DE19717893A1 - New ralstonia eutropha glycosyl-transferase - Google Patents

Abstract

A Ralstonia eutropha (Alcaligenes eutrophus) glycosyltransferase protein referred to as monofunctional glycosyltransferase (Mgt) is claimed in terms of an amino acid sequence given in the specification the sequence given is a DNA sequence numbered from 3500 to 4708 with three ORFs encoding sequences of 21, 231 and 105 amino acids. Also claimed are: (i) DNA having the above sequence; (ii) an expression plasmid containing the DNA; (iii) a transformant containing the plasmid; and (iv) an antibody directed against the protein.

Description

The present invention relates to a monofunctional glycosyltransferase, a DNA coding therefor and a method for producing it. Further relates to the invention antibodies directed against the protein and Ver use of protein or DNA.

Glycosyltransferases, the essential steps in bacterial murein biosynthesis catalyze, come in the high molecular penicillin-binding proteins of Class A before. Since substances are known that affect the activity of glycosyltrans Inhibiting ferases and showing antimicrobial activity, it is believed that the glycosyltransferases suitable target proteins for new antibiotics and Represent chemotherapy drugs. The problem is the presentation of this enzyme in a form that makes it available for screening.

The object of the present invention is therefore to provide a new glycosyltransferase, especially in soluble form.

According to the invention, this is the subject of the claims reached.

The present invention thus relates to a monofunctional glycosyl transferase, which comprises the amino acid sequence of FIG. 1 or an amino acid sequence different therefrom by one or more amino acids.

The applicant has isolated from Ralstonia eutropha (formerly: Alcaligenes eutrophus) a protein which is a monofunctional glycosyltransferase. This protein comprises the amino acid sequence of FIG. 1 or an amino acid sequence different therefrom by one or more amino acids. The applicant has also recognized that the homology of this protein with other related proteins and domains of this class is so high that it can be regarded as a model protein. Through sequence comparisons, it is now possible to define the corresponding domains of penicillin-binding proteins and to use a suitable expression system to produce derivatives thereof.

In the present invention, the above protein is treated with Mgt ("Monofunctio nale glycosyltransferase).

Another object of the present invention is a nucleic acid coding for Mgt. This can be an RNA or a DNA. The latter can e.g. B. be a genomic DNA or a cDNA. A DNA is preferred which comprises the following:

• (a) the DNA of FIG. 1 or a DNA different therefrom by one or more base pairs,
• (b) a DNA hybridizing with the DNA of (a), or
• (c) one with the DNA from (a) or (b) above the degenerate genetic Code related DNA.

The term "hybridizing DNA" indicates a DNA that is commonly used Conditions, especially at 20 ° C below the melting point of the DNA with DNA from (a) hybridizes.

The DNA of FIG. 1 was deposited with the DSMZ (German Collection of Microorganisms and Cell Cultures GmbH) as E. coli SG13009 pEM12-7 under DSM 11519 on April 22, 1997.

A DNA according to the invention is described below in the form of a cDNA.  

This is an example of every DNA covered by the present invention.

A cDNA according to the invention can be produced by customary methods. It is favorable to start from a bacterial expression library and to screen it with the DNA from FIG. 1, in particular with primers which relate to the region of the underlined DNA region. Conventional conditions, in particular those specified above, can be selected as hybridization conditions. Positive clones can then be tested for their glycosyltransferase activity using standard methods.

A cDNA according to the invention can be in a vector or expression vector available. Examples of such are known to the person skilled in the art. In the case of an ex pressure vectors for E.coli are z. B. pGEMEX, pUC derivatives, pGEX-2T, pET3b, pQE-8 and pQE-12. For expression in yeast z. B. pY100 and To call Ycpad1, while for expression in animal cells z. B. pKCR, pEFBOS, cDMB and pCEV4 must be specified. For expression in insect cells len is particularly suitable for the baculovirus expression vector pAcSGHisNT-A.

The person skilled in the art knows suitable cells in order to use an inventive cell in a Expression vector to express cDNA present. Examples of such cells include the E. coli strains HB101, DH1, x1776, JM101, JM109, BL21, TB1 and SG 13009, the yeast strain Saccharomyces cerevisiae and the animal ones Cells L, 3T3, FM3A, CHO, COS, Vero and HeLa as well as the insect cells sf9.

The person skilled in the art knows in what way a cDNA according to the invention is converted into a Expression vector must be inserted. He also knows that this DNA in connection with a DNA coding for another protein or peptide can be inserted so that the cDNA according to the invention in the form of a Fu ion protein, e.g. B. as His-Tag protein, can be expressed.

Furthermore, the person skilled in the art knows conditions, transformed or trans cultivate infected cells. He is also aware of procedures that are carried out by the  isolate and purify protein of the invention expressed cDNA. A such a protein, which can also be a fusion protein, is thus also Subject of the present invention.

It has been found by the inventors that it is particularly advantageous if one the monofunctional glycosyltransferase according to the invention as a fusion with a maltose binding protein expressed in an E. coli expression system. It has been found that when expression is low Temperature is induced and the cells are cultivated at this temperature the monofunctional glycosyltransferase can be obtained in soluble form. According to the invention, a temperature between 25 and 35 ° C, in particular 28 to 30 ° C, are understood.

Another object of the present invention is a protrude of the protein or fusion protein directed antibodies. Such an antibody can be made by conventional methods. It can be polyclonal or be monoclonal. It is cheap to make it, especially animals Rabbits or chickens for a polyclonal and mice for a monoclonal len antibody, with an above (fusion) protein or fragment thereof to immunize. Further "boosters" of the animals can be used with the same (Fu sions) protein or fragments thereof. The polyclonal antibody can were then obtained from the serum or egg yolk of the animals. For the monoclona Antibodies are fused to animal spleen cells with myeloma cells.

The present invention enables it to be used in other penicillin-binding Define and identify domains corresponding to proteins.

The present invention thus makes a major contribution to identification suitable target proteins for new antibiotics and chemotherapeutics.  

Brief description of the figures:

Fig. 1 shows the base sequence and the amino acid sequence derived therefrom, which is encompassed by a Mtg gene according to the invention from Ralstonia eutropha. The 5 'end represents ORF6. The hydrophobic N-terminal peptide is underlined.

Figure 2 shows the construction of the MBP-Mgt fusion protein
The boxed sequence gives the R. eutropha Mgt sequence which codes for amino acids 31-231 .
MBP: Maltose binding protein.

Fig. 3 shows the expression of the Mgt according to the invention in E. coli. Exponentially growing cells containing the plasmid pPEC12 were treated with IPTG (2 mM) at OD ₆₀₀ = 0.7-0.8 and the cells were harvested after 3 hours. The cells were sonicated by Ultrabe, the total cellular protein separated on SDS-polyacrylamide gels and stained with Coomassie blue.

1 and 2: E. coli pPEC12
3: Control cells containing the plasmid without Mgt insert
M: molecular weight marker.

The arrow shows the position of the Mgt derivative.

Fig. 4 is a soluble derivative Mgt
The overexpression of the fusion protein from maltose-binding protein (MBP) and Mgt was induced in E. coli TB1, which contained the corresponding plasmid pMPE, at 28 ° C. The MBP-Mgt fusion protein was purified by affinity chromatography and treated with factor Xa as described in Example 3 below. After SDS polyacrylamide gel electrophoresis, Mgt could be detected by Western blot and immunostaining (immunostaining) with specific antiserum. 50 µg fusion protein and 1 µg factor Xa were used. The applied samples corresponded to approx. 12 µg. The incubation times were:

• (10 mins
• (2) 6 hours
• (3) 12 hours
• (4) 24 hours.

Fig. 5 shows the presence of Mgt in R. eutropha
R. eutropha cells were grown under aerobic conditions to an OD ₄₃₆ = 10 and then switched to conditions of restricted oxygenation. Solubilized cytoplasmic membrane proteins were used (lanes 5 and 7 , membranes; lanes 6 and 8 , soluble proteins). Whole cell lysates from E. coli with pPEM8 (expressing membrane-bound Mgt) were also used:

Lane 1 : E. coli SG13009 with plasmid pQE8 without insert
Lanes 2-4 cell lysates from E. coli / pPEM8 (lane 3: 1: 20 of the amount of lane 2 ; lane 4: 1: 100 of the amount of lane 2 )
M molecular weight marker

The arrows on the left show the position of Mgt-His

(A): Coomassie blue colored SDS polyacrylamide gel
(B): Immunoblot of (A) with specific Mgt antibodies.

The present invention is illustrated by the following examples.

example 1 Production and purification of a Mgt protein according to the invention

To overexpress the Mgt protein in E. coli, either the whole Gene or a smaller soluble derivative in which the hydrophobic N-terminal part had been deleted, cloned into the pQE vector system. (The pQE derivatives and the E. coli strain SG13009, which contained the repressor plasmid pREP4, were obtained from the company Qiagen (Hilden).)

The Mgt sequences were obtained by PCR using the following oligonucleotide primers:

to amplify the entire Mgt gene:

• a) CGGGATCCA3628AAAGACTCTGGTCCGCCTTC3648 and
• b) CCCAAG4322CTTACCTCAGCCTCAACGGCTCCA4297;
  for the amplification of a derivative in which the amino acids Met 1 to Ala 30 had been deleted:
• c) CGGGATC3713CAACCGGCAGCTGCCGTCGCTC3735 and
• (b) as above.

The oligonucleotides were chosen so that BamHI or HindIII cleavage sites were generated at the ends of the PCR products, which were used to convert the DNA fragments into pQE8 (which resulted in a fusion protein with an N-terminal His tag) or to clone in pQE12 (without His tag). The PCRs were carried out in a Biomed thermal cycler for 30 cycles (denaturation: 30 seconds at 96 ° C; annealing: 1 minute at 52 ° C; extension: 1 minute at 72 ° C followed by 5 minutes extension time at 72 ° C) . A 100 ul reaction mixture contained 10 pmol of each oligonucleotide primer, 0.8 mM deoxynucleoside triphosphates, 5-6 mM MgCl ₂ , 2.5 U Taq polymerase and buffer according to the manufacturer's instructions. The plasmids containing the membrane-bound proteins were called pPEM8 and pPEM12, and those containing the cytoplasmic derivatives were called pPEC8 and pPEC12, respectively. These plasmids were used to transform E.coli SG 13009 (see. Gottesmann, S. et al., J. Bacteriol. 148, (1981), 265-273). The bacteria are cultivated in an LB medium with 10 μg / ml ampicillin and 25 μg / ml kanamycin and induced for 4 h with 60 μM isopropyl-β-D-thiogalacto pyranoside (IPTG). When inducing expression by IPTG, it was found that the supposedly membrane-associated proteins stopped growing immediately, while those that expressed the supposedly soluble derivative in the cytoplasm continued to grow for at least 1.5 hours. While the cytoplasmic protein was over-expressed as an inclusion body, the intact protein was associated with the membrane portion, which confirmed the role of the hydrophobic N-terminal peptide as a membrane anchor.

The E. coli cells expressing the Mgt protein were lysed using ultrasound, the total protein released therefrom was separated electrophoretically on a 15% polyacrylamide gel and stained with Coomassie blue (cf. Thomas, JO and Kornberg, RD, J. Mol. Biol. 149 (1975), pp. 709-733). In this connection, reference is made to FIG. 3, where the expression of Mgt was detected in E. coli.

Example 2 Production and detection of an antibody according to the invention

A fusion protein according to the invention from Example 1 is 15% SDS polyacrylamide gel electrophoresis. After staining the gel with 4 sts Sodium acetate is cut out of an approximately 23 kD band from the gel and into Phosphate buffered saline incubated. Pieces of gel are sedimented, before the protein concentration of the supernatant by an SDS polyacrylamide Gel electrophoresis followed by a Coomassie blue stain is determined. With The gel-purified fusion sport animals are immunized as follows:

Immunization protocol for polyclonal antibodies in rabbits

40 µg gel-purified fusion protein in 0.7 ml PBS and 0.7 ml complete or incomplete Freund's adjuvant are used per immunization.

Day 0: 1 immunization (Freund's complete adjuvant)
Day 14: 2nd immunization (incomplete Freund's adjuvant; icFA)
Day 28: 3rd immunization (icFA)
Day 56: 4th immunization (icFA)
Day 80: bleeding.

The rabbit's serum is tested in an immunoblot. For this purpose, a fusion protein according to the invention of Example 1 is subjected to an SDS-polyacrylamide gel electrophoresis and transferred to a nitrocellulose filter (cf. Khyse-Andersen), J., J. Biochem. Biophys. Meth. 10, (1984), 203-209). Western blot analysis is carried out as usual. For this purpose, the nitrocellulose filter is incubated with a first antibody at 37 ° C. for 1 h. This antibody is that of the rabbit (1: 20000 in PBS / Tween). After several washing steps with PBS, the nitrocellulose filter is incubated with a second antibody. This antibody is a goat anti-rabbit IgG monoclonal antibody coupled to alkaline phosphatase (Sigma Chemicals Co. St. Louis, USA) (1: 5000) in PBS. After 30 minutes of incubation at 37 ° C, there are several washing steps with PBS and then the alkaline phosphatase detection reaction with developer solution (36 µm 5 'bromo-4-chloro-3-indolyl phosphate, 400 µM nitro blue tetrazolium, 100 mM Tris-HCl , pH 9.5, 100 mM NaCl, 5 mM MgCl ₂ ) at room temperature until bands become visible.

It can be seen that polyclonal antibodies according to the invention are produced can.

Instead of Freund's adjuvant, the RIBI Adjuvant System has now proven itself from RIBI ImmunoChem Research, Hamilton, Montana, USA.

Immunization protocol for chicken polyclonal antibodies

40 µg gel-purified fusion protein in 0.8 ml PBS and 0.8 ml complete or incomplete Freund's adjuvant are used per immunization.

Day 0: 1st immunization (Freund's complete adjuvant)
Day 28: 2nd immunization (incomplete Freund's adjuvant; icFA)
Day 50: 3. Immunization (icFA).

Antibodies are extracted from egg yolk and tested in a Western blot. It polyclonal antibodies according to the invention are detected.

Immunization protocol for mouse monoclonal antibodies

For each immunization, 12 µg gel-purified fusion protein in 0.25 ml PBS and 0.25 ml complete or incomplete Freund's adjuvant are used; at the 4th immunization the fusion protein is dissolved in 0.5 ml (without adjuvant).

Day 0: 1st immunization (Freund's complete adjuvant)
Day 28: 2nd immunization (incomplete Freund's adjuvant; icFA)
Day 56: 3rd immunization (icFA)
Day 84: 4th immunization (PBS)
Day 87: fusion.

Supernatants from hybridomas are tested in a Western blot. Invention appropriate monoclonal antibodies are detected.

Example 3 Preparation of a soluble Mgt derivative

The DNA for R. eutropha Mgt, which did not contain the information for the first 30 amino acids, was fused to the DNA for maltose-binding protein (MBP) and expressed (see FIG. 2). For this, a DNA segment coding for the amino acids 31-231 of Mtg was used with the oligonucleotide primers
d) A3715ACCGGCAGCTGCCGTCGCTCGACGCCCTC3745 and
c) [p. above]
amplified by PCR. The conditions for this were as given in Example 1.

After ligation with the plasmid pMALc2 (Maina et al., Gene 74 (1988), pp. 365-373), which had been cut with XmnI / HindIII gave the plasmid pMPE, which transforms into E. coli TB1 (Guan et al., Gene 67 (1987), pp. 21-30) has been. Protein expression was induced overnight with 0.3 mM IPTG. Inclusion bodies were again formed when the protein induced at 37 ° C has been. Surprisingly, however, at an induction temperature of 28 ° C isolated over 50% of the fusion protein from the soluble fraction. In In this connection it was noted that the cell growth of E. coli was immediate after induction of the vector containing the Mgt fusion protein, when the temperature was 28 ° C. At a temperature of 37 ° C the cells continued to grow, but with a reduced generation time, what concluded that the native form of Mgt has some cellular functions intervenes even if it is not translocated in the membrane.

After breaking up the cells in a French cell press and centrifuging the cell lysate, the fusion protein was purified from the supernatant using amylose affinity chromatography as described by the manufacturer (New England Biolabs, Schwalbach). The soluble Mgt was obtained after incubation of the fusion protein for 24 hours with factor Xa (2% w / w) at 4 ° C. In this connection, reference is made to FIG. 4.

Example 4 Expression of Mgt in R. eutropha

R. eutropha H16 (DSM 428; Yabuuchi et al., Microbiol. Immunol. 39 (1995), pp. 897-904) was in a mineral salt medium (Schlegel et al., Arch. Mikrobiol. 38 (1961), p. 119 -128) with 1.5% sodium gluconate as carbon source aerobic under an air flow of 500 ml / min. let grow. The cells were broken up in a French cell press and the membranes were separated from the cytoplasmic fraction by centrifugation (60 min., 18,000 rpm, Sorvall centrifuge). The cytoplasmic membrane proteins were solubilized with 2% sarcosyl for 20 minutes at room temperature and the unsolubilized outer membrane proteins and cell wall components were sedimented at 18,000 rpm for 40 minutes in a Sorvall centrifuge. The isolated Mgt was determined on a Western blot using polyclonal Mgt antibodies. The antibody reacted with the isolated membrane protein as well as with the recombinant protein which had been expressed in E. coli according to Example 3. In this connection, reference is made to FIG. 5. This example shows that Mgt is indeed a protein that is expressed in R. eutropha and is associated with the membrane of R. eutropha.

Claims (9)

1. Monofunctional glycosyltransferase which comprises the amino acid sequence of Fig. 1 or one of these by one or more amino acids under different amino acid sequence. 2. Glycosyltransferase according to claim 1, which from Ralstonia eutropha comes from. 3. DNA encoding the protein of claim 1 or 2, the DNA comprising:

• (a) the DNA of FIG. 1 or a DNA different therefrom by one or more base pairs,
• (b) a DNA hybridizing with the DNA of (a) or
• (c) a DNA related to the DNA of (a) or (b) via the degenerate genetic code.

4. Expression plasmid comprising the DNA of claim 3. 5. Transformant containing the expression plasmid according to claim 4. 6. A method for expressing the protein of claim 1 or 2, comprises send the cultivation of the transformant according to claim 5 under suitable conditions. 7. The method according to claim 6, wherein the transformant is E. coli and the Expression takes place as a fusion protein at temperatures of 25 to 35 ° C.   8. Antibody directed against the protein according to claim 1 or 2. 9. Use of the protein according to claim 1 as a target for antimicrobial Active ingredients.