DE10253068A1 - Analysis of methylation patterns in a genomic DNA comprises amplification of a target DNA by a method that retains the methylation pattern of the template, followed by analysis of the amplification product by mass spectrometry - Google Patents

Abstract

Analysis (M1) of methylation patterns comprising (a) isolation of genomic nucleic acids (NA) from a biological sample; (b) amplification of one or more target NA by a method that retains the methylation patterns in the amplification products; and (c) performing mass spectrometry on the amplified products or their fragments to determine the methylation pattern and/or status of the sample, is new. An Independent claim is also included for a kit for use in performing M1 comprising reagents for the methylation retaining amplification of genomic DNA, and reagents for the mass spectrometric analysis of nucleic acids.

Description

State of the art

The developments in the field molecular biology in particular have changed in the last decade focused on the analysis of the human genome. The recognized Benefit from understanding the functioning of the genome has to develop one Variety of techniques performed the for the analysis and manipulation of nucleic acid sequences are suitable. Techniques that reduce costs are of particular interest and increase the speed of genetic analysis. One such technique is the application of mass spectrometry to the analysis of nucleic acid sequences.

Mass spectrometry is an analytical technique with diverse Applications in the field of chemistry and biology. Their use excludes the exact one Determination of molecular weights, identification of chemical Structures by means of their fragmentation properties, the determination the composition of mixtures and the qualitative elementary analysis on. A sample is first ionized in a mass spectrometer, different ones Ion species are then classified according to their Mass / charge ratio separated and the relative abundance of each ion species is measured.

Of particular use for analysis of great molecules are time-of-flight mass spectrometers ("time-of-flight", TOF), which ions according to their mass / charge ratio by measuring the time it takes for the generated ones Ions have moved to a detector. TOF mass spectrometer are advantageous because they are relatively simple, inexpensive devices with a are practically unlimited mass / charge range. TOF mass spectrometer have a potentially higher Sensitivity as scanning devices because they all generated Record ions from each ionization event. TOF mass spectrometer are especially for the measurement of the mass / charge ratio of large organic molecules suitable where conventional magnetic field mass spectrometers Sensitivity is missing. The state of the art in TOF mass spectrometers is for example in the US patents Nos. 5,045,694 and 5,160,840.

TOF mass spectrometers have one Ionization source for the generation of ions of the sample material under investigation. The ionization source contains one or more electrodes or electrostatic lenses for acceleration and Focusing the ion beam. In the simplest case, the electrodes are Grid. A detector is used for the Detection of ions as a function of time in a given time Distance from the last grid placed. Usually is a distraction region between the last grid and the detector. The distraction region allows the ions to fly freely over the specified distance to move before hitting the detector.

The flight time one by a given electrical The voltage of accelerated ions is proportional to its mass / charge ratio. Therefore the flight time of an ion is a function of its mass / charge ratio and is approximate proportional to the square root of the mass / charge ratio. If one assumes the existence of only simply charged ions, this is achieved the lightest group of ions followed the detector first successively heavier mass groups.

The analysis of biological compounds like peptides and nucleic acids by mass spectrometry is hampered by the difficulty been ionizing big molecules to reach. This condition became gentler through the development Techniques such as fast atom bombardment (FAB) and electrospray ionization (ESI) shock activation / tandem MS improved.

However, the current method is the choice of analysis by matrix-assisted laser desorption / ionization (MALDI), see for example M. Karas, F. Hillenkamp. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal. Chem. 1988, Oct. 15; 60 (20): 2299: 301). With this procedure the analyte is embedded in a light-absorbing matrix. The Matrix is vaporized by a short laser pulse, which causes the analyte is transported unfragmented into the gas phase. Due to the collision with matrix molecules the analyte ionizes. An applied voltage accelerates the ions in a field-free flight tube. Because of their different masses the ions are accelerated to different speeds and smaller molecules reach the detector faster than larger ones. The basic ones Close advantages of this technique a relatively broad mass range, high resolution and sampling frequency (up to at 1 sample / second). In one respect, MALDI offers ESI and FAB a possible one Advantage because biomolecules of great Mass can be easily ionized and analyzed. Furthermore, unlike ESI, MALDI produces mostly simply charged species.

Although MALDI-TOF spectrometry is excellent it is suitable for the analysis of peptides and proteins showed that the analysis of nucleic acids is however somewhat more difficult is (I. G. Gut, S. Beck. DNA and Matrix Assisted Laser Desorption Ionization mass spectrometry. Current Innovations and Future Trends. 1995, 1; 147-57).

The problems include one Lack of resolution for DNA fragments of higher molecular weight, the instability of DNA and the interference of reagents in sample preparation on.

The sensitivity for nucleic acids is about 100 times worse than for peptides and decreases with increasing length of the nucleic acid. With Nuklein Acids that have a backbone with multiple negative charges make the ionization process via the matrix much less effective. The selection of the matrix plays a particularly important role in MALDI-TOF spectrometry. Various very effective matrices have been found for the desorption of peptides, which produce a very fine crystallization. Although various corresponding matrices are suitable for DNA analysis, the difference in sensitivity has not been reduced.

The difference in sensitivity can be reduced by such chemical modification of the DNA, making it more like a peptide. Phosphorothioate nucleic acids which the usual Backbone phosphates can be replaced with thiophosphates more easily using Alkylation process (I. G. Gut, S. Beck. A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 1995 Apr. 25; 23 (8): 1367-73) be converted into a charge-neutral DNA. The coupling of a charge marker to this modified DNA results in an increase in sensitivity to the same level as that for peptides. Another advantage of cargo marking is that it is increased stability compared to the analysis Contamination, which is the detection of unmodified substrates make it much more difficult.

There are also procedures for introducing modified ones Nucleotides, which are the nucleic acid stabilizing against fragmentation has been described (Schneider and Chait, Nucleic Acids Res., 23, 1570 (1995), Tang et al., J. At the. Chem. Soc. Mass Spectrom., 8, 218-227, 1997).

The use of non-fissile Mass markers have also been exploited to address the above defects turn. For example, Japanese Patent No. 59-131909 discloses the design of a mass spectrometer, the nucleic acid fragments detected by electrophoresis, liquid chromatography or high speed gel filtration were separated, in which atoms were incorporated into the nucleic acids. The Atoms that are not normally found in DNA are sulfur, Bromine, iodine, silver, gold, platinum, tin and mercury. See for example K. B. Jacobson, H. F. Arlinghaus, H. W. Schmitt, R. A. Sachleben, G.M. Brown, N. Thonnard, F.V. Sloop, R.S. Foote, F.W. Larimer, R. P. Woychik et al .. "An approach to the use of stable isotopes for DNA sequencing. "Genomics. 1991 Jan; 9 (1): 51-9.

MALDI-TOF analysis has been found in many Aspects of nucleic acid sequence analysis as useful proven, especially in DNA sequencing. For example Wang et al. (WO 98/03684) exploited the "in source fragmentation" and this with delayed pulsed ion extraction method for determining the sequence of nucleic acid analytes coupled. Other analysis techniques detect those by standard sequencing methods produced fragments. For example, U.S. Pat. No. 5,288,644 (Beavis et al.); US Pat. No. 5,547,835 (Koster) and U.S. Pat. No. 5,622,824 (Koster) Method for determining the sequence of a target nucleic acid using by MALDI-TOF on heads of the target, either by exonuclease digestion or by Sanger sequencing techniques.

Mass spectrometry is also for analysis known sequences have been used to determine the presence, location and identity of mutations to determine. Pat.-No. For example, US 5,605,798 discloses one A method wherein a DNA primer that is complementary to a target molecule in a region adjacent to the known region of interest is labeled with a DNA polymerase in the presence of a mass Dideoxynucleotide, extended becomes. The identity the mutation is then extended by analyzing the mass of the dideoxy DNA primers determined.

A particular advantage of mass spectrometer analysis compared to other commonly used molecular biological techniques is the ability to analyze many samples in a time and cost effective manner and thus their potential as a tool for high throughput. Technological advantages, such as those outlined in PCT application WO 95/04160 (Southern et al.), Enable effective analysis of the very widespread oligonucleotide array format (see for example EP 1138782 A2 ).

The methodological developments of the last years in molecular biology studied levels of observation are the genes, the translation of these genes in RNA and the resulting proteins. In particular have the effort in research on the sequences of genes and variations in Concentrated page sequences. However, the emphasis is on areas like proteomics, genomics and bioinformatics means analysis epigenetic variations don't get as much attention from the Science has received.

The question of which gene to which Time turned on in the course of an individual's development will and how the activation and inhibition of a specific Gene in specific cells and tissues is controlled with the degree and character of the methylation of the genes or genome correlated. In this context, pathogenic conditions in one amended Manifest methylation patterns of individual genes or the genome.

DNA methylation plays a role, for example, in the regulation of transcription, in genetic imprinting and in tumorigenesis. The methyl transfer reaction proceeds via a non-specific binding of the transferase to the hemimethylated strand, the identification of the target base follows from the recruitment of the methyl donor group, most often S-adenosyl-L-methionine (Ado-Met), to the active site. DNA methyltransferases (mSC-Mtase) insert a methyl group on the carbon in the 5-position. The reaction is carried out via a covalent intermediate between the enzyme and the base, whereby the target cytosine is folded away by 180 degrees. The mechanism of methyltransferase-dependent cytosine methylation is further described in articles such as Cheng and Robertson "AdoMet-dependent methylation, DNA methyltransferases and base flipping" Nucleic Acids Res. 15; 29 (18): 3784-95.

Different methytransferase species are have been identified for this invention the family of maintenance methyltransferases such as DNMT 1 are of particular interest which are the methylation patterns Propagate hemimethylated DNA within the unmethylated strand. The in vitro mechanism of action of DNMT 1 is completely in S. Pradhan, A. Bacolla, R.D. Wells, R.J. Roberts "Recombinant Human DNA (cytosine-5) methyl transferase. I. Expression, Purification and comparison of de novo and maintenance methylation. "J. Biol. Chem. 274: 33002-33010 and A. Bacolla, S. Pradhan, R. J. Roberts, R. D. Wells. "Recombinant human DNA (cytosine-5) methyl transferase. II. Steady-state kinetics reveal allosteric activation by methylated DNA "J. Biol. Chem. 12; 274 (46): 33011-9.

The identification of 5-methylcytosine as a component of genetic information is significant Interest. However, can the 5-methylcytosine positions were not identified by sequencing be because 5-methylcytosine has the same base pairing behavior as cytosine. Farther goes the epigenetic information carried by 5-methylcytosine while PCR amplification completely lost. Therefore, a new analysis method for the analysis of methylation patterns had to be developed become.

The most common method currently used Analyzing DNA for 5-methylcytosine is based on the specific Reaction of bisulfite with cytosine, which is followed by alkaline Hydrolysis is converted into uracil, which in its base pairing behavior matches that of thymine. An overview of others Known methods for the detection of 5-methylcytosine can be found in the following review article are taken from: T. Rein, M.L. DePamphilis, H. Zorbas, Nucleic Acids Res. 1998, 26, 2255.

The bisulfite-treated nucleic acids are then analyzed, usually using one or more different methods. For example, by amplifying a short, specific region of the treated nucleic acid, followed by sequencing. (A. Olek, J. Walter. The pre-implantation ontogeny of the H19 methylation imprint. Nat. Genet. 1997 Nov; 17 (3): 275-6), the estimation of individual cytosine positions by a primer extension reaction (ML Gonzalgo , PA Jones. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15; 25 (12: 2529-31, WO patent 9500669) or by enzymatic digestion (Z. Xiong, PW Laird. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun. 15; 25 (12) 2532–4). Detection by hybridization has also been described (Olek et al., WO 99 28498) The use of methylation-specific primers for the amplification of bisulfite-treated nucleic acids is another commonly used method and is described in Herman US Pat. No. 6,265,171. Other suitable methods include the use of oligonucleotide-based Tec Technologies such as quantitative methylation-specific fluorescence-based real-time PCR (described in US 6,331,393 ) and variations such as the use of dual probe technology (Lightcycler ^TM ) or fluorescence amplification primer (SunriseTM technology). Another suitable method for the use of probe oligonucleotides for the estimation of methylation by the analysis of bisulfite-treated nucleic acids is the use of blocker oligonucleotides. The use of blocker oligonucleotides has been described in BioTechniques 23 (4), 1997, 714-720 D. Yu, M. Mukai, Q. Liu, C. Steinman, although this reference does not apply this tool to the determination of Describes methylation patterns by analysis of bisulfite-treated nucleic acids.

However, none of the currently used Procedure for the analysis of methylation patterns directly using mass spectrometry use, since the analysis of very small nucleic acid samples is not without prior Amplification of the sample can be carried out is. None currently known method of nucleic acid amplification conserves these methylation patterns, which is why the application is currently of mass spectrometry in the analysis of methylation patterns at available biological samples not possible is.

description

The method according to the invention provides a means ready for analysis of methylation patterns in nucleic acids. This method allows the estimate complex methylation pattern using methylation-preserving amplification a nucleic acid sample, followed by mass spectrometric analysis. The method according to the invention thereby provides improvements over the prior art, that it is especially for the analysis of biological samples with medium or high throughput suitable.

• a) Isolierung genomischer Nukleinsäuren aus einer biologischen Probe,
• b) Amplifikation einer oder mehrere Target-Nukleinsäuren dieser genomischen Nukleinsäuren in einer Art, durch welche die Methylierungsmuster dieser genomischen Nukleinsäuren in der amplifizierten Nukleinsäure erhalten bleiben,
• c) Durchführung der Massenspektrometrie an dieser amplifizierten Nukleinsäure oder deren Fragmenten, um Massenspektren zu erhalten,
• d) Auswertung der erhaltenen Massenspektren und
• e) Bestimmung der Methylierungsmuster und/oder des Methylierungsstatus der Probe.

It is an object of the present Er to provide a method for analyzing methylation patterns comprising the following steps:

• a) isolation of genomic nucleic acids from a biological sample,
• b) amplification of one or more target nucleic acids of these genomic nucleic acids in a manner by which the methylation patterns of these genomic nucleic acids are retained in the amplified nucleic acid,
• c) carrying out the mass spectrometry on this amplified nucleic acid or its fragments in order to obtain mass spectra,
• d) evaluation of the mass spectra obtained and
• e) Determination of the methylation pattern and / or the methylation status of the sample.

According to the invention, it is preferred that in step a) the genomic DNA from cells or cellular components, which DNA is obtained, the DNA sources being, for example, cell lines, Biopsies, blood, sputum, stool, urine, cerebral spinal fluid, tissue embedded in paraffin, such as tissue from the eyes, intestines, kidneys, Brain, heart, prostate, lungs, chest or liver, histological slides and all sorts Combinations thereof.

• i) Amplifikation der genomischen Target-Nukleinsäuresequenz in semikonservativer Art,
• ii) Methylierung des synthetisierten Strangs, wodurch der 5'-Methylierungsstaus des Cytosins des CG-Dinukleotids im Templat-Strang in das CG-Dinukleotid des synthetisierten Strangs kopiert wird.

According to the invention, it is also preferred that step b) is carried out by means of the following additional steps or substeps:

• i) amplification of the genomic target nucleic acid sequence in a semi-conservative manner,
• ii) Methylation of the synthesized strand, whereby the 5'-methylation congestion of the cytosine of the CG dinucleotide in the template strand is copied into the CG dinucleotide of the synthesized strand.

• iii) Denaturierung der doppelsträngigen Nukleinsäuren, um einzelsträngige Nukleinsäuren zu bilden,
• iv) Wiederholung der Schritte i) bis iii), bis eine gewünschte Anzahl von Amplifikaten erhalten wurde.

In this case, it is particularly preferred that the method further comprises the following steps:

• iii) denaturing the double-stranded nucleic acids to form single-stranded nucleic acids,
• iv) repetition of steps i) to iii) until a desired number of amplificates has been obtained.

It is also preferred that in step i) the amplification method is selected from: ligase chain reaction, Polymerase chain reaction, polymerase reaction, rolling circle replication.

It is particularly preferred that in step ii) this methylation is carried out with enzymatic means. A preferred enzyme is a maintenance methyl transferase.

According to the invention, it is also preferred that the methyl transferase is DNA-5-cytosine methyl transferase (DNMT 1).

According to the invention it is also preferred that the methyl group from the donor molecule S-adenosylmethionine is obtained.

• (1) Erhitzen der genomischen DNA auf eine Temperatur, die geeignet ist, Denaturierung zu bewirken,
• (2) Abkühlen der denaturierten DNA in Anwesenheit von einzelsträngigen Oligonukleotid-Primern, so dass die Primer sich an die DNA anlagern,
• (3) Erhitzen der Mischung in Anwesenheit einer Polymerase und Nukleotiden auf eine Temperatur, so dass die Primer verlängert werden,
• (4) Inkontaktbringen der doppelsträngigen Nukleinsäure mit Enzymen und/oder Agenzien unter Bedingungen, die derart zur Methylierung des synthetisierten Strangs führen, dass die CpG-Dinukleotide in dem synthetisierten Strang gemäß des Methylierungsstatus des korrespondierenden CpG-Dinukleotids des Templat-Strangs methyliert werden, wodurch das genomische Methylierungsmuster erhalten bleibt,
• (5) Wiederholen der Schritte (1) bis (4) in gewünschter Anzahl, bis eine gewünschte Anzahl von Nukleinsäuren erhalten wurde.

In a preferred embodiment of the invention, step b) of the method is carried out using the following additional steps or substeps

• (1) heating the genomic DNA to a temperature suitable for causing denaturation,
• (2) cooling the denatured DNA in the presence of single-stranded oligonucleotide primers so that the primers attach to the DNA,
• (3) heating the mixture in the presence of a polymerase and nucleotides to a temperature so that the primers are extended,
• (4) contacting the double-stranded nucleic acid with enzymes and / or agents under conditions that lead to methylation of the synthesized strand such that the CpG dinucleotides in the synthesized strand are methylated according to the methylation status of the corresponding CpG dinucleotide of the template strand, thereby the genomic methylation pattern is preserved,
• (5) Repeating steps (1) to (4) in the desired number until a desired number of nucleic acids has been obtained.

In the method according to the invention it is preferred that the amplified nucleic acids prior to step c be fragmented. It is further preferred that this Fragmentation is carried out with enzymatic or chemical means.

In the method according to the invention it is preferred that step c) by means of time-of-flight MALDI or ESI mass spectrometry carried out becomes.

It is also preferred that at step c) internal and / or external calibration is used.

According to the invention, it is also preferred that Step c) the nucleic acids getting cleaned. It is particularly preferred that this nucleic acids single stranded are.

It is also preferred according to the invention that the amplified nucleic acids are less than 100 base pairs long.

According to the invention, it is also preferred that all during Step b) used primer oligonucleotides do not contain CG dinucleotides.

It is special according to the invention preferred that these amplificates be immobilized on a solid phase are.

It is also a method according to the invention preferred, wherein the synthesized amplificates at least one chemical modification of an internucleoside bond, a sugar backbone or contain a nucleoside base.

• d) Vergleichen der erhaltenen Massenspektren mit Referenz-Massenspektren, die von der Nukleinsäure in ihrer vollständig methylierten und/oder vollständig unmethylierten Form erhalten wurden und
• e) über diesen Vergleich die Bestimmung ob Fragmente methyliert sind, unmethyliert oder teilweise methyliert sind und dadurch die Bestimmung des Methylierungsmusters der Nukleinsäure.

A method according to the invention is also preferred, in which steps d) and e) are carried out as follows:

• d) comparing the mass spectra obtained with reference mass spectra obtained from the nucleic acid in its fully methylated and / or completely unmethylated form and
• e) by means of this comparison, the determination of whether fragments are methylated, unmethylated or partially methylated and thereby the determination of the methylation pattern of the nucleic acid.

• d) Bestimmung des Molekulargewichts des Fragments oder der Fragmente
• e) Bestimmung des Methylierungsstatus dieser Fragmente.

In another exemplary embodiment preferred according to the invention, it is also preferred that steps d) and e) are carried out as follows:

• d) determination of the molecular weight of the fragment or fragments
• e) Determination of the methylation status of these fragments.

According to the invention, it is also preferred that the methyl group carries a detectable marker which is synthesized in the Nucleic acid strand is incorporated.

According to the invention, it is also preferred that a mass marker into the amplified nucleic acids is incorporated.

Another object of the present invention is the use of a method according to the invention as described above for analysis of methylation patterns in genomic DNA.

• – Reagenzien für die methylierungserhaltende Amplifikation von genomischer DNA
• – Reagenzien für die massenspektrometrische Analyse von Nukleinsäuren.

The third subject of the present invention is a kit for the analysis of methylation in nucleic acids according to a method according to the invention, comprising

• - Reagents for methylation-maintaining amplification of genomic DNA
• - Reagents for mass spectrometric analysis of nucleic acids.

• a) Isolierung genomischer Nukleinsäuren aus einer biologischen Probe,
• b) Amplifikation einer oder mehrerer Target-Nukleinsäuren dieser genomischen DNA in einer Art, dass die Methylierungsmuster dieser genomischen Nukleinsäuren in der amplifizierten Nukleinsäure erhalten bleiben,
• c) Ausführung von Massenspektrometrie an diesen amplifizierten Nukleinsäuren oder deren Fragmenten, um ein Massenspektrum zu erhalten.

In other words, the object of the invention is achieved by a method comprising the following steps:

• a) isolation of genomic nucleic acids from a biological sample,
• b) amplification of one or more target nucleic acids of this genomic DNA in such a way that the methylation patterns of these genomic nucleic acids are retained in the amplified nucleic acid,
• c) Execution of mass spectrometry on these amplified nucleic acids or their fragments in order to obtain a mass spectrum.

In a particularly preferred embodiment the results of the mass spectrometric analysis are then either by comparison with a signature spectrum and / or by the Analysis of the molecular weight of the fragments produced was analyzed. The analysis or analyzes then become the methylation pattern of the interesting genomic region.

In the first step of the process genomic DNA is isolated from biological samples. suitable Close sources one, but are not limited on cells or cell components, for example cell lines, biopsies, Blood, sputum, stool, urine, cerebrospinal fluid, tissue embedded in paraffin such as tissue from the eyes, intestines, kidneys, brain, heart, prostate, lungs, Breast or liver, histological sections or combinations thereof.

The DNA is then extracted by means which are known to those of ordinary skill in the art who use detergent lysates, ultrasound and swirling with glass beads lock in. As soon as the nucleic acids have been extracted, the genomic double-stranded DNA for the analyzes used.

In the second step of the process becomes one or more preselected regions of the genomic DNA amplified in a way by which the methylation pattern of this genomic DNA are retained in the amplified nucleic acids.

The third step of the process the amplificates or their fragments by mass spectrometry analyzed. The methylation pattern of the genomic nucleic acid is then determined by analyzing the mass spectrum. Preferably happens by time-of-flight mass spectrometry using MALDI or ESI procedure.

In a preferred embodiment comprises The second step of this procedure is the following steps.

In the first step of the process is the semi-conservative replication of the genomic target nucleic acid sequence performed in such a way that the resulting amplificate is a hemimethylated nucleic acid. It can be any method of semi-conservative in vitro replication be applied.

These procedures are more specific to amplification DNA targets are based on the template-directed oligonucleotide primer extension Polymerases. Enzymatic processes are particularly preferred isothermal replication (also known as rolling circle replication), Ligase-based reactions and polymerase-based reactions.

The most commonly used by these methods is the polymerase chain reaction (K. Mullis et al. Cold Spring Harbor Symp. Quant. Biol. 51: 263-273 (1986); H. Ehrlich et al., EP 50424 ; EP 84796 . EP 258017 . EP 237,362 ; K. Mullis, EP 201184 ; K. Mullis et al. US Pat. No. 4,683,202; H. Erlich, U.S. Pat. No. 4582788, R. Saiki et al. US Pat. 4683194 and R. Higuchi "PCR Technology", H. Ehrlich (ed.), Stockton Press, NY, 1989, pages 61-68).

In the first step, the DNA double helix is denatured by transient heating. That follows Annealing of two primer species, each to a strand of DNA. Subsequently, the attached primers are extended using a polymerase and dNTPs.

Other suitable methods include the ligase chain reaction and variants of it. In the ligase chain reaction, two Probe oligonucleotides hybridized to a single-stranded template nucleic acid in such a way that the 5 'end an oligonucleotide probe next to the 3 'end of the other oligonucleotide probe, making it possible to that the two oligonucleotides are linked together by a ligase become. In a variant of the ligase reaction in which the ends are not are adjacent to each other, the gap between the two oligonucleotides be "filled in" by the action of a polymerase.

Both the ligase and polymerase reactions are commonly referred to as chain reactions, by performing a Denaturation step. The two strands are heat denatured and this enables the resulting single-stranded nucleic acid as Template nucleic acid in subsequent cycles of ligase or polymerase Nucleic acid replication to be used, the reaction cycles being repeated in the desired number can.

According to the invention, each of these "chain reaction processes" can be carried out before the denaturation step execution of a methylation step described below.

Isothermal rolling circle nucleic acid amplification is done by circularizing the target nucleic acid, below referred to as the Amplification Target Circle (ATC). The circularized nucleic acid then becomes isothermal using rolling circle replication primers and replicated with a polymerase enzyme. There is no denaturing and annealing levels, therefore, DNA replication is both continuous and isothermal. The resulting DNA comprises a chained linear DNA, with too the ATC of identical sequence. There are different versions of the Process has been described, see for example US Pat. No. 5,871,921 (Landgren et al.).

The design of primers for replication or Amplification of genomic DNA using those described above Procedure, should be obvious to one of ordinary skill in the art. These should include at least two oligonucleotides, the Sequences complementary to be or identical to a segment at least 18 base pairs long, the adjacent to the base sequences to be analyzed. In one in particular preferred embodiment these primers are designed to have a nucleic acid sequence with a length amplify from no more than 100 base pairs. Furthermore are these primers are preferably characterized in that they have no CpG dinucleotides contain.

The next step is the newly synthesized unmethylated strand of the double-stranded nucleic acid is selective methylated. This methylation reaction is carried out on specific cytosine bases of CG dinucleotides, with reference to the methylation status of the template strand the nucleic acid, carried out. Where a CG dinucleotide is methylated on the template strand, the cytosine is on the newly synthesized strand, which is attached to the guanine of this dinucleotide is hybridized, methylated at the 5 'position.

In a preferred embodiment of the This is achieved by bringing the double-stranded nucleic acid into contact with the process a methyltransferase enzyme and a methyl donor molecule, under Conditions that lead to methylation of the synthesized strand are carried out. The The methylation effect of this enzyme is such that the CpG dinucleotides in the synthesized strand according to the methylation status of the corresponding CpG dinucleotide be methylated on the template strand and thereby the genomic Methylation pattern remains.

In a preferred embodiment of the In the present invention, the methyl transferase is a maintenance methyl transferase. For the Use suitable methylation enzymes in step D of the process are limited to those which are able to position the cytosine in the 5-position according to the methylation status in the to methylate the corresponding CpG dinucleotide on the template strand. In the event that a cytosine in a CpG on the template strand is methylated, the corresponding CpG on which it is the synthesized strand is hybridized by the action of Enzyme at the 5 'position of the cytosine base methylated. If the cytosine in this CpG is unmethylated, it remains corresponding CpG unmethylated on the synthesized strand. The reaction is carried out using appropriate buffers and others Reagents and the reaction conditions recommended by the manufacturer of the enzymes carried out, what a methyl donor molecule how, but not limited on S-adenosylmethionine lock in can. The enzyme can be from any source, e.g. B. human, Mouse, recombinant. In a particularly preferred embodiment is the methyltransferase DNA-5-cytosine methyltransferase (DNMT 1).

It is preferred according to the invention that the methyl donor molecule S-adenosylmethionine is.

According to the invention, it is also preferred that the methyl group carries a detectable marker which is synthesized in the Nucleic acid strand incorporated becomes.

In a wide preferred exemplary embodiment of the method, a denaturation step is carried out following the steps of replication and methylation. This is preferably done in the form of heat denaturation, the dop pel-stranded nucleic acid is heated to a temperature which is suitable for breaking the hybridization bonds between the two strands. Suitable temperatures should be obvious to one of ordinary skill in the art and depend on the length of the amplificates and the CG content of the nucleic acids.

These are denatured strands then as template nucleic acids for one further run of the template-directed oligonucleotide extension, followed by the methylation steps and denaturation steps described above, used. These steps can in desired Number are repeated in order to amplify the target nucleic acid in the desired copy number, in a similar way Similar to the polymerase chain reaction or the ligase chain reaction.

In a particularly preferred embodiment this procedure involves the following steps.

• (a) heating the genomic DNA to a temperature, which is suitable for causing denaturation
• (b) cooling the DNA in the presence of single-stranded oligonucleotide primers, so that the primers attach to the DNA
• (c) heating the mixture in the presence of a polymerase and Nucleotides to a temperature so that the primers are extended.
• (d) contacting the double-stranded nucleic acid with a methyl transferase and a methyl donor molecule Conditions that lead to methylation of the synthesized strand such that the CpG dinucleotides in the synthesized strand corresponding to the Methylation status of the corresponding CpG dinucleotide the template strand are methylated, creating the genomic methylation pattern preserved
• (e) repeating steps AD in the desired number by a desired number of nucleic acids to obtain.

The for each stage of the process suitable reaction temperatures are for the average person skilled in the art be obvious since they are analogous to those used in standard polymerase chain reactions are. Typically these are in the range of 94 ° C for denaturation, 55 ° C for annealing and 72 ° C for the Extension lie. It is also possible, to combine the annealing and extension incubations to make one To obtain a second temperature incubation process, typically around 94 ° C for denaturation and around 50-65 ° C for an annealing and extension incubation. The optimal incubation temperatures and times differ for different targets and Primer oligonucleotides since the effective temperatures depend on factors such as nucleic acid length and depending on the G / C content are.

The third step will be the amplificates were analyzed by mass spectroscopy. More preferred this is done by ESI (electron spray ionization) or MALDI-TOF (Matrix-assisted Laser desorption / ionization-time of flight) mass spectrometry.

Before the mass spectrometric analysis of the Amplificates must various modifications are carried out on the amplified nucleic acid, to facilitate the detectability in the mass spectrometer. This Close modifications one, but are not limited modifications of the internucleoside bonds, the sugar backbone or the bases. This Modifications can during or be carried out after the synthesis of the amplificates.

It is a particularly preferred one embodiment of the method that before the spectrometric analysis of the amplified Nucleic acid this nucleic acids be fragmented for better detectability in the mass spectrometer to reach. Stronger this fragmentation is preferably carried out in a sequence-specific manner. method for fragmentation of nucleic acids will be known to those of ordinary skill in the art.

The sequence-specific fragmentation the amplificates can be either chemical or enzymatic Means executed become. The enzymatic cleavage of nucleic acids can be done by a variety of ribo- and deoxyribonucleases or glycosylases can be achieved. The advantage is that prior knowledge of the sequence of the fragments is a Fragmentation of the amplificates into predetermined fragments, preferred with "blunt" ends (in which none single There are 3 'or 5' overhangs after splitting), enable would.

The chemical cleavage is one less consuming and more robust, but less site-specific, assay. Chemically modified Internucleoside bindings at specified locations in the amplificate introduced will allow predetermined fragmentation and MALDI-TOF detection. Examples Cleavable nucleotide modifications include that in triphosphate form Available "achiral" 5'-phosphoramidate analogs one that can be provided by some polymerases and wherein cleavage under the acidic conditions of many commonly used MALDI matrices occurs.

Another useful modification that a preferred embodiment of the invention is the incorporation of deoxyuridine into the amplified nucleic acid, digestion with uracil-N-glycosidase then for fragmentation the nucleic acid leads.

Another preferred exemplary embodiment which is suitable for facilitating the detectability in the base of the mass spectrometer is the incorporation of 7-desaguanosine and 7-desaadenosine into the amplificate. These compounds are reported to inhibit nucleic acid during the Stabilize mass spectrometry.

In a further preferred embodiment the sugar backbone of the process amplified nucleic acid according to the teachings of Gut et al., U.S. Patent 6,268,129. In this method, the amplified nucleic acid is under Use of a phosphorothioate bond or a phosphorus selenoate bond between the sugar residues and a positively charged marker or one half synthesized. The synthesized amplificate is then alkylated to eliminate the charge on the phosphorothioate bond or phosphorus selenoate bond, making it possible for an average specialist to form the backbone of the nucleic acid to charge selectively.

The sensitivity of the technique can also through the use of internal and / or external calibration tools, as known in the art, who improved. calibration means are analytes of known mass, which are analyzed by the mass spectrometer and are used as reference analytes for accuracy and precision of the masses when analyzing an unknown compound. Internal calibration means are added to the sample to be analyzed thereby analyzed at the same time, whereas external calibration means not added to the sample and are analyzed separately.

Before the mass spectrometric analysis of the Amplificate may be desirable be to purify the amplificate to remove contaminants such as polymerase, Remove salts, primers and triphosphates. Anyone can do that Agents that are standard in the art, including precipitation, ion exchange spin columns, filtration, Dialysis and ion exchange chromatography are done. A special one preferred method is the use of (magnetic) glass balls, to nucleic acids one specific size range precipitate and make it possible to make them vigorous getting washed. Such a commonly used one is suitable Technique is labeling the amplification primer with biotin. The biotin-labeled strand is then bound to streptavidin captured the single-stranded nucleic acids are then used in the analysis.

In a particularly preferred embodiment is the methylation pattern of the genomic nucleic acid Analysis of the mass spectrum obtained determined.

In a particularly preferred embodiment of the method, the mass spectrum obtained with a mass spectrum of fragments compared from known samples of both the methylated as well as the unmethylated version of the target nucleic acid were.

These known spectra are referred to as "reference" spectra. A simple comparison of the sample spectrum with the reference spectra enables the Determination of the methylation status of the sample.

In another embodiment the procedure will be the ratio Mass used to charge the amplificate or its fragments to determine the molecular weight of each of these nucleic acids and thereby to determine their methylation status. However, this is the procedure only possible there where the sequence of these nucleic acids is known.

In another embodiment of the procedure the nucleic acids before high density mass spectrometric analysis on a solid surface be immobilized. In one embodiment, the primer oligonucleotide, directly or using a cross-linking agent, on a solid carrier immobilized. The amplification and methylation reactions are then on the solid surface carried out.

Preferred solid supports are those that can support the binding of nucleic acids in high density. It can use a variety of insoluble substrates be used including, but not limited on, silica gel, cellulose, glass fiber filters, glass surfaces, metal surfaces (steel, Gold, silver, aluminum, silicon and copper), plastics (e.g. Polyethylene, polypropylene, polyamide, polyvinylidene difluoride) and Silicon.

Anyone, an average specialist, can do it known, linker can be used, which is suitable for nucleic acids for mass spectrometric Analysis on solid supports to immobilize. Preferred linkers are selectively cleavable linkers, cleavable Linkers such as bismaleimidoethoxypropane, acid-labile, photolytically cleavable and heat sensitive linkers.

In a particularly preferred embodiment becomes the nucleic acid immobilized using a photolytically cleavable half, which during the Mass spectrometry is split off. Exemplary photolabile Close crosslinker one, but are not limited on, 3-amino- (2-nitrophenyl) propionic acid (Rothschild et al. (1996) Nucleic Acids Res. 24: 361-66).

In an alternative preferred embodiment can the left half be a chemically cleavable linker molecule. In this case, they are acid labile Linker for mass spectrometry, especially MALDI-TOF-MS, particularly preferred because the acid labile Bond during the pretreatment of the nucleic acid, for example by adding the 3-HPA (3-hydroxypicolinic acid) matrix solution becomes.

In the embodiments of the method in which no cross-linking reagent is used, a modified primer oligonucleotide can be bound to a solid surface by direct reaction with a suitably functionalized surface to give an immobilized nucleic acid. Consequently, for example React iodoacetyl-modified surface (or other thiol-reactive surface functionality) with a thiol-modified nucleic acid to provide immobilized nucleic acids.

Multiple species of primer oligonucleotides can on a flat solid phase in the form of a rectangular or hexagonal grid, also known as an "array".

An overview of the state of the art at Oligomer array manufacture can be one published in January 1999 Special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), and the literature cited therein.

Furthermore, an object of present invention a kit, which is preferably composed of two reagent sets is. One for the methylation-maintaining amplification of the target nucleic acids required first Reagent set, accordingly Polymerase and / or methyltransferase enzymes, primer oligonucleotides and may include methyl donor reagents. A second set of reagents provides reagents for the mass spectrometric analysis of the nucleic acid amplificates is required, for example, but not limited to, a suitable matrix material for MALDI analysis.

As used herein, refers to the term "nucleic acid" on oligonucleotides or polynucleotides such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) as well as on analogs of both RNA and DNA, for example from nucleotide analogs, each in single or double stranded form is present or can form triple helices. Nucleic acid molecules can be synthesized or can from special biological samples using any Number of methods to be isolated that are well known in the art are, the specially selected Procedure for the special biological sample must be suitable.

As used herein, nucleotides include nucleoside mono-, di-, and triphosphates on. Nucleotides can also include modified nucleotides such as phosphorothioate nucleotides and deazapurine nucleotides.

The term "methylation pattern" as used herein means the specific sequence of the 5'-methyl groups that are bound to cytosine bases in a nucleic acid, more precisely said where these cytosine bases are part of a CG dinucleotide.

The term "methylation-maintaining amplification" as used herein means amplification of a nucleic acid, in which the methylation pattern copies of the template nucleic acid Template nucleic acid is preserved.

"Mass spectrum" refers to a graphic representation of the ionic species, according to their Mass / charge ratio are separated. The spectrum is a plot of m / z against the measured frequency of the ions.

The term "target nucleic acid" refers to one according to the present invention disclosed method of amplifying and analyzing nucleic acid sequence.

The term "template-directed oligonucleotide primer extension" refers to the replication of a single strand Sequence by means of hybridization of a primer oligonucleotide, preferred and the 3 'end this sequence, followed by the enzymatic extension of this primer by enzymatic means.

"Semiconservative Replication "how As used herein, replication of template nucleic acid means where each de copy of this nucleic acid consists of the template strand and a synthesized strand.

The term "template strand" refers to single-stranded nucleic acid which as a template for one Nucleic Acid Amplification or replication by means of a template-directed oligonucleotide primer extension reaction serves. This expression also refers to the use of Nucleic acid during successive Cycles of this enzymatic process, e.g. B. polymerase chain reaction, Ligase chain reaction.

The term "synthesized strand" refers to the product of the template-directed oligonucleotide primer extension reaction, where this nucleic acid not even as a template in a template-directed oligonucleotide primer extension reaction served.

"Amplification" of nucleic acids or Polynucleotides is any process that is used to form a copy or several copies of a nucleic acid or a polynucleotide molecule (exponential Amplification) or to form one or more copies of only a complement of a nucleic acid or a polynucleotide (linear amplification) leads.

Examples

example 1

Methylation preserving PCR amplification

Genomic DNA, commercially available from Promega, is used in the analysis. A CpG-rich fragment of the regulatory region of the GSTPi gene is used in the analysis. The DNA is first artificially methylated at all cytosine 5 positions in the CpGs (Aufmethylie tion). The methylated DNA is then amplified using a PCR run. The resulting amplificate is then separated into two samples, sample A (the control sample) is amplified using conventional PCR. Sample B is amplified according to the disclosed method. The two Samples are then compared to demonstrate the presence of methylated CpG positions in Sample B. The comparison is carried out by means of a bisulfite treatment and the analysis of the treated nucleic acids.

Aufmethylierung

reagents:

DNA
SssI methylase (concentration 2 units / μl).
SAM (S-adenosylmethionine)
4.5 μl Mss1 buffer (NEB buffer B + (10 mmol Tris-HCl, 300 mmol NaCl, 10 mmol Tris-HCl, 0.1 mmol EDTA, 1 mmol dithiothreitol, 500 μg / ml BSA, 50% glycerol (pH 7.4 at 25 ° C) pH 7.5; 10 mmol MgCl ₂ ; 0.1 mg / ml BSA)
dd water (0.2 μm filtered, autoclaved, DNase, RNase, protease and phosphatase free)

Method:

The reagents are mixed and at 37 ° C for 16 Incubated for hours. The sample can then be stored in the refrigerator (+4 ° C).

The methylated DNA is under Digested use of restriction enzyme.

PCR

reagents:

Primer I: TTCGCTGGAGTTTCGCC (SEQ ID No .: 1)
Primer II: GCTTGGGGGAATAGGGAG (SEQ ID No .: 2)
HotStart Taq polymerase (QIAGEN)
10 × PCR buffer (QIAGEN)
dNTP solution (25 mmol each)
Water (0.2 μm filtered, autoclaved, DNase, RNase, protease and phosphatase free).

The reagents must be in a reaction solution mix in the above order. The reaction solution is then over in a thermal cycler the cycle described below. An initial one Denaturation is carried out at 95 ° C for 15 min. carried out. This is followed by primer annealing at 55 ° C for 45 seconds and elongation at 72 ° C for 1.5 Min ..

The resulting reaction solution is then divided into two equal samples, A and B. Every sample will be like treated below.

Sample A

Standard PCR as described above. The reaction is over 40 cycles at 95 ° C for 1 minute, 55 ° C for 45 seconds and elongation at 72 ° C for 1.5 min. guided.

Sample B

reagents:

Human DNA-S-cytosine methyltransferase (New England Biolabs)
DNMT-1 reaction buffer (50 mmol Tris-HCl pH 7.8, 1 mmol EDTA, 1 mmol dithiothreitol, 7 μg / ml PMSF, 5% glycerol) 100 μg / ml BSA

• 1. DNA wird ausgefällt und pelletiert, unter Verwendung von DNMT-1-Reaktionspuffer, DNMT und BSA resuspendiert.
• 2. Die Reaktionslösung wird bei 37 °C inkubiert.
• 3. DNA wird ausgefällt und pelletiert, unter Verwendung der PCR-Reagenzien wie oben resuspendiert.
• 4. Ein PCR-Zyklus wird bei 95 °C für 1 Minute, 55 °C für 45 Sek. und Elongation bei 65 °C für 2 Min. durchgeführt.

Steps 1 to 4 are repeated 40 times:

• 1. DNA is precipitated and pelleted, resuspended using DNMT-1 reaction buffer, DNMT and BSA.
• 2. The reaction solution is incubated at 37 ° C.
• 3. DNA is precipitated and pelleted, resuspended using the PCR reagents as above.
• 4. A PCR cycle is carried out at 95 ° C for 1 minute, 55 ° C for 45 seconds and elongation at 65 ° C for 2 minutes.

Sample Analysis

Both samples are analyzed to determine their relative degree of methylation. In a first The two samples were treated to step between methylated and unmethylated cytosines. The treatment is made using a sodium disulfite solution executed. the treatment transfers cytosine in thymine during 5-methyl cytosine is retained as cytosine. Sample A is thereby Thymine-rich compared to Sample B, which is relatively cytosine-rich is. The bisulfite treatment following, both samples are analyzed by sequencing to their degree of methylation (i.e. the relative concentrations of Cytosine and thymine). The sequencing is done using the Sanger process using the "ABI-310 sequencer" (Applied Biosystems).

Example 2

Mass spectrometry Analysis of a methylated oligonucleotide

A test sample (not from one Patients) of an oligonucleotide of known sequence and unknown Methylation status is provided. It's supposed to be the methylation status the sample is determined, which is completely methylated, completely unmethylated or a mixture of the two. The sequence of the oligonucleotide is AACACGGGCATTGATCTGACGT (SEQ ID No .: 3)

Reference spectrum

To accurately determine the methylation status of the sample, it was necessary to take the spectra of two Determine control samples. Accordingly, an oligonucleotide according to SEQ ID No. 3 was ordered from a commercial supplier, one sample of each cytosine in the oligonucleotide being methylated and the other completely unmethylated. A sample of the unmethylated oligonucleotide was analyzed by MALDI-TOF mass spectrometry and the resulting spectrum is shown in 1 shown, the mass of the oligonucleotide was determined as 6757.97 daltons. The fully methylated sample was then analyzed by MALDI-TOF mass spectrometry and the resulting spectrum is shown in 2 shown, the mass of the oligonucleotide was determined as 6785.65 daltons.

Mass spectrometric analysis of the sample provided. The test sample was analyzed using MALDI-TOF mass spectrometry and the resulting spectrum is shown in 3 shown. Two peaks were observed at 6758.01 daltons and 6788.70 daltons. How to compare the 1 and 2 can see, the sample material contained two oligonucleotide species, a first one corresponding to the fully methylated sample and a second one corresponding to the completely unmethylated sample. It was concluded that the sample was a mixture of the two oligonucleotide species, which was confirmed by the provider of the test sample. All mass spectrometric analyzes were mixed using a standard matrix of 0.1 mol diammonium citrate and 3'-hydroxypicolinic acid in acetonitrile in a ratio of 1: 1. The analysis was carried out with a Bruker "Biflex ^™ III" mass spectrometer. The analysis of the spectra was carried out using the Bruker software "XACQ 4.0.4", the subsequent editing was carried out using the Bruker "X-TOF 5.1.0" software. No additional purification was required as all oligonucleotides were provided by the provider in a saline solution. The adducts formed between the K and Na salts in the solution and the oligonucleotides are responsible for the additional peaks that can be observed in the spectrum. For the analysis, 0.5 μl of a solution of 100 pmol / l oligonucleotide with 0.5 μl matrix was mixed and placed on the target.

characters

1 shows the mass spectrum of the oligonucleotide analyzed according to Example 1. The X axis shows the frequency of each ion species, the Y axis shows the mass of each species. Additional peaks were observed in which adducts were formed between the salt present in the solution and the oligonucleotides. The analyzed oligonucleotide contains no methylated cytosines and the mass observed is 6757.97 daltons.

2 shows the mass spectrum of the oligonucleotide analyzed according to Example 1. The X axis shows the frequency of each ion species, the Y axis shows the mass of each species. Additional peaks were observed in which adducts were formed between the salt present in the solution and the oligonucleotides. The oligonucleotide analyzed is completely methylated on all cytosines and the mass observed is 6785.65 daltons.

3 shows the mass spectrum of the test sample analyzed according to Example 3. The X axis shows the frequency of each ion species, the Y axis shows the mass of each species. Additional peaks were observed in which adducts were formed between the salt present in the solution and the oligonucleotides. Peaks were observed at 6758.01 and 6788.70 daltons. It was concluded that the sample contained a mixture of both methylated and unmethylated oligonucleotides.

Claims (26)

Methods of analyzing methylation patterns, including the following steps: a) Isolation of genomic nucleic acids from a biological sample, b) amplification of one or more Target nucleic acids of this genomic nucleic acids in a way that the methylation pattern of this genomic nucleic acids in the amplified nucleic acid remain, c) implementation mass spectrometry on this amplified nucleic acid or their fragments to get mass spectra, d) evaluation the mass spectra obtained and e) Determination of the methylation pattern and / or the methylation status of the sample. Method according to claim 1, characterized in that in step a) the genomic DNA from cells or cellular Ingredients containing DNA is obtained using the DNA sources for example cell lines, biopsies, blood, sputum, stool, urine, Cerebral spinal fluid, tissue embedded in paraffin, such as tissue from the eyes, intestines, kidneys, Brain, heart, prostate, lungs, chest or liver, histological slides and all sorts Combinations thereof. Procedure according to a of the preceding claims, characterized in that step b) by means of the following additional Steps or substeps are carried out: i) amplification the genomic target nucleic acid sequence in a semi-conservative way, ii) methylation of the synthesized Strands, causing the 5'-methylation congestion of the cytosine of the CG dinucleotide in the template strand on the CG dinucleotide of the synthesized strand is copied. Method according to claim 3, characterized in that it continues the following steps comprises: iii) denaturing the double-stranded nucleic acids in order to single nucleic acids to form iv) repeating steps i) to iii) until a desired number was obtained from amplificates. Method according to claims 3 or 4, wherein the amplification method is selected in step i) from: ligase chain reaction, polymerase chain reaction, polymerase reaction, Rolling circle replication. Method according to claims 3 or 4, wherein in step ii) this methylation with enzymatic agents carried out becomes. Method according to claim 6, wherein this enzyme is a maintenance methyl transferase. Procedure according to a of claims 6 or 7 wherein the methyltransferase is DNA-5-cytosine methyltransferase (DNMT 1) is. Procedure according to a of claims 6 to 8, the methyl group obtained from the donor molecule S-adenosylmethionine becomes. Procedure according to a of the preceding claims, wherein step b) of the method by means of the following additional Steps or substeps are performed (1) heating the genomic DNA to a temperature that is suitable for denaturing to cause (2) cooling the denatured DNA in the presence of single-stranded oligonucleotide primers, so that the primers attach to the DNA, (3) heating the Mix in the presence of a polymerase and nucleotides on one Temperature so that the primers are extended (4) Contact the double-stranded nucleic acid with enzymes and / or agents under conditions that are such Methylation of the synthesized strand lead to the CpG dinucleotides in the synthesized strand according to the methylation status of the corresponding CpG dinucleotide of the template strand are methylated, whereby the genomic methylation pattern is preserved, (5) Repeat steps (1) to (4) in the desired Number until a desired Number of nucleic acids was obtained. Method according to claims 1 to 10, wherein the amplified nucleic acids fragment before step C. become. Method according to claim 11, wherein this fragmentation by enzymatic or chemical means carried out becomes. Procedure according to a of the preceding claims, wherein step c) using time-of-flight MALDI or ESI mass spectrometry carried out becomes. Procedure according to a of the preceding claims, wherein internal and / or external calibration is used in step c) becomes. Procedure according to a of the preceding claims, wherein the nucleic acids are purified before step c). Method according to claim 15, where these nucleic acids single stranded are. Procedure according to a of the preceding claims, wherein the amplified nucleic acids are less than 100 base pairs are long. Procedure according to a of the preceding claims, wherein each during Step b) used primer oligonucleotide contains no CG dinucleotides. Procedure according to a of the preceding claims, in which these amplificates are immobilized on a solid phase. Procedure according to a of the preceding claims, wherein the synthesized amplificates at least one chemical Modification of an internucleoside bond, a sugar backbone or contain a nucleoside base. Procedure according to a of the preceding claims, characterized in that steps d) and e) are carried out as follows: d) Comparing the mass spectra obtained with reference mass spectra, that from the nucleic acid in their completely methylated and / or completely unmethylated Shape have been obtained and e) the determination of this comparison whether fragments are methylated, unmethylated or partially unmethylated and thereby the determination of the methylation pattern of the nucleic acid. Procedure according to a of claims 1 to 20, characterized in that steps d) and e) as follows become: d) determining the molecular weight of the fragment or of the fragments e) Determination of the methylation status of these Fragments. Procedure according to a of the preceding claims, wherein the methyl group carries a detectable marker which incorporated in the synthesized nucleic acid strand becomes. Method according to one of the preceding Claims wherein a mass marker is incorporated into the amplified nucleic acids. Use of a method according to claims 1 to 24 for the analysis of methylation patterns in genomic DNA. Kit for the analysis of methylation in nucleic acids according to claims 1 to 25, comprising - reagents for the methylation-preserving amplification of genomic DNA - reagents for the mass spectrometric analysis of nucleic acids.