DE1322476U - - Google Patents
Info
- Publication number
- DE1322476U DE1322476U DENDAT1322476D DE1322476DU DE1322476U DE 1322476 U DE1322476 U DE 1322476U DE NDAT1322476 D DENDAT1322476 D DE NDAT1322476D DE 1322476D U DE1322476D U DE 1322476DU DE 1322476 U DE1322476 U DE 1322476U
- Authority
- DE
- Germany
- Prior art keywords
- boi
- chemist
- λαε
- θράβη
- αθγ
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 241000196324 Embryophyta Species 0.000 claims 1
- 235000010627 Phaseolus vulgaris Nutrition 0.000 claims 1
- 244000046052 Phaseolus vulgaris Species 0.000 claims 1
- 235000013305 food Nutrition 0.000 claims 1
Landscapes
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
Publications (1)
| Publication Number | Publication Date |
|---|---|
| DE1322476U true DE1322476U (cg-RX-API-DMAC7.html) |
Family
ID=639748
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| DENDAT1322476D Active DE1322476U (cg-RX-API-DMAC7.html) |
Country Status (1)
| Country | Link |
|---|---|
| DE (1) | DE1322476U (cg-RX-API-DMAC7.html) |
-
0
- DE DENDAT1322476D patent/DE1322476U/de active Active
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| DE1322476U (cg-RX-API-DMAC7.html) | ||
| Carotti et al. | Gaseous emissions from municipal incinerators | |
| Lubis et al. | Strategi peningkatan kesadaran masyarakat dalam mengelola sampah di Desa Pematang Johar Kecamatan Labuhan Deli | |
| DE1380632U (cg-RX-API-DMAC7.html) | ||
| DE1312351U (cg-RX-API-DMAC7.html) | ||
| Haddady et al. | Implication of Scope of International Derived Responsibility: Comparative Study of Responsibility of States and International Organizations | |
| Izanloo et al. | Privilege Debt | |
| Suzuki et al. | Tissue-specific regulation of gene expression for renin and angiotensinogen | |
| DE1329516U (cg-RX-API-DMAC7.html) | ||
| DE1324082U (cg-RX-API-DMAC7.html) | ||
| DE1336149U (cg-RX-API-DMAC7.html) | ||
| DE1306286U (cg-RX-API-DMAC7.html) | ||
| DE1322031U (cg-RX-API-DMAC7.html) | ||
| GGACACTAGTGTGAGTAACTAGC | sRNA-Seq amplicon libraries generationa | |
| DE1288509U (cg-RX-API-DMAC7.html) | ||
| DE1298334U (cg-RX-API-DMAC7.html) | ||
| DE1313216U (cg-RX-API-DMAC7.html) | ||
| DE1333899U (cg-RX-API-DMAC7.html) | ||
| Barbir et al. | Refinements of Jessen’s functional | |
| Subgroup | IRD14-011 | |
| DE1287112U (cg-RX-API-DMAC7.html) | ||
| Johansson | Beyond vice | |
| DE1468594U (cg-RX-API-DMAC7.html) | ||
| Van Buren | Ostia, Cenni Storici e Guida. By Dante Vaglieri. 6½× 4¾, xii+ 150 pp. 5 plates, 25 text-illustrations. Rome: Ermanno Loescher & Co. 1914. Lire 4. | |
| DE1312301U (cg-RX-API-DMAC7.html) |