DE112015004935B4 - Primer set for the detection of the 8bp deletion mutation in exon 3 of the 21-hydroxylase (CYP 21) gene and method therefor - Google Patents

Abstract

Primer set for the detection of an 8bp deletion mutation in exon 3 of the 21-hydroxylase gene, which enables the diagnosis of congenital adrenal hyperplasia (Congenital Adrenal Hyperplasia CAH), comprising a forward (F) primer that is 21 base pairs long, and a 19 base pair reverse (R) primer with the sequence: i) (F) CAGACCTGAGCCACTTACCTGii) (R) CAGAGCAGGGAGTAGTCTC.

Description

FIELD OF THE INVENTION:

The present invention relates to a new primer set which is used to detect the 8bp deletion mutation in exon 3 of the 21-hydroxylase (CYP 21) gene. The mutation is one of the most common causes of classic congenital adrenal hyperplasia (Congenital Adrenal Hyperplasia CAH) with salt loss, a condition that can be fatal.

The present invention further relates to a PCR-based detection technique for the amplification of the 8bp region and control region in exon 3 of the 21-hydroxylase (CYP 21) gene.

STATE OF THE ART:

CAH is a treatable inherited condition with worldwide distribution. The disease is autosomal recessive with a prevalence that varies globally between 1: 10000 and 1: 15000 live births. However, no estimates are available for India. CAH is a disease that can lead to death, with early detection ensuring early treatment that helps the affected individual live a normal life.

The condition arises mainly due to mutations in the 21-hydroxylase gene (CYP 21), with a detection of these mutations providing a precise basis for its early diagnosis. Over the years, various working groups have used a number of DNA-based diagnostic techniques with different levels of sensitivity, namely Southern blotting, PCR-RFLP, real-time PCR, ACRS, MLPA, DGGE and reverse hybridization test methods based on test strips (CAH strip assay ). Other techniques, such as multiplex minisequencing, multiplex PMSG (Peptide Mass Signature Genotyping) and LC-MS / MS, have also been used by researchers with various degrees of specificity. With the advent of DNA sequencing techniques for mutation analysis in recent years, the gold standard for this diagnosis has now been made available.

From the U.S. patent number US8153962 B2 and US8415616 B2 a mass spectrometric method is known for the quantitative detection of one or more CAH group analyzes (ie, pregnenolone, 17-OH-pregnenolone, progesterone, 17-OH-progesterone, dehydroepiandrosterone (DHEA), androstenedione, testosterone, deoxycortocisterone isolate and 11-desoxycortisol ester, and 11-desoxy cortisol cortisol, 11-desoxy cortisol cortisol, and 11-deoxy cortisol cortisol, and 11-desoxy cortisol cortisol) ).

The method is not suitable for general use, since it requires special training for the handling of the mass spectrometer and its data interpretation. It turns out that with the exception of 17-OH progesterone, the hormone test procedures are not suitable for the diagnosis of CAH, since no normal ranges have been established for different populations in different age groups. In addition, the equipment as well as chemicals from other countries have to be requested, which increases its costs.

The U.S. patent number US4230684 A relates to a filter paper method that can be used to quantify steroids such as 17-hydroxyprogesterone for the diagnosis of CAH. The steroid is eluted from the filter paper and quantified using a radioimmunoassay. The method is particularly suitable for screening newborns.

Filter paper techniques have been used in conjunction with RIA in the screening of newborns as described here. However, the use of dangerous radioactive material is required. The borderline results have to be re-analyzed and confirmed by DNA sequencing.

From U.S. patent number US5807678 A the specific diagnosis of congenital lipoid adrenal hyperplasia is known via mutation analysis of the gene for StAR (steroid A-cute regulatory protein) protein by means of RFLP, nucleic acid hybridization or nucleotide sequencing.

Although these techniques are sensitive, they are very costly and labor-intensive and require a modern laboratory setup with state-of-the-art equipment.

Accordingly, there has been a long felt need to provide an improved method for detecting the 8bp deletion mutation in exon 3 of the CYP 21 gene that is inexpensive and labor intensive, and is also applicable to facilities with a low budget.

The present invention satisfies the long felt need to develop a new primer and novel PCR-based method for the detection of the 8bp deletion mutation in the gene that is simple and fast and is widely accepted in smaller laboratories that do not Enjoy support from first-class facilities.

OBJECTS OF THE INVENTION:

It is therefore an object of the present invention to propose a new primer set and a PCR-based technique as well as primers for the detection of the 8bp deletion mutation in CAH, which is simple and less labor-intensive.

Another object of the present invention is to propose a new set of primers and a PCR-based technique, as well as primers to detect the 8bp deletion mutation in CAH, which is inexpensive and can be performed on setups that lack the support of first-class facilities.

These and other objects and advantages of the invention will become apparent upon reading the following description in conjunction with the accompanying drawings.

Figure list

• 1 : Standardization of Biplex-PCR for the detection of the 8bp deletion: lane 1 : 100 bp DNA molecular weight ladder, traces 2nd , 3rd , 4th , 5 : Amplification at annealing temperatures of 45 ° C, 47 ° C, 48 ° C and 50 ° C with a normal sample DNA. Optimal amplification was obtained using annealing at 48 ° C. The amplicon at 340 bp corresponds to the 8 bp locus and the amplicon at 520 bp to the internal control area.
• 2nd : Evidence of the 8bp deletion. The biplex PCR test on a sample DNA with 8bp deletion: There is no amplification corresponding to the 8bp locus and only an amplification of the internal control region of 520 bp (lanes 2nd and 3rd ) observed.
• 3rd : DNA sequence of the 8bp locus in the normal control sample.
• 4th : DNA sequence of the sample with 8bp deletion. Deletion locus indicated by arrow.
• 5 : Fragment analysis of a normal control sample for the 8bp deletion locus.
• The presence of the two peaks at 150bp and 158bp denotes the existence of the 8bp region in the active gene.
• 6 : Fragment analysis of the test sample for the 8bp deletion locus. The absence of the peak at 158 bp denotes the deletion of the 8bp region in the active gene.

DETAILED DESCRIPTION OF THE INVENTION:

According to the present invention, a new primer set and also a PCR-based technique for detecting the 8bp deletion mutation in exon 3rd of the 21-hydroxylase (CYP 21) gene. The mutation is one of the most common causes of classic congenital adrenal hyperplasia (CAH) with salt loss, a condition that can be fatal.

The Biplex PCR technique was developed with the goal of providing a home diagnostic procedure that is applicable in a low budget environment.

In the sense of the present invention, we developed the biplex-PCR technique to specifically detect one of the frequently encountered mutations in CAH, ie 8bp deletion in the 21-hydroxylase gene. This 8bp deletion is a zero mutation that results in 100% inactivation of 21-hydroxylase activity, causing the severe salt loss form of CAH. The mutation is described worldwide in different ethnic groups, with the reported frequencies ranging from 4% to 26%. The techniques used were Southern blotting, RFLP, nested PCR and fragment analysis, each with different degrees of sensitivity. With a similar goal, an analysis was performed in our laboratory on a group of 70 clinically defined Indian CAH cases using DNA sequencing analysis. Our results showed that the 8bp deletion mutation was responsible for approximately 20% of the clinically suspected CAH cases (unpublished observation).

However, this DNA sequencing approach, which is costly and labor intensive, cannot be used in low budget environments. A PCR-based diagnostic technique with a built-in confirmation step would find wide acceptance in smaller laboratories that do not enjoy the support of first-class facilities.

The PCR-based confirmation test was developed by us, with which the 8bp deletion mutation can be precisely detected. The test to be carried out enables precise detection, comparable to DNA sequencing.

The test uses a biplex approach involving two sets of primers (Table 1). Amplificate name Primer sequence Amplificate size (bp) Forward (F) primer 8bp deletion CAGACCTGAGCCACTTACCTG 340 Reverse (R) primer 8bp deletion CAGAGCAGGGAGTAGTCTC Internal control forward (F) primer for 8bp deletion CTTCAGCATCTCCGGCTAC 520 Internal control reverse (R) primer for 8bp deletion GGAGCAATAAAGGAGAAACTGAT

The sequences of these primers are designed to have two different bands 340bp for the area encompassing the 8bp locus of the active gene and at 520bp that represent the internal control area. The internal control area was selected to represent a non-variable segment, the exon 9 and part of exon 10th of the active CYP21 gene contains. The selection of this non-variable range is based on our previously performed mutation analysis using sequencing in around 70 clinically diagnosed Indian CAH cases. The temperature profile over time for the PCR reaction was optimized using a normal sample, so that it separated the two specific bands of 340bp respectively. 520bp delivers as in 1 you can see. A reaction volume of 50 μl was used, the 200 ng genomic DNA, 1.5 mM MgCl ₂ , 0.2 mM dNTPs, 200 mM (NH ₄ ) ₂ SO ₄ , 750 mM Tris-HCl (pH 8.8), 0.1% Tween, 2 units Taq polymerase (Fermentas, Life Sciences) and 50 pmol primer set. The final temperature curve used over time was as follows: 5 min at 96 ° C for the first denaturation, followed by 30 cycles of 1 min at 95 ° C, 1 min at 48 ° C and 1 min at 72 ° C and 10 min final extension at 72 ° C. 2nd shows the PCR analysis in a known case of CAH due to the deletion of the 8bp region. PCR analysis on this sample showed a single band of 520bp that corresponds to the control fragment. This amplification of the control fragment alone, without the one corresponding to the 8bp locus, indicates a homzygote deletion of the 8bp site. DNA sequencing was used to reconfirm the 8bp locus in the normal sample as well as the 8bp deletion in the CAH sample ( 3rd , 4th ). A secondary confirmation of the results was also carried out using the fragment analysis method. For fragment analysis, primers were constructed in such a way that a peak in the presence of the 8bp region in the active gene 158bp along with a second peak at 150bp that corresponds to the same locus in the pseudo gene is obtained. 5 shows the fragment analysis of the normal sample with peaks from both 150bp for the pseudo gene as well 158bp for the active gene. Similar analysis in the CAH sample showed only a single peak of 150bp that corresponds to the pseudo gene ( 6 ). The absence of the 158bp -Peaks in this case confirmed the homozygous deletion of the 8bp region as observed via PCR as well as DNA sequencing. Thus, the existence or deletion of the 8bp region, as determined by the new PCR technique, was validated both with DNA sequencing and with fragment analysis.

Sequence listing

 <110> Indian Council of Medical Research

 <120> Primersatz zum Nachweis der 8bp-Deletion-Mutation in Exon 3 des
 21-Hydroxylase(CYP 21)-Gens und Verfahren hierfür

 <130> CAH - 8bp Deletion

 <140> DE 112015004935.5

 <141> 2015-10-29

 <150> IN 3088/DEL/2014

 <151> 2014-10-29

 <160> 8

 <170> BiSSAP 1.3

 <210> 1
 <211> 21
 <212> DNA
 <213> Homo sapiens

 <220>
 <223> Vorwärts (F)-Primer 8bp-Deletion

 <400> 1

 <210> 2
 <211> 19
 <212> DNA
 <213> Homo sapiens

<220>

 <223> Rückwärts (R)-Primer 8bp-Deletion

 <400> 2

 <210> 3
 <211> 19
 <212> DNA
 <213> Homo sapiens

 <220>
 <223> Interne Kontrolle Vorwärts (F)-Primer für 8bp-Deletion

<400> 3

 <210> 4
 <211> 23
 <212> DNA
 <213> Homo sapiens

 <220>
 <223> Interne Kontrolle Rückwärts (R)-Primer für 8bp-Deletion

<400> 4

 <110> Indian Council of Medical Research 

 <120> Primer set for the detection of the 8bp deletion mutation in exon 3 of the
 21-hydroxylase (CYP 21) gene and method therefor 

 <130> CAH - 8bp deletion 

 <140> DE 112015004935.5 

 <141> 2015-10-29 

 <150> IN 3088 / DEL / 2014 

 <151> 2014-10-29 

 <160> 8 

 <170> BiSSAP 1.3 

 <210> 1
 <211> 21
 <212> DNA
 <213> Homo sapiens 

 <220><223> Forward (F) primer 8bp deletion 

 <400> 1 

 <210> 2
 <211> 19
 <212> DNA
 <213> Homo sapiens 

 <220><223> Reverse (R) primer 8bp deletion 

 <400> 2 

 <210> 3
 <211> 19
 <212> DNA
 <213> Homo sapiens 

 <220><223> Internal control forward (F) primer for 8bp deletion 

 <400> 3 

 <210> 4
 <211> 23
 <212> DNA
 <213> Homo sapiens 

 <220><223> Internal control reverse (R) primer for 8bp deletion 

 <400> 4 

Claims (6)

Primer set for the detection of an 8bp deletion mutation in exon 3 of the 21-hydroxylase gene, which enables the diagnosis of congenital adrenal hyperplasia (Congenital Adrenal Hyperplasia CAH), comprising a forward (F) primer that is 21 base pairs long, and a backward (R) primer, 19 base pairs long, with the sequence: i) (F) CAGACCTGAGCCACTTACCTG ii) (R) CAGAGCAGGGAGTAGTCTC. Primer set after Claim 1 , further comprising two internal control primers with the base pair sequence: i) (F) CTTCAGCATCTCCGGCTAC ii) (R) GGAGCAATAAAGGAGAAACTGAT. Primer set after Claim 1 , wherein the sequences of the primers are designed to deliver two different bands at 340 bp, which represents a region comprising the 8 bp locus of the active gene, and at 520 bp for the internal control region. A method of detecting an 8bp deletion mutation in exon 3 of the 21-hydroxylase gene, comprising the steps of: i) taking up a reaction volume of 50 µl; ii) adding 1.5 mM MgCl ₂ , 0.2 mM dNTPs, 200 mM (NH ₄ ) ₂ SO ₄ , 750 mM Tris-HCl (pH 8.8) to the mixture followed by mixing 0.1% Tween, 2 units of Taq polymerase; iii) final addition of 50 pmol of the primer set according to one of the preceding claims, followed by an additional confirmation test achieved by fragment analysis, which gives a peak of 158 bp corresponding to the presence of the 8 bp region in the active gene. Procedure according to Claim 4 , the temperature curve used for different phases of the reaction being as follows: i) 96 ° C for 5 minutes for initial denaturation, followed by 30 cycles at 95 ° C for 1 minute; ii) 48 ° C for 1 minute; iii) 72 ° C for 1 minute; and iv) final extension at 72 ° C for 10 minutes. Using a procedure after Claim 4 or 5 for the diagnosis of congenital adrenal hyperplasia (Congenital Adrenal Hyperplasia CAH).

Images