complex comprising the PCSK9 form f, c, r, p, m, e, h, aj and q is detected.
• 63. The method of paragraph 61 or 62, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 64. The assay of any of paragraphs 61-63, wherein the human PCSK9 binding ligand is specific for the detected PCSK9 form.
• 65. The assay of any of paragraphs 61-64, further comprising amplifying nucleic acids from the biological sample.
• 66. The assay of any of paragraphs 61-65, further comprising isolating nucleic acids from the biological sample.
• 67. The assay of any of paragraphs 61-66, further comprising administering the PCSK9 binding ligand to a human.
• 68. A method of producing an anti-human pro-protein convertase subtilisin / kexin type 9 (PCSK9) antibody binding site, the method comprising obtaining a plurality of anti-PCSK9 antibody binding sites, screening the antibody binding sites for binding to a human PCSK9 or a catalytic or C-terminal domain or a peptide thereof selected from the forms f, c, r, p, m, e, h, aj and q, which has an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3, and isolating an antibody binding site which binds in the screening step, and optionally producing a form f, c, r, p, m, e, h, aj or q of the PCSK9 binding Fragment or derivative of the isolated antibody.
• 69. A method of producing an anti-human pro-protein convertase subtilisin / kexin type 9 (PCSK9) antibody, which method comprises immunizing a non-human vertebrate with a human PCSK9 having an amino acid sequence selected from the group consisting of the amino acid sequences of the Forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and isolating an antibody directed to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide of which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and optionally producing a form f, c, r, p, m, e, h, aj or q of the PCSK9 binding fragment or derivative of the isol comprising antibody.
• 70. The method of paragraphs 68-69, wherein the non-human vertebrate is a mouse or a rat.
• 71. The method of any of paragraphs 68-70, comprising the step of recovering a nucleic acid encoding the antibody, fragment, derivative or binding site, and optionally inserting the nucleic acid into an expression vector.
• 72. A proprotein convertase kit Subtilisin / Kexin type 9 (PCSK9) genotyping of a human, said kit comprising a nucleic acid comprising (i) a sequence of contiguous nucleotides specifically hybridizing to a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or at least the catalytic domain or the C-terminal domain coding sequence thereof hybridized, or hybridized specifically with an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides with at least hybridizing to a nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or hybridizing to an antisense sequence or an RNA transcript thereof; and / or (ii) comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or comprises an antisense sequence or RNA version of these contiguous nucleotides, wherein the sequence of contiguous nucleotides is at least a nucleotide present in the selected sequence but not present in SEQ ID NO: 28.
• 73. A Proprotein Convertase Kit Subtilisin / Kexin Type 9 (PCSK9) genotyping or phenotyping of a human, the kit comprising a ligand antibody linked to a human PCSK9 selected from the group consisting of forms f, c, r, p , m, e, h, aj and q or a catalytic or C-terminal domain or peptide thereof, which includes an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, or an antibody Fragment or derivative produced by the method of any of paragraphs 68-71.
• 74. A method for targeting a proprotein convertase subtilisin / kexin type 9 (PCSK9) for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition in a human, the method comprising administering an anti-PCSK9 ligand comprises a human comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, targeting a PCSK9 encoded by the nucleotide sequence.
• 75. The method of paragraph 74, wherein the method comprises targeting a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q with the ligand for treatment and / or prevention illness or disease in humans.
• 76. A method for the treatment and / or prevention of a proprotein convertase subtilisin / kexin type 9 (PCSK9) mediated disease or a PCSK9 mediated disease in a human, the method comprising targeting a human PCSK9 selected from the group consisting of forms f , c, r, p, m, e, h, aj, and q, by administering to humans a ligand that binds PCSK9, thereby treating and / or preventing the disease or condition in humans.
• 77. The method of paragraph 76, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.
• 78. The method of any of paragraphs 74 to 77, wherein the human has been genotyped as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof; becomes.
• 79. The method of any of paragraphs 74 to 78, wherein the human is or has been phenotyped as positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q ,
• 80. The method of any of paragraphs 74-79, wherein the method comprises genotyping the human as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence it was or will be genotyped.
• 81. The method of any one of paragraphs 74-80, wherein the method of human phenotyping is positive for a human PCSK9 sequence selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q includes.
• 82. The method of any of paragraphs 74 to 81, wherein the human has been or is being genotyped as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof; wherein the human optionally as the nucleotide sequence of SEQ ID NO: 28 or the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or for the catalytic or C-terminal Domain coding sequence thereof has been or will be genotyped.
• 83. The method of any one of paragraphs 74 to 82, wherein the human genome is genotyped as homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof became or becomes.
• 84. The method of any one of paragraphs 74 to 83, the method comprising human genotyping for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof prior to administration of the ligand to human, it being found that the ligand is capable of binding to a PCSK9 encoded by the selected sequence.
• 85. The method of any one of paragraphs 74 to 84, further comprising administering to a human the ligand and a statin (eg, atorvastatin).
• 86. The method of paragraph 85, wherein the ligand and the statin are administered separately.
• 87. The method of paragraph 85, wherein the ligand and statin are co-administered.
• 88. The method of any one of paragraphs 74 to 87, wherein the ligand is administered by subcutaneous injection.
• 89. A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a person in need thereof, comprising:
• a. selecting a human having (i) a proprotein convertase subtilisin / kexin type 9 (PCSK9) nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein; and
• b. the administration of an antibody or antibody fragment that specifically binds one or more PCSK9 amino acid sequences encoded by the nucleotide sequence that resides in the human to that human.
• 90. The method of paragraph 89, wherein step (a) comprises selecting a human comprising a PCSK9 protein encoded by the nucleotide sequences of (i) or (ii).
• 91. The method of paragraph 89 or 90, wherein the antibody or antibody fragment specifically binds the PCSK9 amino acid sequence.
• 92. The method of paragraph 89 or 90, wherein the antibody or antibody fragment binds a second PCSK9 protein comprising an amino acid sequence encoded by (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 ; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein.
• 93. The method of paragraph 89 or 90, wherein the antibody comprises a VH domain derived from the recombination of a human VH gene segment, human D gene segments, and a human JH segment, wherein the VH gene segment comprises a nucleotide sequence which comprises a single nucleotide polymorphism with nucleotide C as shown in rs56069819 (SEQ ID NO 41).
• 94. The method of paragraph 93, wherein the VH gene segment is VH3-23 * 04.
• 95. The method of any one of paragraphs 89-93, wherein the antibody comprises a VH domain, wherein the VH domain comprises the backbone 1 sequence of SEQ ID NO: 38.
• 96. The method of any of paragraphs 89-95, wherein it has been determined that the human comprises the nucleotide sequence of (i) and / or (ii).
• 97. The method of any of paragraphs 89-96, wherein it has been determined that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of (i) and / or (ii) , The method of any one of paragraphs 89-97, comprising the step of determining that the human comprises the nucleotide sequence of (i) and / or (ii).
• 98. The method of paragraph 98, wherein the detecting step is performed prior to administration of the antibody to a human.
• 99. The method of any one of paragraphs 89-99, comprising the step of determining that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant represented by the nucleotide sequence of (i) and / or (ii ) is encoded.
• 100. The method of paragraph 100, wherein the detecting step is performed prior to administration of the antibody to a human.
• 101. The method of paragraph 100 or 101, wherein the determining step comprises examining a human biological sample for (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence encoding the catalytic domain or C-terminal domain of a variant PCSK9 protein.
• 102. The method of paragraph 102, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides which can specifically hybridize to and identify with a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NOs: 29-37 or at least that for the catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridizing with an antisense sequence of the sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or hybridizing with an antisense sequence to form a complex when at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence of these contiguous nucleotides, wherein the sequence of contiguous nucleotides comprises at least one Nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 is present; and detecting the presence or absence of the complex, wherein determining the presence of the complex determines that the human comprises the variant PCSK9 protein.
• 103. The method of paragraph 102 or 103, wherein the assay comprises nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification.
• 104. The method of any of paragraphs 102-104, wherein the examination is in a multiplexed format.
• 105. The method of any one of paragraphs 102-105, further comprising recovering the biological sample from the human.
• 106. The method of any of paragraphs 89-106, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 107. The method of any of paragraphs 89-107, wherein the human receives or has received statin treatment or shows a decreased response to statin treatment.
• 108. The method of any of paragraphs 89-108, further comprising administering a statin to a human.
• 109. The method of any one of paragraphs 89-108, wherein the antibody or antibody fragment and statin are administered separately or simultaneously.
• 110. The method of any one of paragraphs 106-110, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 111. The method of any of paragraphs 89-111, wherein the human is heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the nucleotide sequence thereof, those for the catalytic domain or C-terminal Domain coding sequence of a PCSK9 protein encoded.
• 112. The method of any one of paragraphs 89-112, wherein the human further comprises the nucleotide sequence of SEQ ID NO: 28 and / or the catalytic domain or C-terminal domain encoding sequence thereof.
• 113. The method of any one of paragraphs 89-113, wherein the human is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the catalytic domain or C-terminal domain encoding sequence thereof ,
• 114. The method of any of paragraphs 89-114, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 115. The method of any one of paragraphs 89-115, wherein the method comprises at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension, and cardiovascular disease or cardiovascular disease.

Additional tailoring of ligands to the genotype and / or phenotype of the human patient

As described herein, the present invention contemplates ligands (eg, antibodies and fragments) whose binding site specificities have been adapted to one or more human PCSK9 variants. Human PCSK9 is referred to elsewhere as "TOI". Additionally or alternatively (and as further explained in the non-limiting examples below), an optional aspect of the invention provides for the adaptation of other features of the ligand to the genotype or phenotype of the patient. In this regard, the invention includes the ability to tailor amino acid sequence variation in a human patient to one or more ligand sequences or domains outside the binding sites. For example, where the ligand comprises or consists of a human PCSK9-binding antibody or an anti-human PCSK9 receptor-Fc fusion, this aspect of the invention provides for a more tailored adaptation of one or more domains (eg, Fc) of constant regions ready for the genotype or phenotype of the patient. Additionally or alternatively, it is contemplated that the sequence variation in the binding site will be similarly adapted to the genotype or phenotype of the patient. The inventor of the present application has accomplished this by analyzing the cases of SNP in sequences encoding one or more portions of the ligand, e.g. SNPs occurring in one, several or all of the gene segments from which the variable domain (s) and / or the variable domain (s) of constant regions are derived / derived have been considered. It is clear to the inventor that it would be desirable to adapt the ligand to one or more corresponding SNP variants found in the therapeutically and / or prophylactically treated patient. The adaptation could include the specific development of the ligand for a patient of known phenotype and / or genotype, or the adaptation could be the selection of a ligand by establishing that there is a correspondence between the variation in phenotype or genotype of the patient to the variation in the Ligand amino acid and / or corresponding nucleotides.

Most important to the inventor was the desire to improve the compatibility of the ligand with the patient's body and, in particular, the possible responses of the patient's immune system to the administered ligands. For example, it has been observed that in human patients given human or humanized antibody drugs, an immune response to the delivered antibody (a so-called HAHA response) can be elicited that results in the patient following the drug's identification the immune system of the patient as a foreign antibody against the drug forms. For example, studies indicate that some patients receiving HUMIRA ^TM (adalimumab), currently the best-selling antibody drug, have a HAHA immune response to the drug and may have a detrimental effect on the treatment. It's up JAMA. 2011; 305 (14): 1460-1468. doi: 10.1001 / jama.2011.406: "Development of Antidrug Antibodies Against Adalimumab and Association With Disease Activity and Treatment Failure During Long-term Follow-up", GM Bartelds et al. directed. The authors concluded that the results of this study showed that the development of anti-drug antibodies was associated with a negative result of adalimumab treatment in human RA patients. It was reported that not only the patients with anti-adalimumab antibodies discontinued treatment more often and earlier than patients without anti-adalimumab antibodies, but also had higher disease activity during treatment and rarely remissioned. In addition, data reported that two-thirds of anti-adalimumab antibody-positive patients developed these antibodies within the first 28 weeks of treatment and that the presence of anti-adalimumab antibodies significantly affected serum adalimumab concentrations.

This HAHA issue is therefore a major concern, and this has been taken into account by the regulatory authorities. For example, the European Medicines Agency (EMA) has one "Guideline on immunogenicity assessment of monoclonal antibodies intended for in vivo clinical use" (available on the World Wide Web at www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2012/06/WC50 0128688.pdf; EMA / CHMP / BMWP / 86289/2010 , Addendum to EMEA / CHMP / BMWP / 14327/2006), which entered into force on 1 December 2012. As such, it is good practice for researchers to identify and assess the risk of anti-antibody drug events and effects.

The present aspect of the invention aids in tailoring the ligand itself (and its specificity) to the patient in the development and administration of anti-human PCSK9 drugs for the treatment and / or prevention of human PCSK9-related diseases and conditions To consider concerns.

The inventor has also considered the desirability of tailoring the variation in the constant region of the ligand (e.g., to an antibody or Fc-containing ligand), paying attention that the constant region administered to the patient will then affect the various components the Fc receptors of the patient that would interact with the constant region in the patient would be adjusted. Good Fc / Fc receptor interactions may be important for drug (via FcRn) recycling to provide useful in vivo lifetimes or for use in killing cells, e.g. In cancer indications. In this way, it is possible to better adjust the effector function of the constant region (eg, Fc) to the patient to improve efficacy. More effective drugs, for example, are desirable for better patient care and may provide the opportunity to reduce the dosage and / or the frequency of administration.

• 1. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung, wobei
• (i) der Ligand (z. B. der Antikörper oder das Fragment) Folgendes umfasst
• (a) eine variable Domäne, die von einer Nukleotidsequenz der humanen V-Region codiert wird, wobei sich die V-Nukleotidsequenz von einer Rekombination von humanen VH-, D- und JH-Gensegmenten oder humanen VL- und JL-Gensegmenten ableitet; oder
• (b) eine Domäne einer konstanten Region, die durch ein C-Region-Gensegment codiert wird; wobei ein erstes Gensegment der Gensegmente von (a), oder das C-Region-Gensegment von (b) einen ersten Einzelnukleotidpolymorphismus (Single Nucleotide Polymorphism, SNP) umfasst, der für einen ersten Aminosäurepolymorphismus codiert; und
• (ii) das Genom des Menschen den ersten SNP umfassst oder wobei der Mensch (a') eine variable Antikörperdomäne, die den ersten Aminosäurepolymorphismus umfasst, oder (b') eine konstante Antikörperdomäne, die den ersten Aminosäurepolymorphismus umfasst, exprimiert.
• 2. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 1, wobei Blut das Menschen im Wesentlichen keine Antikörper umfasst, die spezifisch an die Domäne binden, die den ersten Aminosäurepolymorphismus umfasst, wie in einem in-vitro-Bindungsassay bestimmt.
• 3. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 2, wobei man sich zur Durchführung des Assays der SPR bedient. Bei einer Alternative kommt ELISA zur Anwendung.
• 4. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 3, wobei das Genom des Menschen das erste Gensegment (im Fall von (a)) oder das C-Region-Gensegment (im Fall von (b)) umfasst.
• 5. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 4, wobei das erste Segment oder ein zweites Segment der Segmente von (a), oder das C-Region-Gensegment von (b) einen zweiten SNP umfasst, der für einen zweiten Aminosäurepolymorphismus codiert; und wobei das Genom des Menschen den zweiten SNP umfasst oder wobei der Mensch (a'') eine variable Domäne eines Antikörpers exprimiert, die den zweiten Aminosäurepolymorphismus umfasst, oder (b'') eine Domäne einer konstanten Region eines Antikörpers exprimiert, die den ersten und den zweiten Aminosäurepolymorphismus umfasst.
• 6. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 5, wobei der Mensch eine variable Domäne eines Antikörpers exprimiert, die den ersten und den zweiten Aminosäurepolymorphismus umfasst.
• 7. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 5 oder 6, wobei der erste und der zweite SNP des Genoms im gleichen Antikörpergensegment enthalten sind. Beispielsweise sind der erste und der zweite SNP des Genoms in einem IGHG1*01-Gensegment enthalten und das erste Segment von (a) ist ein IGHG1*01-Gensegment. Beispielsweise sind der erste und der zweite SNP des Genoms in einem IGHG2*02-Gensegment enthalten und das erste Segment von (a) ist ein IGHG2*01-Gensegment.
• 8. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 7, wobei jede SNP eine SNP im Gensegment einer variablen Region ist.
• 9. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 7, wobei es sich bei den SNP jeweils um ein SNP eines Gensegments einer konstanten Region handelt, wobei z. B. die SNP jeweils ein SNP eines Gensegments einer konstanten gamma-1-Region oder ein SNP eines Gensegments einer konstanten gamma-2-Region oder ein SNP eines Gensegments einer konstanten gamma-3-Region oder ein SNP eines Gensegments einer konstanten gamma-4-Region sind.
• 10. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 9, wobei der erste SNP ein SNP eines CH1-, CH2-, CH3- oder CH4-Gensegments und/oder der zweite SNP ein SNP eines CH1-, CH2-, CH3- oder CH4-Gensegments ist.
• 11. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 8, wobei jede SNP eine SNP einer variablen Domäne, z. B. ein VH-Domänen-SNP oder ein Vκ-Domänen-SNP oder ein Vλ-SNP ist.
• 12. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 11, wobei die Domäne der konstanten Region von (b) aus einer Antikörper-Fc-Region besteht.
• 13. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 12, wobei festgestellt wurde, dass der Ligand (z. B. der Antikörper oder das Fragment) spezifisch an eine oder mehrere wie hier offenbarte humane PCSK9-Varianten bindet, zum Beispiel mit einem KD von 1 nM oder weniger (z. B. 100 oder 10 pM oder weniger), wie durch SPR bestimmt.
• 14. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 13), wobei der Ligand einen Antikörper oder ein Fragment umfasst oder daraus besteht, der bzw. das die variable Domäne eines humanen Antikörpers umfasst, abgeleitet von der Rekombination eines humanen V-Gensegments und eines humanen J-Gensegments (und gegebenenfalls eines humanen D-Gensegments, wenn es sich bei den variablen Domänen um VH-Domänen handelt); und wobei das Genom des Menschen das humane V-Gensegment umfasst und/oder der Mensch Antikörper exprimiert, die variable Antikörperdomänen umfassen, die sich von der Rekombination des humanen V-Gensegments und eines humanen J-Gensegments (und gegebenenfalls eines humanen D-Gensegments) ableiten. Bei einem Beispiel handelt es sich bei dem V-Gensegment um eines der in WO2013041844 , einer 1000 Genomes-Datenbank und/oder www.imgt.org, deren Offenbarung (einschließlich der Offenbarung, die die Sequenz betrifft) ausdrücklich durch Verweis zur Verwendung in der vorliegenden Erfindung Bestandteil der vorliegenden Erfindung wird, offenbarten V-Gensegmente.
• 15. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 14), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine humane konstante Domäne einer schweren Kette codiert durch eine erste Nukleotidsequenz einer konstanten Region umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren Kette umfasst, die identisch ist zu der ersten Nukleotidsequenz einer konstanten Region, und/oder der Mensch Antikörper exprimiert, die die humane konstante Domäne umfassen.
• 16. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 15), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine humane CH1-Domäne einer schweren gamma-Kette codiert durch eine CH1-Nukleotidsequenz umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren gamma-Kette umfasst, die identisch ist zu der CH1-Nukleotidsequenz, und/oder der Mensch Antikörper exprimiert, die die humane gamma-CH1-Domäne umfassen.
• 17. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 16), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine humane CH2-Domäne einer schweren gamma-Kette codiert durch eine CH2-Nukleotidsequenz umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren gamma-Kette umfasst, die identisch ist zu der CH2-Nukleotidsequenz, und/oder der Mensch Antikörper exprimiert, die die humane gamma-CH2-Domäne umfassen.
• 18. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 17), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine humane CH3-Domäne einer schweren gamma-Kette codiert durch eine CH3-Nukleotidsequenz umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren gamma-Kette umfasst, die identisch ist zu der CH3-Nukleotidsequenz, und/oder der Mensch Antikörper exprimiert, die die humane gamma-CH3-Domäne umfassen.
• 19. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 18), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine humane CH4-Domäne einer schweren gamma-Kette codiert durch eine CH4-Nukleotidsequenz umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren gamma-Kette umfasst, die identisch ist zu der CH4-Nukleotidsequenz, und/oder der Mensch Antikörper exprimiert, die die humane gamma-CH4-Domäne umfassen.
• 20. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 19), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten humanen PCSK9-Rezeptor umfasst oder daraus besteht) eine Fc-Region einer humanen schweren gamma-Kette codiert durch eine Fc-Nukleotidsequenz umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz einer konstanten Region einer schweren gamma-Kette umfasst, die identisch ist zu der Fc-Nukleotidsequenz, und/oder der Mensch Antikörper exprimiert, die die humane gamma-Fc-Region umfassen.
• 21. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 16 bis 20, wobei es sich bei der humanen schweren gamma-Kette um eine humane schwere gamma-1-Kette handelt.
• 22. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 16 bis 20, wobei es sich bei der humanen schweren gamma-Kette um eine humane schwere gamma-2-Kette handelt.
• 23. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 16 bis 20, wobei der Ligand eine konstante IGHG1*01-Region der humanen schweren gamma-1-Kette umfasst.
• 24. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 16 bis 20, wobei der Ligand eine konstante IGHG2*01-Region der humanen schweren gamma-1-Kette umfasst.
• 25. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 15 bis 24, wobei der Mensch als positiv für die Nukleotidsequenz der konstanten Region der schweren Kette genotypisiert wurde oder wird.
• 26. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 23, wobei der Mensch als positiv für die humane IGHG1*01-Nukleotidsequenz genotypisiert wurde oder wird.
• 27. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 24, wobei der Mensch als positiv für die humane IGHG2*01-Nukleotidsequenz genotypisiert wurde oder wird.
• 28. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 16 bis 24, wobei der Mensch als positiv für die konstante Domäne, CH1, CH2, CH3, CH4 oder Fc der schweren gamma-Kette phänotypisiert wurde oder wird.
• 29. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 28, (i) falls abhängig von Klausel 23, wobei der Mensch als positiv für eine humane konstante IGHG1*01-Domäne einer schweren gamma-Kette, CH1, CH2, CH3, CH4 oder Fc phänotypisiert wurde oder wird oder (ii) falls abhängig von Klausel 24, wobei der Mensch als positiv für eine humane konstante IGHG2*01-Domäne einer schweren gamma-Kette, CH1, CH2, CH3, CH4 oder Fc phänotypisiert wurde oder wird.
• 30. Das Verfahren oder die Anwendung nach einer der Klauseln 16 bis 24 und 26 bis 29, bei dem man den Menschen als positiv für die Nukleotidsequenz der konstanten Region der schweren gamma-Kette, z. B. positiv für die CH1-, CH2-, CH3-, CH4- oder Fc-Nukleotidsequenz der konstanten Domäne der schweren gamma-Kette; positiv für die CH1-, CH2-, CH3-, CH4- oder Fc-Nukleotidsequenz der konstanten IGHG1*01-Region der humanen schweren gamma-Kette; oder positiv für die CH1-, CH2-, CH3-, CH4- oder Fc-Nukleotidsequenz der konstanten IGHG2*01-Region der humanen schweren gamma-Kette genotypisiert.
• 31. Das Verfahren oder die Anwendung nach einer der Klauseln 16 bis 24 und 26 bis 30, bei dem man den Menschen als positiv für die konstante Region der schweren gamma-Kette, z. B. positiv für CH1, CH2, CH3, CH4 oder Fc der konstanten Domäne der schweren gamma-Kette; positiv für CH1, CH2, CH3, CH4 oder Fc der konstanten IGHG1*01-Domäne der humanen schweren gamma-Kette; oder positiv für CH1, CH2, CH3, CH4 oder Fc der konstanten IGHG2*01-Domäne der humanen schweren gamma-Kette phänotypisiert.

The invention thus provides in examples of this aspect (listed as clauses):

• 1. The ligands of the invention, the inventive method, the inventive use, the kit according to the invention or the composition according to the invention, wherein
• (i) the ligand (e.g., the antibody or fragment) comprises
• (a) a variable domain encoded by a human V region nucleotide sequence, said V nucleotide sequence being derived from recombination of human VH, D and JH gene segments or human VL and JL gene segments; or
• (b) a domain of a constant region encoded by a C region gene segment; wherein a first gene segment of the gene segments of (a) or the C region gene segment of (b) comprises a first single nucleotide polymorphism (SNP) encoding a first amino acid polymorphism; and
• (ii) the human genome comprises the first SNP, or wherein human (a ') expresses a variable antibody domain comprising the first amino acid polymorphism, or (b') an antibody constant domain comprising the first amino acid polymorphism.
• 2. The ligand, method, application, kit or composition according to clause 1, wherein blood comprises human substantially no antibodies that bind specifically to the domain comprising the first amino acid polymorphism, as in an in vitro Binding assay determined.
• 3. The ligand, method, application, kit or composition according to Clause 2, using the SPR Assay. An alternative uses ELISA.
• 4. The ligand, method, application, kit or composition of any one of clauses 1 to 3, wherein the human genome comprises the first gene segment (in the case of (a)) or the C region gene segment (in the case of (a)) from (b)).
• 5. The ligand, method, application, kit or composition of any one of clauses 1 to 4, wherein the first segment or a second segment of the segments of (a), or the C region gene segment of (b) a second SNP coding for a second amino acid polymorphism; and wherein the human genome comprises the second SNP, or wherein human (a '') expresses a variable domain of an antibody comprising the second amino acid polymorphism, or (b '') expresses a constant region domain of an antibody comprising the first and the second amino acid polymorphism.
• 6. The ligand, method, application, kit or composition of clause 5, wherein the human expresses a variable domain of an antibody comprising the first and second amino acid polymorphisms.
• 7. The ligand, method, application, kit or composition according to clause 5 or 6, wherein the first and second SNP of the genome are contained in the same antibody gene segment. For example, the first and second SNP of the genome are contained in an IGHG1 * 01 gene segment, and the first segment of (a) is an IGHG1 * 01 gene segment. For example, the first and second SNP of the genome are contained in an IGHG2 * 02 gene segment, and the first segment of (a) is an IGHG2 * 01 gene segment.
• 8. The ligand, method, application, kit or composition of any one of clauses 1-7, wherein each SNP is an SNP in the gene segment of a variable region.
• 9. The ligand, method, application, kit or composition of any one of clauses 1-7, wherein each SNP is a SNP of a constant region gene segment, where e.g. For example, the SNP is an SNP of a gamma-1 constant region gene segment or an SNP of a gamma-2 constant region gene segment or an SNP of a gamma-3 constant region gene segment or SNP of a gamma-4 constant gene segment Region.
• 10. The ligand, method, application, kit or composition of clause 9, wherein the first SNP is an SNP of a CH1, CH2, CH3 or CH4 gene segment and / or the second SNP is an SNP of a CH1 gene. , CH2, CH3 or CH4 gene segment.
• 11. The ligand, method, application, kit, or composition of any of clauses 1-8, wherein each SNP comprises a variable domain SNP, e.g. A VH domain SNP or a Vκ domain SNP or a Vλ SNP.
• 12. The ligand, method, application, kit, or composition of any of clauses 1-11, wherein the domain of the constant region of (b) consists of an antibody Fc region.
• 13. The ligand, method, application, kit or composition of any one of clauses 1 to 12, wherein it has been determined that the ligand (eg, the antibody or fragment) specifically binds to one or more as disclosed herein human PCSK9 variants, for example with a KD of 1 nM or less (eg 100 or 10 pM or less), as determined by SPR.
• 14. The ligand according to the invention, the method according to the invention, the application according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 13), wherein the ligand comprises or consists of an antibody or a fragment, the or comprising the variable domain of a human antibody derived from the recombination of a human V gene segment and a human J gene segment (and optionally a human D gene segment, when the variable domains are V H domains); and wherein the human genome comprises the human V gene segment and / or human expressing antibodies comprising antibody variable domains resulting from recombination of the human V gene segment and a human J gene segment (and optionally a human D gene segment) derived. In one example, the V gene segment is one of the in WO2013041844 , a Genomes database and / or www.imgt.org, the disclosure (including the disclosure concerning the sequence) expressly incorporated herein by reference for use in the present invention disclosed V gene segments.
• 15. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 14), wherein the ligand (eg an antibody or a fragment or comprising or consisting of a Fc-fused human PCSK9 receptor) comprises a human heavy chain constant domain encoded by a first nucleus sequence of a constant region; and wherein the human genome comprises a nucleotide sequence of a heavy chain constant region identical to the first nucleotide sequence of a constant region, and / or human expressing antibodies comprising the human constant domain.
• 16. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 15), wherein the ligand (eg an antibody or a fragment or comprising or consisting of an Fc-fused human PCSK9 receptor) comprises a human heavy Gamma chain CH1 domain encoded by a CH1 nucleotide sequence; and wherein the human genome comprises a heavy gamma chain constant region nucleotide sequence identical to the CH1 nucleotide sequence and / or human expressing antibodies comprising the human gamma CH1 domain.
• 17. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (eg according to one of clauses 1 to 16), wherein the ligand (eg an antibody or a fragment or comprising or consisting of an Fc-fused human PCSK9 receptor) comprises a human heavy Gamma chain CH2 domain encoded by a CH2 nucleotide sequence; and wherein the human genome comprises a heavy gamma chain constant region nucleotide sequence identical to the CH2 nucleotide sequence and / or human expressing antibodies comprising the human gamma CH2 domain.
• 18. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (eg according to one of clauses 1 to 17), wherein the ligand (eg an antibody or a fragment or comprising or consisting of a Fc-fused human PCSK9 receptor) comprises a human heavy Gamma chain CH3 domain encoded by a CH3 nucleotide sequence; and wherein the human genome comprises a heavy gamma chain constant region nucleotide sequence identical to the CH3 nucleotide sequence and / or human expressing antibodies comprising the human gamma CH3 domain.
• 19. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 18), wherein the ligand (eg an antibody or a fragment or comprising or consisting of an Fc-fused human PCSK9 receptor) comprises a human heavy Gamma chain CH4 domain encoded by a CH4 nucleotide sequence; and wherein the human genome comprises a heavy gamma chain constant region nucleotide sequence identical to the CH4 nucleotide sequence, and / or human expressing antibodies comprising the human gamma CH4 domain.
• 20. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 19), wherein the ligand (eg an antibody or a fragment or comprising or consisting of an Fc-fused human PCSK9 receptor) comprises a human heavy gamma chain Fc region encoded by an Fc nucleotide sequence; and wherein the human genome comprises a heavy gamma chain constant region nucleotide sequence identical to the Fc nucleotide sequence and / or human expressing antibodies comprising the human gamma Fc region.
• 21. The ligand, method, application, kit or composition of any of clauses 16 to 20, wherein the human gamma heavy chain is a human gamma 1 heavy chain.
• 22. The ligand, method, application, kit or composition of any of clauses 16 to 20, wherein the human gamma heavy chain is a human gamma 2 heavy chain.
• 23. The ligand, method, application, kit or composition of any one of clauses 16 to 20, wherein the ligand comprises a human gamma-1 heavy chain constant IGHG1 * 01 region.
• 24. The ligand, method, application, kit or composition of any one of clauses 16 to 20, wherein the ligand comprises a human gamma-1 heavy chain constant IGHG2 * 01 region.
• 25. The ligand, method, application, kit, or composition of any one of clauses 15 to 24, wherein the human is or has been genotyped as positive for the nucleotide sequence of the heavy chain constant region.
• 26. The ligand, method, application, kit or composition of clause 23, wherein the human is or has been genotyped as positive for the human IGHG1 * 01 nucleotide sequence.
• 27. The ligand, method, application, kit or composition of clause 24, wherein the human is or has been genotyped as positive for the human IGHG2 * 01 nucleotide sequence.
• 28. The ligand, method, application, kit or composition of any one of clauses 16 to 24, wherein the human has been phenotyped as positive for the gamma heavy chain constant domain, CH1, CH2, CH3, CH4 or Fc or will.
• 29. The ligand, method, application, kit or composition according to clause 28, (i) if dependent on clause 23, wherein the human is positive for a human gamma heavy chain constant IGHG1 * 01 domain, CH1 , CH2, CH3, CH4 or Fc has been or will be phenotyped or (ii) if dependent on clause 24, wherein the human being is positive for a human gamma heavy chain constant IGHG2 * 01 domain, CH1, CH2, CH3, CH4 or Fc has been phenotyped or will.
• 30. The method or use of any one of clauses 16 to 24 and 26 to 29, wherein said human is said to be positive for the heavy gamma chain constant region nucleotide sequence, e.g. B. positive for the heavy gamma chain constant domain CH1, CH2, CH3, CH4 or Fc nucleotide sequence; positive for the CH1, CH2, CH3, CH4 or Fc nucleotide sequence of the human heavy gamma heavy chain IGHG1 * 01 constant region; or positively genotyped for the CH1, CH2, CH3, CH4 or Fc nucleotide sequence of the human heavy gamma chain IGHG2 * 01 constant region.
• 31. The method or use of any one of clauses 16 to 24 and 26 to 30, wherein human is said to be positive for the heavy gamma chain constant region, e.g. B. positive for CH1, CH2, CH3, CH4 or Fc of the gamma heavy chain constant domain; positive for CH1, CH2, CH3, CH4 or Fc of the human heavy gamma chain IGHG1 * 01 constant domain; or positively phenotyped for CH1, CH2, CH3, CH4 or Fc of the human heavy gamma chain IGHG2 * 01 constant domain.

Examples of tailored ligands

The inventor has analyzed the amino acid variability and distribution in large representative human samples. The result of the analysis for exemplary antibody gene segments is shown in Table 8.

• 32. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 31), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten TOI-Rezeptor umfasst) eine konstante Region der humanen schweren gamma-1-Kette umfasst die ein Asp, das der Position 204 von SEQ ID NO: 42 entspricht, oder ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der schweren gamma-1-Kette umfasst, die für ein Asp oder Leu codiert, oder der Mensch Antikörper exprimiert, die solches Asp oder Leu umfassen. Der Fachmann wird mit den Methoden zur Bestimmung von Genomsequenzen eines Menschen z. B. unter Anwendung einer genomische DNA und/oder RNA enthaltenden Probe, Sequenzieren und Vergleichen unter Anwendung von Bioinformatik oder anderen Computerwerkzeugen zum Vergleich der als Probe gezogenen Sequenz mit Sequenzen humaner Allele (z. B. wie in der IMGT-, 100 Genomes- oder einer anderen wie hier offenbarten Datenbank offenbart) vertraut sein. Bei einem Beispiel handelt es sich bei der Probe um Blut oder Speichel oder eine Wangenabstrichprobe.
• 33. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 32, wobei der Ligand eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst.
• 34. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 32 oder 33, wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der schweren gamma-1-Kette umfasst, die für ein solches Asp oder Leu codiert, oder der Mensch Antikörper exprimiert, die solch ein Asp oder Leu umfassende konstante Regionen der humanen gamma-1-Kette umfassen.
• 35. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 32, 33 oder 34, wobei der Ligand eine konstante IGHG1*01-Region einer humanen schweren gamma-1-Kette, z. B. eine Fc-, CH1-, CH2- und/oder CH3-Domäne codiert durch humanes IGHG1*01, umfasst.
• 36. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 35, wobei das Genom des Menschen eine humane IGHG1*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die humane konstante Domänen umfassen, die durch eine humane IGHG1*01-Nukleotidsequenz codiert werden.
• 37. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 36, wobei der Ligand eine durch humanes IGHG1*01 codierte Gelenkregion umfasst.
• 38. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 37, wobei der Ligand einen Antikörper umfasst oder daraus besteht, wobei der Antikörper schwere Ketten umfasst, die SEQ ID NO: 61 umfassen.
• 39. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 38, wobei der Mensch europäischer Abstammung ist. Wie in Tabelle 8 gezeigt finden sich in solchen Menschen 204D und 206L.
• 40. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 39, wobei der Mensch als positiv für das Asp und/oder Leu genotypisiert wurde oder wird.
• 41. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 40, wobei der Mensch als positiv für humane IGHG1*01 genotypisiert wurde oder wird.
• 42. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 41, wobei der Mensch als positiv für eine humane IGHG1*01 CH3 phänotypisiert wurde oder wird.
• 43. Das Verfahren oder die Anwendung nach einer der Klauseln 32 bis 42, umfassend die Auswahl eines Menschen, dessen Genom ein Condon/Codons umfasst, die für das Asp und/oder Leu codieren; oder humanes IGHG1*01 umfasst; oder humanes IGHG1*01 CH3 umfasst.
• 44. Das Verfahren oder die Anwendung nach einer der Klauseln 32 bis 43, umfassend die Auswahl eines Menschen, dessen Phänotyp das Asp und/oder Leu; eine humane IGHG1*01-Region; oder ein humanes IGHG1*01 CH3 umfasst. 44a. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 32 bis 44, wobei der Mensch Antikörper exprimiert, die humane konstante gamma-1-Regionen umfassen, die ein solches Asp und Leu umfassen.

In a first example, the inventor identified the possibility to address the rarer IGH-gamma-1 SNPs 204D (observed at a cumulative frequency of 0.266) and 206L (observed at a cumulative frequency of 0.283) individually or in combination. These residues are part of the CH3 domain and as such form part of the Fc regions of the antibody. Balancing these CH3 variations with the patient is therefore of particular use for the reasons discussed above. This example thus provides aspects that are set forth in the following clauses.

• 32. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (eg according to one of clauses 1 to 31), wherein the ligand (eg an antibody or a fragment or comprises a Fc-fused TOI receptor) a human gamma-1 heavy chain constant region comprises an Asp corresponding to position 204 of SEQ ID NO: 42, or a Leu, position 206 of SEQ ID NO: 42 corresponds, comprises; and wherein the human genome comprises a nucleotide sequence of the gamma-1 heavy chain constant region which codes for an Asp or Leu or the human expresses antibodies comprising such Asp or Leu. The skilled person will be familiar with the methods for the determination of genome sequences of a human z. Using a genomic DNA and / or RNA-containing sample, sequencing and comparing using bioinformatics or other computer tools to compare the sampled sequence with sequences of human alleles (eg, as in the IMGT, Genomes, or Genomics) another database as disclosed herein). In one example, the sample is blood or saliva or a cheek swab specimen.
• 33. The ligand, method, application, kit or composition of clause 32, wherein the ligand comprises a human gamma-1 heavy chain constant region corresponding to an Asp, position 204 of SEQ ID NO: 42 and a leu corresponding to position 206 of SEQ ID NO: 42.
• 34. The ligand, method, application, kit or composition of clause 32 or 33, wherein the human genome comprises a nucleotide sequence of the gamma-1 heavy chain constant region encoding such an Asp or Leu, or human expressing antibodies comprising such human gamma-1 chain constant regions comprising such Asp or Leu.
• 35. The ligand, method, application, kit or composition of clause 32, 33 or 34, wherein the ligand is a human heavy gamma-1 heavy chain IGHG1 * 01 region, e.g. A Fc, CH1, CH2 and / or CH3 domain encoded by human IGHG1 * 01.
• 36. The ligand, method, application, kit or composition of any one of clauses 32 to 35, wherein the human genome comprises a human IGHG1 * 01 nucleotide sequence, or human expressing antibodies comprising human constant domains, the be encoded by a human IGHG1 * 01 nucleotide sequence.
• 37. The ligand, method, application, kit or composition of any of clauses 32 to 36, wherein the ligand comprises a hinge region encoded by human IGHG1 * 01.
• 38. The ligand, method, application, kit, or composition of any of clauses 32 to 37, wherein the ligand comprises or consists of an antibody, wherein the antibody comprises heavy chains comprising SEQ ID NO: 61.
• 39. The ligand, method, application, kit or composition of any one of clauses 32-38, wherein the human is of European descent. As shown in Table 8, 204D and 206L are found in such people.
• 40. The ligand, method, application, kit or composition of any one of clauses 32 to 39, wherein the human is or has been genotyped as positive for the Asp and / or Leu.
• 41. The ligand, method, application, kit or composition of any one of clauses 32 to 40, wherein human is or has been genotyped as positive for human IGHG1 * 01.
• 42. The ligand, method, use, kit or composition of any of clauses 32 to 41, wherein the human is or has been phenotyped as positive for a human IGHG1 * 01 CH3.
• 43. The method or application of any of clauses 32 to 42, comprising selecting a human whose genome comprises a Condon / codon coding for the Asp and / or Leu; or human IGHG1 * 01; or human IGHG1 * 01 CH3.
• 44. The method or use of any of clauses 32 to 43, comprising selecting a human whose phenotype is Asp and / or Leu; a human IGHG1 * 01 region; or a human IGHG1 * 01 CH3. 44a. The ligand, method, application, kit, or composition of any one of clauses 32 to 44, wherein the human expresses antibodies comprising human gamma-1 constant regions comprising such Asp and Leu.

• 45. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 31), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten TOI-Rezeptor umfasst oder daraus besteht) eine konstante Region der humanen schweren gamma-2-Kette umfasst; die eine Aminosäure ausgewählt aus der Gruppe bestehend aus einem Pro, das der Position 72 von SEQ ID NO: 44 entspricht, einem Asn, das Position 75 von SEQ ID NO: 44 entspricht, einem Phe, das Position 76 von SEQ ID NO: 44 entspricht, einem Val, das Position 161 von SEQ ID NO: 44 entspricht, und einem Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der schweren gamma-2-Kette umfasst, die für solch eine ausgewählte Aminosäure codiert, oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen gamma-2-Kette umfassen, die solch eine ausgewählte Aminosäure umfassen.
• 46. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 45, wobei der Ligand eine konstante Region der humanen schweren gamma-2-Kette umfasst, die (i) ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, und gegebenenfalls (ii) ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und/oder ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der schweren gamma-2-Kette umfasst, die für solche Aminosäuren von (i) codiert, oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen gamma-2-Kette umfassen, die solche Aminosäuren von (i) umfassen. Dieses Beispiel konzentriert sich auf die CH1-Variation.
• 47. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 45 oder 46, wobei der Ligand eine konstante Region der humanen schweren gamma-2-Kette umfasst, die (i) ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, und gegebenenfalls (ii) eine Aminosäure ausgewählt aus der Gruppe bestehend aus einem Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, und ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der schweren gamma-2-Kette umfasst, die für solche Aminosäuren von (i) codiert, oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen gamma-2-Kette umfassen, die solche Aminosäuren von (i) umfassen. Dieses Beispiel konzentriert sich auf die Fc-Variation.
• 48. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 47, wobei der Ligand eine konstante IGHG2*01-Region einer humanen schweren gamma-2-Kette, z. B. eine Fc-, CH1-, CH2- und/oder CH3-Domäne codiert durch humanes IGHG2*01, umfasst.
• 49. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 48, wobei das Genom des Menschen eine humane IGHG2*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die humane konstante Domänen umfassen, die durch eine humane IGHG2*01-Nukleotidsequenz codiert werden.
• 50. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 49, wobei der Ligand eine durch humanes IGHG2*01 codierte Gelenkregion umfasst.
• 51. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 50, wobei der Ligand einen Antikörper umfasst oder daraus besteht, wobei der Antikörper schwere Ketten umfasst, die SEQ ID NO: 63 oder 65 umfassen.
• 52. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 51, wobei der Mensch europäischer, afrikanisch-amerikanischer oder europäisch-amerikanischer Abstammung ist.
• 53. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 52, wobei der Mensch als positiv für eine, mehrere oder alle der Pro, Asn, Phe, Val und Ala genotypisiert wurde oder wird.
• 54. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 53, wobei der Mensch als positiv für humane IGHG2*01 genotypisiert wurde oder wird.
• 55. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 54, wobei der Mensch als positiv für eine humane IGHG2*01 CH1 phänotypisiert wurde oder wird.
• 56. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 55, wobei der Mensch als positiv für eine humane IGHG2*01 CH2 phänotypisiert wurde oder wird.
• 57. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 56, wobei der Mensch als positiv für eine humane IGHG2*01 CH3 phänotypisiert wurde oder wird.
• 58. Das Verfahren oder die Anwendung nach einer der Klauseln 45 bis 57, umfassend die Auswahl eines Menschen, dessen Genom ein Condon/Codons umfasst, die für einen, mehrere oder alle der Pro, Asn, Phe, Val und Ala codieren; oder humanes IGHG2*01 umfasst; oder ein humanes IGHG2*01 CH1, CH2 und/oder CH3 umfasst.
• 59. Das Verfahren oder die Anwendung nach einer der Klauseln 45 bis 58, umfassend die Auswahl eines Menschen, dessen Phänotyp einen, mehrere oder alle der Pro, Asn, Phe, Val und Ala; eine humane IGHG2*01-Region; oder ein humanes IGHG2*01 CH1, CH2 und/oder CH3 umfasst.
• 60. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 45 bis 59, wobei der Mensch Antikörper exprimiert, die humane konstante gamma-2-Regionen umfassen, die ein solches Pro, Asn, Phe, Val und Ala umfassen.

In a second example, the inventor identified the possibility of addressing IGH-gamma-2 SNPs. This included consideration of the variation of the Fc region - in this regard, the inventor focused on positions 161 and 257 located in the Fc region. This example thus provides aspects that are set forth in the following clauses.

• 45. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 31), wherein the ligand (eg an antibody or a fragment or comprises or consists of a Fc-fused TOI receptor) comprises a human gamma 2 heavy chain constant region; the one amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe, position 76 of SEQ ID NO: 44 corresponds to a Val corresponding to position 161 of SEQ ID NO: 44 and an Ala corresponding to position 257 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such a selected amino acid, or human expressing antibodies comprising human gamma 2 chain constant regions comprising such a selected one Include amino acid.
• 46. The ligand, method, application, kit or composition of clause 45, wherein the ligand comprises a human heavy gamma 2 chain constant region, which comprises (i) a Pro, position 72 of SEQ ID NO : 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, and optionally (ii) a Val corresponding to position 161 of SEQ ID NO: 44 and / or an Ala corresponding to position 257 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (i), or human expressing antibodies comprising human gamma 2 chain constant regions, such as Include amino acids of (i). This example focuses on CH1 variation.
• 47. The ligand, method, application, kit or composition of clause 45 or 46, wherein the ligand comprises a human heavy gamma 2 chain constant region, which comprises (i) a Val, position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and optionally (ii) an amino acid selected from the group consisting of a pro corresponding to position 72 of SEQ ID NO: 44, an Asn comprising position 75 of SEQ ID NO: 44 and a Phe corresponding to position 76 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (i), or human expressing antibodies comprising human gamma 2 chain constant regions, such as Include amino acids of (i). This example focuses on the Fc variation.
• 48. The ligand, method, application, kit or composition of any one of clauses 45 to 47, wherein the ligand is a human heavy gamma 2 chain constant IGHG2 * 01 region, e.g. A Fc, CH1, CH2 and / or CH3 domain encoded by human IGHG2 * 01.
• 49. The ligand, method, application, kit or composition of any one of clauses 45 to 48, wherein the human genome comprises a human IGHG2 * 01 nucleotide sequence, or the human expressing antibodies comprising human constant domains, the be encoded by a human IGHG2 * 01 nucleotide sequence.
• 50. The ligand, method, application, kit or composition of any one of clauses 45 to 49, wherein the ligand comprises a hinge region encoded by human IGHG2 * 01.
• 51. The ligand, method, application, kit, or composition of any of clauses 45 to 50, wherein the ligand comprises or consists of an antibody, wherein the antibody comprises heavy chains comprising SEQ ID NO: 63 or 65 ,
• 52. The ligand, method, application, kit or composition of any one of clauses 45 to 51, wherein the human is of European, African American or European American descent.
• 53. The ligand, method, application, kit or composition of any one of clauses 45 to 52, wherein human is or has been genotyped as positive for one, several or all of Pro, Asn, Phe, Val and Ala.
• 54. The ligand, method, application, kit or composition of any one of clauses 45 to 53, wherein human is or has been genotyped as positive for human IGHG2 * 01.
• 55. The ligand, method, application, kit or composition of any one of clauses 45 to 54, wherein human is or has been phenotyped as positive for a human IGHG2 * 01 CH1.
• 56. The ligand, method, application, kit or composition of any one of clauses 45 to 55, wherein human is or has been phenotyped as positive for a human IGHG2 * 01 CH2.
• 57. The ligand, method, application, kit or composition of any of clauses 45 to 56, wherein the human has been or is being phenotyped as positive for a human IGHG2 * 01 CH3.
• 58. The method or use of any one of clauses 45 to 57, comprising selecting a human whose genome comprises a Condon / codon encoding one, several or all of Pro, Asn, Phe, Val and Ala; or human IGHG2 * 01; or a human IGHG2 * 01 comprises CH1, CH2 and / or CH3.
• 59. The method or use of any one of clauses 45 to 58, comprising selecting a human whose phenotype has one, several, or all of Pro, Asn, Phe, Val, and Ala; a human IGHG2 * 01 region; or a human IGHG2 * 01 comprises CH1, CH2 and / or CH3.
• 60. The ligand, method, application, kit, or composition of any of clauses 45 to 59, wherein the human expresses antibodies comprising human gamma 2 constant regions comprising such Pro, Asn, Phe, Val and Ala include.

• 61. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 60), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten TOI-Rezeptor umfasst oder daraus besteht) eine konstante Region der humanen leichten kappa-Kette umfasst; die ein Val umfasst, das der Position 84 von SEQ ID NO: 50 entspricht, oder ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst; und wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der leichten kappa-Kette umfasst, die für ein solches Val oder Cys codiert, oder der Mensch Antikörper exprimiert, die solch ein Val oder Cys umfassende konstante Regionen der humanen leichten kappa-Kette umfassen.
• 62. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 61, wobei der Ligand eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst.
• 63. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 61 oder 62, wobei das Genom des Menschen eine Nukleotidsequenz der konstanten Region der leichten kappa-Kette umfasst, die für ein solches Val oder Cys codiert, oder der Mensch Antikörper exprimiert, die solch ein Val oder Cys umfassende konstante Regionen der humanen kappa-Kette umfassen.
• 64. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 63, wobei der Antikörper oder das Fragment eine konstante IGKC*01-Region der humanen leichten kappa-Kette umfasst.
• 65. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 64, wobei der Ligand einen Antikörper umfasst oder daraus besteht, wobei der Antikörper leichte Ketten umfasst, die SEQ ID NO: 62 oder 66 umfassen.
• 66. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 65, wobei der Ligand einen Antikörper umfasst oder daraus besteht, wobei der Antikörper eine variable Domäne der leichten Kette umfasst, die sich aus einer Rekombination eines humanen Vκ-Gensegments und eines humanen Jκ-Gensegments ableitet, wobei es sich bei dem Jκ-Gensegment um IGKJ2*01 (SEQ ID NO: 57) handelt.
• 67. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 66, wobei der Mensch als positiv für das Val und/oder Cys phänotypisiert wurde oder wird.
• 68. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 67, wobei der Mensch als positiv für humane IGKC*01 genotypisiert wurde oder wird.
• 69. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 68, wobei der Mensch als positiv für eine humane IGKC*01-Domäne phänotypisiert wurde oder wird.
• 70. Das Verfahren oder die Anwendung nach einer der Klauseln 61 bis 69, umfassend die Auswahl eines Menschen, dessen Genom ein Condon/Codons umfasst, die für das Val und/oder Cys codieren; oder humanes IGKC*01 umfasst.
• 71. Das Verfahren oder die Anwendung nach einer der Klauseln 61 bis 70, umfassend die Auswahl eines Menschen, dessen Phänotyp ein solches Val und/oder Cys umfasst; oder eine humane IGKC*01-Domäne umfasst.
• 72. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 61 bis 71, wobei der Mensch Antikörper exprimiert, die humane konstante kappa-Domänen umfassen, die ein solches Val und Cys umfassen, z. B. konstante IGKC*01-Domänen exprimiert.

In a third example, the inventor treats the variation of the human kappa chain constant region. The present aspect of the invention thus also provides the following.

• 61. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 60), wherein the ligand (eg an antibody or a fragment or comprising or consisting of a Fc-fused TOI receptor) comprises a human kappa light chain constant region; which comprises a Val corresponding to position 84 of SEQ ID NO: 50, or a Cys corresponding to position 87 of SEQ ID NO: 50; and wherein the human genome comprises a kappa light chain constant region nucleotide sequence encoding such a Val or Cys or a human expressing antibodies comprising such human kappa light chain constant regions comprising Val or Cys.
• 62. The ligand, method, application, kit or composition of clause 61, wherein the ligand comprises a human kappa light chain constant region corresponding to a Val, position 84 of SEQ ID NO: 50, and a Cys corresponding to position 87 of SEQ ID NO: 50.
• 63. The ligand, method, application, kit or composition of clause 61 or 62, wherein the human genome comprises a kappa light chain constant region nucleotide sequence encoding such a Val or Cys, or the Human expressing antibodies comprising such Val or Cys human kappa chain constant regions.
• 64. The ligand, method, application, kit or composition of any one of clauses 61 to 63, wherein the antibody or fragment comprises a human kappa light chain constant IGKC * 01 region.
• 65. The ligand, method, application, kit, or composition of any of clauses 61 to 64, wherein the ligand comprises or consists of an antibody, wherein the antibody comprises light chains comprising SEQ ID NO: 62 or 66 ,
• 66. The ligand, method, application, kit, or composition of any of clauses 61 to 65, wherein the ligand comprises or consists of an antibody, wherein the antibody comprises a light chain variable domain resulting from recombination a human Vκ gene segment and a human Jκ gene segment, wherein the Jκ gene segment is IGKJ2 * 01 (SEQ ID NO: 57).
• 67. The ligand, method, application, kit or composition of any one of clauses 61 to 66, wherein the human is or has been phenotyped as positive for the Val and / or Cys.
• 68. The ligand, method, application, kit or composition of any one of clauses 61 to 67, wherein human is or has been genotyped as positive for human IGKC * 01.
• 69. The ligand, method, application, kit or composition of any of clauses 61 to 68, wherein the human is or has been phenotyped as positive for a human IGKC * 01 domain.
• 70. The method or use of any of clauses 61 to 69, comprising selecting a human whose genome comprises a Condon / codon encoding the Val and / or Cys; or human IGKC * 01.
• 71. The method or use of any of clauses 61 to 70, comprising selecting a human whose phenotype includes such Val and / or Cys; or a human IGKC * 01 domain.
• 72. The ligand, method, application, kit or composition of any one of clauses 61 to 71, wherein the human expresses antibodies comprising human kappa constant domains comprising such Val and Cys, e.g. B. expressed constant IGKC * 01 domains.

• 73. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 60), wobei der Ligand (der z. B. einen Antikörper oder ein Fragment oder einen Fc-kondensierten TOI-Rezeptor umfasst oder daraus besteht) eine humane konstante IGLC2*01-Region der leichten Kette umfasst; und wobei das Genom des Menschen eine humane IGLC2*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die humane konstante IGLC2*01-Regionen der leichten Kette umfassen.
• 74. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 73, wobei der Antikörper leichte Ketten umfasst, die SEQ ID NO: 64 umfassen.
• 75. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 73 oder 74, wobei der Mensch als positiv für humanes IGLC2*01 genotypisiert wurde oder wird.
• 76. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 73 bis 75, wobei der Mensch als positiv für eine humane IGLC2*01-Domäne phänotypisiert wurde oder wird.
• 77. Das Verfahren oder die Anwendung nach einer der Klauseln 73 bis 76, umfassend die Auswahl eines Menschen, dessen Genom humanes IGLC2*01 umfasst.
• 78. Das Verfahren oder die Anwendung nach einer der Klauseln 73 bis 77, umfassend die Auswahl eines Menschen, dessen Phänotyp eine humane IGLC2*01-Domäne umfasst.
• 79. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 73 bis 78, wobei der Mensch humane konstante lambda-IGLC2*01-Domänen exprimiert.

In a fourth example, the inventor treats the variation of the human lambda chain constant region. This example thus provides aspects that are set forth in the following clauses.

• 73. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (eg according to one of the clauses 1 to 60), wherein the ligand (eg an antibody or a fragment or comprising or consisting of a Fc-fused TOI receptor) comprises a human light chain IGLC2 * 01 constant region; and wherein the human genome comprises a human IGLC2 * 01 nucleotide sequence or human expressing antibodies comprising human IGLC2 * 01 human constant light chain regions.
• 74. The ligand, method, use, kit or composition of clause 73, wherein the antibody comprises light chains comprising SEQ ID NO: 64.
• 75. The ligand, method, application, kit or composition according to clause 73 or 74 wherein the human has been or is being genotyped positive for human IGLC2 * 01.
• 76. The ligand, method, application, kit or composition of any one of clauses 73 to 75, wherein the human is or has been phenotyped as positive for a human IGLC2 * 01 domain.
• 77. The method or use of any of clauses 73 to 76, comprising selecting a human whose genome comprises human IGLC2 * 01.
• 78. The method or use of any one of clauses 73 to 77, comprising selecting a human whose phenotype comprises a human IGLC2 * 01 domain.
• 79. The ligand, method, application, kit or composition of any one of clauses 73 to 78, wherein the human expresses human lambda IGLC2 * 01 constant domains.

• 80. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 79), wobei der Ligand einen Antikörper oder ein Fragment umfasst oder daraus besteht, wobei der Antikörper bzw. das Fragment eine VH-Domäne umfasst, die sich aus der Rekombination eines humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments ableitet, wobei das VH-Gensegment ausgewählt ist aus der Gruppe bestehend aus (i) IGHV1-18*01 und das Genom des Menschen eine humane IGHV1-18*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die variable Domänen umfassen, die sich aus der Rekombination von humanem IGHV1-18*01 ableiten; oder (ii) IGVH1-46*01 und das Genom des Menschen eine humane IGHV1-46*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die variable Domänen umfassen, die sich von der Rekombination von humanem IGHV1-46*01 ableiten.
• 81. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 80, wobei der Antikörper oder das Fragment eine, mehrere oder alle einer durch humanes IGHG2*01 codierten CH1-Domäne, CH2-Domäne, CH3-Domäne, Hinge-Region oder Fc-Region umfasst.
• 82. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 80 oder 81, wobei der Antikörper oder das Fragment schwere Ketten umfasst, die SEQ ID NO: 63 oder 65 umfassen.
• 83. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 80 bis 82, wobei der Mensch als positiv für das ausgewählte VH-Gensegment, positiv für humanes IGHV1-18*01 oder IGVH1-46*01 genotypisiert wurde oder wird.
• 84. Das Verfahren oder die Anwendung nach einer der Klauseln 80 bis 83, umfassend die Genotypisierung des Menschen als positiv für das ausgewählte VH-Gensegment, z. B. positiv für humanes IGHV1-18*01 oder IGVH1-46*01.

In a fifth example, the inventor treats the variation of the human heavy chain variable region. This example thus provides aspects that are set forth in the following clauses.

• 80. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 79), wherein the ligand comprises or consists of an antibody or a fragment, wherein the The antibody or fragment comprises a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment is selected from the group consisting of (i) IGHV1-18 * 01 and the human genome comprises a human IGHV1-18 * 01 nucleotide sequence or human antibody comprising variable domains derived from the recombination of human IGHV1-18 * 01; or (ii) IGVH1-46 * 01 and the human genome comprises a human IGHV1-46 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGHV1-46 * 01.
• 81. The ligand, method, use, kit or composition of clause 80, wherein the antibody or fragment comprises one, several or all of a human IGHG2 * 01 encoded CH1 domain, CH2 domain, CH3 domain, Hinge region or Fc region includes.
• 82. The ligand, method, application, kit or composition of clause 80 or 81, wherein the antibody or fragment comprises heavy chains comprising SEQ ID NO: 63 or 65.
• 83. The ligand, method, application, kit or composition of any one of clauses 80 to 82, wherein the human is positive for the selected VH gene segment, positive for human IGHV1-18 * 01 or IGVH1-46 * 01 was or will be genotyped.
• 84. The method or use of any one of clauses 80 to 83, comprising human genotyping as positive for the selected VH gene segment, e.g. Positive for human IGHV1-18 * 01 or IGVH1-46 * 01.

• 85. Den erfindungsgemäßen Liganden, das erfindungsgemäße Verfahren, die erfindungsgemäße Anwendung, das erfindungsgemäße Kit oder die erfindungsgemäße Zusammensetzung (z. B. gemäß einer der Klauseln 1 bis 84), wobei der Ligand einen Antikörper oder ein Fragment umfasst oder daraus besteht, wobei der Antikörper bzw. das Fragment eine VL-Domäne umfasst, die sich aus der Rekombination eines humanen VL-Gensegments und eines humanen JL-Gensegments ableitet, wobei das VL-Gensegment ausgewählt ist aus der Gruppe bestehend aus (i) IGKV4-1*01 und das Genom des Menschen eine humane IGKV4-1*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die variable Domänen umfassen, die sich aus der Rekombination von humanem IGKV4-1*01 ableiten; (ii) IGLV2-14*01 und das Genom des Menschen eine humane IGLV2-4*01-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die variable Domänen umfassen, die sich aus der Rekombination von humanem IGLV2-14*01 ableiten; oder (iii) IGKV1-13*02 und das Genom des Menschen eine humane IGKV1-13*02-Nukleotidsequenz umfasst oder der Mensch Antikörper exprimiert, die variable Domänen umfassen, die sich aus der Rekombination von humanem IGKV1-13*02 ableiten.
• 86. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 85, wobei der Antikörper leichte Ketten umfasst, die SEQ ID NO: 62, 64 oder 66 umfassen.
• 87. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach Klausel 85 oder 86, wobei der Antikörper oder das Fragment eine variable Domäne der leichten Kette umfasst, die sich aus einer Rekombination eines humanen Vκ-Gensegments und eines humanen Jκ-Gensegments ableitet, wobei es sich bei dem Jκ-Gensegment um IGKJ2*01 (SEQ ID NO: 57 handelt; wobei (i) oder (iii) gilt.
• 88. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 85 bis 87, wobei der Mensch als positiv für das ausgewählte VL-Gensegment, z. B. positiv für humanes IGKV4-1*01, IGLV2-14*01 oder IGKV1-13*02, genotypisiert wurde oder wird.
• 89. Das Verfahren oder die Anwendung nach Klausel 88, umfassend die Genotypisierung des Menschen als positiv für das ausgewählte VL-Gensegment, z. B. Genotypisieren des Menschen als positiv für humanes IGKV4-1*01, IGLV2-14*01 oder IGKV1-13*02.
• 90. Den Liganden, das Verfahren, die Anwendung, das Kit oder die Zusammensetzung nach einer der Klauseln 1 bis 89, wobei der Ligand (z. B. der Antikörper oder das Fragment) an die humane PCSK9 mit einer Dissoziationskonstante (Kd) von 1 nM oder weniger, bestimmt mittels SPR, (z. B. 100, 10 oder 1 pM oder weniger) bindet.

In a sixth example, the inventor treats the variation of the human light chain variable region. This example thus provides aspects that are set forth in the following clauses.

• 85. The ligand according to the invention, the method according to the invention, the use according to the invention, the kit according to the invention or the composition according to the invention (for example according to one of clauses 1 to 84), wherein the ligand comprises or consists of an antibody or a fragment, wherein the The antibody or the fragment comprises a VL domain derived from the recombination of a human VL gene segment and a human JL gene segment, wherein the VL gene segment is selected from the group consisting of (i) IGKV4-1 * 01 and the human genome comprises a human IGKV4-1 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGKV4-1 * 01; (ii) IGLV2-14 * 01 and the human genome comprises a human IGLV2-4 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGLV2-14 * 01; or (iii) IGKV1-13 * 02 and the human genome comprises a human IGKV1-13 * 02 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGKV1-13 * 02.
• 86. The ligand, method, use, kit or composition of clause 85, wherein the antibody comprises light chains comprising SEQ ID NO: 62, 64 or 66.
• 87. The ligand, method, application, kit or composition of clause 85 or 86, wherein the antibody or fragment comprises a light chain variable domain resulting from recombination of a human Vκ gene segment and a human Jκ Gene segment, where the Jκ gene segment is IGKJ2 * 01 (SEQ ID NO: 57, where (i) or (iii) applies.
• 88. The ligand, method, application, kit or composition of any one of clauses 85 to 87, wherein the human is positive for the selected VL gene segment, e.g. Positive for human IGKV4-1 * 01, IGLV2-14 * 01 or IGKV1-13 * 02, has been or will be genotyped.
• 89. The method or the application of clause 88, comprising human genotyping as positive for the selected VL gene segment, e.g. B. Genotyping of human as positive for human IGKV4-1 * 01, IGLV2-14 * 01 or IGKV1-13 * 02.
• 90. The ligand, method, application, kit, or composition of any one of clauses 1 to 89, wherein the ligand (eg, the antibody or fragment) is linked to human PCSK9 having a dissociation constant (Kd) of 1 nM or less, determined by SPR (eg, 100, 10 or 1 pM or less).

• 1. Ein Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region einer humanen schweren gamma-Kette umfasst, die eine erste Aminosäure umfasst, die von einem Gensegment-SNP für eine humane schwere gamma-Kette codiert wird, und der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die PCSK9-Aminosäuresequenz codiert, und ein das SNP umfassendes Gensegment für eine konstante Region einer humanen schweren gamma-Kette umfasst, oder der Mensch Antikörper exprimiert, die humane konstante gamma-Regionen umfassen, die die erste Aminosäure umfassen.
• Alternativ dazu stellt Absatz 1 Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, oder ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment für eine konstante Region IGHG1*01 einer humanen schweren Kette umfasst, oder der Mensch Antikörper exprimiert, die humane konstante gamma-1-Regionen umfassen, die ein solches Asp und Leu umfassen.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment für eine konstante Region IGHG1*01 einer humanen schweren Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG1*01 der humanen schweren Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment für eine konstante Region IGHG1*01 einer humanen schweren Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG1*01 der humanen schweren Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG1*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Der Antikörper oder das Antikörperfragment nach Absatz 1, wobei der Antikörper eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst.
• 3. Der Antikörper oder das Antikörperfragment nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region IGHG1*01 der humanen schweren Kette umfasst.
• 4. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 3, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 5. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 4, wobei das Verfahren den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 6. Der Antikörper oder das Antikörperfragment nach Absatz 5, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 7. Der Antikörper oder das Antikörperfragment nach Absatz 6, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Der Antikörper oder das Antikörperfragment nach Absatz 6 oder 7, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 9. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 8, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder bei dem ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 10. Der Antikörper oder das Antikörperfragment nach einem der Ansprüche 1 bis 9, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 11. Der Antikörper oder das Antikörperfragment nach Absatz 9 oder 10, wobei der Antikörper bzw. das Antikörperfragment für eine Verabreichung an den Menschen bestimmt ist, die getrennt von oder gleichzeitig mit der Statinbehandlung erfolgt.
• 12. Der Antikörper oder das Antikörperfragment nach einem der Absätze 6 bis 10, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 13. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 12, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 14. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 13, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 15. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 14, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei dem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 16. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 15, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 17. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 16, wobei der Antikörper bzw. das Antikörperfragment zur Verabreichung durch intravenöse oder subkutane Verabreichung bestimmt ist und/oder in einer injizierbaren Zubereitung enthalten ist.

Other exemplary ligands can be found in paragraphs 1-17 as follows.

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human gamma heavy chain constant region comprising a first An amino acid encoded by a gene segment SNP for a human heavy gamma chain, and the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain, the a mutation comprising I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the PCSK9 amino acid sequence, and comprising an SNP human gamma heavy chain constant region gene segment, or human Expressing antibodies comprising human gamma constant regions comprising the first amino acid.
• Alternatively, paragraph 1 provides: -
• An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp which corresponds to position 204 of SEQ ID NO: 42, or a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the antibody or fragment specifically comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence which comprises a C-terminal domain comprising a mutation of I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a human heavy chain constant region IGHG1 * 01 gene segment or human expressing antibodies comprising human gamma-1 constant regions containing such Asp and Leu, and the like mfassen.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp comprising position 204 of SEQ ID NO: 42 and a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the antibody or fragment specifically comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence which comprises a C-terminal domain comprising a mutation I474V in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising a human heavy chain constant region IGHG1 * 01 gene segment. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG1 * 01.
• Another example provides:
• An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp comprising position 204 of SEQ ID NO: 42 and a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the antibody or fragment specifically comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence which comprises a C-terminal domain comprising an E670G mutation in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising a human heavy chain constant region IGHG1 * 01 gene segment. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG1 * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human gamma-1 heavy chain constant region comprising an Asp corresponding to position 204 of SEQ ID NO: 42 and a Leu corresponding to position 206 of SEQ ID NO: 42 and wherein the human is (i) a human heavy chain constant region gene segment IGHG1 * 01; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• 2. The antibody or antibody fragment of paragraph 1, wherein the antibody comprises a human gamma-1 heavy chain constant region corresponding to an Asp, position 204 of SEQ ID NO: 42, and a Leu, position 206 of SEQ ID NO: 42 corresponds to.
• 3. The antibody or antibody fragment of paragraph 1 or 2, wherein the antibody comprises a human heavy chain constant region IGHG1 * 01.
• 4. The antibody or antibody fragment of any one of paragraphs 1 to 3, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO 1 comprises, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 5. The antibody or antibody fragment of any one of paragraphs 1 to 4, the method comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain containing the I474V or E670G mutation and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, optionally, the detection step is performed prior to administration of the antibody to a human.
• 6. The antibody or antibody fragment of paragraph 5, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 7. The antibody or antibody fragment of paragraph 6, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 8. The antibody or antibody fragment of paragraph 6 or 7, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification, and / or wherein the assay is performed in a multiplex format.
• 9. The antibody or antibody fragment of any one of paragraphs 1 to 8, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• The antibody or antibody fragment of any one of claims 1 to 9, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 11. The antibody or antibody fragment of paragraph 9 or 10, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 12. The antibody or antibody fragment of any one of paragraphs 6 to 10, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 13. The antibody or antibody fragment of any one of paragraphs 1 to 12, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G in SEQ ID NO: 1.
• 14. The antibody or antibody fragment of any one of paragraphs 1 to 13, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 15. The antibody or antibody fragment according to any one of paragraphs 1 to 14, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, by the antibody or the antibody fragment, Peripheral vascular disease, claudication and hypertension are treated in humans or the risk of such a disease is reduced.
• 16. The antibody or antibody fragment of any one of paragraphs 1 to 15, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 17. The antibody or antibody fragment of any one of paragraphs 1 to 16, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

• 1. Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, oder ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG1*01 der humanen schweren Kette umfasst oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen schweren gamma-1-Kette umfassen, die ein solches Asp und Leu umfassen, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG1*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG1*01 der humanen schweren Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG1*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation E670G in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG1*01 der humanen schweren Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG1*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Das Verfahren nach Absatz 1, bei dem man vor der Verabreichung einen Menschen auswählt, der die Nukleotidsequenz von (ii) umfasst, wobei es sich bei dem Menschen um den Menschen nach Absatz 1 handelt.
• 3. Das Verfahren nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Asp, das Position 204 von SEQ ID NO: 42 entspricht, und ein Leu, das Position 206 von SEQ ID NO: 42 entspricht, umfasst.
• 4. Das Verfahren nach Absatz 1, 2 oder 3, wobei der Antikörper eine konstante Region IGHG1*01 der humanen schweren Kette umfasst.
• 5. Das Verfahren nach einem der Absätze 1 bis 4, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 6. Das Verfahren nach einem der Absätze 1 bis 5, das den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 7. Das Verfahren nach Absatz 6, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Das Verfahren nach Absatz 7, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 9. Das Verfahren nach Absatz 7 oder 8, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 10. Das Verfahren nach einem der Absätze 1 bis 9, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 11. Das Verfahren nach einem der Absätze 1 bis 10, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 12. Das Verfahren nach Absatz 10 oder 11, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 13. Das Verfahren nach einem der Absätze 7 bis 9, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 14. Das Verfahren nach einem der Absätze 1 bis 13, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 15. Das Verfahren nach einem der Absätze 1 bis 14, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 16. Das Verfahren nach einem der Absätze 1 bis 15, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei dem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 17. Das Verfahren nach einem der Absätze 1 bis 16, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 18. Das Verfahren nach einem der Absätze 1 bis 17, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.

Further exemplary methods can be found in paragraphs 1-18 as follows.

• A method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a A C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1 comprises in said human, said antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp, the Position 204 of SEQ ID NO: 42, or a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the human (i) comprises a human heavy chain constant region IGHG1 * 01 gene segment or human Expressing antibodies comprising human gamma-1 heavy chain constant regions comprising such Asp and Leu, and (ii) a nucleotide sequence encoding the Pr protein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising a mutation I474 in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp, position 204 of SEQ ID NO: 42, and a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the human (i) is a human heavy chain constant region IGHG1 * 01 gene segment, and (ii) a nucleotide sequence for the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising the mutation I474V in SEQ ID NO: 1. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG1 * 01.
• Another example provides:
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising an E670G mutation in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human gamma-1 heavy chain constant region comprising an Asp, position 204 of SEQ ID NO: 42, and a Leu corresponding to position 206 of SEQ ID NO: 42, and wherein the human (i) is a human heavy chain constant region IGHG1 * 01 gene segment, and (ii) a nucleotide sequence subtilisin / kexin type 9 (PCSK9) encoding a C-terminal domain comprising the E670G mutation in SEQ ID NO: 1, for the proprotein convertase. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG1 * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human gamma-1 heavy chain constant region comprising an Asp corresponding to position 204 of SEQ ID NO: 42 and a Leu corresponding to position 206 of SEQ ID NO: 42 and wherein the human is (i) a human heavy chain constant region gene segment IGHG1 * 01; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• 2. The method of paragraph 1, comprising, prior to administration, selecting a human comprising the nucleotide sequence of (ii), wherein the human is the human under paragraph 1.
• 3. The method of paragraph 1 or 2, wherein the antibody comprises a human gamma-1 heavy chain constant region corresponding to an Asp, position 204 of SEQ ID NO: 42, and a Leu, position 206 of SEQ ID NO: 42 corresponds to.
• 4. The method of paragraph 1, 2 or 3, wherein the antibody comprises a human heavy chain constant region IGHG1 * 01.
• 5. The method of any one of paragraphs 1 to 4, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 , and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 6. The method of any one of paragraphs 1 to 5, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 7. The method of paragraph 6, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 8. The method of paragraph 7, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 9. The method of paragraph 7 or 8, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is performed in a multiplex Format is done.
• 10. The method of any one of paragraphs 1 to 9, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 11. The method according to any one of paragraphs 1 to 10, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• 12. The method of paragraph 10 or 11, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 13. The method of any one of paragraphs 7 to 9, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 14. The method of any of paragraphs 1 to 13, wherein the human is heterozygous for a nucleotide sequence encoding the PCSK9 C-terminal domain comprising the I474V or E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 15. The method of any one of paragraphs 1 to 14, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, Atherosclerosis, peripheral vascular disease, claudication and hypertension was diagnosed.
• 16. The method according to any one of paragraphs 1 to 15, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, by the antibody or antibody fragment, Claudication and hypertension in people treated or reduced the risk of such a condition.
• 17. The method of any one of paragraphs 1 to 16, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 18. The method according to any one of paragraphs 1 to 17, wherein the antibody or the antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

• 1. Ein Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper eine konstante Region der humanen schweren gamma-2-Kette umfasst, die eine Aminosäure ausgewählt aus der Gruppe bestehend aus einem Pro, das Position 72 von SEQ ID NO: 44 entspricht, einem Asn, das Position 75 von SEQ ID NO: 44 entspricht, einem Phe, das Position 76 von SEQ ID NO: 44 entspricht, einem Val, das Position 161 von SEQ ID NO: 44 entspricht, und einem Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment für eine konstante Region IGHG2*01 einer humanen schweren Kette umfasst, oder der Mensch Antikörper exprimiert, die humane konstante gamma-2-Regionen umfassen, die ein solches Pro, Asn, Phe, Val und Ala umfassen.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die die Mutation I474V in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment einer konstanten Region IGHG2*01 einer humanen schweren Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG2*01 der humanen schweren Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die die Mutation E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment einer konstanten Region IGHG2*01 einer humanen schweren Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG2*01 der humanen schweren Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG2*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Der Antikörper oder das Antikörperfragment nach Absatz 1, wobei der Antikörper eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst.
• 3. Der Antikörper oder das Antikörperfragment nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region IGHG2*01 der humanen schweren Kette umfasst.
• 4. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 3, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 5. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 4, wobei das Verfahren den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 6. Der Antikörper oder das Antikörperfragment nach Absatz 5, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 7. Der Antikörper oder das Antikörperfragment nach Absatz 6, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Der Antikörper oder das Antikörperfragment nach Absatz 6 oder 7, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 9. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 8, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder bei dem ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 10. Der Antikörper oder das Antikörperfragment nach einem der Ansprüche 1 bis 9, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 11. Der Antikörper oder das Antikörperfragment nach Absatz 9 oder 10, wobei der Antikörper bzw. das Antikörperfragment für eine Verabreichung an den Menschen bestimmt ist, die getrennt von oder gleichzeitig mit der Statinbehandlung erfolgt.
• 12. Der Antikörper oder das Antikörperfragment nach einem der Absätze 6 bis 8, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 13. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 12, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 14. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 13, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 15. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 14, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei dem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 16. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 15, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 17. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 16, wobei der Antikörper bzw. das Antikörperfragment zur Verabreichung durch intravenöse oder subkutane Verabreichung bestimmt ist und/oder in einer injizierbaren Zubereitung enthalten ist.

Other exemplary ligands can be found in paragraphs 1-17 as follows.

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody comprising a human gamma 2 heavy chain constant region comprising one amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val, the Position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence, which comprises a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a human heavy chain constant region IGHG2 * 01 gene segment or human expressing antibodies comprising human gamma 2 constant regions comprising such Pro, Asn, Phe, Val and Ala.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody comprising a human gamma 2 heavy chain constant region comprising a pro, position 72 SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising the Mutation comprises I474V in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a gene segment of a human heavy KG constant region IGHG2 * 01 includes. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• Another example provides:
• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody comprising a human gamma 2 heavy chain constant region comprising a pro, position 72 SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising the Mutation comprises E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a human heavy KG constant region IGHG2 * 01 gene segment includes. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human heavy gamma 2 heavy chain constant region corresponding to a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe which corresponds to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human is (i) a human heavy chain constant region IGHG2 * 01 gene segment; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 2. The antibody or antibody fragment of paragraph 1, wherein the antibody comprises a human gamma 2 heavy chain constant region corresponding to a Pro, position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44 ,
• 3. The antibody or antibody fragment of paragraph 1 or 2, wherein the antibody comprises a human heavy chain constant region IGHG2 * 01.
• 4. The antibody or antibody fragment of any one of paragraphs 1 to 3, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO 1 comprises, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 5. The antibody or antibody fragment of any one of paragraphs 1 to 4, the method comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain containing the I474V or E670G mutation and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 6. The antibody or antibody fragment of paragraph 5, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 7. The antibody or antibody fragment of paragraph 6, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1 is present; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 8. The antibody or antibody fragment of paragraph 6 or 7, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification, and / or wherein the assay is performed in a multiplex format.
• 9. The antibody or antibody fragment of any one of paragraphs 1 to 8, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• The antibody or antibody fragment of any one of claims 1 to 9, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 11. The antibody or antibody fragment of paragraph 9 or 10, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 12. The antibody or antibody fragment of any one of paragraphs 6 to 8, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 13. The antibody or antibody fragment of any one of paragraphs 1 to 12, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 that has a mutation I474V or E670G, wherein the human optionally further comprises the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 having a mutation I474V or E670G in SEQ ID NO : 1 includes.
• 14. The antibody or antibody fragment of any one of paragraphs 1 to 13, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 15. The antibody or antibody fragment according to any one of paragraphs 1 to 14, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, by the antibody or the antibody fragment, Peripheral vascular disease, claudication and hypertension are treated in humans or the risk of such a disease is reduced.
• 16. The antibody or antibody fragment of any one of paragraphs 1 to 15, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 17. The antibody or antibody fragment of any one of paragraphs 1 to 16, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

• 1. Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-2-Kette umfasst, die eine Aminosäure ausgewählt aus der Gruppe bestehend aus einem Pro, das Position 72 von SEQ ID NO: 44 entspricht, einem Asn, das Position 75 von SEQ ID NO: 44 entspricht, einem Phe, das Position 76 von SEQ ID NO: 44 entspricht, einem Val, das Position 161 von SEQ ID NO: 44 entspricht, und einem Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG2*01 der humanen schweren Kette umfasst oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen schweren gamma-2-Kette umfassen, die ein solches Pro, Asn, Phe, Val und Ala umfassen, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG2*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG2*01 der humanen schweren Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG2*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation E670G in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGHG2*01 der humanen schweren Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen schweren gamma-2-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGHG2*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Das Verfahren nach Absatz 1, bei dem man vor der Verabreichung den Menschen auswählt, der die Nukleotidsequenz von (ii) umfasst.
• 3. Das Verfahren nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region der humanen schweren gamma-1-Kette umfasst, die ein Pro, das Position 72 von SEQ ID NO: 44 entspricht, ein Asn, das Position 75 von SEQ ID NO: 44 entspricht, ein Phe, das Position 76 von SEQ ID NO: 44 entspricht, ein Val, das Position 161 von SEQ ID NO: 44 entspricht, und ein Ala, das Position 257 von SEQ ID NO: 44 entspricht, umfasst.
• 4. Das Verfahren nach Absatz 1, 2 oder 3, wobei der Antikörper eine konstante Region IGHG2*01 der humanen schweren Kette umfasst.
• 5. Das Verfahren nach einem der Absätze 1 bis 4, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 6. Das Verfahren nach einem der Absätze 1 bis 5, das den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 7. Das Verfahren nach Absatz 6, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Das Verfahren nach Absatz 7, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 9. Das Verfahren nach Absatz 7 oder 8, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 10. Das Verfahren nach einem der Absätze 1 bis 9, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 11. Das Verfahren nach einem der Absätze 1 bis 10, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 12. Das Verfahren nach Absatz 10 oder 11, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 13. Das Verfahren nach einem der Absätze 7 bis 9, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 14. Das Verfahren nach einem der Absätze 1 bis 13, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 15. Das Verfahren nach einem der Absätze 1 bis 14, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 16. Das Verfahren nach einem der Absätze 1 bis 15, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 17. Das Verfahren nach einem der Absätze 1 bis 16, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 18. Das Verfahren nach einem der Absätze 1 bis 17, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.

Further exemplary methods can be found in paragraphs 1-18 as follows.

• A method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1 comprises in said human, said antibody or fragment comprising a human gamma 2 heavy chain constant region comprising an amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val, the Position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human (i) is a gene region of the constant region IGHG2 * 01 human heavy chain or human expressing antibodies comprising human gamma 2 heavy chain constant regions comprising such Pro, Asn, Phe, Val and Ala, and (ii) a nucleotide sequence common to the human Proprotein convertase subtilisin / Kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising a mutation I474 in SEQ ID NO: 1 in said human, said antibody or fragment comprising a human heavy gamma 2 chain constant region comprising a pro, position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and a Ala, which corresponds to position 257 of SEQ ID NO: 44, and wherein the human (i) a human heavy chain constant region gene segment IGHG2 * 01 and (ii) a nucleotide sequence corresponding to the Propro subtilisin / kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising the mutation I474V in SEQ ID NO: 1. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• Another example provides:
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising a E670G mutation in SEQ ID NO: 1 in said human, said antibody or fragment comprising a human heavy gamma 2 chain constant region comprising a pro, position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and a Ala, which corresponds to position 257 of SEQ ID NO: 44, and wherein the human (i) a human heavy chain constant region gene segment IGHG2 * 01 and (ii) a nucleotide sequence corresponding to the Propr oteinconvertase subtilisin / kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising the E670G mutation in SEQ ID NO: 1. Optionally, the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human heavy gamma 2 heavy chain constant region corresponding to a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe which corresponds to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human is (i) a human heavy chain constant region IGHG2 * 01 gene segment; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 2. The method according to paragraph 1, wherein, prior to administration, selecting the human comprising the nucleotide sequence of (ii).
• 3. The method of paragraph 1 or 2, wherein the antibody comprises a human gamma-1 heavy chain constant region corresponding to a Pro, position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44.
• 4. The method of paragraph 1, 2 or 3, wherein the antibody comprises a human heavy chain constant region IGHG2 * 01.
• 5. The method of any one of paragraphs 1 to 4, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 , and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 6. The method of any one of paragraphs 1 to 5, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 7. The method of paragraph 6, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 8. The method of paragraph 7, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 9. The method of paragraph 7 or 8, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is performed in a multiplex Format is done.
• 10. The method of any one of paragraphs 1 to 9, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 11. The method according to any one of paragraphs 1 to 10, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• 12. The method of paragraph 10 or 11, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 13. The method of any one of paragraphs 7 to 9, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 14. The method of any of paragraphs 1 to 13, wherein the human is heterozygous for a nucleotide sequence encoding the PCSK9 C-terminal domain comprising the I474V or E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 15. The method of any one of paragraphs 1 to 14, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension has been.
• 16. The method according to any one of paragraphs 1 to 15, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, by the antibody or antibody fragment, Claudication and hypertension in this person are treated or the risk of such a condition is diminished.
• 17. The method of any one of paragraphs 1 to 16, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 18. The method according to any one of paragraphs 1 to 17, wherein the antibody or the antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

• 1. Ein Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, oder ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert und ein Gensegment für eine konstante Region IGKC*01 einer humanen leichten Kette umfasst, oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen leichten kappa-Kette umfassen, die ein solches Val und Cys umfassen.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und ein Gensegment einer konstanten Region IGKC*01 einer humanen leichten Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGKC*01 der humanen leichten Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und ein Gensegment einer konstanten Region IGKC*01 einer humanen leichten Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGKC*01 der humanen leichten Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGKC*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Der Antikörper oder das Antikörperfragment nach Absatz 1, wobei der Antikörper eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, oder ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst.
• 3. Der Antikörper oder das Antikörperfragment nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region IGKC*01 der humanen kappa-Kette umfasst.
• 4. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 3, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 5. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 4, wobei das Verfahren den Schritt der Feststellung umfasst, dass der Mensch die Nukleinsäuresequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 6. Der Antikörper oder das Antikörperfragment nach Absatz 5, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 7. Der Antikörper oder das Antikörperfragment nach Absatz 6, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und
• das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Der Antikörper oder das Antikörperfragment nach Absatz 6 oder 7, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 9. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 8, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder bei dem ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 10. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 9, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 11. Der Antikörper oder das Antikörperfragment nach Absatz 9 oder 10, wobei der Antikörper bzw. das Antikörperfragment für eine Verabreichung an den Menschen bestimmt ist, die getrennt von oder gleichzeitig mit der Statinbehandlung erfolgt.
• 12. Der Antikörper oder das Antikörperfragment nach einem der Absätze 6 bis 10, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 13. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 12, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 14. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 13, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 15. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 14, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 16. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 15, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 17. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 16, wobei der Antikörper bzw. das Antikörperfragment zur Verabreichung durch intravenöse oder subkutane Verabreichung bestimmt ist und/oder in einer injizierbaren Zubereitung enthalten ist.

Other exemplary ligands can be found in paragraphs 1-17 as follows.

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human kappa light chain constant region comprising a Val which corresponds to position 84 of SEQ ID NO: 50, or a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the antibody or fragment specifically comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence which comprises a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a gene segment for a constant Human IGKC * 01 region or human expressing antibodies comprising human kappa light chain constant regions comprising such Val and Cys.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human kappa light chain constant region comprising a Val, the Position 84 of SEQ ID NO: 50, and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence, which comprises a C-terminal domain comprising a mutation I474V in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a human light chain constant region IGKC * 01 gene segment. Optionally, the antibody or fragment comprises a human light chain constant region IGKC * 01.
• Another example provides:
• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody or fragment comprising a human kappa light chain constant region comprising a Val, the Position 84 of SEQ ID NO: 50, and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence, which comprises a C-terminal domain comprising an E670G mutation in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a human light chain constant region IGKC * 01 gene segment. Optionally, the antibody or fragment comprises a human light chain constant region IGKC * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human kappa light chain constant region comprising a Val corresponding to position 84 of SEQ ID NO: 50 and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein human (i) encodes a human heavy chain constant region IGKC * 01 gene segment; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) which comprises a C-terminal domain encoding the mutation I474V or E670G in SEQ ID NO: 1.
• 2. The antibody or antibody fragment of paragraph 1, wherein the antibody comprises a human kappa light chain constant region corresponding to a Val, position 84 of SEQ ID NO: 50, or a Cys, position 87 of SEQ ID NO: 50 corresponds to includes.
• 3. The antibody or antibody fragment of paragraph 1 or 2, wherein the antibody comprises a human kappa chain constant region IGKC * 01.
• 4. The antibody or antibody fragment of any one of paragraphs 1 to 3, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO 1 comprises, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 5. The antibody or antibody fragment of any one of paragraphs 1 to 4, the method comprising the step of determining that the human comprises the nucleic acid sequence encoding a PCSK9 comprising a C-terminal domain containing the I474V or E670G mutation and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 6. The antibody or antibody fragment of paragraph 5, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 7. The antibody or antibody fragment of paragraph 6, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and
• determining the presence or absence of the complex, it being determined by determining the presence of the complex that the human comprises PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 ,
• 8. The antibody or antibody fragment of paragraph 6 or 7, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification, and / or wherein the assay is performed in a multiplex format.
• 9. The antibody or antibody fragment of any one of paragraphs 1 to 8, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• 10. The antibody or antibody fragment of any one of paragraphs 1 to 9, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 11. The antibody or antibody fragment of paragraph 9 or 10, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 12. The antibody or antibody fragment of any one of paragraphs 6 to 10, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 13. The antibody or antibody fragment of any one of paragraphs 1 to 12, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G in SEQ ID NO: 1.
• 14. The antibody or antibody fragment of any one of paragraphs 1 to 13, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 15. The antibody or antibody fragment according to any one of paragraphs 1 to 14, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, by the antibody or the antibody fragment, Peripheral vascular disease, claudication and hypertension in this human being treated or the risk of such a disease is reduced.
• 16. The antibody or antibody fragment of any one of paragraphs 1 to 15, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 17. The antibody or antibody fragment of any one of paragraphs 1 to 16, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

• 1. Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, oder ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGKC*01 der humanen leichten Kette umfasst oder der Mensch Antikörper exprimiert, die konstante Regionen der humanen leichten kappa-Kette umfassen, die ein solches Val und Cys umfassen, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGKC*01 der humanen leichten Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGKC*01 der humanen leichten Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGKC*01 der humanen leichten Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation E670G in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGKC*01 der humanen leichten Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, und ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGKC*01 der humanen schweren Kette und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Das Verfahren nach Absatz 1, bei dem man vor der Verabreichung den Menschen auswählt, der die Nukleotidsequenz von (ii) umfasst.
• 3. Das Verfahren nach Absatz 1 oder 2, wobei der Antikörper eine konstante Region der humanen leichten kappa-Kette umfasst, die ein Val, das Position 84 von SEQ ID NO: 50 entspricht, oder ein Cys, das Position 87 von SEQ ID NO: 50 entspricht, umfasst.
• 4. Das Verfahren nach Absatz 1, 2 oder 3, wobei der Antikörper eine konstante Region IGKC*01 der humanen kappa-Kette umfasst.
• 5. Das Verfahren nach einem der Absätze 1 bis 4, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 6. Das Verfahren nach einem der Absätze 1 bis 5, das den Schritt der Feststellung umfasst, dass der Mensch die Nukleinsäuresequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 7. Das Verfahren nach Absatz 6, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 8. Das Verfahren nach Absatz 7, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und
• das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 9. Das Verfahren nach Absatz 7 oder 8, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 10. Das Verfahren nach einem der Absätze 1 bis 9, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 11. Das Verfahren nach einem der Absätze 1 bis 10, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 12. Das Verfahren nach Absatz 10 oder 11, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 13. Das Verfahren nach einem der Absätze 7 bis 9, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 14. Das Verfahren nach einem der Absätze 1 bis 13, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 15. Das Verfahren nach einem der Absätze 1 bis 14, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 16. Das Verfahren nach einem der Absätze 1 bis 15, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 17. Das Verfahren nach einem der Absätze 1 bis 16, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 18. Das Verfahren nach einem der Absätze 1 bis 17, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.

Further exemplary methods can be found in paragraphs 1-18 as follows.

• A method for reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1 comprising, said antibody or fragment comprising a human kappa light chain constant region corresponding to a Val, position 84 of SEQ ID NO: 50, or a Cys, position 87 of SEQ ID NO: 50, and wherein the human comprises (i) a human light chain constant region IGKC * 01 gene segment, or human expressing antibodies comprising human kappa light chain constant regions containing such Val and Cys and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising a mutation I474 in SEQ ID NO: 1 to said human, said antibody or fragment comprising a human kappa light chain constant region comprising a Val, position 84 of SEQ ID NO : 50, and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the human comprises (i) a human light chain constant region IGKC * 01 gene segment, and (ii) a nucleotide sequence coding for the Proprotein convertase subtilisin / kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising mutation I474V in SEQ ID NO: 1. Optionally, the antibody or fragment comprises a human light chain constant region IGKC * 01.
• Another example provides:
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising an E670G mutation in SEQ ID NO: 1 in said human, said antibody or fragment comprising a human kappa light chain constant region comprising a Val, position 84 of SEQ ID NO : 50, and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein the human comprises (i) a human light chain constant region IGKC * 01 gene segment, and (ii) a nucleotide sequence coding for the Proprotein convertase subtilisin / kexin type 9 (PCSK9) encoded comprising a C-terminal domain comprising the E670G mutation in SEQ ID NO: 1. Optionally, the antibody or fragment comprises a human light chain constant region IGKC * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human kappa light chain constant region comprising a Val corresponding to position 84 of SEQ ID NO: 50 and a Cys corresponding to position 87 of SEQ ID NO: 50, and wherein human (i) encodes a human heavy chain constant region IGKC * 01 gene segment; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) which comprises a C-terminal domain encoding the mutation I474V or E670G in SEQ ID NO: 1.
• 2. The method according to paragraph 1, wherein, prior to administration, selecting the human comprising the nucleotide sequence of (ii).
• 3. The method of paragraph 1 or 2, wherein the antibody comprises a human kappa light chain constant region corresponding to a Val, position 84 of SEQ ID NO: 50, or a Cys, position 87 of SEQ ID NO : 50 equals, includes.
• 4. The method of paragraph 1, 2 or 3, wherein the antibody comprises a human kappa chain constant region IGKC * 01.
• 5. The method of any one of paragraphs 1 to 4, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 , and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 6. The method of any one of paragraphs 1 to 5, comprising the step of determining that the human comprises the nucleic acid sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 7. The method of paragraph 6, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 8. The method of paragraph 7, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and
• determining the presence or absence of the complex, it being determined by determining the presence of the complex that the human comprises PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 ,
• 9. The method of paragraph 7 or 8, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is performed in a multiplex Format is done.
• 10. The method of any one of paragraphs 1 to 9, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 11. The method according to any one of paragraphs 1 to 10, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• 12. The method of paragraph 10 or 11, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 13. The method of any one of paragraphs 7 to 9, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 14. The method of any of paragraphs 1 to 13, wherein the human is heterozygous for a nucleotide sequence encoding the PCSK9 C-terminal domain comprising the I474V or E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 15. The method of any one of paragraphs 1 to 14, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension has been.
• 16. The method according to any one of paragraphs 1 to 15, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, by the antibody or antibody fragment, Claudication and hypertension in this person are treated or the risk of such a condition is diminished.
• 17. The method of any one of paragraphs 1 to 16, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 18. The method according to any one of paragraphs 1 to 17, wherein the antibody or the antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

• 1. Ein Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst und der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und ein Gensegment für eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, oder der Mensch Antikörper exprimiert, die konstante Regionen IGLC2*01 der human leichten lambda-Kette umfassen.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst und der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und ein Gensegment für eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Einen Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst und der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und ein Gensegment für eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 entspricht, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGLC2*01 der humanen schweren Kette umfasst und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 2. Der Antikörper oder das Antikörperfragment nach Absatz 1, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 3. Der Antikörper oder das Antikörperfragment nach Absatz 1 oder 2, wobei das Verfahren den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 4. Der Antikörper oder das Antikörperfragment nach Absatz 3, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 5. Der Antikörper oder das Antikörperfragment nach Absatz 4, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 6. Der Antikörper oder das Antikörperfragment nach Absatz 4 oder 5, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 7. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 6, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder bei dem ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 8. Der Antikörper oder das Antikörperfragment nach einem der Ansprüche 1 bis 7, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 9. Der Antikörper oder das Antikörperfragment nach Absatz 7 oder 8, wobei der Antikörper bzw. das Antikörperfragment für eine Verabreichung an den Menschen bestimmt ist, die getrennt von oder gleichzeitig mit der Statinbehandlung erfolgt.
• 10. Der Antikörper oder das Antikörperfragment nach einem der Absätze 4 bis 8, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 11. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 10, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 12. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 11, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 13. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 12, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 14. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 13, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 15. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 14, wobei der Antikörper bzw. das Antikörperfragment zur Verabreichung durch intravenöse oder subkutane Verabreichung bestimmt ist und/oder in einer injizierbaren Zubereitung enthalten ist.

Other exemplary ligands can be found in paragraphs 1-15 as follows.

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01, and the antibody or fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence, which encodes the amino acid sequence and comprises a human lambda light chain human constant region IGLC2 * 01 gene segment, or human expressing antibodies comprising human lambda light chain constant region IGLC2 * 01 constant regions.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01 and the antibody or the fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising a mutation I474V in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence coded, and a gene region for a constant region IGLC2 * 01 the human lambda light chain. Optionally, the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01.
• Another example provides:
• An antibody or antibody fragment for use in a method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01 and the antibody or the fragment specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) amino acid sequence comprising a C-terminal domain comprising an E670G mutation in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and a gene segment for a human lambda light chain constant region IGLC2 * 01. Optionally, the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01.
• In one example, it has been found that the antibody or antibody fragment specifically binds to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain corresponding to a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01, and wherein the human comprises (i) a human heavy chain constant region IGLC2 * 01 gene segment, and (ii) a nucleotide sequence common to the human Protroconvertase subtilisin / kexin type 9 (PCSK9) encoding a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• 2. The antibody or antibody fragment of paragraph 1, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 3. The antibody or antibody fragment of paragraph 1 or 2, the method comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, wherein the detecting step is optionally performed prior to administration of the antibody to a human.
• 4. The antibody or antibody fragment of paragraph 3, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 5. The antibody or antibody fragment of paragraph 4, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 6. The antibody or antibody fragment of paragraph 4 or 5, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification, and / or wherein the assay is performed in a multiplex format.
• 7. The antibody or antibody fragment of any one of paragraphs 1 to 6, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• The antibody or antibody fragment of any one of claims 1 to 7, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 9. The antibody or antibody fragment of paragraph 7 or 8, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 10. The antibody or antibody fragment of any one of paragraphs 4 to 8, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 11. The antibody or antibody fragment of any one of paragraphs 1 to 10, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G in SEQ ID NO: 1.
• 12. The antibody or antibody fragment of any one of paragraphs 1 to 11, wherein the human is at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 13. The antibody or antibody fragment according to any one of paragraphs 1 to 12, wherein the antibody or the antibody fragment at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, Peripheral vascular disease, claudication and hypertension in this human being treated or the risk of such a disease is reduced.
• 14. The antibody or antibody fragment of any one of paragraphs 1 to 13, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 15. The antibody or antibody fragment of any one of paragraphs 1 to 14, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

• 1. Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGLC2*01 der humanen leichten Kette umfasst oder der Mensch Antikörper exprimiert, die konstante Regionen IGLC2*01 der humanen leichten lambda-Kette umfassen, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• Ein Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGLC2*01 der humanen leichten Kette umfasst, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten Kette.
• Ein anderes Beispiel stellt Folgendes bereit:-
• Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGLC2*01 der humanen leichten Kette umfasst, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation E670G in SEQ ID NO: 1 umfasst, umfasst. Gegebenenfalls umfasst der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten Kette.
• Bei einem Beispiel wurde festgestellt, dass der Antikörper bzw. das Antikörperfragment spezifisch an eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, wobei der Antikörper bzw. das Fragment eine konstante Region IGLC2*01 der humanen leichten lambda-Kette umfasst, und wobei der Mensch (i) ein Gensegment der konstanten Region IGLC2*01 der humanen schweren Kette umfasst, und (ii) eine Nukleotidsequenz, die für die Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, umfasst.
• 2. Das Verfahren nach Absatz 1, bei dem man vor der Verabreichung den Menschen auswählt, der die Nukleotidsequenz von (ii) umfasst.
• 3. Das Verfahren nach Absatz 1 oder 2, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 4. Das Verfahren nach einem der Absätze 1 bis 3, das den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 5. Das Verfahren nach Absatz 4, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 6. Das Verfahren nach Absatz 5, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 7. Das Verfahren nach Absatz 5 oder 6, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 8. Das Verfahren nach einem der Absätze 1 bis 7, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 9. Das Verfahren nach einem der Absätze 1 bis 8, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 10. Das Verfahren nach Absatz 8 oder 9, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 11. Das Verfahren nach einem der Absätze 5 bis 7, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 12. Das Verfahren nach einem der Absätze 1 bis 11, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 13. Das Verfahren nach einem der Absätze 1 bis 12, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 14. Das Verfahren nach einem der Absätze 1 bis 13, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 15. Das Verfahren nach einem der Absätze 1 bis 14, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 16. Das Verfahren nach einem der Absätze 1 bis 15, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.

Further exemplary methods can be found in paragraphs 1-16 as follows.

• A method for reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a Comprises a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human lambda light chain constant region IGLC2 * 01, and wherein said human (i) comprises a human light chain constant region IGLC2 * 01 gene segment, or human expressing antibodies comprising human lambda light chain constant region IGLC2 * 01 regions, and (ii) a A nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• An example provides: -
• A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising a mutation I474 in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human lambda light chain constant region IGLC2 * 01, and wherein human (i) comprises a And (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the mutation I474V in SEQ ID NO : 1 comprises. Optionally, the antibody or fragment comprises a human light chain constant region IGLC2 * 01.
• Another example provides:
• A method for reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) having a C- comprising a terminal domain comprising an E670G mutation in SEQ ID NO: 1, in said human, said antibody or fragment comprising a human lambda light chain constant region IGLC2 * 01, and wherein human (i) comprises a And (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the mutation E670G in SEQ ID NO : 1 comprises. Optionally, the antibody or fragment comprises a human light chain constant region IGLC2 * 01.
• In one example, the antibody or antibody fragment was found to specifically bind to a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human lambda light chain constant region IGLC2 * 01, and wherein human (i) comprises a human heavy chain constant region IGLC2 * 01 gene segment, and (ii) a nucleotide sequence known for the subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• 2. The method according to paragraph 1, wherein, prior to administration, selecting the human comprising the nucleotide sequence of (ii).
• 3. The method according to paragraph 1 or 2, wherein it has been determined that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1, and or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 4. The method of any one of paragraphs 1 to 3, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 5. The method of paragraph 4, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 6. The method of paragraph 5, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 7. The method according to paragraph 5 or 6, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification and / or wherein the assay is performed in a multiplex Format is done.
• 8. The method of any one of paragraphs 1 to 7, wherein the human being is substantially resistant to statin treatment, or wherein the human has also been determined to be substantially resistant to statin treatment.
• 9. The method according to any one of paragraphs 1 to 8, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• 10. The method of paragraph 8 or 9, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 11. The method of any one of paragraphs 5 to 7, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 12. The method of any of paragraphs 1 to 11, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 13. The method according to any one of paragraphs 1 to 12, wherein said human at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, Dyslipidemia, hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension.
• 14. The method according to any one of paragraphs 1 to 13, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease by the antibody or antibody fragment, Claudication and hypertension in this person are treated or the risk of such a condition is diminished.
• 15. The method of any one of paragraphs 1 to 14, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 16. The method according to any one of paragraphs 1 to 15, wherein the antibody or the antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

• 1. Ein Antikörper oder ein Antikörperfragment zur Verwendung in einem Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels in einem dessen bedürftigen Menschen, wobei der Antikörper bzw. das Fragment eine humane variable Domäne umfasst, die sich aus der Rekombination eines humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments ableitet, wobei das VH-Gensegment definert ist in einer der Klauseln 80 bis 90, und der Antikörper bzw. das Fragment spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Aminosäuresequenz bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, wobei der Mensch eine Nukleotidsequenz umfasst, die für die Aminosäuresequenz codiert, und das VH-Gensegment umfasst oder Antikörper exprimiert, die VH-Domänen umfassen, die sich aus der Rekombination des humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments ableiten.
• Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• 2. Der Antikörper oder das Antikörperfragment nach Absatz 1, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 3. Der Antikörper oder das Antikörperfragment nach Absatz 1 oder 2, wobei das Verfahren den Schritt der Feststellung umfasst, dass der Mensch die Nukleinsäuresequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 4. Der Antikörper oder das Antikörperfragment nach Absatz 3, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 5. Der Antikörper oder das Antikörperfragment nach Absatz 4, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 6. Der Antikörper oder das Antikörperfragment nach Absatz 4 oder 5, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 7. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 6, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder bei dem ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 8. Der Antikörper oder das Antikörperfragment nach einem der Ansprüche 1 bis 7, wobei der Antikörper oder das Antikörperfragment für die Verabreichung an einen Menschen bestimmt ist, der eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 9. Der Antikörper oder das Antikörperfragment nach Absatz 7 oder 8, wobei der Antikörper bzw. das Antikörperfragment für eine Verabreichung an den Menschen bestimmt ist, die getrennt von oder gleichzeitig mit der Statinbehandlung erfolgt.
• 10. Der Antikörper oder das Antikörperfragment nach einem der Absätze 4 bis 8, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 11. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 10, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die eine Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 12. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 11, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 13. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 12, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 14. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 13, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 15. Der Antikörper oder das Antikörperfragment nach einem der Absätze 1 bis 14, wobei der Antikörper bzw. das Antikörperfragment zur Verabreichung durch intravenöse oder subkutane Verabreichung bestimmt ist und/oder in einer injizierbaren Zubereitung enthalten ist.

Other exemplary ligands can be found in paragraphs 1-15 as follows.

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human variable domain resulting from the recombination of a human VH Gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment is defined in any of clauses 80 to 90, and the antibody or fragment specifically comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) - Amino acid sequence comprising a C-terminal domain comprising a mutation I474V or E670G in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence coding for the amino acid sequence and comprising the VH gene segment or expressing antibodies which VH Domains that result from the recombination of the human VH gene segment, a human D gene segment s and a human JH gene segment.
• In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• 2. The antibody or antibody fragment of paragraph 1, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 3. The antibody or antibody fragment of paragraph 1 or 2, the method comprising the step of determining that the human comprises the nucleic acid sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, wherein the detecting step is optionally performed prior to administration of the antibody to a human.
• 4. The antibody or antibody fragment of paragraph 3, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 5. The antibody or antibody fragment of paragraph 4, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 6. The antibody or antibody fragment according to paragraph 4 or 5, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, Next Generation Sequencing, nucleic acid hybridization and allele-specific amplification and / or wherein the assay is in a multiplex format.
• 7. The antibody or antibody fragment of any one of paragraphs 1 to 6, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• The antibody or antibody fragment of any one of claims 1 to 7, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 9. The antibody or antibody fragment of paragraph 7 or 8, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 10. The antibody or antibody fragment of any one of paragraphs 4 to 8, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 11. The antibody or antibody fragment of any one of paragraphs 1 to 10, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation of I474V or E670G in SEQ ID NO: 1.
• 12. The antibody or antibody fragment of any one of paragraphs 1 to 11, wherein the human is at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 13. The antibody or antibody fragment according to any one of paragraphs 1 to 12, wherein the antibody or the antibody fragment at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, Peripheral vascular disease, claudication and hypertension in this human being treated or the risk of such a disease is reduced.
• 14. The antibody or antibody fragment of any one of paragraphs 1 to 13, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 15. The antibody or antibody fragment of any one of paragraphs 1 to 14, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

• 1. Ein Verfahren zum Reduzieren des Cholesterinspiegels oder zur Aufrechterhaltung eines zuvor reduzierten Cholesterinspiegels bei einem dessen bedürftigen Menschen, wobei das Verfahren die Verabreichung eines Antikörpers oder Antikörperfragments, der bzw. das spezifisch eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) bindet, die eine C-terminale Domäne umfasst, die eine Mutation I474 oder E670G in SEQ ID NO: 1 umfasst, an diesen Menschen umfasst, wobei der Antikörper bzw. das Fragment eine humane variable Domäne umfasst, die sich von der Rekombination eines humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments abgeleitet, wobei das VH-Gensegment wie in einer der Klauseln 80 bis 90 definiert ist und wobei der Mensch (i) das VH-Gensegment umfasst oder Antikörper exprimiert, die VH-Domänen umfassen, die sich von der Rekombination des humanen VH-Gensegments, eines humanen D-Gensegments und eines humanen JH-Gensegments ableiten, und (ii) eine Nukleotidsequenz, die für eine Proproteinkonvertase Subtilisin/Kexin Typ 9 (PCSK9) codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst. Gemäß einer Ausführungsform handelt es sich bei der Mutation um I474V. Gemäß einer anderen Ausführungsform handelt es sich bei der Mutation um E670G.
• 2. Das Verfahren nach Absatz 1, bei dem man vor der Verabreichung den Menschen auswählt, der die Nukleotidsequenz von (ii) umfasst.
• 3. Das Verfahren nach Absatz 1 oder 2, wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 4. Das Verfahren nach einem der Absätze 1 bis 3, das den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 5. Das Verfahren nach Absatz 4, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 6. Das Verfahren nach Absatz 5, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 7. Das Verfahren nach Absatz 5 oder 6, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 8. Das Verfahren nach einem der Absätze 1 bis 7, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 9. Das Verfahren nach einem der Absätze 1 bis 8, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 10. Das Verfahren nach Absatz 8 oder 9, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 11. Das Verfahren nach einem der Absätze 5 bis 7, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 12. Das Verfahren nach einem der Absätze 1 bis 11, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 13. Das Verfahren nach einem der Absätze 1 bis 12, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 14. Das Verfahren nach einem der Absätze 1 bis 13, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 15. Das Verfahren nach einem der Absätze 1 bis 14, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 16. Das Verfahren nach einem der Absätze 1 bis 15, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.

Further exemplary methods can be found in paragraphs 1-16 as follows.

• A method of reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1 comprises in said human, said antibody or fragment comprising a human variable domain resulting from the recombination of a human VH gene segment, a human VH gene segment human V gene segment and a human JH gene segment, wherein the V H gene segment is as defined in any one of clauses 80 to 90 and wherein the human (i) comprises the V H gene segment or expresses antibodies comprising V H domains derive from the recombination of the human VH gene segment, a human D gene segment and a human JH gene segment, and (ii) a A nucleotide sequence encoding a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1. In one embodiment, the mutation is I474V. In another embodiment, the mutation is E670G.
• 2. The method according to paragraph 1, wherein, prior to administration, selecting the human comprising the nucleotide sequence of (ii).
• 3. The method according to paragraph 1 or 2, wherein it has been determined that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1, and or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 4. The method of any one of paragraphs 1 to 3, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 5. The method of paragraph 4, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 6. The method of paragraph 5, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 7. The method according to paragraph 5 or 6, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification and / or wherein the assay is performed in a multiplex Format is done.
• 8. The method of any one of paragraphs 1 to 7, wherein the human being is substantially resistant to statin treatment, or wherein the human has also been determined to be substantially resistant to statin treatment.
• 9. The method according to any one of paragraphs 1 to 8, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• 10. The method of paragraph 8 or 9, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 11. The method of any one of paragraphs 5 to 7, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 12. The method of any of paragraphs 1 to 11, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 13. The method of any one of paragraphs 1 to 12, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension has been.
• 14. The method according to any one of paragraphs 1 to 13, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease by the antibody or antibody fragment, Claudication and hypertension in this person are treated or the risk of such a condition is diminished.
• 15. The method of any one of paragraphs 1 to 14, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 16. The method according to any one of paragraphs 1 to 15, wherein the antibody or the antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

logs

A: The invention further provides the following protocols, ligands and kits.

• A method for treating a human PCSK9-mediated disease or condition in a human by targeting a rare human PCSK9 variant, the method comprising administering a ligand (eg, an antibody or a fragment) thereof was that it specifically binds the PCSK9 variant to humans; wherein the human expresses the PCSK9 variant or the human genome comprises a nucleotide sequence coding for the PCSK9 variant; whereby the human being is treated against the illness or the suffering.

For example, the PCSK9 variant may be any of the rare variants described herein.

• 1a. Ein Verfahren zur Behandlung einer durch PCSK9 vermittelten Krankheit oder eines durch PCSK9 vermittelten Leidens bei einem Menschen durch Targeting einer PCSK9, die einen Aminosäurepolymorphismus in der C-terminalen Domäne (im Vergleich zu SEQ ID NO: 1) umfasst, wobei das Verfahren die Verabreichung eines Liganden (z. B. eines Antikörpers oder eines Fragments) an den Menschen umfasst, von dem festgestellt wurde, dass er spezifisch an eine PCSK9 bindet, die eine C-terminale Domäne umfasst, die I474V oder 670G umfasst (Nummerierung gemäß SEQ ID NO: 1); wobei der Mensch die PCSK9 exprimiert oder das Genom des Menschen eine Nukleotidsequenz umfasst, die für die PCSK9 codiert; wobei der Mensch gegen die Krankheit bzw. das Leiden behandelt wird.
• Gemäß einer Ausführungsform erfolgt die Feststellung der spezifischen Bindung in Bezug auf Bindungsassaydaten, z. B. wie durch SPR oder ELISA bestimmt. Die Feststellung kann zum Beispiel in Bezug auf Informationen in einer gedruckten Veröffentlichung, z. B. unter Kenntnis der in der vorliegenden und anderen Patentanmeldungen oder in einem Artikel in einer wissenschaftlichen Zeitschrift dargestellten Daten, erfolgen. In Kenntnis eines solchen Wissens (z. B. in Abwesenheit weiterer Bindungstests) ist der Fachmann dazu in der Lage – unter Anleitung durch die vorliegende Erfindung – einen betreffenden Menschen zu behandeln, dessen Genotyp oder Phänotyp der Bindungsspezifität des Liganden entspricht.
• Der Antikörper bzw. das Fragment kann gemäß einer beliebigen Konfiguration, einem beliebigen Beispiel, einer beliebigen Ausführungsform, einem beliebigen Aspekt, einer beliebigen Klausel oder einem beliebigen Absatz hieraus sein.
• Gemäß einer Ausführungsform umfasst das Verfahren vor der Verabreichung die Auswahl eines Menschen, der die für die PCSK9 codierende Nukleotidsequenz umfasst, wobei es sich bei dem Menschen um den Menschen in Klausel 1 (z. B. 1a) handelt.
• 2. Das Verfahren nach Klausel 1, welches vor der Verabreichung den Schritt der Feststellung umfasst, dass der Ligand spezifisch an die PCSK9 bindet, z. B. unter Anwendung von SPR oder ELISA.
• 3. Das Verfahren nach Klausel 1 oder 2, wobei die spezifische Bindung an die PCSK9 eine Bindung mit einer Dissoziationskonstante (Kd) von 1 nM oder weniger, z. B. 100, 10 oder 1 pM oder weniger, ist.
• 4. Das Verfahren nach einer der Klauseln 1 bis 3 (z. B. Klausel 1a), wobei es sich bei dem Leiden um erhöhtes LDL-Cholesterin handelt oder das Leiden durch erhöhtes LDL-Cholesterin verursacht wird.
• 5. Das Verfahren nach Klausel 4 (z. B. bei einer Abhängigkeit von Klausel 1a), wobei das Leiden ausgewählt ist aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck.
• 6. Das Verfahren nach einer der Klauseln 1 bis 5 (z. B. bei einer Abhängigkeit von Klausel 1a), wobei festgestellt wurde, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9 codiert, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9(PCSK9)-Proteinvariante, die von der Nukleotidsequenz von SEQ ID NO: 29 oder 30 codiert wird.
• 7. Das Verfahren nach einer der Klauseln 1 bis 6 (z. B. bei einer Abhängigkeit von Klausel 1a), das den Schritt der Feststellung umfasst, dass der Mensch die Nukleotidsequenz umfasst, die für eine PCSK9, die eine C-terminale Domäne umfasst, die die Mutation I474V oder E670G umfasst, und/oder eine Proproteinkonvertase Subtilisin/Kexin Typ 9-(PCSK9)-Proteinvariante, die die Mutation I474V oder E670G umfasst, codiert, wobei der Feststellungsschritt gegebenenfalls vor der Verabreichung des Antikörpers an den Menschen durchgeführt wird.
• 8. Das Verfahren nach Klausel 7, wobei der Feststellungsschritt die Untersuchung einer biologischen Probe von dem Menschen auf eine Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 9. Das Verfahren nach Klausel 8, wobei die Untersuchung das Inkontaktbringen der biologischen Probe mit
• a. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden umfasst, die spezifisch mit einer Nukleotidsequenz hybridisieren und diese in der biologischen Probe identifizieren kann, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder die spezifisch mit einer Antisense-Sequenz dieser Sequenz hybridisiert, wobei die Nukleinsäure mit wenigstens einem Nukleotid hybridisiert, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, oder mit einer Antisense-Sequenz hybridisiert und so einen Komplex bildet, wenn wenigstens eine Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und/oder
• b. wenigstens einer Oligonukleotidsonde, die eine Sequenz von wenigstens 10 aufeinanderfolgenden Nukleotiden einer Nukleotidsequenz umfasst, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, oder eine Antisense-Sequenz dieser aufeinanderfolgenden Nukleotide umfasst, wobei die Sequenz aufeinanderfolgender Nukleotide wenigstens ein Nukleotid umfasst, das in der ausgewählten Sequenz vorhanden ist, aber nicht in SEQ ID NO: 28 vorhanden ist, und so einen Komplex bildet, wenn die Nukleotidsequenz, die für die PCSK9 codiert, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst, vorhanden ist; und das Feststellen des Vorhandenseins oder der Abwesenheit des Komplexes umfasst, wobei durch das Feststellen des Vorhandenseins des Komplexes bestimmt wird, dass der Mensch die PCSK9 umfasst, die die C-terminale Domäne umfasst, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 10. Das Verfahren nach Klausel 8 oder 9, wobei die Untersuchung eine Nukleinsäureamplifikation und gegebenenfalls eines oder mehrere Verfahren ausgewählt aus Sequenzieren, Sequenzieren der nächsten Generation (Next Generation Sequencing), Nukleinsäurehybridisierung und allelspezifischer Amplifikation umfasst und/oder wobei die Untersuchung in einem Multiplex-Format erfolgt.
• 11. Das Verfahren nach einer der Klauseln 1 bis 10, wobei der Mensch im Wesentlichen resistent gegenüber einer Statinbehandlung ist oder wobei bei dem Menschen ferner festgestellt wurde, dass er im Wesentlichen resistent gegenüber einer Statinbehandlung ist.
• 12. Das Verfahren nach einer der Klauseln 1 bis 11, wobei der Mensch eine Statinbehandlung erhält oder erhalten hat oder ein vermindertes Ansprechen auf eine Statinbehandlung zeigt.
• 13. Das Verfahren nach Klausel 11 oder 12, wobei der Antikörper bzw. das Antikörperfragment dem Menschen getrennt von oder gleichzeitig mit der Statinbehandlung verabreicht wird.
• 14. Das Verfahren nach einer der Klauseln 8 bis 10, wobei die biologische Probe Serum, Blut, Kot, Gewebe, eine Zelle, Urin und/oder Speichel des Menschen umfasst.
• 15. Das Verfahren nach einer der Klauseln 1 bis 14, wobei der Mensch heterozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G umfasst, wobei der Mensch gegebenenfalls ferner die Nukleotidsequenz von SEQ ID NO: 28 umfasst, oder der Mensch homozygot für eine Nukleotidsequenz ist, die für die C-terminale Domäne von PCSK9 codiert, die die Mutation I474V oder E670G in SEQ ID NO: 1 umfasst.
• 16. Das Verfahren nach einer der Klauseln 1 bis 15, wobei bei dem Menschen wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck diagnostiziert wurde.
• 17. Das Verfahren nach einer der Klauseln 1 bis 16, wobei durch den Antikörper bzw. das Antikörperfragment wenigstens ein Leiden ausgewählt aus einer Lipidstörung, Hyperlipoproteinämie, Hyperlipidämie, Dyslipidämie, Hypercholesterinämie, einem Herzanfall, einem Schlaganfall, koronarer Herzkrankheit, Atherosklerose, peripherer Gefäßkrankheit, Klaudikation und Bluthochdruck bei diesem Menschen behandelt oder das Risiko eines solchen Leidens vermindert wird.
• 18. Das Verfahren nach einer der Klauseln 1 bis 17, wobei es sich bei der Nukleotidsequenz um SEQ ID NO: 29 oder 30 handelt.
• 19. Das Verfahren nach einer der Klauseln 1 bis 18, wobei der Antikörper bzw. das Antikörperfragment durch intravenöse oder subkutane Verabreichung verabreicht wird und/oder in einer injizierbaren Zubereitung enthalten ist.
• 20. Ein Ligand (z. B. ein Antikörper oder Fragment) zur Verwendung in dem Verfahren nach einer der Klauseln 1 bis 19, wobei der Ligand die PCSK9 spezifisch bindet.
• 21. Ein Kit, umfassend den Liganden nach Klausel 20 und Instruktionen zur Durchführung des Verfahrens nach einer der Klauseln 1 bis 19.

For example, it provides:

• 1a. A method for treating a PCSK9 mediated disease or a PCSK9 mediated disease in a human by targeting a PCSK9 comprising an amino acid polymorphism in the C-terminal domain (as compared to SEQ ID NO: 1), the method comprising administering a Human ligand (eg, an antibody or fragment) that has been found to specifically bind to a PCSK9 comprising a C-terminal domain comprising I474V or 670G (numbering as shown in SEQ ID NO: 1). 1); wherein the human expresses the PCSK9 or the human genome comprises a nucleotide sequence encoding the PCSK9; whereby the human being is treated against the illness or the suffering.
• In one embodiment, the determination of specific binding relative to binding assay data, e.g. As determined by SPR or ELISA. The determination may be made, for example, in relation to information in a printed publication, e.g. With knowledge of the data presented in this and other patent applications or in an article in a scientific journal. Knowing such knowledge (eg, in the absence of further binding assays), one skilled in the art will be able to - under the guidance of the present invention - treat a subject human whose genotype or phenotype corresponds to the binding specificity of the ligand.
• The antibody or fragment may be in accordance with any configuration, example, embodiment, aspect, clause, or paragraph.
• In one embodiment, the method prior to administration comprises selecting a human comprising the nucleotide sequence encoding the PCSK9, wherein the human is the human in clause 1 (eg, 1a).
• 2. The method of clause 1, comprising the step of determining, prior to administration, that the ligand specifically binds to PCSK9, e.g. Using SPR or ELISA.
• 3. The method of clause 1 or 2, wherein the specific binding to the PCSK9 is binding with a dissociation constant (Kd) of 1 nM or less, e.g. 100, 10 or 1 pM or less.
• 4. The method of any one of clauses 1 to 3 (eg clause 1a), wherein the condition is elevated LDL cholesterol or the condition is caused by increased LDL cholesterol.
• 5. The method of clause 4 (eg, if dependent on clause 1a), wherein the condition is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease , Klaudikation and hypertension.
• 6. The method according to any one of clauses 1 to 5 (eg, when dependent on clause 1a), wherein it has been determined that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain, the comprises the mutation I474V or E670G in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 7. The method of any one of clauses 1 to 6 (eg, when dependent on clause 1a) comprising the step of determining that the human comprises the nucleotide sequence that corresponds to a PCSK9 comprising a C-terminal domain which encodes the I474V or E670G mutation and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the I474V or E670G mutation, wherein the detecting step is optionally performed prior to administration of the antibody to a human ,
• 8. The method of clause 7, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 9. The method of clause 8, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• 10. The method of clause 8 or 9, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification and / or wherein the assay is performed in a multiplex Format is done.
• 11. The method of any one of clauses 1 to 10, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 12. The method of any one of clauses 1 to 11, wherein the human receives or has received statin treatment or shows a decreased response to statin treatment.
• 13. The method of clause 11 or 12, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• 14. The method of any one of clauses 8-10, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 15. The method of any one of clauses 1 to 14, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 16. The method of any one of clauses 1 to 15, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension has been.
• 17. The method according to any of clauses 1 to 16, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease by the antibody or antibody fragment, Claudication and hypertension in this person are treated or the risk of such a condition is diminished.
• 18. The method of any of clauses 1-17, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 19. The method of any one of clauses 1 to 18, wherein the antibody or antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.
• 20. A ligand (eg, an antibody or fragment) for use in the method of any one of clauses 1 to 19, wherein the ligand specifically binds the PCSK9.
• 21. A kit comprising the ligand according to clause 20 and instructions for carrying out the method according to any one of clauses 1 to 19.

B: The invention further provides the following protocols, ligands and kits.

• 1. A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a person in need thereof, the method comprising: -
• a. administering a first human treatment over a first treatment period by administering to human an anti-human PCSK9 ligand (eg, an antibody or a fragment), (i) determining that the ligand is specific to a PCSK9 which comprises a C-terminal domain comprising I474V or 670G (numbering according to SEQ ID NO: 1); (ii) the human expressing PCSK9 or the human genome comprises a nucleotide sequence encoding the PCSK9, and (iii) the human receives or has received a statin treatment to lower or maintain the cholesterol level; wherein the first treatment comprises administering to the human a single or multiple doses of the ligand;
• b. the decision to (i) stop statin treatment (ii) treat people with statins; or (iii) to reduce statin treatment after the first treatment period; and
• c. continuing administration of the ligand to the patient after the lapse of the time period, whereby the cholesterol level is lowered or a previously lowered cholesterol level in the human is maintained.
• In one embodiment, the determination of specific binding relative to binding assay data, e.g. As determined by SPR or ELISA. The determination may be made, for example, in relation to information in a printed publication, e.g. With knowledge of the data presented in this and other patent applications or in an article in a scientific journal. Knowing such knowledge (eg, in the absence of further binding assays), one skilled in the art will be able to - under the guidance of the present invention - treat a subject human whose genotype or phenotype corresponds to the binding specificity of the ligand.
• The antibody or fragment may be in accordance with any configuration, example, embodiment, aspect, clause, or paragraph.
• A pharmaceutically effective amount of the ligand is administered.
• In one embodiment, the method comprises, prior to administration, selecting a human comprising the nucleotide sequence encoding the PCSK9, wherein the human is the human listed in clause 1.
• In one example, the first treatment period is 7 days, 14 days, 21 days, 28 days, one month, two months, three months, four months, five months, six months, seven months, eight months, nine months, or one year.
• 2. The method according to clause 1, wherein the person has suffered or is suffering from a statin-associated memory loss or a statin-associated neurodegenerative condition, or where the person has or is at increased risk of diabetes (eg statin-associated diabetes).
• 3. The method of clause 1 or 2, comprising, prior to the first treatment, the step of determining that the person has suffered or is suffering from a statin-associated memory loss or a statin-associated neurodegenerative condition, or an increased risk of diabetes in the person (eg. statinassociated diabetes) has existed or exists.
• 4. The method of clause 2 or 3, comprising, after step (b) (eg, during step (c)), determining that memory loss or neurodegenerative disease has improved.
• 5. The method of any one of clauses 1 to 4, wherein the person is over 40 years old (eg, 50 years or older, 55 years or older, 60 years or older, 65 years or older, or 70 years or older ).
• 6. The method of any of clauses 1-5, wherein step (c) comprises increasing the dosage of the ligand to be administered after the first treatment and administering the increased dosage to the human.
• 7. The method of any one of clauses 1 to 6, wherein step (b) comprises determining that the human is intolerant or not responsive to statin treatment for treatment with a statin.
• 8. The method of any one of clauses 1 to 7, wherein the first treatment comprises administering to a human a statin, fenofibrate (eg Tricor ^™ or Lofibra ^™ ) or ezetimibe in addition to the ligand.
• 9. The method of any one of clauses 1 to 8, wherein step (b) comprises termination or reduction of statin, fenofibrate (eg, Tricor ^™ or Lofibra ^™ ) or ezetimibe treatment during step (c).
• 10. The method of any one of clauses 1 to 9, which comprises increasing (eg, increasing compared to the dosage in the first treatment) the dosage of the ligand during step (c).
• 11. The method according to any one of clauses 1 to 10, wherein the person has received a treatment with a high dose of statin prior to the first treatment and wherein Schrit (c) the administration of a Treatment with a lower (eg, medium or low) statin dosage in addition to the ligand. One skilled in the art will be familiar with the importance of high, medium, and low dose treatments (and how they are to be determined according to the particular patient, eg, according to the body weight of the patient). The statin is selected, for example, from rosuvastatin, atorvastatin and simvastatin.
• For example, the statin daily doses are as follows: low 10 to 20 mg (eg 10 mg); medium> 20 and <60 mg (eg 40 mg); high 60-100 mg (eg 80 mg).
• 12. The method of any one of clauses 1 to 10, wherein the human received treatment with a median dose of statin prior to the first treatment, and wherein step (c) means administering a treatment with a lower (eg, low) statin dosage or not Administration of a statin in addition to the ligand.
• 13. The method of any one of clauses 1 to 10, wherein the human has received a low dose of statin treatment prior to the first treatment, and wherein step (c) does not involve administration of a statin in addition to the ligand.
• 14. The method of any one of clauses 1 to 13, comprising, prior to the first treatment, the step of determining that the ligand specifically binds to the PCSK9, e.g. Using SPR or ELISA.
• 15. The method of any one of clauses 1 to 14, wherein the specific binding to the PCSK9 is binding with a dissociation constant (Kd) of 1 nM or less, e.g. 100, 10 or 1 pM or less.
• 16. The method of any one of clauses 1 to 15, wherein the human is suffering from at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, and hypertension or the risk of such a condition exists.
• 17. The method of clause 16, wherein step (c) treats or reduces the risk of suffering in the human.
• 18. The method of any one of clauses 1 to 17, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1 , and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 19. The method of any one of clauses 1 to 18, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutant I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 20. The method of clause 19, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 21. The method of clause 20, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises PCSK9 comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1 ,
• 22. The method of clause 20 or 21, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is performed in a multiplex Format is done.
• 23. The method of any one of clauses 1 to 22, wherein the human is substantially resistant to statin treatment or wherein the human has also been determined to be substantially resistant to statin treatment.
• 24. The method of any of clauses 20 to 22, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 25. The method of any of clauses 1 to 24, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 26. The method of any one of clauses 1 to 25, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, and hypertension has been.
• 27. The method of any one of clauses 1 to 26, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 28. The method of any of clauses 1 to 27, wherein the ligand (eg, antibody or antibody fragment) is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.
• 29. A ligand (eg, an antibody or fragment) for use in the method of any one of clauses 1 to 28, wherein the ligand specifically binds the PCSK9.
• 30. A kit comprising the ligand in accordance with clause 29 and instructions for carrying out the procedure according to any one of clauses 1 to 28.

In an example of one aspect of the invention, the ligand (eg, the antibody or fragment, eg, alirocumab, bocovizumab, or evolocumab, or an antibody or fragment comprising the variable domains of 316P or 31H4) administered to the human at a biweekly dose of 75 to 150 mg (eg, 75 to 150 mg administered once or twice over the course of two weeks). In one example, the ligand is for such administration to humans.

EXAMPLES

Example 1: Rare PCSK9 variants

The present invention provides anti-PCSK9 ligands and PCSK9-binding or PCSK9-targeting ligands as described herein. The ligands can be used differently. For example, some of the ligands are useful in assays for specific binding, genotyping or phenotyping of humans, for affinity purification of PCSK9, particularly human PCSK9 or its ligands, and for screening assays for identifying other antagonists of PCSK9 activity. Some of the ligands of the invention are useful for inhibiting the binding of PCSK9 to LDLR, or for inhibiting PCSK9 mediated activities.

Anti-PCSK9 ligands (eg, antibodies and anti-sense RNA) have been developed based on the targeting and neutralization of so-called human "wild-type" PCSK9, which is a conventionally occurring form (see e.g. US20120093818A1 and US20110065902A1 ). While such therapies are suitable for human patients experiencing this form of human PCSK9, the inventor has found it useful to examine the possibility of targeting much more rare, but still naturally occurring, forms of PCSK9 in human populations. In this way, the inventor has come to glimpses of the natural occurrence and distribution of lesser human PCSK9 forms, which are useful targets (at the protein or nucleic acid level) for the treatment, prophylaxis, and diagnosis of humans Diseases and conditions mediated by or associated with PCSK9 activity. In particular, tailored therapies, prophylactics, and diagnoses in humans to which the normal PCSK9 gene or protein (ie, those as described in U.S. Pat US20120093818A1 and US20110065902A1 form a or a ') used to generate antibodies is provided.

It will be appreciated by those skilled in the art that SNPs or other changes translated into amino acid variations may result in variability in activity and / or conformation in the human targets to be targeted. This has led to a great deal of interest in personalized medicine using more efficient drug adaptation and diagnostics to genotyping patients and understanding protein and nucleotide variability. The invention thus provides individually tailored pharmaceuticals and assays that specifically address more rare polymorphic PCSK9 variant forms. Such forms or "alleles" (at the nucleotide level) in many of the examples set forth by the inventor include multiple changes at the nucleotide and amino acid levels as compared to the corresponding conventional form of nucleotide and amino acid sequences, ie, there are multiple non-synonymous changes on the nucleotide and amino acid sequences Nucleotide level, which are translated into multiple corresponding changes in the protein target in humans.

Further, the inventor has surprisingly found that the rarer natural forms, although much less common in humans than the conventional form, are nonetheless present in multiple and ethnically diverse human populations, usually with many human examples per reported ethnic population. The inventor has thus found that targeting such more rare forms would provide effective treatment, prophylaxis, or diagnosis across many human ethnic populations, thus extending the utility of the present invention.

With this finding, the inventor has found that there are significant industrial and medical applications to the invention, which has become the direction in the selection of an anti-PCSK9 ligand for administration to human patients for the therapy and / or prophylaxis of PCSK9-mediated or with PCSK9 associated diseases or conditions. In this way, the patient receives drugs and ligands that are tailored to his needs, due to the genetic or phenotypic composition of the patient. Along with this, the invention provides the genotyping and / or phenotyping of patients in connection with such treatment, thereby making it possible to find the appropriate drug for the patient. This increases the chances of medical efficacy, reduces the likelihood of poor treatment with drugs or ligands that are not personalized to the patient (eg, poor efficacy and / or side effects), and avoids pharmaceutical misconduct and waste.

• • PCSK9-Varianten mit einer kumulativen humanen Allelhäufigkeit im Bereich von 1 bis 10%;
• • PCSK9-Varianten mit einer humanen Genotypgesamthäufigkeit im Bereich von 1 bis 15%;
• • PCSK9-Varianten, die sich in vielen verschiedenen humanen ethnischen Populationen finden (unter Anwendung der Standardkategorisierung des 1000 Genomes Project, bei dem es sich um den anerkannten technischen Standard handelt; siehe Tabelle 4 unten); und
• • PCSK9-Varianten, die sich in vielen Individuen verteilt über solche vielen verschiedenen ethnischen Populationen finden.

In developing this series of thought, in this non-limiting example, the inventor of the present invention decided to determine a set of human PCSK9 variants based on the following criteria, which are criteria that the inventor has found to be useful drugs and deliver diagnostics to tailored needs in the human population. The inventor chose variants that met at least 3 out of the following 4 criteria:

• PCSK9 variants with a cumulative human allele frequency ranging from 1 to 10%;
• PCSK9 variants with a total genotypic genotype in the range of 1 to 15%;
• • PCSK9 variants found in many different human ethnic populations (using the standard categorization of the 1000 Genome Project, which is the accepted technical standard, see Table 4 below); and
• • PCSK9 variants that are found in many individuals across such many different ethnic populations.

Based on these criteria, the inventor identified the variants listed in Table 1 below (except for form a).

The inventor's selection included, as a consideration, the selection of nucleotide variation that resulted in amino acid variation in the corresponding PCSK9 forms (i.e., non-synonymous variations) as opposed to silent variations in which the amino acid residues in the target protein do not change.

Allele Nukleotidsequenzenvarianten

Consequently

• (i) the nucleotide sequence of allele f is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele comprises fine GTC codon instead of an ATC codon at the position marked "I474V" in SEQ ID NO: 28;
• (ii) the nucleotide sequence of allele c is identical to SEQ ID NO: 28, but the nucleotide sequence of allele c comprises a GGG codon instead of a GAG codon at the position marked "E670G" in SEQ ID NO: 28;
• (iii) the nucleotide sequence of allele r is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele r is a GTC codon instead of an ATC codon at the position marked "I474V" in SEQ ID NO: 28 and a GGG Codon instead of a GAG codon at the position marked "E670G" in SEQ ID NO: 28;
• (iv) the nucleotide sequence of allele p is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele p is a GTC codon instead of a GCC codon at the position marked "A53V" in SEQ ID NO: 28 and a GTC Codon in place of an ATC codon at the position marked "I474V" in SEQ ID NO: 28;
• (v) the nucleotide sequence of allele m is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele m comprises an ACC codon instead of a GCC codon at the position marked "A443T" in SEQ ID NO: 28;
• (vi) the nucleotide sequence of allele e is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele e is an AGT codon instead of an AAT codon at the position marked "N425S" in SEQ ID NO: 28 and a GTC Codon in place of an ATC codon at the position marked "I474V" in SEQ ID NO: 28;
• (vii) the nucleotide sequence of allele h is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele h is an ACC codon instead of a GCC codon at the position marked "A443T" in SEQ ID NO: 28 and a CCG Codon in place of a CAG codon at the position marked "Q619P" in SEQ ID NO: 28;
• (viii) the nucleotide sequence of allele aj is identical to SEQ ID NO: 28 except that the nucleotide sequence of allele aj is a CTT codon instead of a CGT codon at the position marked "R46L" in SEQ ID NO: 28 and a GTC Codon instead of an ATC codon at the position marked "I474V" in SEQ ID NO: 28 and
• (ix) the nucleotide sequence of allele q is identical to SEQ ID NO: 28, but the nucleotide sequence of allele q is a GTC codon instead of a GCC codon at the position marked "A53V" in SEQ ID NO: 28 and a GGG Codon instead of a GAG codon at the position marked "E670G" in SEQ ID NO: 28.

Amino acid sequence variants of the pro-form (numbering according to the above-mentioned SEQ ID NO: 1)

• (A) The amino acid sequence of form f is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form f comprises a valine at position 474;
• (B) The amino acid sequence of form c is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form c comprises a glycine at position 670;
• (C) The amino acid sequence of form r is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form r comprises a valine at position 474 and a glycine at position 670 ;
• (D) The amino acid sequence of form p is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form p comprises a valine at position 53 and a valine at position 474 ;
• (E) The amino acid sequence of form m is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form m comprises a threonine in position 443;
• (F) The amino acid sequence of form e is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form e comprises a serine at position 425 and a valine at position 474 ;
• (G) The amino acid sequence of form h is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form h comprises a threonine at position 443 and a proline at position 619 ;
• (H) The amino acid sequence of form aj is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form aj comprises a leucine at position 46 and a valine at position 474 ; and
• (I) The amino acid sequence of form q is identical to the amino acid sequence of amino acid number 31 to (and including) amino acid number 692 of SEQ ID NO: 1, but the amino acid sequence of form q comprises a valine at position 53 and a glycine at position 670 ,

Amino acid sequence variants of the mature form (numbering according to the above-mentioned SEQ ID NO: 1)

• (A ') The amino acid sequence of form f is identical to SEQ ID NO: 2, but the amino acid sequence of form f comprises a valine at position 474;
• (B ') The amino acid sequence of Form c is identical to SEQ ID NO: 2, but the amino acid sequence of Form c comprises a glycine at position 670;
• (C ') The amino acid sequence of form r is identical to SEQ ID NO: 2, but the amino acid sequence of form r comprises a valine at position 474 and a glycine at position 670;
• (D ') The amino acid sequence of form p is identical to SEQ ID NO: 2, but the amino acid sequence of form p comprises a valine at position 474;
• (E ') The amino acid sequence of form m is identical to SEQ ID NO: 2, but the amino acid sequence of form m comprises a threonine in position 443;
• (F ') The amino acid sequence of form e is identical to SEQ ID NO: 2, but the amino acid sequence of form e comprises a serine at position 425 and a valine at position 474;
• (G ') The amino acid sequence of Form h is identical to SEQ ID NO: 2, but the amino acid sequence of Form h comprises a threonine at position 443 and a proline at position 619;
• (H ') The amino acid sequence of form aj is identical to SEQ ID NO: 2, but the amino acid sequence of form aj comprises a valine at position 474; and
• (I ') The amino acid sequence of Form q is identical to SEQ ID NO: 2, but the amino acid sequence of Form q comprises a glycine at position 670.

The mature form of p is identical to the mature form of f and aj.

The mature form of c is identical to the mature form of q.

• • PCSK9-Varianten, deren Aminosäurerestevarianten (im Vergleich zur üblichen Form der humanen PCSK9) sich in der reifen Form des Targets finden (d. h. außerhalb der Pro-Domäne); und
• • PCSK9-Varianten, deren Aminosäurerestevarianten (im Vergleich zur üblichen Form der humanen PCSK9) auf dem Target an der Oberfläche exponiert sind, was der Erfinder als einen Beitrag zur Bestimmung der Topographie des Targets leistend und potentiell einen Beitrag zu wie und wo es auf dem Target zur Ligandenbindung kommt leistend ansah.

Further sequence analysis and 3D computer modeling (see 1 ) showed that selected variants also met the following additional selection criteria:

• PCSK9 variants whose amino acid residue variants (in comparison to the usual form of human PCSK9) find themselves in the mature form of the target (ie outside the pro domain); and
• PCSK9 variants whose amino acid residue variants (compared to the usual form of human PCSK9) are exposed on the surface of the target, which the inventor contributes to determining the topography of the target and potentially contributing to how and where it exists on the target Target for ligand binding comes in handy.

As in 1 As shown, the identified positions 425, 443, 474, 619, and 670 (found in the selected variants of the invention) are all surface exposed and outside the pro domain. Variant positions 425 and 443 are surface exposed on the catalytic domain, while variant positions 474, 619 and 670 are surface exposed on the C-terminal domain.

The inventor has thus applied new selection criteria to the determination of rare variant forms of human PCSK9, the utility of their nucleotide and amino acid sequences in the various configurations, aspects, clauses, embodiments and examples of the invention herein, and thereby new, customized medical and diagnostic applications as above described provided.

Individual adaptation of antibodies to rare PCSK9 variant profiles

As outlined above, the invention includes the ability to further customize human treatments by using antibody-based variable domain ligands based on gene segments commonly found in people of the ethnic populations where the PCSK9 variant forms meet the selection criteria of Meet invention, are encountered, selects. Below is an example for ligands comprising antibody VH domains derived from recombination of human VH3-23.

The inventor analyzed the abundances and distribution of various human VH3-23 alleles and recognized the desirability of using ligands based on human VH3-23 alleles comprising SNP rs56069819. This SNP corresponds to a change of leucine at position 24 in the encoded protein sequence to a valine in this position (L24V change) and the SNP is at coordinate 106268889 on human chromosome 14.

2 Figure 10 shows the cumulative allele frequency distribution across the database of the 1000 Genome Project of human VH3-23 alleles comprising SNP rs56069819 (where such alleles are referred to as "C" and the most abundant allele (not including this SNP) as "A" referred to as). The figure shows that the VH3-23 alleles comprising SNP rs56069819 occur at a cumulative frequency of 11% across all human ethnic populations taken together, while in certain specific human ethnic subpopulations (ASW, LWK, YRI, CEU and GBR) such alleles with an above-average cumulative frequency occur. Shown in the figure are the variant forms of human PCSK9 (designated as "variants") found in various subpopulations with above-average occurrence of human VH3-23 alleles with SNP rs56069819. Table 6 shows the VH3-23 variants and the SNPs that comprise them, as well as their cumulative allele frequencies, as found in the database of the 1000 Genome Project.

Remarkably, human VH3-23 alleles with SNP rs56069819 were found in the CEU population at a frequency almost double that of 11% for all populations. In the ASW and YRI populations, the incidence was over one quarter of the population. The invention thus advantageously permits selection of a ligand comprising an antibody or antibody fragment, the antibody or fragment comprising a VH domain resulting from the recombination of a human VH gene segment, a human D gene segment, and a human gene human JH gene segment, wherein the VH gene segment comprises a nucleotide sequence comprising SNP rs56069819 (dbSNP numbering, construction number as stated above).

In one example, one can further tailor the treatment by selecting a ligand that specifically binds to a human PCSK9 selected from the forms: f, c, m, e, h, p, q, and aj, which forms those that occur in the human populations ASW, LWK, YRI, CEU and GBR.

In one example, the VH gene segment is VH3-23 * 04, which is a common variant of SNP rs56069819 in the human populations ASW, LWK, YRI, CEU and GBR.

In one example, the ligand is for use in the treatment and / or prevention of a PCSK9-mediated disease or a PCSK9-mediated condition in a human having a human PCSK9 selected from the forms: f, c, m, e, h, p, q and aj expressed.

In one example, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or a PCSK9-mediated condition in a human with ASW, LWK, YRI, CEU or GBR descent.

In one embodiment, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or condition in a human of ASW descent, wherein the human is a PCSK9 selected from f, c, m, e, h, p and q or human comprises a corresponding nucleotide or amino acid sequence as listed in Table 5. Optionally, this ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one embodiment, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or condition in a human of LWK descent, wherein the human expresses a PCSK9 selected from f, c, m, e and h, or human a corresponding nucleotide or amino acid sequence as listed in Table 5. Optionally, this ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one embodiment, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or condition in a human of YRI descent, wherein the human expresses a PCSK9 selected from f, c, m, e and h, or human a corresponding nucleotide or amino acid sequence as listed in Table 5. Optionally, this ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one embodiment, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or condition in a human of CEU descent, wherein the human expresses a PCSK9 selected from f, c, p and aj, or human as defined in Table 5 nucleotide or amino acid sequence. Optionally, this ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

According to one embodiment, the ligand is for the treatment and / or prevention of a PCSK9-mediated disease or condition in a human of GBR descent, wherein the human expresses a PCSK9 selected from f, c and p or the human, such as in Table 5, nucleotide or amino acid sequence. Optionally, this ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

For example, in any aspect, example, embodiment, or configuration of the invention, the anti-TOI (eg, PCSK9 or IL4Ra) ligand (eg, trap, antibody or fragment) comprises a VH domain derived from the recombination of a human VH segment (e.g., human VH3-23 * 04), a human D gene segment and a human JH segment, wherein the human VH segment for backbone 1 of SEQ ID NO: 40, and wherein the human comprises a VH gene segment coding for backbone 1 of SEQ ID NO: 40 or the human expressing VH domains comprising backbone 1 of SEQ ID NO: 40. Alternatively, the ligand comprises a VH domain derived by recombination of a human VH segment (e.g., human VH3-23 * 04), a human D gene segment, and a human JH segment, where the human VH gene is derived. Segment SNP rs56069819 and wherein the human comprises a VH gene segment comprising SNP rs56069819.

SNP rs56069819 is present in humans according to the database of the 1000 genome Phase I with an average cumulative frequency of 11%, but more frequently in AFR (23%), EUR (13%), ASW (27%), LWK ( 15%), YRI (28%), CEU (19%) and GBR (15%) populations, thus, in one embodiment, when an anti-TOI (eg PCSK9 or IL4Ra) - An antibody or fragment comprising backbone 1 of SEQ ID NO: 40 or comprising a VH domain resulting from the recombination of a human VH segment (e.g., human VH3-23 * 04), a human D gene segment, and of a human JH segment, wherein the human VH segment comprises SNP rs56069819, in which human is a human of descent selected from the group consisting of AFR, EUR, ASW, LWK, YRI, CEU, and GBR descent. For example, humans are of AFR descent. For example, humans are EUR-descent. For example, humans are of ASW descent. For example, humans are of LWK descent. For example, the human being is of YRI descent. For example, humans are of CEU descent. For example, humans are of GBR descent. In one example, the selected lineage of the human is one of these listed lineages, and the TOI comprises an amino acid variation (mutation) encoded by an SNP that, according to the 1000 genomes, also resides in such a human population with an above-average cumulative frequency. For example, the ligand (e.g., the antibody or fragment) specifically binds to an IL4R protein comprising a S752A mutation, and the human is YRI-derived. In this case, both the mutation-encoding SNP and the SNP rs56069819 are present in the YRI population with an above-average cumulative frequency. This general aspect of the invention is therefore particularly suitable for individual adaptation to the genomic profiles of members of such a population.

In one example, the ligand specifically binds to the human PCSK9 form f.

In one example, human expresses a human PCSK9 selected from the forms: f, e, p and aj.

In one example, the human is ASW, LWK, YRI, CEU, or GBR descent.

In one example, the human is of ASW descent and the human expresses a human PCSK9 selected from the forms: f, e, p and aj; optionally, the ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one example, the human is of LWK descent and the human expresses a human PCSK9 selected from the forms: f, e, p and aj; optionally, the ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one example, the human is of YRI descent and the human expresses a human PCSK9 selected from the forms: f, e, p and aj; optionally, the ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one example, the human is of CEU descent and the human expresses a human PCSK9 selected from the forms: f, e, p and aj; optionally, the ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one example, the human is of GBR descent and the human expresses a human PCSK9 selected from the forms: f, e, p and aj; optionally, the ligand comprises a VH domain derived from the recombination of human VH3-23 * 04.

In one example, the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29, 32, 34, and 36, wherein the antibody or fragment specifically belongs to a human PCSK9 selected from the forms: f, e, p or aj, wherein the antibody or fragment comprises a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment comprises a nucleotide sequence comprising SEQ ID NO: 39 or its complement. In one example, the VH gene segment is VH3-23 * 04 (SEQ ID NO: 38).

In one example, the ligand is alirocumab.

According to other embodiments, as explained in more detail above, the invention provides ligands tailored individually to the genotype and / or phenotype of the human recipient based on alternative human VH gene segments or gene segments of Vκ, Vλ or constant regions (see also Table 8 for representative variants).

For example, the ligand of the invention comprises or consists of an antibody comprising a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the V H gene segment is selected from the group consisting of (i) IGHV1-18 * 01 and the human genome comprises a human IGHV1-18 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains resulting from the recombination of human IGHV1-18 * 01 derived; or (ii) IGVH1-46 * 01 and the human genome comprises a human IGHV1-46 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGHV1-46 * 01.

For example, the ligand of the invention comprises or consists of an antibody comprising a VL domain derived from the recombination of a human VL gene segment and a human JL gene segment, wherein the VL gene segment is selected from the group consisting of ( i) IGKV4-1 * 01 and the human genome comprises a human IGKV4-1 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGKV4-1 * 01; (ii) IGLV2-14 * 01 and the human genome comprises a human IGLV2-14 * 01 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGLV2-14 * 01; or (iii) IGKV1-13 * 02 and the human genome comprises a human IGKV1-13 * 02 nucleotide sequence or the human expressing antibodies comprising variable domains derived from the recombination of human IGKV1-13 * 02.

For example, the inventor identified the possibility of addressing the rarer IGH-gamma-1 SNPs 204D (observed at a cumulative frequency of 0.296) and 206L (as observed with a cumulative frequency of 0.283) individually or in combination. These residues are part of the CH3 domain and as such form part of the Fc regions of the antibody. Balancing these CH3 variations with the patient is therefore of particular use for the reasons discussed above. Thus, the inventive In this example, an antibody comprises or consists of an antibody comprising a human gamma-1 heavy chain constant region corresponding to an Asp, position 204 of SEQ ID NO: 42, or a Leu, position 206 of SEQ ID NO : 42 corresponds, includes; and wherein the human genome comprises a heavy gamma-1 heavy chain constant region sequence encoding an Asp or Leu, or human expressing antibodies comprising human gamma-1 chain constant regions comprising such an Asp or Leu include. An example of such a ligand is alirocumab.

In another example, the inventor identified the possibility of targeting IGH gamma 2 SNPs. This included consideration of the variation of the Fc region - in this regard, the inventor focused on positions 161 and 257 located in the Fc region. Thus, in this example, the ligand of the present invention comprises or consists of an antibody comprising a human gamma 2 heavy chain constant region comprising an amino acid selected from the group consisting of a pro corresponding to position 72 of SEQ ID NO: 44 , an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala to position 257 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such a selected amino acid, or human expressing antibodies comprising human gamma 2 chain constant regions comprising such a selected one Include amino acid. An example of such a ligand is evolocumab or bococizumab.

In another example, the inventor treats the variation of the human kappa chain constant region. Thus, in this example, the ligand of the present invention comprises or consists of an antibody comprising a human kappa light chain constant region corresponding to a Val corresponding to position 84 of SEQ ID NO: 50 or a Cys containing position 87 of SEQ ID NO: 50, includes; and wherein the human genome comprises a kappa light chain constant region nucleotide sequence encoding such a Val or Cys or a human expressing antibodies comprising such human kappa light chain constant regions comprising Val or Cys. An example of such a ligand is alirocumab or bococizumab.

In another example, the inventor treats the variation of the human lambda chain constant region. Thus, in this example, the ligand of the invention comprises or consists of an antibody comprising a human light chain constant IGLC2 * 01 region; and wherein the human genome comprises a human IGLC2 * 01 nucleotide sequence or human expresses antibodies comprising human IG light chain constant IGLC2 * 01 regions. An example of such a ligand is evolocumab.

Example 2 Determination of the specific binding of ligands according to the invention to PCSK9 variants

Method of determining binding by SPR

Antibody binding to the PCSK9 variants was determined by SPR using the ProteOn XPR36 ^™ array system (BioRad). An anti-human IgG surface (Jackson Labs 109-005-008) was prepared on a GLC biosensor chip by coupling with a primary amine. On this surface test antibodies were captured as ligands. The PCSK9 variants were used as analytes and passed over the captured antibodies at concentrations of 256 nM, 64 nM, 16 nM, 4 nM, and 1 nM. Binding curves were double referenced using buffer injection (ie, 0 nM) to remove baseline drift and injection artifacts. Regeneration of the capture surface was done with 100 mM phosphoric acid, removing the captured antibody, allowing another cycle of capture and binding. The generated binding sensorgrams were analyzed with the 1: 1 model associated with the analysis software of the ProteOn XPR36 array system. The assay was performed at 25 ° C and with 1X HBS-EP (Teknova) as running buffer.

dates

Three antibodies were tested and the binding data obtained are listed below (Table 3). The antibodies 316P and 31H4 are in US20110065902A1 Published antibodies (the sequences of these antibodies and their variable domains are incorporated herein by reference for possible use in the present invention and possible inclusion in the claims). The antibody 316P comprises heavy chain variable domains derived from the Derive recombination of human VH3-23 * 04 and JH2 * 01 (with a D), and light chain variable domains derived from the recombination of human Vκ4-1 * 01 and Jκ2 * 01.

Evolocumab includes a human heavy IGHG2 * 01 chain and a human light IGLC2 * 01 lambda chain derived from the recombination of human IGHV1-18 * 01 and IGHJ6 * 01 (with a D-segment) and a Vλ derived from VH from the recombination of human IGLV2-14 * 01 and IGLJ2 * 01. Table 3: Determination of ligand binding specificity for PCSK9 variants by SPR Variant / antibody ka (1 / M) kd (1 / s) KD (nM) PCSK9 a 316P 1,37E + 06 2,75E-04 0.201 31H4 1,14E + 06 6,38E-05 0.056 evolocumab 1,14E + 05 2,62E-05 0.229 PCSK9 a ' 316P 1,50E + 06 2,72E-04 0,181 31H4 1.23E + 06 6,06E-05 0,049 evolocumab 1,24E + 05 2,29E-05 0.185 PCSK9 c 316P 1,49E + 06 2,75E-04 0.184 31H4 1,22E + 06 5,69E-05 0.047 evolocumab 1,20E + 05 2,20E-05 0.183 PCSK9 r 316P 1,40E + 06 2,76E-04 0.197 31H4 1,15E + 06 5,82E-05 0,051 evolocumab 1,16E + 05 2,67E-05 0.230 PCSK9 f 316P 1,39E + 06 2,82E-04 0,203 31H4 1.13e + 06 5,95E-05 0.053 evolocumab 1,16E + 05 2,66E-05 0.229 PCSK9 p 316P 1,39E + 06 2,73E-04 0.196 31H4 1,14E + 06 6,12E-05 0.054 evolocumab 1,14E + 05 2,50E-05 0.219

Results

The results showed that all antibodies tested bound equally to PCSK9 variants, with observed binding variations within the experimental error accounting for such high affinity interaction.

• 1. Ein Antikörper (z. B. 316P oder Alirocumab), der variable Domänen der schweren Kette umfasst, die sich aus der Rekombination von humanem IGHV3-23*04 und IGHJH2*01 (mit einem D) ableiten, und variable Domänen der leichten Kette, die sich aus der Rekombination von humanem IGKV4-1*01 und IGKJ2*01 ableiten; oder
• 2. Ein Antikörper (z. B. Evolocumab), der variable Domänen der humanen schweren Kette umfasst, die sich aus der Rekombination von humanem IGHV1-18*01 und IGHJ6*01 (mit einem D-Segment) ableiten, und variable Domänen der leichten Kette, die sich aus der Rekombination von humanem IGLV2-14*01 und IGLJ2*01 ableiten.

The invention thus states that an antibody having the following profile can specifically bind one or more variants of the invention:

• 1. An antibody (eg, 316P or alirocumab) comprising heavy chain variable domains derived from the recombination of human IGHV3-23 * 04 and IGHJH2 * 01 (with a D) and variable domains of the light chain Chain derived from the recombination of human IGKV4-1 * 01 and IGKJ2 * 01; or
• 2. An antibody (eg, evolocumab) comprising human heavy chain variable domains derived from the recombination of human IGHV1-18 * 01 and IGHJ6 * 01 (with a D-segment) and variable domains of the human heavy chain light chain derived from the recombination of human IGLV2-14 * 01 and IGLJ2 * 01.

According to the invention, therefore, the skilled person will be able to determine the specific binding of the ligand to PCSK9 variants. Applications of this provision are found above within the scope of the methods and other aspects of the invention.

References:

The references cited herein are hereby incorporated by reference in their entirety part of the present application.

• 1) Horton et al, Trends Biochem Sci. Feb. 2007; 32 (2): 71-7. Epub Jan. 9, 2007, Molecular biology of PCSK9: its role in LDL metabolism ,
• 2) Seidah and Prat, J Mol Med (Berl). Jul. 2007; 85 (7): 685-96. Epub March 10, 2007, The proprotein convertases are potential targets in the treatment of dyslipidemia ,
• 3) Benjannet et al, J Biol Chem. Nov. 19, 2004; 279 (47): 48865-75. Epub Sept. 9, 2004, NARC-1 / PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol ,
• 4) Lagace et al, J Clin Invest. Nov. 2006; 116 (11): 2995-3005, Secreted PCSK9 decreases the number of LDL receptors in hepatocytes and in universes of parabiotic mice ,
• 5) Maxwell et al, Proc Natl Acad Sci USA. Feb 8, 2005; 102 (6): 2069-74. Epub Jan. 27, 2005, Overexpression of PCSK9 accelerates the degradation of the LDLR in a post-endoplasmic reticulum compartment ,
• 6) Park et al, J Biol Chem. Nov. 26, 2004; 279 (48): 50630-8. Epub 22 Sept. 2004, Post-transcriptional regulation of low-density lipoprotein receptor protein by proprotein convertase subtilisin / kexin type 9a in mouse liver ,
• 7) Rashid et al, Proc Natl Acad Sci USA. April 12, 2005; 102 (15): 5374-9. Epub April 1, 2005, Decreased plasma cholesterol and hypersensitivity to statins in mice varnishing Pcsk9 ,
• 8th) Kotowski et al., Am J Hum Genet. March 2006; 78 (3): 410-22. Epub Jan. 20, 2006, A spectrum of PCSK9 contributes to plasma levels of low-density lipoprotein cholesterol ,
• 9) Chen et al, J. Am Coll Cardiol. May 17, 2005; 45 (10): 1611-9. Epub April 21, 2005, A common PCSK9 haplotype, encompassing the E670G coding single nucleotide polymorphism, is a novel genetic marker for plasma low-density lipoprotein cholesterol levels and severity of coronary atherosclerosis ,
• 10) Pisciotta et al., Atherosclerosis. June 2006; 186 (2): 433-40. Epub Sept. 23, 2005, Additive effect of mutations in LDLR and PCSK9 genes on the phenotype of familial hypercholesterolemia ,
• 11) Zhao et al., Am J Hum Genet. Sept. 2006; 79 (3): 514-23. Epub July 18, 2006, Molecular characterization of loss-of-function mutations in PCSK9 and identification of a compound heterozygote ,
• 12) Seidah et al, Proc Natl Acad Sci USA. Feb. 4, 2003; 100 (3): 928-33. Epub Jan. 27, 2003, The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation ,

Table 4: HUMAN POPULATIONS OF THE 1000 GENOME PROJECT Below is a summary of the ethnic populations according to the sequences of the 1000 Genome Project.

Table 7: Exemplary anti-PCSK9 antibodies and / or antibody fragments useful in any and all aspects of the invention

Table 9: OTHER SEQUENCES

STATEMENT OF THE INVENTION

• An antibody or antibody fragment for use in modifying cholesterol levels or maintaining a previously modified cholesterol level in a human in need thereof, the antibody comprising a VH domain obtained by recombination of a human VH gene segment, a human D gene segment, and a human JH gene segment, wherein the human VH segment comprises a valine at the amino acid corresponding to position 5 of SEQ ID NO: 40, and the antibody specifically to an amino acid sequence of the proprotein convertase subtilisin / kexin type 9 (PCSK9 ) comprising a C-terminal domain comprising a R46L, A53V, N425S, A443T, I474V, Q619P or E670G mutation (for example, an I474V, E670G, N425S or Q619P mutation) in SEQ ID NO: 1, wherein the Human comprises a nucleotide sequence coding for the amino acid sequence and a VH gene segment coding for backbone 1 of SEQ ID NO: 40.
• 2. A method for modifying cholesterol level or maintaining a previously modified cholesterol level in a human in need thereof, comprising administering to said human an antibody or fragment thereof, the antibody comprising a VH domain produced by recombination of a human VH antibody. Gene segment, a human D gene segment and a human JH gene segment is obtained, wherein the human VH segment comprises a valine at the amino acid corresponding to the position 5 of SEQ ID NO: 40, and the antibody specifically to an amino acid sequence of Proprotein convertase subtilisin / kexin type 9 (PCSK9) which comprises a C-terminal domain containing a mutation R46L, A53V, N425S, A443T, I474V, Q619P or E670G (for example a mutation I474V, E670G, N425S or Q619P) in SEQ ID NO: 1, wherein the human encodes a nucleotide sequence coding for the amino acid sequence and a VH gene segment coding for the parent t 1 of SEQ ID NO: 40 encoded.
• 3. The antibody or antibody fragment according to statement 1 or method according to statement 2, wherein the VH domain is formed by recombination of the human VH gene segment VH3-23 * 04 of SEQ ID NO: 39 and a human D segment and a human JH Segments is won.
• 4. The antibody or antibody fragment or method of any one of the preceding statements, wherein the human VH gene segment is VH3-23 * 04 of SEQ ID NO: 39.
• 5. The antibody or antibody fragment or method of any one of the preceding statements, wherein the antibody comprises a VH domain, wherein the VH domain comprises the backbone 1 sequence of SEQ ID NO: 40.
• 6. The antibody or antibody fragment or method of any one of the preceding claims, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having a mutation E670G in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 30.
• 7. The antibody or antibody fragment or method of any preceding statement, comprising the step of determining that the human comprises the nucleic acid sequence encoding a PCSK9 comprising a C-terminal domain comprising an E670G mutation, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising a E670G mutation, wherein the detecting step is optionally performed prior to administration of the antibody to a human.
• 8. The antibody or antibody fragment or method of statement 7, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1 includes.
• 9. The antibody or antibody fragment or method of statement 8, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides which can specifically hybridize to and identify with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the mutation E670G in SEQ ID NO: 1, or specific with an antisense sequence of this sequence hybridizing, wherein the nucleic acid hybridizes with at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or hybridizing with an antisense sequence to form a complex when at least one nucleotide sequence coding for the PCSK9 encodes the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1 or an antisense sequence of these consecutive nucleotides wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9 encoding the C -terminal domain comprising the E670G mutation in SEQ ID NO: 1; and determining the presence or absence of the complex, wherein determining the presence of the complex determines that the human comprises PCSK9 comprising the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1.
• 10. The antibody or antibody fragment or method of claim 8, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or the assay done in a multiplex format.
• 11. The antibody or antibody fragment or method of any one of the preceding claims, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially free of statin is resistant to statin treatment.
• 12. The antibody or antibody fragment or method of any one of the preceding claims, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 13. The antibody or antibody fragment or method of statement 11 or 12, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 14. The antibody or antibody fragment or method of any of claims 8-10, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 15. The antibody or antibody fragment or method of any one of the preceding claims, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising an E670G mutation, wherein the human optionally further comprises the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising an E670G mutation in SEQ ID NO: 1.
• 16. The antibody or antibody fragment or method of any one of the preceding claims, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, hypolipoproteinemia, hypolipidemia, hypocholesterolaemia, a heart attack, a stroke, coronary heart disease , Atherosclerosis, peripheral vascular disease, claudication and hypertension was diagnosed.
• 17. The antibody or antibody fragment or method of any one of the preceding claims, wherein the antibody or antibody fragment comprises at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, hypolipoproteinemia, hypolipidemia, hypocholesterolaemia, a heart attack Stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension are treated in this person or the risk of such a condition is reduced.
• 18. The antibody or antibody fragment or method of any one of the preceding statements, wherein the nucleotide sequence is SEQ ID NO: 30.
• 19. The antibody or antibody fragment or method of any one of the preceding claims, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.
• 20. The antibody or antibody fragment or method of any one of the preceding statements, wherein the mutation is I474V, E670G, N425S and / or Q619P and the antibody or antibody fragment is for reducing cholesterol levels or maintaining a previously reduced one For example, the cholesterol level is for use in the treatment of hyperlipidemia, or the method is a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol, for example, a method of treating hyperlipidemia.
• 21. The antibody or antibody fragment or method of any one of claims 1 to 19, wherein the mutation is R46L, A53V and / or A443T, and the antibody or antibody fragment is for increasing cholesterol or maintaining a previously elevated level For example, the cholesterol level is for use in the treatment of hypolipidemia, or the method is a method of increasing cholesterol levels or maintaining a previously elevated level of cholesterol, for example, a method of treating hypolipidemia.
• 22. The antibody or antibody fragment or method of any one of claims 1 to 20, wherein the mutation is I474V and / or E670G in SEQ ID NO: 1.
• 23. The antibody or antibody fragment or method of any one of claims 1 to 20 or 22, wherein the mutation is I474V in SEQ ID NO: 1.
• 24. The antibody or antibody fragment or method of any one of claims 1 to 20 or 22, wherein the mutation is E670G in SEQ ID NO: 1.
• 25. The antibody or antibody fragment or method of any one of claims 1 to 20, wherein the mutation is N425S in SEQ ID NO: 1.
• 26. The antibody or antibody fragment or method of any one of claims 1 to 20, wherein the mutation is Q619P in SEQ ID NO: 1.
• 27. The antibody or antibody fragment or method of any one of claims 1 to 19 and 21, wherein the mutation is R46L in SEQ ID NO: 1.
• 28. The antibody or antibody fragment or method of any one of claims 1 to 19 and 21, wherein the mutation is A53V in SEQ ID NO: 1.
• 29. The antibody or antibody fragment or method of any one of claims 1 to 19 and 21, wherein the mutation is A443T in SEQ ID NO: 1.

Further statements of the invention

• 1. A method of treating or preventing a disease or condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human identified as having a variant of PCSK9 protein, and / or or which has been selected to comprise a variant PCSK9 protein, wherein the method comprises administering to humans a ligand that binds the PCSK9 protein variant to treat and / or prevent the disease or condition.
• 2. The method of statement 1, wherein the PCSK9 protein variant is selected from the group consisting of the PCSK9 protein variant forms f, c, r, p, m, e, h, aj and q.
• 3. The method of statement 2, wherein the variant is mature PCSK9.
• 4. The method of statement 1, 2 or 3, further comprising assaying a human biological sample for the PCSK9 variant protein form.
• 5. A method of treating and / or preventing a disease or condition mediated by the proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by (i) a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37; and / or (ii) a nucleotide sequence encoding the catalytic domain or C-terminal domain thereof in a human that has been found to be (i) the nucleotide sequence selected from the group consisting of SEQ ID NO: 29- 37; and / or (ii) the nucleotide sequence thereof encoding the catalytic domain or the C-terminal domain of a PCSK9 protein, or which has been selected therefor, the method comprising administering to humans a ligand encoding the PCSK9 protein. Protein variant binds, for the treatment and / or prevention of the disease or the disease.
• 6. The method of statement 5, further comprising: a human biological sample for (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein.
• 7. The method of statement 6, wherein the assay comprises nucleic acid amplification and / or one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification.
• 8. The method of statement 6, wherein the examination is in a multiplex format.
• 9. The method of any one of 1-8, further comprising recovering the biological sample from the human.
• 10. The method of any one of claims 1-9, further comprising determining that the human is substantially resistant to statin treatment of the disease or condition, and / or selecting the human to do so.
• 11. The method of any one of 1-10, wherein the ligand is selected from an antibody, a portion of an antibody, an antibody fragment or an affibody.
• 12. The method of statement 11, wherein the ligand is an antibody or antibody fragment specific to a human PCSK9 selected from the forms f, c, m, e, h, p, q, and aj wherein the antibody or antibody fragment comprises a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment comprises a nucleotide sequence, the SNP rs56069819 (SEQ ID NO: 41).
• 13. The ligand of statement 12, wherein the VH gene segment is VH3-23 * 04.
• 14. The method of any one of claims 1-13, wherein the administration further comprises administering a statin to a human.
• 15. The method of any one of claims 1-14, wherein the ligand and the statin are administered separately or simultaneously.
• 16. The method of any of 1-15, wherein the biological sample comprises human serum, blood, faeces, hair, tissue, cells, urine and / or saliva.
• 17. The method of any one of claims 1-16, wherein the human is heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the nucleotide sequence thereof, that for a catalytic domain or C-terminal domain of a PCSK9 protein.
• 18. The method of any one of 1-17, wherein the human comprises the nucleotide sequence of SEQ ID NO: 28 and / or the catalytic domain or C-terminal domain encoding sequence thereof.
• 19. The method of any one of 1-18, wherein the human is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the nucleotide sequence thereof, that for a catalytic domain or C-terminal domain of a PCSK2 protein.
• 20. The method of any one of statements 1-19, wherein if it is determined that the human comprises and / or the human is selected to include:
• a. SEQ ID NO: 29 and classified as ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU, is a ligand to humans which specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 29; or
• b. SEQ ID NO: 30 and classified as ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU, is a ligand to humans which specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 30; or
• c. SEQ ID NO: 32 and classified as ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU descent, is administered to humans a ligand specific for this variant of PCSK9 protein which comprises a variant encoded by SEQ ID NO: 32; or
• d. SEQ ID NO: 33 and classified as LWK, ASW, YRI or CLM descent, is administered to humans a ligand that specifically binds this PCSK9 protein variant comprising a variant encoding SEQ ID NO: 33 becomes; or
• e. SEQ ID NO: 34 and classified as LWK, ASW or YRI descent, is administered to humans a ligand that specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 34; or
• f. SEQ ID NO: 35 and classified as PUR, TSI, FIN or CEU derived from administering to humans a ligand specifically binding that PCSK9 protein variant comprising a variant encoding SEQ ID NO: 35 becomes; or
• G. SEQ ID NO: 36 and classified as LWK, ASW or YRI descent, the human being administered a ligand which specifically binds this PCSK9 protein variant comprising a variant encoded by SEQ ID NO: 36; or
• H. SEQ ID NO: 37 and classified as CHS, ASW, JPT, PUR or CHB descent, the human is administered a ligand which specifically binds this PCSK9 protein variant comprising a variant represented by SEQ ID NO : 37 is coded.
• 21. The method of any of statements 1-19, wherein if it is determined that the human comprises and / or the human is selected to include:
• a. PCSK9 protein form f and classified as ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU, a ligand is administered Specifically, the PCSK9 protein form f over a period of time and in an amount sufficient for the treatment and / or prevention of the Illness or condition in which a human being treats and / or prevents the disease or suffering in the human being; or
• b. PCSK9 protein form c, and classified as ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU, a ligand is administered specifically, binding the PCSK9 protein form c over a period of time and in an amount sufficient for the treatment and / or prevention of the disease or condition in the human thereby treating and / or preventing the disease or condition in the human; or
• c. PCSK9 protein form p, and classified as ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU, a ligand is administered which specifically transcribes the PCSK9 protein form p a period of time and in an amount sufficient for the treatment and / or prevention of the disease or condition in the human thereby treating and / or preventing the disease or condition in the human; or
• d. PCSK9 protein form m, and classified as LWK, ASW, YRI or CLM lineage, is administered a ligand that specifically provides the PCSK9 protein form m for a period of time and in an amount sufficient for the treatment and / or prevention of the Illness or condition in which a human being treats and / or prevents the disease or suffering in the human being; or
• e. PCSK9 protein form e, and classified as LWK, ASW or YRI descent, is administered a ligand that specifically delivers the PCSK9 protein form e over a period of time and in an amount sufficient for the treatment and / or prevention of the disease or disease Suffering in which human beings bind, whereby the illness or suffering in the human being is treated and / or prevented; or
• f. PCSK9 protein form h, and classified as PUR, TSI, FIN or CEU, a ligand is administered which specifically harbors the PCSK9 protein form h for a period of time and in an amount sufficient for the treatment and / or prevention of the Illness or condition in which a human being treats and / or prevents the disease or suffering in the human being; or
• G. PCSK9 protein form aj and classified as LWK, ASW or YRI descent, is administered a ligand that specifically produces the PCSK9 protein form aj for a period of time and in an amount sufficient for the treatment and / or prevention of the disease or disease Suffering in which human beings bind, whereby the illness or suffering in the human being is treated and / or prevented; or
• H. PCSK9 protein form q, and classified as CHS, ASW, JPT, PUR or CHB lineage, is administered a ligand that specifically produces the PCSK9 protein form q over a period of time and in an amount sufficient for treatment and / or or prevention of the disease or condition in the human, thereby treating and / or preventing the disease or condition in the human.
• 22. The method of any one of 1-21, wherein the ligand is capable of specifically binding the PCSK9 protein variant or a nucleic acid encoding the PCSK9 protein variant.
• 23. The method of any of statements 1-21, wherein the ligand specifically binds two or more human PCSK9 protein variants or fragments thereof selected from the group consisting of SEQ ID NOs: 4-27.
• 24. The method of statement 23, wherein the ligand specifically binds two or more human PCSK9 proteins or fragments thereof, wherein at least one of the protein fragments comprises an amino acid sequence selected from SEQ ID NOs: 4-14, 18-23, 26 and 27.
• 25. The method of any one of statements 4 and 6-23, wherein the human PCSK9 protein assayed in the sample is in the mature form.
• 26. The method of any one of statements 4 and 6-24, wherein the human PCSK9 protein assayed in the sample is in the pro-form.
• 27. The method of statement 1-26, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 28. A kit for genotyping a proprotein convertase subtilisin / kexin type 9 (PCSK9) gene variant in a nucleic acid sample of a human suffering from or at risk of developing a PCSK9-mediated disease, the kit comprising
• a. at least one nucleic acid probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NOs: 29-37 and the sequence thereof encodes a catalytic domain or the C-terminal domain of a PCSK9 protein, or which can specifically hybridize with and identify an antisense sequence of the nucleotide sequence in the biological sample, wherein the nucleic acid probe hybridizes to at least one nucleotide present in the selected sequence is but not in SEQ ID NO: 28 or an antisense sequence thereof; and or
• b. at least two nucleic acid probes comprising at least two sequences each comprising at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence of these contiguous nucleotides, at least one of the oligonucleotide probes comprising at least one Nucleotide present in the selected nucleotide sequence, but not in SEQ ID NO: 28 or an antisense sequence thereof, and
• c. optionally at least one of the following: one or more buffers, packages, labels and / or instructions for PCSK9 genotyping in a biological sample comprising nucleic acids from a human.
• 29. The kit of claim 28, wherein the nucleic acid probe is bound to a solid surface.
• 30. The kit of any of statements 28-29, further comprising a detectable label attached to the nucleic acid probe.
• 31. A kit for phenotyping proprotein convertase subtilisin / kexin type 9 (PCSK9) protein in a biological sample, said kit comprising a plurality of antibodies or parts or fragments of antibodies, said antibody or antibody fragment or part of said antibody Each antibody specific for a PCSK9 protein variant selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof, or which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3; and optionally at least one of the following: one or more buffers, packages and / or labels or instructions or a label for PCSK9 phenotyping in a biological sample comprising human PCSK9.
• 32. The kit of statement 31, which further includes a statin.
• 33. A pharmaceutical composition comprising a ligand capable of producing proprotein convertase subtilisin / kexin type 9 (PCSK9) variants selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or peptide thereof specifically comprising an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3.
• 34. The pharmaceutical composition of statement 33, wherein the ligand is an antibody, a portion of an antibody, an antibody fragment or an affibody specific for the PCSK9 variant selected from the group consisting of the forms f, c, r, p , m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof, which comprises an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3.
• 35. The pharmaceutical composition according to any one of statements 33-34, further comprising a statin.
• 36. The pharmaceutical composition of statement 35, wherein the statin is atorvastatin.
• 37. A drug delivery system comprising the pharmaceutical composition of statement 33 or 34 and an injection or IV device.
• 38. A kit comprising the pharmaceutical composition of statement 33, packaging and instructions or labels for administration of the ligand to a human suffering from or at risk of developing a disease or condition related to PCSK9 Suffering, wherein the human expresses a PCSK9 variant protein form, which is selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide from that.
• 39. The kit of claim 38, wherein the instructions or label are for administration with a statin and / or to a human being indicated to have statin treatment or who has been administered a statin or who has a reduced response to statin treatment ,
• 40. The kit of claim 38 or 39, wherein it has been established that the human is resistant to treatment with statins and / or the human has been selected to be resistant to treatment with statins.
• 41. The kit according to statement 39 or 40, wherein the instructions or the label indicate administration to a human having received statin, and further instruct the instruction to reduce the administration of statin to the human.
• 42. The kit of claim 38, further comprising at least one buffer, packaging and / or instructions or label for PCSK9 genotyping in a human-derived biological sample.
• 43. The kit of claim 38, wherein the label includes a drug approval number issued by an approval authority.
• 44. The kit according to statement 43, with the approval authority selected from FDA and EMA.
• 45. The kit of claim 38, wherein the label or instructions further include instructions for administering alirocumab or evolocumab to a human.
• 46. The kit of any of claims 38-45, further comprising an IV or injection device, optionally comprising alirocumab or evolocumab.
• 47. A kit for the treatment and / or prevention of a disease or condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human identified as having a variant PCSK9 protein, and / or selected as such, wherein the Kit (a) alirocumab or evolocumab in a sealed container; and (b) a label or instructions that demonstrate administration of alirocumab or evolocumab to a human having a PCSK9 protein variant form selected from the group consisting of forms f, c, r , p, m, e, h, aj and q or a catalytic or C-terminal domain or peptide expressed therefrom.
• 48. The kit according to statement 47, the label further showing that, if statin has been or is being administered to a person, statin treatment should be continued.
• 49. The kit of statement 47, the label further showing that, if statin has been or is being administered to a person, statin treatment should be reduced or stopped.
• 50. A method for the treatment and / or prevention of a disease and / or a condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human, the method comprising
• c. examining a human biological sample for the presence of one or more PCSK9 protein variants selected from the group consisting of PCSK9 forms f, c, r, p, m, e, h, aj and q; and
• d. the administration to humans of a therapeutically effective amount of a human PCSK9 binding ligand when one or more of the PCSK9 forms f, c, r, p, m, e, h, aj and q is detected.
• 51. The method of statement 50, wherein the ligand specifically binds one or more of the PCSK9 forms f, c, r, p, m, e, h, aj, and q.
• 52. A method of treating or preventing a disease or condition mediated by proprotein convertase subtilisin / kexin type 9 (PCSK9) in a human, the method comprising
• a. assaying a human biological sample for the presence of one or more PCSK9 nucleic acid variants selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof; and
• b. the administration to humans of a therapeutically effective amount of a human PCSK9 binding ligand when one or more of the PCSK9 nucleic acid variants are detected.
• 53. The method of statement 52, wherein the ligand specifically binds one or more of the PCSK9 forms f, c, r, p, m, e, h, aj and q.
• 54. A method of selecting a human for the treatment and / or prevention of a disease mediated by a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein with a human PCSK9 binding ligand, comprising:
• a. examining a biological sample taken from a human for the presence of a PCSK9 protein variant selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q; and
• b. human selection for treatment with the human PCSK9 binding ligand when at least one of the PCSK9 protein variants selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q is detected.
• 55. The method of statement 54, wherein the human is indicated for statin treatment or has been administered statin to the human.
• 56. The method of statement 54 or 55, wherein the human has been identified as being substantially resistant to statin treatment or shows a reduced response to statin treatment.
• 57. The method of any one of claims 54-56, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 58. The method of any one of claims 54-57, wherein the administered human PCSK9 binding ligand is specific for the detected PCSK9 form.
• 59. The method of any one of claims 54-58, wherein the PCSK9 protein form comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 4-27.
• 60. The method of any one of claims 54-59, wherein the PCSK9 protein form comprises the mature PCSK9 form.
• 61. An assay for selecting a human suffering from a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein-mediated disease or condition as appropriate for treatment with a human PCSK9-binding ligand, the method comprising includes
• d. contacting a biological sample from the human with at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides that can specifically hybridize to and identify a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NO Or at least the sequence coding for the catalytic domain or the C-terminal domain thereof, or specifically with an antisense Sequence of the sequence hybridizes, wherein the nucleic acid hybridizes with at least one nucleotide present in the selected sequence, but not present in SEQ ID NO: 28, or hybridized with an antisense sequence and thus forms a complex, if at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof; and or
• e. proof of the presence or absence of the complex; and
• f. human selection as appropriate for treatment with the human PCSK9 binding ligand, if the presence of at least one complex comprising a PCSK9 form encoded by SEQ ID NO: 29-37, or those for the catalytic domain or C-terminal Domain coding sequence thereof is detected.
• 62. An assay for selecting a human suitable for treatment with a human proprotein convertase subtilisin / kexin type 9 (PCSK9) binding ligand, the method comprising
• a. contacting a biological sample from a human with a PCSK9 mediated disease or condition with one or more antibodies, portions of antibody or antibody fragments capable of producing a PCSK9 variant form selected from the group consisting of the PCSK9 forms f to bind c, r, p, m, e, h, aj and q to form a complex when one or more PCSK9 forms f, c, r, p, m, e, h, aj and q are present;
• b. proof of the presence or absence of the complex; and
• c. human selection as appropriate for treatment with the human PCSK9 binding ligand if the presence of at least one complex comprising the PCSK9 form f, c, r, p, m, e, h, aj and q is detected.
• 63. The method of statement 61 or 62, wherein the disease is selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 64. The assay of any one of claims 61-63, wherein the human PCSK9 binding ligand is specific for the detected PCSK9 form.
• 65. The assay of any one of claims 61-64, further comprising amplifying nucleic acids from the biological sample.
• 66. The assay of any one of claims 61-65, further comprising isolating nucleic acids from the biological sample.
• 67. The assay of any one of claims 61-66, further comprising administering the PCSK9 binding ligand to a human.
• 68. A method of producing an anti-human pro-protein convertase subtilisin / kexin type 9 (PCSK9) antibody binding site, the method comprising obtaining a plurality of anti-PCSK9 antibody binding sites, screening the antibody binding sites for binding to a selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q human PCSK9 or a catalytic or C-terminal domain or a peptide thereof, the or an amino acid variation of the corresponding to SEQ ID NO: 1, 2 or 3, and isolating an antibody binding site which binds in the screening step, and optionally producing a form f, c, r, p, m, e, h, aj or q of PCSK9 binding fragment or derivative of the isolated antibody.
• 69. A method of producing an anti-human pro-protein convertase subtilisin / kexin type 9 (PCSK9) antibody, which method comprises immunizing a non-human vertebrate with a human PCSK9 having an amino acid sequence selected from the group consisting of the amino acid sequences of the Forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and isolating an antibody directed to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a Peptide thereof which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and optionally producing a form f, c, r, p, m, e, h, aj or q of PCSK9 binding fragment or derivative of the isolated antibody.
• 70. The method of claims 68-69, wherein the non-human vertebrate is a mouse or a rat.
• 71. The method of any of claims 68-70, comprising the step of recovering a nucleic acid encoding the antibody, fragment, derivative or binding site, and optionally inserting the nucleic acid into an expression vector.
• 72. A proprotein convertase kit Subtilisin / Kexin type 9 (PCSK9) genotyping of a human, said kit comprising a nucleic acid comprising (i) a sequence of contiguous nucleotides specifically hybridizing to a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or at least the catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridizing to an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes to at least one nucleotide, which is present in the selected sequence but is not present in SEQ ID NO: 28 or hybridizes with an antisense sequence or an RNA transcript thereof; and / or (ii) comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or comprises an antisense sequence or RNA version of these contiguous nucleotides, wherein the sequence of contiguous nucleotides is at least a nucleotide present in the selected sequence but not present in SEQ ID NO: 28.
• 73. A Proprotein Convertase Kit Subtilisin / Kexin Type 9 (PCSK9) genotyping or phenotyping of a human, the kit comprising a ligand antibody linked to a human PCSK9 selected from the group consisting of forms f, c, r, p , m, e, h, aj and q or a catalytic or C-terminal domain or peptide thereof, which includes an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, or an antibody Fragment or derivative produced by the method of any of statements 68-71.
• 74. A method for targeting a proprotein convertase subtilisin / kexin type 9 (PCSK9) for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition in a human, the method comprising administering an anti-PCSK9 ligand to a human Comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37, wherein is targeted to a coded by the nucleotide sequence PCSK9.
• 75. The method of statement 74, wherein the method comprises targeting a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q with the ligand for treatment and / or prevention illness or disease in humans.
• 76. A method for the treatment and / or prevention of a proprotein convertase subtilisin / kexin type 9 (PCSK9) mediated disease or a PCSK9 mediated disease in a human, the method comprising targeting a human PCSK9 selected from the group consisting of forms f , c, r, p, m, e, h, aj, and q, by administering to humans a ligand that binds PCSK9, thereby treating and / or preventing the disease or condition in humans.
• 77. The method of statement 76, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.
• 78. The method of any of statements 74 to 77, wherein the human has been genotyped as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof; becomes.
• 79. The method of any one of statements 74 to 78, wherein human is or has been phenotyped as positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj, and q ,
• 80. The method of any one of statements 74-79, wherein the method comprises genotyping the human as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence it was or will be genotyped.
• 81. The method of any one of statements 74-80, wherein the method comprises human phenotyping as positive for a human PCSK9 sequence selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q includes.
• 82. The method of any one of statements 74 to 81, wherein the human is or has been genotyped as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof; wherein the human optionally as the nucleotide sequence of SEQ ID NO: 28 or the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or for the catalytic or C-terminal Domain encoding sequence thereof has been or will be genotyped.
• 83. The method of any of statements 74 to 82, wherein the human genome is genotyped as homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or the catalytic or C-terminal domain encoding sequence thereof became or becomes.
• 84. The method of any one of statements 74 to 83, the method comprising human genotyping for a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof prior to administration of the ligand to human, it being found that the ligand is capable of binding to a PCSK9 encoded by the selected sequence.
• 85. The method of any of claims 74 to 84, further comprising administering to a human the ligand and a statin (eg, atorvastatin).
• 86. The method of claim 85, wherein the ligand and the statin are administered separately.
• 87. The method of claim 85, wherein the ligand and the statin are administered concomitantly.
• 88. The method of any one of statements 74 to 87, wherein the ligand is administered by subcutaneous injection.
• 89. A method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a person in need thereof, comprising:
• a. selecting a human having (i) a proprotein convertase subtilisin / kexin type 9 (PCSK9) nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein; and
• b. the administration of an antibody or antibody fragment that specifically binds one or more PCSK9 amino acid sequences encoded by the nucleotide sequence that resides in the human to that human.
• 90. The method of statement 89, wherein step (a) comprises selecting a human comprising a PCSK9 protein encoded by the nucleotide sequence of (i) or (ii).
• 91. The method of statement 89 or 90, wherein the antibody or antibody fragment specifically binds the PCSK9 amino acid sequence.
• 92. The method of statement 89 or 90, wherein the antibody or antibody fragment binds a second PCSK9 protein comprising an amino acid sequence encoded by (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 ; and / or (ii) a nucleotide sequence thereof encoding the catalytic domain or C-terminal domain of a PCSK9 protein.
• 93. The method of statement 89 or 90, wherein the antibody comprises a VH domain derived from the recombination of a human VH gene segment, human D gene segments, and a human JH segment, wherein the VH gene segment comprises a nucleotide sequence which comprises a single nucleotide polymorphism with nucleotide C as shown in rs56069819 (SEQ ID NO 41).
• 94. The method of statement 93, wherein the VH gene segment is VH3-23 * 04.
• 95. The method of any of statements 89-93, wherein the antibody comprises a VH domain, wherein the VH domain comprises the backbone 1 sequence of SEQ ID NO: 38.
• 96. The method of any one of statements 89-95, wherein it has been determined that the human comprises the nucleotide sequence of (i) and / or (ii).
• 97. The method of any of statements 89-96, wherein it has been determined that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of (i) and / or (ii) ,
• The method of any of statements 89-97, comprising the step of determining that the human comprises the nucleotide sequence of (i) and / or (ii).
• 98. The method of statement 98, wherein the detecting step is performed prior to administration of the antibody to a human.
• 99. The method of any one of statements 89-99, comprising the step of determining that the human comprises a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant represented by the nucleotide sequence of (i) and / or (ii ) is encoded.
• 100. The method of claim 100, wherein the detecting step is performed prior to administration of the antibody to a human.
• 101. The method of statement 100 or 101, wherein the step of determining comprises assaying a human biological sample for (i) a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37; and / or (ii) a nucleotide sequence encoding the catalytic domain or C-terminal domain of the variant PCSK9 protein.
• 102. The method of statement 102, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides which can specifically hybridize to and identify with a nucleotide sequence in the biological sample selected from the group consisting of SEQ ID NOs: 29-37 or at least those for catalytic domain or C-terminal domain encoding sequence thereof, or specifically hybridized to an antisense sequence of the sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or hybridizing with an antisense sequence to form a complex when at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence of these contiguous nucleotides, wherein the sequence of contiguous nucleotides comprises at least one Nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 is present; and
• determining the presence or absence of the complex, determining that the human comprises the variant PCSK9 protein by detecting the presence of the complex.
• 103. The method of statement 102 or 103, wherein the assay comprises nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification.
• 104. The method of any one of statements 102-104, wherein the examination is in a multiplexed format.
• 105. The method of any of statements 102-105, further comprising recovering the human biological sample.
• 106. The method of any one of claims 89-106, wherein the human is substantially resistant to statin treatment or wherein the human has further been determined to be substantially resistant to statin treatment.
• 107. The method of any one of claims 89-107, wherein the human receives or has received statin treatment or shows decreased response to statin treatment.
• 108. The method of any of claims 89-108, further comprising administering a statin to the human.
• 109. The method of any of claims 89-108, wherein the antibody or antibody fragment and statin are administered separately or simultaneously.
• 110. The method of any of statements 106-110, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 111. The method of any one of statements 89-111, wherein the human is heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the nucleotide sequence thereof selected for the catalytic domain or C is coding for the terminal domain coding sequence of a PCSK9 protein.
• 112. The method of any one of statements 89-112, wherein the human further comprises the nucleotide sequence of SEQ ID NO: 28 and / or the catalytic domain or C-terminal domain encoding sequence thereof.
• 113. The method of any one of statements 89-113, wherein the human is homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 and / or the catalytic domain or C-terminal domain encoding sequence thereof ,
• 114. The method of any of statements 89-114, wherein the human is at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension and cardiovascular disease or cardiovascular disease.
• 115. The method of any one of statements 89-115, wherein the method comprises at least one condition selected from a disorder of lipid disorder, hyperlipoproteinemia, hyperlipidemia; dyslipidemia; Hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, type II diabetes, hypertension, and cardiovascular disease or cardiovascular disease.

Further statements of the invention

• 1. An anti-human PCSK9 ligand for use in a method of treatment and / or Prevention of a PCSK9-mediated disease or a PCSK9 mediated disease in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, which process comprises administering the ligand to a human.
• 2. The ligand of statement 1, wherein it has been established that the ligand is capable of binding a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q.
• 3. A ligand which binds a human PCSK9 comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 4-27 for use in a method comprising the step of using the ligand to target the PCSK9 in a Humans for the treatment and / or prevention of a PCSK9-mediated disease or a condition mediated by PCSK9, which method comprises administering the ligand to a human.
• 4. The ligand of statement 3, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37.
• 5. The ligand according to any one of the preceding statements, wherein the human has been or is genotyped as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain coding sequence thereof.
• 6. The ligand according to one of the preceding statements, wherein the human being positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or at least the catalytic or C -terminal domain of which has been or will be phenotyped.
• 7. The ligand of any one of the preceding claims, wherein the method comprises human genotyping as positive for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof.
• 8. The ligand according to any one of the preceding statements, wherein the method comprises human phenotyping as positive for a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or at least the catalytic domain thereof.
• 9. The ligand of any one of the preceding claims, wherein the human has been or is genotyped as heterozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain encoding sequence thereof; wherein the human optionally as the nucleotide sequence of SEQ ID NO: 28 or at least the catalytic or C-terminal domain coding sequence thereof and a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal Domain coding sequence thereof has been or will be genotyped.
• 10. The ligand according to any one of statements 1 to 9, wherein the human genome has been genotyped as homozygous for a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least the catalytic or C-terminal domain coding sequence thereof or will.
• 11. The ligand of any one of the preceding claims, wherein the ligand comprises an antibody binding site that binds a human PCSK9 that comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 4-27 and has been found to be or may be is capable of such a bond.
• 12. The ligand of claim 11, wherein the ligand is an antibody or an antibody fragment.
• 13. The ligand according to any one of claims 1 to 10, wherein (i) the ligand comprises a sequence of consecutive nucleotides specific to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least those for the catalytic domain or the C-terminal domain coding sequence thereof hybridizes, or specifically hybridizes with an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes with at least one nucleotide present in the selected sequence but not in SEQ ID NO: 28, or hybridized with an antisense sequence or an RNA transcript thereof; and / or (ii) the ligand comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or an antisense sequence or RNA version of these contiguous nucleotides, the sequence being sequential Nucleotides comprise at least one nucleotide present in the selected sequence but not in SEQ ID NO: 28.
• 14. The ligand of any preceding claim, wherein the disease or condition is hyperlipidemia, hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis or cardiovascular disease, or cardiovascular disease.
• 15. The ligand of any preceding claim, wherein the disease is associated with elevated LDL cholesterol.
• 16. The ligand of any one of the preceding claims, wherein the ligand inhibits the binding of human PCSK9 to the human LDL receptor and, optionally, it has been found that the ligand is capable of such inhibition.
• 17. The ligand of any preceding claim, wherein the human is substantially resistant to statin treatment of the disease or condition.
• 18. The ligand according to any one of the preceding claims, wherein the ligand is for use in the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human,
• (i) whose genome comprises SEQ ID NO: 29 and wherein human beings are ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU Descent is; or
• (ii) whose genome comprises SEQ ID NO: 30, and wherein human beings are ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU Descent is; or
• (iii) whose genome comprises SEQ ID NO: 32 and wherein the human is ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU ancestry; or
• (iv) whose genome comprises SEQ ID NO: 33 and wherein the human is LWK, ASW, YRI or CLM lineage; or
• (v) whose genome comprises SEQ ID NO: 34 and wherein the human is LWK, ASW or YRI derived; or
• (vi) whose genome comprises SEQ ID NO: 35 and wherein the human is PUR, TSI, FIN or CEU ancestry; or
• (vii) whose genome comprises SEQ ID NO: 36 and wherein the human is LWK, ASW or YRI derived; or
• (viii) whose genome comprises SEQ ID NO: 37 and wherein the human is CHS, ASW, JPT, PUR or CHB descent.
• 19. The ligand according to any one of the preceding claims, wherein the ligand is for use in the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease in a human,
• (i) expressing the PCSK9 form f and wherein human beings are ASW, YRI, GBR, TSI, CLM, LWK, MXL, JPT, PUR, IBS, FIN or CEU ancestry is; or
• (ii) expressing the PCSK9 form c, and wherein human beings are ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, JPT, PUR, FIN or CEU ancestry is; or
• (iii) expressing the PCSK9 form p and wherein the human is ASW, GBR, TSI, CLM, JPT, PUR, IBS, FIN or CEU; or
• (iv) expressing the PCSK9 form m and wherein the human is LWK, ASW, YRI or CLM lineage; or
• (v) expressing the PCSK9 form e and wherein the human being is LWK, ASW or YRI derived; or
• (vi) expressing the PCSK9 form h and wherein the human is PUR, TSI, FIN or CEU ancestry; or
• (vii) which expresses the PCSK9 form aj and wherein the human is LWK, ASW or YRI derived; or
• (viii) which expresses the PCSK9 form q and wherein the human is CHS, ASW, JPT, PUR or CHB descent.
• 20. The ligand according to any one of the preceding statements, wherein the ligand is an antibody or antibody fragment specific to a human PCSK9 selected from the forms: f, c, m, e, h, p, q and aj, the antibody or fragment comprising a VH domain derived from the recombination of a human VH gene segment, a human D gene segment and a human JH gene segment, wherein the VH gene segment comprises a nucleotide sequence comprising SEQ ID NO: 39 or its complement.
• 21. The ligand of statement 20, wherein the VH gene segment is VH3-23 * 04 (SEQ ID NO: 38).
• 22. The ligand of claim 20 or 21, wherein the ligand is for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition in a human having a human PCSK9 selected from the forms: f, c, m , e, h, p, q and aj are expressed.
• 23. The ligand according to any one of statements 20 to 22, wherein the ligand for treating and / or preventing a PCSK9-mediated disease or a PCSK9 mediated disease in a human ASW, LWK, YRI, CEU or GBR descent is provided.
• 24. A pharmaceutical composition or a pharmaceutical kit for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated disease (as set out, for example, in statement 15 or 16), wherein the composition or kit comprises a ligand one of the preceding statements and optionally a statin (eg atorvastatin); and, optionally, in combination with a label or instructions for use in the treatment and / or prevention of the disease or condition in a human (e.g., which covers treatment of a human, such as in statement 18 or 19); the label or instructions optionally comprising a drug approval number (eg, an FDA or EMA approval number); optionally, the label or instructions include instructions for administering alirocumab or evolocumab to a human; wherein the kit optionally comprises an IV or injection device comprising the ligand (and eg also a statin).
• 25. A method of producing an anti-human PCSK9 antibody binding site, the method comprising recovering a plurality of anti-PCSK9 antibody binding sites, screening the Antibody binding sites for binding to a human PCSK9 or a catalytic or C-terminal domain or a peptide thereof selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q; comprising an amino acid variation from the corresponding sequence of SEQ ID NO: 1, 2 or 3 and isolating an antibody binding site which binds in the screening step and optionally producing a form f, c, r, p, m, e, h , aj or q of the PCSK9 binding fragment or derivative of the isolated antibody.
• 26. A method of producing an anti-human PCSK9 antibody, the method comprising immunizing a non-human vertebrate (eg, a mouse or a rat) with a human PCSK9 having an amino acid sequence selected from the group consisting of the amino acid sequences of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C-terminal domain or a peptide thereof which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1 , 2 or 3, and isolating an antibody conjugated to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q or a catalytic or C -terminal domain or a peptide thereof, which comprises an amino acid variation of the corresponding sequence of SEQ ID NO: 1, 2 or 3, and optionally producing a form f, c, r, p, m, e, h , aj or q of the PCSK9 binding fragment or derivative s of the isolated antibody.
• 27. The method of statement 25 or 26, comprising the step of recovering a nucleic acid encoding the antibody, fragment, derivative or binding site, and optionally inserting the nucleic acid into an expression vector.
• 28. A kit for PCSK9 genotyping of a human, the kit comprising a nucleic acid comprising (i) a sequence of contiguous nucleotides that specifically hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37 or at least hybridizing the catalytic domain or C-terminal domain encoding sequence thereof, or hybridizing specifically to an antisense sequence or an RNA transcript of the sequence, wherein the sequence of consecutive nucleotides hybridizes to at least one nucleotide present in the selected sequence is present, but not present in SEQ ID NO: 28, or hybridized with an antisense sequence or an RNA transcript thereof; and / or (ii) comprises a sequence of at least 10 contiguous nucleotides of a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, or comprises an antisense sequence or RNA version of these contiguous nucleotides, wherein the sequence of contiguous nucleotides is at least a nucleotide present in the selected sequence but not present in SEQ ID NO: 28.
• 29. A kit for human PCSK9 genotyping or phenotyping, wherein the kit comprises a ligand according to any of statements 1 to 23 or an antibody, fragment or derivative produced by the method of any one of statements 25 to 27.
• 30. Use of an anti-PCSK9 ligand which binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q, in the manufacture of a medicament for the treatment and or preventing a PCSK9-mediated disease or a PCSK9-mediated condition in a human whose genome comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 29-37, optionally for the treatment and / or prevention of a PCSK9-mediated disease or a PCSK9 mediated disease in a human, as stated in statement 18 or 19.
• 31. Use of an anti-PCSK9 ligand which binds to a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q, in the manufacture of a medicament for targeting the PCSK9 in a human for the treatment and / or prevention of a PCSK9 mediated disease or a PCSK9 mediated condition, optionally for targeting PCSK9 in a human, as recited in statement 18 or 19.
• 32. The use according to statement 30 or 31, wherein the ligand, the human being, the disease or the disease according to any of the statements 1 to 19.
• 33. A method of PCSK9 genotyping a nucleic acid sample of a human, the method comprising identifying the presence of a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or the catalytic or C-terminal domain encoding sequence thereof in the Sample includes.
• 34. A method of PCSK9-typing a protein sample of a human, the method comprising identifying the presence of a human PCSK9 selected from the group consisting of the forms f, c, r, p, m, e, h, aj and q in the Sample includes.
• 35. The method of claim 33 or 34, comprising obtaining a serum, blood, faeces, hair, tissue, cell, urine or saliva sample from a human, wherein the nucleic acid or protein sample in the step is recovered and used to identify the sequence.
• 36. The method according to any one of statements 33 to 35, wherein the ligands used according to one of the statements 1 to 19 for carrying out the identification step.
• 37. A diagnostic, therapeutic or prophylactic kit comprising a ligand capable of binding to, or being capable of, an amino acid sequence selected from SEQ ID NO: 4-27 and instructions for carrying out the method according to one of the statements 34 to 36 and / or a label or instructions from which the administration of the ligand to a man as defined in one of the statements 1 to 23 or this is covered.
• 38. A diagnostic, therapeutic or prophylactic kit comprising a nucleic acid probe comprising a nucleotide sequence that specifically hybridizes to a nucleotide sequence selected from the group consisting of SEQ ID NO: 29-37 or an antisense sequence or an RNA -Transcript of it and instructions for carrying out the procedure according to statement 33, 35 or 36.

Further statements of the invention

• A. A method for reducing cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering an antibody or antibody fragment that specifically binds a proprotein convertase subtilisin / kexin type 9 (PCSK9) which has a C-terminal domain comprising a mutation I474 or E670G in SEQ ID NO: 1 comprises in said human, said antibody or fragment comprising a human gamma 2 heavy chain constant region comprising an amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val, the Position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human is (i) a gene segment of the constant IGHG2 * 01 regi or human expressing antibodies comprising human heavy gamma 2 chain constant regions corresponding to a Pro, position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO : 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• B. The method of statement A, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region comprising (i) a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn, the Position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, and optionally (ii) a Val corresponding to position 161 of SEQ ID NO: 44 and / or an Ala Position 257 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (i), or human expressing antibodies comprising human gamma 2 chain constant regions, such as Include amino acids of (i).
• C. The method of statement A or B, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region comprising (i) a Val corresponding to position 161 of SEQ ID NO: 44, and a Ala corresponding to position 257 of SEQ ID NO: 44, and optionally (ii) an amino acid selected from the group consisting of a pro corresponding to position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO : 44, and a Phe corresponding to position 76 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (i), or human expressing antibodies comprising human gamma 2 chain constant regions, such as Include amino acids of (i).
• D. The method of any one of the preceding claims, wherein the antibody or antibody fragment specifically binds to a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having a mutation I474 or E670G in SEQ ID NO: 1, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region corresponding to a Pro, position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO: 44 , a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the Human (i) a human heavy chain constant region gene segment IGHG2 * 01; and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the mutation in SEQ ID NO: 1 includes.
• E. The method of any one of the preceding claims, wherein the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• F. The method of any one of the preceding claims, comprising, prior to administration, selecting a human comprising the nucleotide sequence of (ii), wherein the human is Statement 1.
• G. The method of any one of the preceding claims, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1, and or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• H. The method of any preceding statement comprising the step of determining that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the I474V or E670G mutation and / or a proprotein convertase Subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutation I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• I. The method of statement H, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the I474V or E670G mutation in SEQ ID NO: 1 includes.
• J. The method of statement I, wherein the assay comprises contacting the biological sample with a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and / or b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the comprising the C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• K. The method of statement I, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification and / or wherein the assay is in a multiplexed format ,
• L. The method of any one of the preceding claims, wherein the human is substantially resistant to statin treatment or wherein the human has further been found to be substantially resistant to statin treatment.
• M. The method of any one of the preceding claims, wherein the human receives or has received statin treatment or shows a decreased response to statin treatment.
• N. The method of any one of the preceding claims, wherein the human is substantially resistant to statin treatment or wherein the human has further been determined to be substantially resistant to statin treatment.
• O. The method according to statement G, wherein the human receives or has received a statin treatment or shows a reduced response to a statin treatment.
• P. The method of any one of the preceding claims, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• Q. The method of statement M, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• R. The method of statement O, wherein the antibody or antibody fragment is administered to humans separately from or concurrently with statin treatment.
• S. The method of statement I, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• T. The method of any one of the preceding statements, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the mutation I474V or E670G, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the PCSK9 C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1.
• U. The method of any one of the preceding claims, wherein the human has been diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension.
• V. The method according to one of the preceding statements, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, and by the antibody or antibody fragment Hypertension is treated or the risk of such suffering in humans is reduced.
• W. The method of claim Q, wherein the human is diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, and hypertension.
• X. The method of claim Q, wherein the antibody or antibody fragment is at least one of a disorder of lipids, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, heart attack, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication, and hypertension or the risk of such suffering in humans is diminished.
• Y. The method of any one of the preceding statements, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• The method of any one of the preceding claims, wherein the antibody or antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.
• AA. The method of statement Q, wherein the antibody or antibody fragment is administered by intravenous or subcutaneous administration and / or contained in an injectable preparation.

Further statements of the invention

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region, the an amino acid selected from the group consisting of a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe, position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and the antibody specifically to a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising an I474V or E670G mutation in SEQ ID NO: 1, wherein the human comprises (i) a human heavy chain constant IGHG2 * 01 region gene segment or Human expressing antibodies comprising human gamma 2 heavy chain constant regions comprising the amino acid selected from the group consisting of a pro corresponding to position 72 of SEQ ID NO: 44, an asn, position 75 of SEQ ID NO Figure 44 corresponds to a Phe corresponding to position 76 of SEQ ID NO: 44, to a Val corresponding to position 161 of SEQ ID NO: 44, and to an Ala corresponding to position 257 of SEQ ID NO: 44, and (ii) a nucleotide sequence coding for the proprotein convertase Su btilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising mutation I474V or E670G in SEQ ID NO: 1.
• 2. The antibody or antibody fragment of statement 1, wherein the antibody or fragment comprises a human heavy gamma 2 chain constant region, which is (a) a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn which corresponds to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, and optionally (b) a Val corresponding to position 161 of SEQ ID NO: 44, and / or an Ala comprising position 257 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (a), or human expressing antibodies comprising extensive human gamma 2 chain constant regions, the include such amino acids of (a).
• 3. The antibody or antibody fragment of statement 1, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region, which comprises (c) a Val corresponding to position 161 of SEQ ID NO: 44, and a Ala corresponding to position 257 of SEQ ID NO: 44, and optionally (d) an amino acid selected from the group consisting of a pro corresponding to position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO : 44, and a Phe corresponding to position 76 of SEQ ID NO: 44; and wherein the human genome comprises a heavy gamma 2 chain constant region nucleotide sequence encoding such amino acids of (c), or human expressing antibodies comprising human gamma 2 chain constant regions, such as Include amino acids of (c).
• 4. The antibody or antibody fragment of statement 1, wherein the antibody or antibody fragment specifically binds to a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having a mutation I474V or E670G in SEQ ID NO 1, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region corresponding to a Pro, position 72 of SEQ ID NO: 44, an Asn, position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44, and wherein human (e) human heavy chain constant region IGHG2 * 01 gene segment; and (f) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) which comprises a C-terminal domain having the mutation in SEQ ID NO: 1 comprises.
• 5. The antibody or antibody fragment of any one of 1-4, wherein the antibody or fragment comprises a human heavy chain constant region IGHG2 * 01.
• 6. The antibody or antibody fragment of any one of 1-5, wherein the method comprises, prior to administration of the antibody or fragment, selecting a human comprising the nucleotide sequence of (ii), wherein the human is human after statement 1 acts.
• 7. The antibody or antibody fragment of any one of 1-6, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having the I474V or E670G mutation in SEQ ID NO 1 comprises, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• 8. The antibody or antibody fragment of any one of 1-7, wherein the method comprises the step of determining that the human comprises the nucleotide sequence that corresponds to a PCSK9 comprising a C-terminal domain containing the I474V or E670G mutation and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising mutation I474V or E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 9. The antibody or antibody fragment of claim 8, wherein the detecting step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 includes.
• 10. The antibody or antibody fragment of statement 9, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1, or which specifically hybridizes with an antisense sequence of this sequence, wherein the nucleic acid hybridizes to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 or with one Antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the I474V or E670G mutation in SEQ ID NO: 1 or an antisense sequence thereof successive nucleotides, wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9, the a C-terminal domain comprising the mutation I474V or E670G in SEQ ID NO: 1 is present; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain having the mutation I474V or E670G in SEQ ID NO: 1 includes.
• The antibody or antibody fragment of claim 9, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is in a multiplex format he follows.
• The antibody or antibody fragment of any one of claims 1-11, wherein the human is substantially resistant to statin treatment, or wherein the human has further been found to be substantially resistant to statin treatment.
• 13. The antibody or antibody fragment of any one of claims 1-12, wherein the human is receiving or has received statin treatment or has a decreased response to statin treatment.
• 14. The antibody or antibody fragment of claim 12 or 13, wherein the antibody or antibody fragment is for administration to a human separate from or concurrent with statin treatment.
• 15. The antibody or antibody fragment of any of claims 9-11, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 16. The antibody or antibody fragment of any one of 1-15, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the I474V or E670G mutation in SEQ ID NO: 1.
• 1 7. The antibody or antibody fragment of any one of 1-16, wherein the human is at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 18. The antibody or antibody fragment of any one of 1-17, wherein the antibody or antibody fragment is selected to treat at least one of a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis Peripheral vascular disease, Klaudikation and hypertension or to reduce the risk of such suffering in humans is provided.
• 19. The antibody or antibody fragment of any one of 1-18, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 20. The antibody or antibody fragment of any one of 1-19, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.

Further statements of the invention

• An antibody or antibody fragment for use in reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, the antibody comprising a VH domain obtained by recombination of a human VH gene segment, a human D gene segment, and a human JH gene segment, wherein the human VH segment comprises a valine at the amino acid corresponding to position 5 of SEQ ID NO: 40, and the antibody specifically to an amino acid sequence of the proprotein convertase subtilisin / kexin type 9 (PCSK9 ) comprising a C-terminal domain comprising a mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1, wherein the human encodes a nucleotide sequence coding for the amino acid sequence and a VH gene segment coding for the amino acid sequence Backbone 1 encoded by SEQ ID NO: 40.
• 2. The antibody or antibody fragment of statement 1, wherein the VH domain is obtained by recombination of the human VH gene segment VH3-23 * 04 of SEQ ID NO: 39 and a human D segment and a human JH segment.
• 3. The antibody or antibody fragment of statement 1, wherein the human VH gene segment is VH3-23 * 04 of SEQ ID NO: 39.
• 4. The antibody or antibody fragment of any of claims 1-3, wherein the antibody comprises a VH domain, wherein the VH domain comprises the backbone 1 sequence of SEQ ID NO: 40.
• 5. The antibody or antibody fragment of any of 1-4, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain having an E670G mutation in SEQ ID NO: 1 and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 30.
• 6. The antibody or antibody fragment of any of 1-4, comprising the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising an E670G mutation, and / or encodes a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant comprising a mutation E670G, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 7. The antibody or antibody fragment of statement 6, wherein the detecting step comprises assaying a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the mutation E670G in SEQ ID NO: 1 includes.
• 8. The antibody or antibody fragment of statement 7, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides which can specifically hybridize to and identify with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the mutation E670G in SEQ ID NO: 1 or which hybridizes specifically with an antisense sequence of this sequence, wherein the nucleic acid hybridizes with at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28, or with an antisense Sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the E670G mutation in SEQ ID NO: 1 or an antisense sequence of these consecutive nucleotides wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for PCSK9 encoding a C -terminal domain comprising the E670G mutation in SEQ ID NO: 1; and determining the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises PCSK9 comprising the C-terminal domain comprising the mutation E670G in SEQ ID NO: 1.
• 9. The antibody or antibody fragment of claim 7, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification, and / or wherein the assay is in a multiplex Format takes place.
• 10. The antibody or antibody fragment of any one of claims 1-9, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant versus a statin treatment.
• 11. The antibody or antibody fragment of any of 1-10, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 12. The antibody or antibody fragment of claim 10 or 11, wherein the antibody or antibody fragment is for human administration separate from or concurrent with statin treatment.
• 13. The antibody or antibody fragment of any one of 7-9, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of a human.
• 14. The antibody or antibody fragment of any one of 1-13, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising an E670G mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising an E670G mutation in SEQ ID NO: 1.
• 15. The antibody or antibody fragment of any one of 1-14, wherein the human is at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and high blood pressure was diagnosed.
• 16. The antibody or antibody fragment of any one of claims 1-15, wherein the antibody or antibody fragment comprises at least one of a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, Peripheral vascular disease, Klaudikation and hypertension treated or the risk of such suffering in humans is reduced.
• 17. The antibody or antibody fragment of any one of 1-16, wherein the nucleotide sequence is SEQ ID NO: 30.
• 18. The antibody or antibody fragment of any one of claims 1-17, wherein the antibody or antibody fragment is for administration by intravenous or subcutaneous administration and / or is included in an injectable preparation.
• 19. The antibody or antibody fragment of any one of the preceding statements, wherein the mutation is I474V or E670G in SEQ ID NO: 1.
• 20. The antibody or antibody fragment of any one of the preceding statements, wherein the mutation is I474V in SEQ ID NO: 1.
• 21. The antibody or antibody fragment of any one of the preceding statements, wherein the mutation is E670G in SEQ ID NO: 1.
• 22. The antibody or antibody fragment of any one of the preceding claims, wherein the antibody or fragment specifically binds to the human PCSK9 form f.
• 23. The antibody or antibody fragment of any one of the preceding claims, wherein the human expresses a PCSK9 selected from forms f, e, p and aj.
• 24. The antibody or antibody fragment of any one of the preceding claims, wherein the human is ASW, LWK, YRI, CEU or GBR descent.
• 25. The antibody or antibody fragment of statement 24, wherein the human is of ASW descent and human expresses a human PCSK9 selected from forms f, e, p and aj, wherein the antibody or fragment thereof optionally is a VH domain which was obtained by the recombination of human VH-23 * 04.
• 26. The antibody or antibody fragment of statement 24, wherein the human is of LWK descent and human expresses a human PCSK9 selected from f, e, p and aj, the antibody or fragment thereof optionally being a VH domain which was obtained by the recombination of human VH-23 * 04.
• 27. The antibody or antibody fragment of claim 24, wherein the human is of YRI descent and human expresses a human PCSK9 selected from forms f, e, p and aj, the antibody or fragment thereof optionally being a VH domain which was obtained by the recombination of human VH-23 * 04.
• 28. The antibody or antibody fragment of statement 24, wherein the human is of CEU descent and human expresses a human PCSK9 selected from forms f, e, p and aj, wherein the antibody or fragment thereof optionally represents a VH domain which was obtained by the recombination of human VH-23 * 04.
• 29. The antibody or antibody fragment of claim 24, wherein the human is GBR-derived and human expresses a human PCSK9 selected from forms f, e, p and aj, the antibody or fragment thereof optionally being a VH domain which was obtained by the recombination of human VH-23 * 04.
• 30. The antibody or antibody fragment of claim 24, wherein the human genome comprises a nucleotide sequence selected from the group consisting of SEQ ID Nos. 29, 32, 34 and 36, wherein the antibody or fragment is specific to a human PCSK9 selected from the forms f, e, p and aj, respectively, and wherein the VH segment comprises a nucleotide sequence comprising SEQ ID NO 39 or its complement, wherein the VH gene segment is optionally VH3-23 * 04 (SEQ ID NO 38).

Further statements of the invention

• An antibody or antibody fragment for use in a method of reducing cholesterol levels or maintaining a previously reduced level of cholesterol in a human in need thereof, wherein the antibody or fragment comprises a human gamma heavy chain constant region comprising a first amino acid which is encoded by a human heavy gamma chain constant region gene segment SNP and which specifically binds to an amino acid sequence of the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain, which comprises a mutation of I474V, E670G, N425S or Q619P in SEQ ID NO: 1, wherein the human comprises a nucleotide sequence encoding the PCSK9 amino acid sequence and a human heavy gamma chain constant region gene segment comprising the SNP or human expresses antibodies that are human g. constant regions include amma chain comprising the first amino acid.
• 2. The antibody or antibody fragment of claim 1, wherein the antibody or fragment comprises a human gamma-1 heavy chain constant region comprising an Asp corresponding to position 204 of SEQ ID NO: 42 or a Leu, the corresponds to position 206 of SEQ ID NO: 42, and wherein the human comprises a gene region of a human heavy IGHG1 * 01 heavy chain constant region or the human expresses antibodies comprising human gamma-1 chain constant regions include such an Asp and Leu.
• The antibody or antibody fragment of statement 1 or 2, wherein the antibody or fragment comprises a human gamma-1 heavy chain constant region comprising an Asp corresponding to position 204 of SEQ ID NO: 42 and a Leu comprising position 206 of SEQ ID NO: 42.
• 4. An antibody or antibody fragment according to statement 1 or 2, wherein it has been found that the antibody or antibody fragment binds specifically to a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain having the mutation SEQ ID NO 1, wherein the antibody or fragment comprises a human gamma-1 heavy chain constant region comprising an Asp corresponding to position 204 of SEQ ID NO: 42 and a Leu encoding position 206 of SEQ ID NO: 42, and wherein the human (i) encodes a human heavy IGHG1 * 01 chain constant region gene segment, and (ii) a nucleotide sequence encoding the proprotein convertase subtilisin / kexin type 9 (PCSK9) comprises a C-terminal domain comprising the mutation in SEQ ID NO: 1.
• The antibody or antibody fragment of any one of the preceding claims, wherein the antibody comprises a human heavy IGHG1 * 01 chain constant region.
• 6. An antibody or antibody fragment according to statement 1, wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region comprising an amino acid selected from the group consisting of a pro which is position 72 of SEQ ID NO: 44 corresponds to an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and a Ala corresponding to position 257 of SEQ ID NO: 44, and wherein the human comprises a human heavy IGHG2 * 01 chain heavy region gene segment, or human expressing antibodies, the human gamma 2 chain constant regions comprising such Pro, Asn, Phe, Val and Ala.
• 7. The antibody or antibody fragment of claim 6, wherein the antibody comprises a human gamma 2 heavy chain constant region comprising a pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44 corresponds, includes.
• 8. An antibody or antibody fragment according to statement 6, wherein it has been determined that the antibody or antibody fragment binds specifically to a proprotein convertase subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain containing the mutation SEQ ID NO: 1 wherein the antibody or fragment comprises a human gamma 2 heavy chain constant region comprising a Pro corresponding to position 72 of SEQ ID NO: 44, an Asn corresponding to position 75 of SEQ ID NO: 44, a Phe corresponding to position 76 of SEQ ID NO: 44, a Val corresponding to position 161 of SEQ ID NO: 44, and an Ala corresponding to position 257 of SEQ ID NO: 44 and wherein the human is (i) a human heavy IgHG2 * 01 constant chain gene segment and (ii) a subtilisin / kexin type 9 (PCSK9) proprotein convertase comprising a C-terminal domain containing the mutation in SEQ ID NO: 1 comprises nucleotide sequence encoding sst.
• The antibody or antibody fragment of statement 6, 7 or 8, wherein the antibody comprises a human heavy IGHG2 * O1 heavy chain constant region.
• 10. An antibody or antibody fragment according to any one of the preceding statements, wherein it has been determined that the human comprises the nucleotide sequence encoding a PCSK9 comprising a C-terminal domain comprising the mutation in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type 9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30.
• The antibody or antibody fragment of any one of the preceding claims, wherein the method comprises the step of determining that the human comprises the nucleotide sequence coding for a PCSK9 comprising a C-terminal domain comprising the mutation and / or a proprotein convertase Subtilisin / kexin type 9 (PCSK9) protein variant comprising the mutation, wherein the detection step is optionally performed prior to administration of the antibody to a human.
• 12. The antibody or antibody fragment of claim 11, wherein the determining step comprises examining a human biological sample for a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the mutation in SEQ ID NO: 1.
• 13. An antibody or antibody fragment according to statement 12, wherein the assay comprises contacting the biological sample with
• a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides capable of specifically hybridizing to and identifying with a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain having the mutation in SEQ ID NO Comprising: 1 or specifically hybridizing to an antisense sequence of said sequence, said nucleic acid hybridizing to at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28, or having an antisense sequence hybridizes to form a complex when at least one nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the mutation in SEQ ID NO: 1 is present; and or
• b. at least one oligonucleotide probe comprising a sequence of at least 10 consecutive nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising the mutation in SEQ ID NO: 1 or an antisense sequence of these contiguous nucleotides wherein the sequence of consecutive nucleotides comprises at least one nucleotide present in the selected sequence but not present in SEQ ID NO: 28 to form a complex when the nucleotide sequence coding for the PCSK9 encoding a C- comprising the terminal domain comprising the mutation in SEQ ID NO: 1; and determining the presence or absence of the complex, wherein determining the presence of the complex determines that the human comprises PCSK9 comprising the C-terminal domain comprising the mutation in SEQ ID NO: 1.
• 14. The antibody or antibody fragment of claim 12 or 13, wherein the assay comprises a nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele-specific amplification and / or wherein the assay is in a multiplex Format takes place.
• The antibody or antibody fragment of any one of claims 1 to 14, wherein the antibody or antibody fragment is for administration to a human that is substantially resistant to statin treatment or that has been found to be substantially resistant to a statin treatment is.
• 16. The antibody or antibody fragment of any one of claims 1 to 15, wherein the antibody or antibody fragment is for administration to a human receiving or having received statin treatment or exhibiting a decreased response to statin treatment.
• 17. An antibody or antibody fragment according to statement 15 or 16, wherein the antibody or antibody fragment is intended for human administration, separate from or concurrent with statin treatment.
• 18. An antibody or antibody fragment according to any one of statements 12 to 14, wherein the biological sample comprises serum, blood, faeces, tissue, a cell, urine and / or saliva of the human.
• 19. An antibody or antibody fragment according to any one of claims 1 to 18, wherein the human is heterozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising a mutation, optionally further comprising the nucleotide sequence of SEQ ID NO: 28, or the human is homozygous for a nucleotide sequence encoding the C-terminal domain of PCSK9 comprising the mutation in SEQ ID NO: 1.
• 20. An antibody or antibody fragment according to any one of claims 1 to 19, wherein the human is at least one selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension was diagnosed.
• 21. An antibody or antibody fragment according to any one of statements 1 to 20, wherein at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, a heart attack, a stroke, coronary heart disease, atherosclerosis, peripheral vascular disease by the antibody or antibody fragment , Claudication and hypertension are treated or the risk of such a condition in humans is reduced.
• 22. An antibody or antibody fragment according to any one of statements 1 to 21, wherein the nucleotide sequence is SEQ ID NO: 29 or 30.
• 23. An antibody or antibody fragment according to any one of statements 1 to 22, wherein the antibody or the antibody fragment is intended for administration by intravenous or subcutaneous administration and / or contained in an injectable preparation.
• 24. An antibody or antibody fragment according to any one of the preceding statements, wherein the mutation in SEQ ID NO: 1 is I474V or E670G.
• 25. An antibody or antibody fragment according to any one of the preceding statements, wherein the mutation in SEQ ID NO: 1 is I474V.
• 26. An antibody or antibody fragment according to any one of claims 1 to 24, wherein the mutation in SEQ ID NO: 1 is E670G.
• 27. Antibody or antibody fragment according to one of the preceding statements, wherein the antibody or the fragment is a human antibody or a human fragment.

SEQUENCE LISTING

QUOTES INCLUDE IN THE DESCRIPTION

This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Cited patent literature

• US 20120093818 A1 [0007, 0419, 0419, 0433, 0434, 0435, 0436, 0447, 0448, 0449, 0449, 0450, 0451, 0461, 0461, 0462, 0463, 0463, 0463, 0464, 0464, 0648, 0648]
• US 20120093818 [0084, 0294]
• US 2011/0065902 [0086, 0459, 0471, 0477, 0478]
• WO 2008/057457 [0271, 0454]
• WO 2008/057458 [0271, 0454]
• WO 2008/057459 [0271, 0454]
• WO 2008/063382 [0271, 0454]
• WO 2008/133647 [0271]
• WO 2009/100297 [0271]
• WO 2009/100318 [0271]
• WO 2011/037791 [0271]
• WO 2011/053759 [0271]
• WO 2011/053783 [0271]
• WO 2008/125623 [0271, 0454]
• WO 2011/072263 [0271]
• WO 2009/055783 [0271]
• WO 2010/029513 [0271]
• WO 2011/111007 [0271]
• WO 2010/077854 [0271]
• US 20110065902 A1 [0419, 0419, 0453, 0455, 0455, 0461, 0462, 0463, 0463, 0464, 0648, 0648, 0693]
• WO 2008057457 [0454]
• WO 2008057458 [0454]
• WO 2008057459 [0454]
• WO 2008063382 [0454]
• WO 2008133647 [0454]
• WO 2009100297 [0454]
• WO 2009100318 [0454]
• WO 2011037791 [0454]
• WO 2011053759 [0454]
• WO 2011053783 [0454]
• WO 2008125623 [0454]
• WO 2011072263 [0454]
• WO 2009055783 [0454]
• WO 2010029513 [0454]
• WO 2011111007 [0454]
• WO 2010077854 [0454]
• US 2008/0008697 [0454]
• US 2012/0093818 [0460]
• WO 05/103081 [0485]
• GB 2444410 A [0507]
• US 2013/0071405 [0552]
• US 7282337 [0565]
• US 7279563 [0565]
• US 7226720 [0565]
• US 7220549 [0565]
• US 7169560 [0565]
• US 6818395 [0565]
• US 6911345 [0565]
• US 2006/0252077 [0565]
• US 2007/0070349 [0565]
• US 20070070349 [0565]
• WO 2013041844 [0626]

Cited non-patent literature

• Horton et al., 2007; Seidah and Prat, 2007 [0003]
• Benjann et al., 2004 [0003]
• Lagace et al., 2006 [0003]
• Maxwell et al., 2005 [0003]
• Park et al., 2004 [0003]
• Benjann et al., 2004 [0003]
• Lagace et al., 2006 [0003]
• Maxwell et al., 2005 [0003]
• Park et al., 2004 [0003]
• Rashid et al., 2005 [0003]
• Kotowski et al., 2006 [0003]
• Zhao et al., 2006 [0003]
• Lagace et al., 2006 [0003]
• Seidah et al., 2003 [0004]
• et al., 2006). Furin [0004]
• Henrich et al., 2003 [0004]
• Tangrea et al., 2002 [0004]
• Henrich et al., 2005 [0004]
• Sakai et al., 1998 [0004]
• Seidah et al., 2003 [0004]
• Seidah et al., 1999 [0004]
• Ikemura et al., 1987 [0005]
• Fu et al., 2000 [0005]
• Anderson et al., 1997 [0005]
• Naureckiene et al., 2003 [0006]
• Seidah et al., 2003 [0006]
• Naureckiene et al., 2003 [0006]
• Seidah et al., 2003 [0006]
• The International HapMap Consortium. 2003; http://hapmap.ncbi.nlm.nih.gov/index.html.en [0048]
• The 1000 Genomes Project Consortium 2010; available on the World Wide Web at http://www.1000genomes.org/ [0048]
• H. Haga et al. 2002; available on the World Wide Web at http://snp.ims.u-tokyo.ac.jp/index.html [0048]
• NA Rosenberg et al (Science December 20, 2002: Vol. 298 No. 5602 2342-2343) [0071]
• The International HapMap Project, Nature, Dec. 18, 2003; 426 (6968): 789-96 [0072]
• Pisciotta et al 2006 [0102]
• Chen et al. 2005 [0103]
• Pisciotta et al 2006 [0130]
• Chen et al 2005 [0131]
• Pisciotta et al 2006 [0159]
• Chen et al 2005 [0160]
• Pisciotta et al 2006 [0174]
• Chen et al 2005 [0175]
• Pisciotta et al 2006 [0191]
• Chen et al. 2005 [0192]
• Pisciotta et al 2006 [0210]
• Chen et al 2005 [0211]
• Pisciotta et al 2006 [0226]
• Chen et al 2005 [0227]
• Pisciotta et al 2006 [0244]
• Chen et al 2005 [0245]
• Pisciotta et al 2006 [0279]
• Chen et al 2005 [0280]
• Pisciotta et al 2006 [0322]
• Chen et al 2005 [0323]
• Pisciotta et al 2006 [0342]
• Chen et al 2005 [0343]
• Pisciotta et al 2006 [0367]
• Chen et al 2005 [0368]
• Cunningham et al., Nat Struct Mol Biol. May 2007; 14 (5): 413-9. Epub April 15, 2007, "Structural and biophysical studies of PCSK9 and its mutants linked to familial hypercholesterolemia" [0446]
• Tutt et al. (1991) J. Immunol. 147: 60-69 [0486]
• Powell et al. "Compendium of Excipients for Parenteral Formulations" PDA (1998) J Pharm Sci Technol 52: 238-311 [0490]
• Wu et al. (1987) J. Biol. Chem. 262: 4429-4432 [0492]
• Langer (1990) Science 249: 1527-1533 [0493]
• Treat et al. (1989) in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez Berestein and Fidler (ed.), Liss, New York, pp. 353-365 [0493]
• Lopez-Berestein, ibid., Pp. 317-327 [0493]
• Langer, above; Sefton (1987) CRC Crit. Ref. Biomed. Closely. 14: 201 [0494]
• Medical Applications of Controlled Release, Langer and Wise (ed.), CRC Pres., Boca Raton, Fla. (1974) [0494]
• Goodson, in Medical Applications of Controlled Release, supra , vol. 2, pp. 115-138, 1984 [0494]
• Shield et al. (2002) JBC 277: 26733 [0500]
• Wang DG, Fan JB, Siao CJ, Berno A, Young P, Sapolsky R, Ghandour G, Perkins N, Winchester E, Spencer J, Kruglyak L, Stein L, Hsie L, Topaloglou T, Hubbell E, Robinson E, Mittmann M , Morris MS, Shen N, Kilburn D, Rioux J, Nusbaum C, Rozen S, Hudson TJ, Lipshutz R, Chee M, Lander ES, Science. May 15, 1998; 280 (5366): 1077-82 [0508]
• Reviewing Accessing genetic variation: genotyping single nucleotide polymorphisms, Syvänen AC, Nat Rev Genet. Dec. 2001; 2 (12): 930-42 [0508]
• Review Techniques patents for SNP genotyping, Twyman RM, Primrose SB, Pharmacogenomics. Jan. 2003; 4 (1): 67-79 [0508]
• AA Komar (ed.), Single Nucleotide Polymorphisms, Methods in Molecular Biology 578, DOI 10.1007 / 978-1-60327-411-1_19, Humana Press, part of Springer Science + Business Media, LLC [0509]
• Single Nucleotide Polymorphisms, Methods in Molecular Biology, Volume 578, 2009, pp. 293-306, The TaqMan Method for SNP Genotyping, Gong-Qing Shen et al [0509]
• Ranade K, Chang MS, Ting CT, Pei D, Hsiao CF, Olivier M, Pesich R, Hebert J, Chen YD, Dzau VJ, Curb D, Olshen R, Risch N, Cox DR, Botstein D, Genome Res. July 2001 ; 11 (7): 1262-8 [0510]
• Assessment of two flexible and compatible SNP Genotyping Platforms: TaqMan SNP Genotyping Assays and the SNPlex Genotyping System, De la Vega FM, Lazaruk KD, Rhodes MD, Wenz MH, Mutat Res. 3 June 2005; 573 (1-2): 111-35 [0510]
• Callegaro et al, Nucleic Acids Res. 2006; 34 (7): e56, published online on April 14, 2006. doi: 10.1093 / nar / gkl185 [0511]
• Horton et al., 2007; Seidah and Prat, 2007 [0527]
• Lagace et al., 2006 [0527]
• Seidah et al., 2003 [0527]
• Naureckiene et al., 2003 [0528]
• Seidah et al., 2003 [0528]
• Creighton, Proteins, WH Freeman and Company (1984) [0536]
• Dordo et al, J. Mol Biol, 1999, 217, 721-739 [0537]
• Taylor et al, J. Theor. Biol. 119 (1986); 205-218 [0537]
• S. French and B. Robson, J. Mol. Evol. 19 (1983) 171 [0537]
• de Wildt et al., Eur. J. Immunol. 1996; 26 (3): 629-39 [0541]
• Sequences of Proteins of Immunological Interest (National Institutes of Health, Bethesda, Md., 1987 and 1991) [0542]
• IMGT or Kabat, EA, et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242, and Chothia, C. et al. (1987) J. Mol. Biol. 196: 901-917 [0545]
• Ward et al., (1989) Nature 341: 544-546 [0546]
• CW Dieffenbach and GS Dveksler (1995) PCR Primer, a Laboratory Manual, Cold Spring Harbor Press, Plainview, NY, USA [0562]
• Shendure, et al., "Next-generation DNA sequencing", Nature, 2008, Vol. 26, No. 10, 1135-1145 [0565]
• Mardis, "The Impact of Next-Generation Sequencing Technology on Genetics," Trends in Genetics, 2007, Vol. 24, No. 3, pp. 133-141 [0565]
• Su, et al., "Next-generation sequencing and its applications in molecular diagnostics." Expert Rev Mol. Diagn., 2011, 11 (3): 333-43 [0565]
• Zhang et al., "The impact of next-generation sequencing on genomics," J Genet Genomics, 2011, 38 (3): 95-109 [0565]
• P. Nyren et al. Anal Biochem 208: 17175 (1993) [0565]
• DR Bentley, Curr Opin Genet Dev 16: 545-52 (2006) [0565]
• RL Strausberg et al. Drug Disc Today 13: 569-77 (2008) [0565]
• "The Merck Manual of Diagnosis and Therapy," 19th Edition, Edited by Merck Research Laboratories, 2006 (ISBN 0-911910-19-0) [0596]
• Robert S. Porter et al. (Ed.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9) [0596]
• Benjamin Lewin, Genes X, edited by Jones & Bartlett Publishing, 2009 (ISBN 10: 0763766321) [0596]
• Kendrew et al. (Ed.) "Molecular Biology and Biotechnology: a Comprehensive Desk Reference, edited by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8) [0596]
• Current Protocols in Protein Sciences 2009, Wiley Intersciences, Coligan et al., Eds. [0596]
• Sambrook et al., Molecular Cloning: A Laboratory Manual (4th Ed.), Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, USA (2012) [0597]
• Davis et al., Basic Methods in Molecular Biology, Elsevier Science Publishing, Inc., New York, USA (1995) [0597]
• Methods in Enzymology: Guide to Molecular Cloning Techniques Vol. 152, SL Berger and AR Kimmel ed., Academic Press Inc., San Diego, USA (1987) [0597]
• Current Protocols in Protein Science (CPPS) (John E. Coligan, et al., Eds., John Wiley and Sons, Inc.), Current Protocols in Cell Biology (CPCB) (Juan S. Bonifacino et al., Eds. , John Wiley and Sons, Inc.) and Culture of Animal Cells: A Manual of Basic Technique by R. Ian Freshney, edited by: Wiley-Liss; 5th edition (2005) [0597]
• Animal Cell Culture Methods (Methods in Cell Biology, Vol. 57, Jennie P. Mather and David Barnes Ed., Academic Press, 1st Edition, 1998) [0597]
• JAMA. 2011; 305 (14): 1460-1468. doi: 10.1001 / jama.2011.406: "Development of Antidrug Antibodies Against Adalimumab and Association With Disease Activity and Treatment Failure During Long-term Follow-up", GM Bartelds et al. [0622]
• "Guideline on immunogenicity assessment of monoclonal antibodies intended for in vivo clinical use" (available on the World Wide Web at www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2012/06/WC50 0128688.pdf; EMA / CHMP / BMWP / 86289/2010 [0623]
• Horton et al, Trends Biochem Sci. Feb. 2007; 32 (2): 71-7. Epub Jan. 9, 2007, Molecular biology of PCSK9: its role in LDL metabolism [0698]
• Seidah and Prat, J Mol Med (Berl). Jul. 2007; 85 (7): 685-96. Epub March 10, 2007, The proprotein convertases are potential targets in the treatment of dyslipidemia [0698]
• Benjannet et al, J Biol Chem. Nov. 19, 2004; 279 (47): 48865-75. Epub Sept. 9, 2004, NARC-1 / PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol [0698]
• Lagace et al, J Clin Invest. Nov. 2006; 116 (11): 2995-3005, Secreted PCSK9 Decreases the Number of LDL Receptors in Hepatocytes and in Universes of Parabiotic Mice [0698]
• Maxwell et al, Proc Natl Acad Sci USA. Feb 8, 2005; 102 (6): 2069-74. Epub Jan. 27, 2005, Overexpression of PCSK9 accelerates the degradation of the LDLR in a post-endoplasmic reticulum compartment [0698]
• Park et al, J Biol Chem. Nov. 26, 2004; 279 (48): 50630-8. Epub 22 Sept. 2004, Post-transcriptional regulation of low density lipoprotein receptor protein by proprotein convertase subtilisin / kexin type 9a in mouse liver [0698]
• Rashid et al, Proc Natl Acad Sci USA. April 12, 2005; 102 (15): 5374-9. Epub 1 April 2005, Decreased plasma cholesterol and hypersensitivity to statins in mice varnishing Pcsk9 [0698]
• Kotowski et al., Am J Hum Genet. March 2006; 78 (3): 410-22. Epub Jan. 20, 2006, A spectrum of PCSK9 alleles to plasma levels of low-density lipoprotein cholesterol [0698]
• Chen et al, J. Am Coll Cardiol. May 17, 2005; 45 (10): 1611-9. Epub April 21, 2005, A common PCSK9 haplotype, encompassing the E670G coding single nucleotide polymorphism, is a novel genetic marker for plasma low-density lipoprotein cholesterol levels and severity of coronary atherosclerosis [0698]
• Pisciotta et al., Atherosclerosis. June 2006; 186 (2): 433-40. Epub Sept. 23, 2005, Additive effects of mutations in LDLR and PCSK9 genes on the phenotype of familial hypercholesterolemia [0698]
• Zhao et al., Am J Hum Genet. Sept. 2006; 79 (3): 514-23. Epub July 18, 2006, Molecular characterization of loss-of-function mutations in PCSK9 and heterozygote identification of a compound [0698]
• Seidah et al, Proc Natl Acad Sci USA. Feb. 4, 2003; 100 (3): 928-33. Epub Jan. 27, 2003, The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation [0698]

Claims (32)

An antibody or antibody fragment for use in a method of reducing a cholesterol level or maintaining a previously reduced level of cholesterol in a human in need thereof, the method comprising administering the antibody or fragment to a human, wherein the antibody or fragment is a proprotein. Convertase, subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising a mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1, and wherein the antibody or fragment is a human kappa A light chain constant region comprising an amino acid selected from the group consisting of a position 84 of SEQ ID NO: 50 corresponding Val and a position 87 of SEQ ID NO: 50 corresponding Cys, and being the human (i) comprises an IGKC * 01 human kappa chain constant region gene segment or the human expresses antibodies comprising the kappa light chain constant regions containing the amino acids Val, corresponding to position 84 of SEQ ID NO: 50, and Cys, corresponding to position 87 of SEQ ID NO: 50, and (ii) a nucleotide sequence encoding the proprotein convertase, subtilisin / kexin type 9 (PCSK9) comprising a C-terminal domain comprising the mutation in SEQ ID NO: 1. The antibody or antibody fragment of claim 1, wherein the antibody or fragment comprises a human kappa light chain constant region corresponding to a position 84 of SEQ ID NO: 50 corresponding to Val and a position 87 of SEQ ID NO: 50, respectively Cys and wherein the human genome comprises a nucleotide sequence of a kappa light chain constant region encoding such amino acids. An antibody or antibody fragment for use according to any preceding claim, wherein the antibody or fragment comprises an IGKC * 01 human kappa chain constant region. An antibody or antibody fragment for use according to any preceding claim, wherein the method comprises, prior to administration of the antibody or fragment, selecting a human comprising the nucleotide sequence of (ii), wherein the human is the human of claim 1. An antibody or antibody fragment for use according to any preceding claim, wherein (i) it has been determined that the human encodes the nucleotide sequence comprising a PCSK9 comprising a C-terminal domain comprising mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1, and / or a proprotein convertase subtilisin / kexin type-9 (PCSK9) protein variant encoded by the nucleotide sequence of SEQ ID NO: 29 or 30, or (ii) the method comprising the step of determining that the human is the nucleotide sequence comprising a PCSK9 comprising a C-terminal domain comprising the I474V, E670G, N425S or Q619P mutation, and / or a Proprotein Convertase Subtilisin / Kexin Type-9 (PCSK9) comprising mutation I474V, E670G, N425S or Q619P Protein variant, optionally, wherein the determining step is before administration of the antibody to the human. An antibody or antibody fragment for use according to claim 5, wherein the determining step comprises testing a human biological sample for a nucleotide sequence comprising the PCSK9 comprising the C-terminal domain comprising mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1 , encoded, includes. An antibody or antibody fragment for use according to claim 6, wherein the testing comprises contacting the biological sample with a. at least one oligonucleotide probe comprising a sequence of at least 10 contiguous nucleotides that specifically binds to a nucleotide sequence encoding the PCSK9 encoding the C-terminal domain comprising mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1; identifying them in the biological sample or specifically hybridizing to an antisense of the sequence, wherein the nucleic acid is at least one nucleotide present in the selected sequence that is not present in SEQ ID NO: 28, hybridizes or hybridizes to an antisense sequence to form a complex when at least one nucleotide sequence encoding the PCSK9 carrying mutation I474V, E670G, N425S or Q619P comprises in SEQ ID NO: 1 comprising C-terminal domain encoded; and / or b. at least one oligonucleotide probe encoding a sequence of at least 10 contiguous nucleotides of a nucleotide sequence encoding the PCSK9 comprising the C-terminal domain comprising mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1 or an antisense A sequence of contiguous nucleotides, wherein the sequence of contiguous nucleotides comprises at least one nucleotide present in the selected sequence, which is not present in SEQ ID NO: 28, whereby a complex is formed, if the nucleotide sequence encoding the PCSK9, one the mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1 comprising C-terminal domain encoded; and detecting the presence or absence of the complex, it being determined by detecting the presence of the complex that the human comprises the PCSK9 comprising the C-terminal domain comprising mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1, includes. An antibody or antibody fragment for use according to claim 6, wherein the assay comprises nucleic acid amplification and optionally one or more methods selected from sequencing, next generation sequencing, nucleic acid hybridization and allele specific amplification, and / or wherein the assay is in a multiplexed format. An antibody or antibody fragment for use according to any preceding claim, wherein it is determined or further determined that the human is substantially resistant to statin treatment. An antibody or antibody fragment for use according to any preceding claim, wherein the human is receiving or has received statin treatment or has decreased responsiveness to statin treatment. An antibody or antibody fragment for use according to any preceding claim, wherein the antibody or antibody fragment is administered to human separately or concurrently with statin treatment. An antibody or antibody fragment for use according to any one of claims 6-8, wherein the biological sample comprises serum, blood, stool, tissue, a cell, urine and / or saliva of the human. An antibody or antibody fragment for use according to any preceding claim, wherein it is indicated that the human is heterozygous for a nucleotide sequence encoding the C-terminal PCSK9 domain comprising mutation I474V, E670G, N425S or Q619P, optionally further indicating in that the human comprises the nucleotide sequence under SEQ ID NO: 28, or it is indicated that the human is homozygous for a nucleotide sequence comprising the C-terminal PCSK9 domain comprising the mutation I474V, E670G, N425S or Q619P in SEQ ID NO: 1 coded. An antibody or antibody fragment for use according to any preceding claim, wherein the human has been diagnosed with at least one condition selected from a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, myocardial infarction, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension , An antibody or antibody fragment for use according to any preceding claim, wherein the antibody or antibody fragment comprises at least one of a lipid disorder, hyperlipoproteinemia, hyperlipidemia, dyslipidemia, hypercholesterolemia, myocardial infarction, stroke, coronary heart disease, atherosclerosis, peripheral vascular disease, claudication and hypertension treated or the risk of it in humans is reduced. An antibody or antibody fragment for use according to any preceding claim, wherein the nucleotide sequence is SEQ ID NO: 29 or 30. An antibody or antibody fragment for use according to any preceding claim, wherein the antibody or antibody fragment is intended for administration by intravenous or subcutaneous administration and / or contained in an injectable preparation. An antibody or antibody fragment for use according to any preceding claim, wherein the antibody is a human antibody. An antibody or antibody fragment for use according to any preceding claim, wherein the antibody has human glycosylation produced by a CHO cell. An antibody or antibody fragment for use according to any preceding claim comprising variable heavy chain domains derived from a recombination of human VH3-23 * 04 and a human D segment and a human JH segment. An antibody or antibody fragment for use according to any preceding claim, comprising variable heavy chain domains derived from a recombination of human VH3-23 * 04, JH2 * 01 and a D-segment, and light chain variable domains derived from a Recombination of human Vκ4-1 * 01 and Jκ2 * 01. An antibody or antibody fragment for use according to any preceding claim comprising the variable domains of antibody 316P or alirocumab. The antibody of claim 22, wherein the antibody is 316P or alirocumab. An antibody or antibody fragment for use according to any preceding claim, wherein the mutation is I474V or E670G in SEQ ID NO: 1. An antibody or antibody fragment for use according to any preceding claim, wherein the mutation is I474V in SEQ ID NO: 1. An antibody or antibody fragment for use according to any preceding claim, wherein the mutation is E670G in SEQ ID NO: 1. An antibody or antibody fragment according to any preceding claim, wherein the antibody or fragment specifically binds to human PCSK9 form c, r, f or p. An antibody or antibody fragment according to any preceding claim, wherein the antibody or fragment specifically binds to human PCSK9 form c, r, f and p. An antibody or antibody fragment according to any preceding claim, wherein the human expresses a PCSK9 selected from forms c, r, f and p. An antibody or antibody fragment according to any preceding claim, wherein the human ancestor is ASW, YRI, GBR, TSI, CLM, CHB, LWK, CHS, MXL, JPT, PUR, IBS, FIN or CEU. A vial, syringe, IV container or injection device (eg, an intraocular or intravitreal injection device) comprising the antibody or fragment of any preceding claim. A kit comprising the antibody or fragment of any preceding claim, packaging material, and instructions for use in treating or preventing or diagnosing a disease or condition mediated by the PCSK9 in a human.

Images