DE102017004108A1 - Method for determining the cell number of eukaryotic cells - Google Patents

Abstract

The invention relates to a method and a nucleic acid molecule for determining the cell number of eukaryotic cells in a sample. The method according to the invention is based on the analysis of the DNA methylation (DNAm), whereby genomic regions are addressed, which are basically methylated in the cells to be examined. The method according to the invention essentially comprises the identification of a genome region which is reliably methylated in the cell types to be measured, and the use of an unmethylated reference nucleic acid comprising this region. If different amounts of the reference nucleic acid are used, the methylation levels decrease continuously with increasing concentration of the reference nucleic acid. The accuracy of the method according to the invention is especially high when the methylation levels are between 20% and 80%, ie. H. when the number of reference nucleotide sequences is approximately equal to the number of genomic nucleic acid molecules.

Description

The invention relates to a method for determining the cell number of eukaryotic cells in a sample. The invention further relates to a nucleic acid molecule comprising at least one nucleotide sequence corresponding to at least one specific region from the genome of at least one eukaryotic cell or eukaryotic cell type, the specific region comprising at least one CpG dinucleotide.

For many applications in clinical diagnostics, for example in the preparation of blood images, the relative quantification of cell types is of particular importance. The determination of the cellular composition of blood samples and in particular the differential blood picture, d. H. the determination of the composition of white blood cells (leukocytes) in the blood, is one of the most common diagnostic test procedures and thus a routine examination in medical laboratory diagnostics. For example, a differential blood picture can be made by microscopic examination of the blood sample and manual counting of the cells. However, in routine diagnostics, blood samples are typically analyzed by automated cell counters using flow cytometric techniques (e.g., Coulter Counter) (1). Alternative measurements are based on counting chambers, automated optical cell counts, or electrical resistance measurements (CASY).

The determination of the cell number is necessary in many diagnostic and cell biological procedures. Numerous methods are available for this purpose, in particular based on imaging or flow cytometry (impedance or scattered light methods) (1). These automatic cell counters detect, for example, the electrical impedance, the optical effects of the light scatter or the intensity of fluorescence signals.

In addition to methods that allow a quantification of cellular material based on the count of individual cells, especially different flow cytometric methods are used, which allow a quantification of cells, for example by means of reference beads in a specific concentration. However, these methods have the disadvantage that previously a labor-intensive work-up of the sample to be measured must be carried out, which may include, for example, complex steps such as centrifuging, filtration and / or sedimentation.

Many optical flow cytometers use the principle of fluorescence or scattered light measurement. However, both methods of measurement require the use of specially prepared and purified blood samples for counting individual cells. For example, to prepare a blood sample, it is necessary to perform hemolysis of the erythrocytes and specific labeling of the cells. The sample preparation is therefore very time consuming, so that by means of optical flow cytometry neither fast nor inexpensive cell number determinations can be performed in a complex sample.

The above methods of cell count determination require relatively fresh material in which the cells are live and as isolated as possible. In general, these methods also require a certain minimum volume due to the hose systems. In addition, in the course of the sample dispatch to a large laboratory or by delayed measurements to an increased cell death, so that the cell number would be estimated accordingly too low. The autolysis begins after just a few hours and initially affects in particular the granulocytes. A shipment of blood samples in the frozen state is not yet possible because the cells are lysed thereby. In addition, measurement inaccuracies exist in all measuring methods, which may make a validation with another method meaningful. For very small cell volumes (e.g., CSF diagnostics) or for very small sample volumes, analysis is not possible with all procedures.

It is an object of the present invention to provide a method for determining the cell number of eukaryotic cells in a sample, which avoids the disadvantages mentioned above, ensures rapid and reliable quantification of the cells and also allows analysis of older samples.

• - Identifizieren mindestens einer spezifischen Region im Genom mindestens einer Zelle oder eines Zelltyps, wobei die spezifische Region mindestens ein CpG-Dinukleotid umfasst, das in der Zelle oder dem Zelltyp grundsätzlich methyliert ist;
• - Bereitstellen mindestens eines nicht-methylierten Referenz-Nukleinsäuremoleküls, das mindestens eine Referenz-Nukleotidsequenz umfasst, die der spezifischen Region entspricht und das mindestens eine CpG-Dinukleotid umfasst;
• - Einbringen einer vorbestimmten Menge des Referenz-Nukleinsäuremoleküls in die Probe;
• - Anschließend Ermitteln des Methylierungsgrades des CpG-Dinukleotids in der Probe; und
• - Berechnen der Anzahl der Zellen basierend auf dem ermittelten Methylierungsgrad, wobei der Methylierungsgrad ein Verhältnis der Anzahl der Referenz-Nukleotidsequenzen zu der Anzahl der Zellen repräsentiert.

According to the invention, the object is achieved by a method for determining the cell number of eukaryotic cells in a sample, which comprises:

• - Identifying at least one specific region in the genome of at least one cell or cell type, wherein the specific region comprises at least one CpG dinucleotide which is basically methylated in the cell or cell type;
• Providing at least one non-methylated reference nucleic acid molecule comprising at least one reference nucleotide sequence corresponding to the specific region and comprising at least one CpG dinucleotide;
• - introducing a predetermined amount of the reference nucleic acid molecule into the sample;
• - then determining the methylation level of the CpG dinucleotide in the sample; and
• Calculating the number of cells based on the determined degree of methylation, the degree of methylation representing a ratio of the number of reference nucleotide sequences to the number of cells.

• - Die Proben können vor der Analyse tiefgefroren werden;
• - Insbesondere in Kombination mit epigenetischen Blutbildanalysen ermöglicht es eine quantitative Auswertung;
• - Sehr kleine Blutmengen reichen aus (theoretisch < 10 µl);
• - Einfache Analyse;
• - Isolierte DNA kann zu Analysezwecken sehr leicht versendet werden.

Epigenetic methods for the determination of absolute cell numbers have not been available so far. So far, no method is known in the DNA methylation is used for cell count. The inventive method is based advantageously on the analysis of DNA methylation (DNAm), wherein genomic areas are addressed, which are basically methylated in the cells to be examined (eg blood cells). Even before the DNA isolation, these cells are mixed with appropriate unmethylated reference DNA in a known concentration (either by adding the reference molecules to the sample or vice versa by adding the sample to a predetermined amount of the reference molecules). After DNA isolation, the ratio of methylated and unmethylated DNA can be determined very accurately. The method according to the invention is therefore based essentially on the identification of a genome region which is reliably methylated in the cell types to be measured and an unmethylated reference DNA which comprises this region. From the application of the method according to the invention, the following advantages result:

• - The samples can be frozen before analysis;
• - Especially in combination with epigenetic blood count analysis, it allows a quantitative evaluation;
• - Very small amounts of blood are sufficient (theoretically <10 μl);
• - simple analysis;
• - Isolated DNA can be shipped very easily for analysis.

According to the invention, the quantification of the cells by means of the determination of the degree of methylation specific genomic regions advantageously carried out with the aid of a non-methylated reference nucleic acid molecule, which is added in a known concentration. The quantitative determination of cell numbers can thus be carried out by adding a predetermined amount of a non-methylated reference nucleic acid molecule to a sample, provided that the specific region in the genome of the cells corresponding to the reference nucleotide sequence of the reference molecule in the cells to be counted in principle is methylated, d. H. generally has a high degree of methylation in these cells. Consequently, by using a non-methylated standard sequence, it is advantageously possible to determine absolute cell numbers quickly and reliably based on the degree of methylation of the DNA (DNAm). The advantages of the method according to the invention are thus based on epigenetic properties of the DNA and are therefore also suitable retrospectively for already isolated samples (eg older blood samples). DNA is relatively stable, d. H. The samples can easily be sent for the investigations and measured in the high-throughput method. This enables the quantitative determination of the cellular composition of samples, for example human blood samples, in a reliable and cost-effective manner.

DNA methylation (DNAm) is an epigenetic modification in which methyl groups are attached to the 5th carbon atom of cytosines, mainly when they are in the form of cytosine-guanine (CpG) dinucleotides. The analysis of DNA methylation has several advantages compared to immunophenotypic methods: i) DNAm is directly linked to the processes of differentiation of the cells; ii) DNAm facilitates absolute quantification with single base resolution (in the range of 0 to 100% DNAm); iii) most cells contain only two copies of the DNA molecules, so that the results for determining the cell numbers or cell composition in the sample can be easily extrapolated (whereas RNA in small subpopulations can be highly overexpressed); and iv) DNA is relatively stable: it can be isolated from lysed or frozen cells and then transported at room temperature for further analysis. For example, the analysis of DNA methylation (DNAm) by Pyrosequencing or MassArray cost-effective and high-throughput procedures for the specific gene areas done. Alternatively, more extensive investigation techniques such as sequencing and microarray-based methods are possible.

The calculation of the number of cells may, for example, be such that at least two aliquots of the same sample are provided and a predetermined amount of the reference nucleic acid molecule is introduced into each aliquot of the sample, a first amount of the reference molecule in a first aliquot and a second amount of the reference molecule is introduced into a second aliquot, and wherein the second amount is greater or less than the first amount. By using different concentrations of the reference molecule, a reference curve can be created in an advantageous manner, by means of which the number of cells can then be determined precisely. In this way, it is also possible to determine the concentration of the reference molecule which corresponds approximately to the expected number of cells and thus ensures the highest possible accuracy of the measurement. Alternatively, the copy number of the reference nucleotide sequence can also be calculated, and thus the cell number can also be determined without a reference curve. Thus, for example, both methods can be used to determine the reference DNA concentration which corresponds to a 50% DNA methylation and thus an identical copy number of the reference DNA and of the genomic DNA. In principle, the amount of reference molecules should correspond approximately to the expected copy number of the genomic DNA, since the sensitivity is highest in this measurement range. In addition, the use of reference molecules in ascending concentrations reliably covers a wide range of cell counts.

For example, the reference nucleic acid molecule may comprise a reference nucleotide sequence and the amount of the reference nucleic acid molecule may be adjusted such that the ratio of the number of reference molecules to the approximately expected number of cells is approximately 2: 1. Assuming that the cells to be analyzed each contain two copies of their DNA molecules, this ratio corresponds to an equal copy number of the reference DNA and the genomic DNA, so that in this embodiment the highest possible sensitivity of the method according to the invention is ensured.

In an advantageous embodiment of the invention, it is provided that two or more different reference nucleic acid molecules, which comprise different specific regions, are introduced into the sample. Also, by using many different reference sequences, a wider range of cell numbers can be reliably covered. In addition, further validation and additional accuracy can be achieved by the parallel determination of different specific genomic regions.

The cells may be, for example, hematopoietic cells, preferably leukocytes. In an advantageous embodiment of the invention, it is provided in this case that the specific region within the gene LSM14B ("LSM Family Member 14B", associated protein "LSM14 homologous B") and / or the gene ZC3H3 ("Zinc Finger CCCH Type Containing 3 "Associated protein" Zinc finger CCCH domain-containing protein 3 "). These regions are consistently highly methylated in hematopoietic cells, especially all leukocyte subpopulations, and are therefore particularly suitable, for example, for use as a specific region in the method of the invention.

• GCGCCCTGATGAAGGCGTGCGGGGTGATGGGATGGCCTTCGCCGTTCTCACCCGATGTCTCGTTGTTCAGTCTTCCCTGGGTTCTGCCTCCGCCTCGCCCTTCCAGCCGCACGTGCCTTACA (SEQ ID NO: 1)
• GACAGGGGGAAGGGCGGGGCGCTGAGAGGCGAGGCCGGCGTCTTCTTGACAATGCGGTAGCGGGTCTTGATCACCTTGCTGGTGGGTGCAGTCCGCACGGCATGCAGGCTGGACGCTGTAGA (SEQ ID NO: 2)
• TCCAAAAGCTTCCGGAAGAGCGGGCAGGGTCCTGCACAGCTGTTCATTCACCCGCGAGTACGTCAAGCATACATTGGGCACCGACTGTGTGCCACGCCCGTCCCGGCAGAGGCCCTGGGGAC (SEQ ID NO: 3)

In an advantageous embodiment of the invention, it is further provided that the specific region has at least one nucleotide sequence within a region of approximately 50,000, 20,000, 10,000, 5,000, 4,000, 3,000, 2,000, 1,000, 500 or 100 nucleotides upstream and / or downstream of one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 3.

• GCGCCCTGATGAAGGCGTGCGGGGTGATGGGATGGCCTTCGCCGTTCTCACCCGATGTCTCGTTGTTCAGTCTTCCCTGGGTTCTGCCTCCGCCTCGCCCTTCCAGCCGCACGTGCCTTACA (SEQ ID NO: 1)
• GACAGGGGGAAGGGCGGGGCGCTGAGAGGCGAGGCCGGCGTCTTCTTGACAATGCGGTAGCGGGTCTTGATCACCTTGCTGGTGGGTGCAGTCCGCACGGCATGCAGGCTGGACGCTGTAGA (SEQ ID NO: 2)
• TCCAAAAGCTTCCGGAAGAGCGGGCAGGGTCCTGCACAGCTGTTCATTCACCCGCGAGTACGTCAAGCATACATTGGGCACCGACTGTGTGCCACGCCCGTCCCGGCAGAGGCCCTGGGGAC (SEQ ID NO: 3)

In particular, it is provided in a further advantageous embodiment of the invention that the specific region comprises at least one nucleotide sequence which is selected from the sequences according to SEQ ID NO: 1 to SEQ ID NO: 3.

• cg06096175 auf dem Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 ist in eckiger Klammer und fett gedruckt hervorgehoben): GCGCCCTGATGAAGGCGTGCGGGGTGATGGGATGGCCTTCGCCGTTCTCACCCGATGTCT[CG]TTGTTCAGTCTTCCCTGGGTTCTGCCTCCGCCTCGCCCTTCCAGCCGCACGTGCCTTACA (SEQ ID NO: 1)
• cg25834632 auf dem Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 ist in eckiger Klammer und fett gedruckt hervorgehoben): GACAGGGGGAAGGGCGGGGCGCTGAGAGGCGAGGCCGGCGTCTTCTTGACAATGCGGTAG[CG]GGTCTTGATCACCTTGCTGGTGGGTGCAGTCCGCACGGCATGCAGGCTGGACGCTGTAGA (SEQ ID NO: 2)
• cg09414987 auf dem Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 ist in eckiger Klammer und fett gedruckt hervorgehoben): TCCAAAAGCTTCCGGAAGAGCGGGCAGGGTCCTGCACAGCTGTTCATTCACCCGCGAGTA[CG]TCAAGCATACATTGGGCACCGACTGTGTGCCACGCCCGTCCCGGCAGAGGCCCTGGGGAC (SEQ ID NO: 3)

In an advantageous embodiment of the invention, it is further provided that the CpG dinucleotide is a dinucleotide consisting of nucleotides Nos. 61 and 62 of at least one nucleotide sequence which is selected from the sequences according to SEQ ID NO: 1 to SEQ ID NO: 3 ,

• cg06096175 on the Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 is highlighted in square brackets and in bold): GCGCCCTGATGAAGGCGTGCGGGGTGATGGGATGGCCTTCGCCGTTCTCACCCGATGTCT [CG] TTGTTCAGTCTTCCCTGGGTTCTGCCTCCGCCTCGCCCTTCCAGCCGCACGTGCCTTACA (SEQ ID NO: 1)
• cg25834632 on the Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 is in square brackets and highlighted in bold): GACAGGGGGAAGGGCGGGGCGCTGAGAGGCGAGGCCGGCGTCTTCTTGACAATGCGGTAG [CG] GGTCTTGATCACCTTGCTGGTGGGTGCAGTCCGCACGGCATGCAGGCTGGACGCTGTAGA (SEQ ID NO: 2)
• cg09414987 on the Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) (CpG 61/62 is highlighted in square brackets and in bold): TCCAAAAGCTTCCGGAAGAGCGGGCAGGGTCCTGCACAGCTGTTCATTCACCCGCGAGTA [CG] TCAAGCATACATTGGGCACCGACTGTGTGCCACGCCCGTCCCGGCAGAGGCCCTGGGGAC (SEQ ID NO: 3)

In an advantageous embodiment of the invention, it is further provided that the CpG dinucleotide cg06096175 (located in the gene "LSM Family Member 14B" (LSM14B), which encodes the protein "LSM14 homologous B"), cg25834632 (located in the gene "Zinc Finger CCCH- Type Containing 3 "(ZC3H3) which encodes the protein" Zinc finger CCCH domain-containing protein 3 ") and / or cg09414987 (no associated gene). These CpG dinucleotides are consistently highly methylated in hematopoietic cells, in particular all leukocyte subpopulations, and are therefore particularly suitable, for example, as reference CpG dinucleotides for the determination of absolute cell numbers.

• - Identifizieren mindestens einer spezifischen Region im Genom mindestens einer Zelle oder eines Zelltyps, wobei die spezifische Region mindestens ein CpG-Dinukleotid umfasst, das in der Zelle oder dem Zelltyp grundsätzlich methyliert ist;
• - Isolieren oder Synthetisieren mindestens einer Referenz-Nukleotidsequenz, welche die spezifische Region und das mindestens eine CpG-Dinukleotid umfasst;
• - Vermehren (Amplifizieren) der Referenz-Nukleotidsequenz außerhalb der Zelle oder des Zelltyps zur Erlangung eines nicht-methylierten Nukleinsäuremoleküls.

The invention further relates to an advantageous method for producing a reference nucleic acid molecule for determining the cell number of eukaryotic cells in a sample, which comprises:

• Identifying at least one specific region in the genome of at least one cell or cell type, the specific region comprising at least one CpG dinucleotide which is basically methylated in the cell or cell type;
• Isolating or synthesizing at least one reference nucleotide sequence comprising the specific region and the at least one CpG dinucleotide;
• Extending (amplifying) the reference nucleotide sequence outside the cell or cell type to obtain an unmethylated nucleic acid molecule.

The reference nucleic acid molecule produced by the method according to the invention must comprise at least one nucleotide sequence corresponding to the specific region in the genome of the cells, which region must in principle be methylated in the eukaryotic cells, d. H. in these cells must generally have a high degree of methylation. An important step in the process is therefore the identification of a genome region that is reliably methylated in the different cell types. According to the invention, however, the reference nucleic acid molecule is then further prepared in such a way that the CpG dinucleotide is in a non-methylated state and thus is suitable as a reference molecule for the method described above.

For example, proliferation of the reference nucleotide sequence may be performed by introducing the reference nucleotide sequence into at least one prokaryotic cell, augmenting the nucleotide sequence in the prokayotic cell, and isolating at least one nucleic acid molecule comprising at least one reference nucleotide sequence from the prokaryotic cell. Thus, for example, the reference molecule can be amplified (e.g., in the form of a plasmid) in E. coli and then purified. In bacteria, the DNA is not methylated accordingly, so that it is ensured in this embodiment of the method that the reference nucleotide sequence is not methylated.

Alternatively, the reference nucleotide sequence can be propagated or synthesized in vitro, preferably by polymerase chain reaction (PCR). In this advantageous manner, an unmethylated reference DNA can be prepared quickly and reliably. For example, the PCR product could be used as a stand-alone DNA double strand or as a cloned plasmid DNA as a standard.

According to the invention, the object is also achieved by a nucleic acid molecule which has been prepared in the method according to the invention described above.

According to the invention, the object is further achieved by a nucleic acid molecule which comprises at least one nucleotide sequence corresponding to at least one specific region from the genome of at least one eukaryotic cell or eukaryotic cell type, the specific region comprising at least one CpG dinucleotide present in the cell or The cell type is basically methylated, and wherein the CpG dinucleotide is in a non-methylated state. The nucleic acid molecule according to the invention comprises at least one nucleotide sequence which corresponds to the specific region in the genome of the cells, this region being basically methylated in the eukaryotic cells, i. H. generally has a high degree of methylation in these cells. The nucleic acid molecule of the invention further comprises at least one CpG dinucleotide which is in a non-methylated state. Such a reference nucleic acid molecule can be, for example, a DNA molecule.

1. a) mindestens einer Nukleotidsequenz, welche mindestens eine der Nukleotidsequenzen gemäß SEQ ID NO: 1 bis SEQ ID NO: 3 umfasst;
2. b) mindestens einer Nukleotidsequenz, die sich von einer der Nukleotidsequenzen gemäß SEQ ID NO: 1 bis SEQ ID NO: 3 mit Ausnahme des CpG-Dinukleotids durch den Austausch von höchstens 10%, vorzugsweise höchstens 5%, der Nukleotide unterscheidet und
3. c) mindestens einer Nukleotidsequenz, die dem zu der Nukleotidsequenz gemäß a) oder b) komplementären Strang entspricht.

The invention also relates to the advantageous use of a nucleic acid molecule for determining the cell number of eukaryotic cells in a sample by means of the method according to the invention, wherein the nucleic acid molecule comprises at least one nucleotide sequence which is selected from the group consisting of:

1. a) at least one nucleotide sequence which comprises at least one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 3;
2. b) at least one nucleotide sequence which differs from one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 3 with the exception of the CpG dinucleotide by exchanging at most 10%, preferably at most 5%, of the nucleotides, and
3. c) at least one nucleotide sequence which corresponds to the strand complementary to the nucleotide sequence according to a) or b).

1. a) mindestens einer Nukleotidsequenz, die mindestens eine Sequenz der Nukleotidsequenzen SEQ ID NO: 4 bis SEQ ID NO: 14 (siehe Tabellen 1 und 2) umfasst,
2. b) mindestens einer Nukleotidsequenz, die zu mindestens 90%, vorzugsweise mindestens 95%, mit der Nukleotidsequenz gemäß a) identisch ist und
3. c) mindestens einer Nukleotidsequenz, die dem zu einer der Nukleotidsequenzen gemäß a) oder b) komplementären Strang entspricht.

The invention further relates to an artificial nucleic acid molecule which comprises at least one nucleotide sequence which is selected from the group consisting of:

1. a) at least one nucleotide sequence which comprises at least one sequence of the nucleotide sequences SEQ ID NO: 4 to SEQ ID NO: 14 (see Tables 1 and 2),
2. b) at least one nucleotide sequence which is at least 90%, preferably at least 95%, identical to the nucleotide sequence according to a), and
3. c) at least one nucleotide sequence which corresponds to the strand complementary to one of the nucleotide sequences according to a) or b).

According to the invention, the object is further achieved by a kit which comprises the nucleic acid molecule according to the invention and / or a combination of at least two different artificial nucleic acid molecules according to the invention. In addition, such a kit may comprise at least one buffer solution and / or reagent for carrying out one or more of the following methods:
DNA amplification, methylation-specific PCR, bisulfite treatment of DNA, DNA sequencing, preferably pyrosequencing of bisulfite-treated DNA, microarrays (Illumina Human Methylation BeadChip technology), Reduced Representation Bisulfite Sequencing (RRBS), Whole Genome Bisulfite Sequencing (WGBS) , DNAM measurements using digital PCR amplicon barkodierte bisulfite sequencing (BBA-seq), "MassARRAY ^®" and "SNP genotyping."

The artificial nucleic acid molecules according to the invention can furthermore advantageously be used for the preparation of a kit for carrying out the method according to the invention.

The invention further relates to the use of the nucleic acid molecule according to the invention and / or the artificial nucleic acid molecule according to the invention and / or the kit according to the invention for determining the cell number of eukaryotic cells in a sample, d. H. for the absolute quantification of cells or cell types.

Both the method according to the invention and the nucleic acid molecules and kits according to the invention can in principle be used for determining the number of cell types of different cell types in various fields of application. In particular, these are suitable, for example, for the determination of the leucocyte count in the blood or other body fluids (CSF, urine, etc.). The leukocyte count is routinely determined in blood samples by flow cytometry. However, the determination is not possible in all blood samples (for example due to coagulation or too small blood volume) and can not be performed reliably on older blood samples. The samples must be freshly shipped for analysis and measured promptly. In contrast, the epigenetic determination of the cell number according to the invention can also be carried out on blood samples in which the cells are no longer isolated. Moreover, the method according to the invention also makes sense in combination with other methods, since quantitative information is obtained without much additional effort, whereas otherwise only relative ratios of the hematopoietic cell types can be determined. In the high-throughput process, the inventive method can also be carried out very inexpensively. The measuring accuracy is comparable with the accuracy of conventional methods.

With the aid of the method according to the invention, for example, the number of nucleated blood cells can be reliably determined. In particular, in combination with epigenetic methods for determining the differential blood count, the method according to the invention is advantageous because it allows a quantitative statement. In contrast to conventional methods, the blood samples can also be shipped frozen, since only the DNA content is determined in relation to the volume. However, since DNA isolation inevitably leads to large deviations, it is not possible to reliably measure the DNA concentration. In contrast, according to the invention, at least one reference nucleotide sequence of predetermined concentration is added (or the sample is added to a predetermined amount of the reference nucleotide sequence), which is then subjected to the same variations in DNA isolation as the genomic DNA.

"Basically methylated" in the sense of the invention means that the corresponding CpG dinucleotide or several CpG dinucleotides have or have a high degree of methylation within a specific region under physiological conditions in a eukaryotic cell.

"Physiological conditions" in the sense of the invention designates environmental parameters (for example, composition of the environment inside and outside the cell, temperature, pH, etc.) which correspond to the living conditions prevailing in the organism.

"Methylation grade" in the sense of the invention denotes the ratio of methylated CpG dinucleotides to non-methylated CpG dinucleotides.

"High degree of methylation" in the sense of the invention denotes a degree of methylation of at least one specific CpG dinucleotide of at least 80%, preferably at least 90%, particularly preferably at least 95%, in particular at least 98%.

"Non-methylated" or "non-methylated state" in the sense of the invention denotes a degree of methylation of at least one specific CpG dinucleotide of at most 20%, preferably at most 10%, particularly preferably at most 5%, in particular at most 2%.

• 1 zeigt Diagramme, die jeweils die Methylierungsgrade („β-value“) unterschiedlicher CpG-Dinukleotide in verschiedenen Zelltypen darstellen. Der DNA-Methylierungsgrad (beta-value von 0 bis 1) ist für verschiedene Zelltypen und in peripherem Blut von verschiedenen Erkrankungen aufgetragen. Die CpG-Dinukleotide (cg06096175, cg09414987 und cg25834632) wurden aus öffentlich zugänglichen Datensätzen des Infinium HumanMethylation450 BeadChip (Illumina, San Diego, USA) ausgewählt. Sie sind alle in gereinigten hämatopoetischen Subpopulation von Reinius et al. (2) (A, D, G; GSE35069, 6 Proben) und Zilbauer et al. (3) (B, E, H; E-MTAB-2145, 6 Proben), sowie in DNAm-Profilen aus Blutproben von gesunden Spendern (C, F, I; GSE41169, 30 Proben; GSE32148, 20 Proben; GSE40005, 12 Proben), akuter Myeloid-Leukemie (AML; TCGA, 194 Proben; GSE58477, 62 Proben; GSE62298, 68 Proben), myelodysplastischem Syndrom (MDS; GSE51758, 4 Proben), myeloproliferativen Neoplasmen (MPN; 8 Proben), und anderen hämatopoetischen Erkrankungen (GSE37362, 31 Proben; GSE69954, 65 Proben) einheitlich hoch methyliert. WB = Vollblut („whole blood“); PBMC = mononukleare Zellen des peripheren Bluts („peripheral blood mononuclear cells“).
• 2 zeigt ein Diagramm, welches das Verhältnis der Referenz-Nukleinsäuremoleküle („Standard“) zum Messwert der DNA-Methylierung (DNAm) darstellt. Bei diesen Versuchen wurden Blutproben unterschiedliche Mengen der Referenz-Nukleinsäuremoleküle zugefügt. Es wurden jeweils unterschiedliche Mengen von Referenz-DNA (Plasmid) (0.0002 - 0.1100 ng) mit 150 µl Blut von zwei Blutproben versetzt. Anschließend wurde die DNA mittels des QIAamp DNA Blood Mini Kits isoliert (Qiagen), bisulfit konvertiert (EZ DNA Methylation Kit,Zymo Research) und die genomische Sequenz mit den in Tabelle 1 aufgeführten Primern für LSM14B amplifiziert. Das Amplikon wurde daraufhin mit dem PyroMark Q96 ID Pyrosequenziergerät (Qiagen) mit dem Sequenzierprimer (Tabelle 1) gemessen. Das Verhältnis des logarithmierten Werts des DNA-Standards (ng) bezogen auf 5.000 Zellen zur DNA-Methylierung (DNAm) ergibt erwartungsgemäß annährend eine Gerade.
• Figure 3 zeigt ein Flussdiagramm und weitere Diagramme, welche eine beispielhafte Ausführungsform des erfindungsgemäßen Verfahrens illustrieren.
  1. (A) Schematische Darstellung der Quantifizierung von Zellen basierend auf DNA-Methylierung (DNAm) mit einer nicht-methylierten Referenz-Nukleinsäure.
  2. (B) Zwei Blutproben (Spender 1 und 2) wurden mit einer Verdünnungsreihe einer Referenz-DNA (Plasmid mit nicht-methylierter Sequenz des LSM14B Gens; 0,0002 ng bis 0,1100 ng) gemischt.
  3. (C) Das Verhältnis des logarithmierten Werts der Referenz-DNA [ng] pro Zelle (ermittelt mit dem Abbott „Cell-Dyn Analyzer“) zur DNA-Methylierung (DNAm) ergibt eine fast lineare Abhängigkeit im Bereich eines Methylierungsgrads zwischen 20% und 80%. Die ermittelten DNAm-Werte kommen den berechneten, erwarteten DNAm-Werten (Kurve) sehr nahe.
  4. (D) Die auf Basis der Referenz-DNA (Plasmid LSM14B) ermittelten Zellzahlen korrelieren deutlich mit den Zellzahlen, die mit einem Abbott „Cell-Dyn Analyzer“ (n = 41; Validierungsgruppe III; R = 0.84) bestimmt wurden.
  5. (E) Verhältnis der mit einem „Coulter Counter“ (n = 38; Validierungsgruppe IV; R = 0.97; MAD = durchschnittliche absolute Abweichung („mean absolute deviation“)) bestimmten Zellzahlen zu erfindungsgemäß bestimmten Zellzahlen von Granulozyten, Lymphozyten und Monozyten.
• 4 zeigt in einem Diagramm die Kombination unterschiedlicher spezifischer Regionen bzw. Referenz-Nukleotidsequenzen in unterschiedlichen Konzentrationen in jeder Blutprobe (0.0033 ng ZC3H3, 0.011 ng LSM14B und 0.033 ng cg09414987).
• 5 zeigt Diagramme zur Bestimmung der Zellzahl nach dem erfindungsgemäßen Verfahren unter Verwendung von „MassARRAY“-Analysen. Zu Blutproben aus der Validierungsgruppe IV (n = 38) wurden Referenz-Nukleotidsequenzen mit einer spezifischen Region des LSM148-Gens gegeben. Die DNAm-Werte wurden dann mittels „MassARRAY“ bestimmt.
  1. (A) Die DNAm-Werte des relevanten CpG-Dinukleotids korrelieren mit den Zellzahlen, die mittels eines „Coulter Counters“ (R = 0.48) bestimmt wurden. Diese Korrelation ist aber geringer als bei entsprechenden Daten, bei denen die DNAm-Werte mittels Pyrosequenzierung ermittelt wurden.
  2. (B) Ein Vergleich der DNAm-Werte, die mittels „MassARRAY“ und Pyrosequenzierung („PSQ“) bestimmt wurden, ergeben tatsächlich eine eher geringe Übereinstimmung, wobei die mittels „MassARRAY“ bestimmten Zellzahlen allgemein zu hoch geschätzt sind. Folglich würden die mit Hilfe einer „MassARRAY“-Methode bestimmten Zellzahlen zu hoch angesetzt.
  3. (C) Daher wurde ein Korrekturfaktor von 0,25 angewendet, um die mittels „MassARRAY“ bestimmten Zellzahlen zu berechnen.

The invention will be explained in more detail by way of example with reference to the following figures and embodiments.

• 1 shows diagrams showing the degrees of methylation ("β-value") of different CpG dinucleotides in different cell types, respectively. The degree of DNA methylation (beta-value from 0 to 1) is plotted for various cell types and in peripheral blood of various diseases. The CpG dinucleotides (cg06096175, cg09414987 and cg25834632) were selected from publicly available datasets of the Infinium HumanMation450 BeadChip (Illumina, San Diego, USA). They are all in purified hematopoietic subpopulation by Reinius et al. (2) (A, D, G, GSE35069, 6 samples) and Zilbauer et al. (3) (B, E, H; E-MTAB-2145, 6 samples) and in DNAm profiles from blood samples from healthy donors (C, F, I, GSE41169, 30 samples, GSE32148, 20 samples, GSE40005, 12 Samples), acute myeloid leukemia (AML; TCGA, 194 samples, GSE58477, 62 samples, GSE62298, 68 samples), myelodysplastic syndrome (MDS; GSE51758, 4 samples), myeloproliferative neoplasms (MPN; 8 samples), and other hematopoietic disorders (GSE37362, 31 samples, GSE69954, 65 samples) uniformly high methylated. WB = whole blood (whole blood); PBMC = Peripheral Blood Mononuclear Cells.
• 2 shows a diagram representing the ratio of the reference nucleic acid molecules ("standard") to the measured value of DNA methylation (DNAm). In these experiments, different amounts of the reference nucleic acid molecules were added to blood samples. In each case different amounts of reference DNA (plasmid) (0.0002 - 0.1100 ng) were mixed with 150 μl of blood from two blood samples. Subsequently, the DNA was isolated (Qiagen) using the QIAamp DNA Blood Mini Kit, bisulfite converted (EZ DNA Methylation Kit, Zymo Research) and the genomic sequence amplified with the primers listed in Table 1 for LSM14B. The amplicon was then measured with the PyroMark Q96 ID Pyrosequencer (Qiagen) with the sequencing primer (Table 1). The ratio of the logarithmic value of the DNA standard (ng) with respect to 5,000 cells for DNA methylation (DNAm) is expected to give approximately a straight line.
• FIG. 3 shows a flowchart and further diagrams which illustrate an exemplary embodiment of the method according to the invention.
  1. (A) Schematic representation of the quantification of cells based on DNA methylation (DNAm) with a non-methylated reference nucleic acid.
  2. (B) Two blood samples (donors 1 and 2) were mixed with a dilution series of a reference DNA (non-methylated sequence plasmid of the LSM14B gene, 0.0002 ng to 0.1100 ng).
  3. (C) The ratio of the logarithmic value of the reference DNA [ng] per cell (determined with the Abbott "Cell-Dyn Analyzer") for DNA methylation (DNAm) gives an almost linear dependence in the range of a methylation degree between 20% and 80 %. The determined DNAm values come very close to the calculated, expected DNAm values (curve).
  4. (D) The cell numbers determined on the basis of the reference DNA (plasmid LSM14B) correlate clearly with the cell numbers determined with an Abbott "Cell-Dyn Analyzer" (n = 41, validation group III, R = 0.84).
  5. (E) Ratio of cell counts determined with a "Coulter Counter" (n = 38; validation group IV; R = 0.97; MAD = mean absolute deviation) to cell numbers of granulocytes, lymphocytes and monocytes determined according to the invention.
• 4 shows in a diagram the combination of different specific regions or reference nucleotide sequences in different concentrations in each blood sample (0.0033 ng ZC3H3, 0.011 ng LSM14B and 0.033 ng cg09414987).
• 5 shows diagrams for determining the cell number by the method according to the invention using "MassARRAY" analyzes. For blood samples from validation group IV (n = 38), reference nucleotide sequences were given with a specific region of the LSM148 gene. The DNAm values were then determined by "MassARRAY".
  1. (A) The DNAm values of the relevant CpG dinucleotide correlate with the cell numbers determined by means of a Coulter Counter (R = 0.48). However, this correlation is lower than in the case of corresponding data in which the DNAm values were determined by pyrosequencing.
  2. (B) A comparison of the DNAm values determined by "MassARRAY" and Pyrosequencing ("PSQ") actually results in a rather low agreement, with the cell numbers determined by "MassARRAY" generally being overestimated. As a result, cell counts determined using a "MassARRAY" method would be overstated.
  3. (C) Therefore, a correction factor of 0.25 was used to calculate the cell numbers determined by "MassARRAY".

DNA isolation and bisulfite conversion

Genomic DNA was isolated from blood using the "QIAamp DNA Mini Kit" (Qiagen, Hilden, Germany). Serum genomic DNA was isolated from serum tubes (S-Monovette, Sarstedt, Numbrecht, Germany) after incubation for 1 hour at room temperature and centrifugation for minutes at 2,000 x g. DNA was subsequently isolated from 1 ml of serum with the "PME freecirculating DNA extraction kit" (GS / VL system, Analytik Jena, Jena, Germany) with the addition of carrier RNA according to the manufacturer's instructions. Either 1 μg of peripheral blood DNA or the complete serum DNA sample was bisulfite-converted with the "EZ DNA Methylation Kit" (Zymo Research, Irvine, CA).

Preparation of non-methylated reference DNA

The specific regions were amplified by means of PCR (Eppendorf Mastercycler 5341, Eppendorf AG, Hamburg, Germany), cloned into the vector pBR322 (Thermo Fischer Waltham, Massachusetts, USA), expanded in DH5α E. coli and incubated with the "Plasmid DNA purification kit". (Macherey-Nagel, Düren, Germany) isolated. To determine the optimal range of DNA methylation level of the blood / reference mixture, peripheral blood (150 μl) was mixed with different dilutions of the reference nucleic acid (0.0002 - 0.1100 ng). The blends of blood and reference DNA were subjected to DNA isolation and bisulfite conversion as described above.

pyrosequencing

Specific regions comprising the CpG dinucleotides cg06096175 (LSM14B), cg25834632 (ZC3H3) and cg09414987 (no associated gene) were amplified by PCR (Eppendorf Mastercycler 5341, Eppendorf AG). The primers were designed with the "Pyrosequencing Assay Design Software 1.0" (Biotag AB, Uppsala, Sweden) and are listed in Table 1. Pyrosequencing was then performed on a "PyroMark Q96 ID" system using region specific sequencing primers. The results were analyzed with the "PyroMark Q CpG software" (Qiagen).

Mass array analysis

Alternatively, "MassARRAY" was used for the specific analysis of DNAm values. Amplicons were created with the "Sequenom's EpiDESIGNER software" (Table 2). Converted DNA was amplified by PCR with the "HotStart Plus PCR Master Mix" (Qiagen). Unincorporated dNTPs were neutralized with shrimp alkaline phosphatase (Agena Bioscience, San Diego, CA, USA). Subsequently, 10 μl of the PCR product was transcribed in vitro and cut base-specifically (U-specific) with "RNase A" (T-Cleavage MassCleave Kit, Agena Bioscience, Hamburg, Germany). The cut product was then analyzed with a "MALDI-TOF" mass spectrometer (MassARRAY Analyzer 4 system, Agena Bioscience).

Determination of the absolute cell numbers

After mixing the genomic DNA with the non-methylated reference DNA, the degree of methylation ("DNAm") can be described mathematically as the ratio of methylated DNA to total DNA: $$DNAm=\frac{a*C_R+b*C_G}{C_R+C_G}$$

"C _R " or "C _G " correspond to the number of reference nucleic acid molecules or the number of genomic nucleic acid molecules; "A" and "b" are absolute DNAm values determined by pyrosequencing or "MassARRAY" in control samples with pure reference DNA or DNA from blood (eg 7% and 93% DNAm). To determine the number of reference nucleic acid molecules ("C _R "), the following formula was used: $$C_R=1.5*\frac{m_R*N_A}{MW}$$

"M _R " is the added amount of reference molecules (eg 0.011 ng "LSM14B"), N _A is the Avogadro constant, MW is the molecular weight of the reference DNA (calculated for the plasmid with the "LSM14B sequence": 2.85 * 10 ⁶ g * mol ^-1 ) and the factor 1.5 was determined empirically (for the reference DNA preparation used, based on the fact that purified plasmids may also include fragments of the bacterial genome or other plasmids).

With these parameters it is reciprocally possible to calculate the number of genomic DNA molecules (CG), and thus to determine the number of cells in a sample: $$cells\text{/}\mu l=\frac{C_R*\left(DNAm-a\right)}{2*v*\left(b-DNAm\right)}$$

The correction value "2" comes from the fact that each cell contains two copies of the genomic DNA; "V" is the volume of the sample analyzed in μl.

Publicly available and proprietary DNA methylation data sets were used in which blood samples were analyzed on the Infinium HumanMethylation450 BeadChip microarray (Illumina, San Diego, USA). The potentially relevant CpG dinucleotides were selected according to the following criteria: 1) the specific region must always have at least one DNA methylation degree of 97.5% in different cell types; 2) It must be methylated throughout 97.5% of data sets with many blood samples; and 3) It must consistently show high DNA methylation in various diseases. On this basis, for example, the CpG dinucleotides cg06096175 (located in the gene "LSM Family Member 14B" (LSM14B), which encodes the protein "LSM14 homologous B"), cg25834632 (located in the gene "Zinc Finger CCCH Type Containing 3" ZC3H3) which encodes the protein "Zinc finger CCCH domain-containing protein 3") and / or cg09414987 (no associated gene). These CpG dinucleotides are consistently highly methylated in all blood cell types tested (DNAm ("β-value")> 0.975) ( 1 ).

The DNA sequences with the corresponding specific regions are amplified by means of PCR and cloned into a plasmid (pBR322). The plasmid is then amplified in E. coli and purified. In the bacteria, this DNA sequence is not methylated, so that the respective reference nucleotide sequence is basically not methylated. The plasmid DNA is mixed with the blood in a certain concentration before further analysis. For a small amount of sample is sufficient, for example, 150 ul of blood (in principle, can also be used much less). For example, it is possible to fill a small heparinized capillary (as used for blood collection from the fingertip) bubble-free and thus to specify a relatively defined volume. This volume is then mixed with a certain amount of the reference nucleic acid molecule (eg in an Eppendorf tube). The amount of reference DNA should correspond approximately to the expected copy number of the genomic DNA. This is advantageous because the sensitivity is highest in this range. 2 shows the ratio of reference DNA (standard) to the DNA methylation reading, with different amounts of reference DNA added. In this way it was possible to determine the DNA concentration which corresponds to a 50% DNA methylation ( 12:01 ng) and thus an equal copy number of the reference DNA (plasmids) and the genomic DNA.

The process according to the invention ( 3A ) can be further refined in an advantageous manner, by not only a specific reference nucleic acid is used, but a mixture of different reference nucleic acid molecules (eg with the selected CpG Dinkleotiden cg09414987 and cg25834632), each of which may be present in a different concentration and thus covering a different range of cell numbers. This is especially necessary for measurements where a very large fluctuation of blood cells has to be expected (for example in urine samples, CSF samples or in the case of leukemia). In addition, by the parallel determination of different suitable specific genome regions, a further validation of the cell number can take place.

If different amounts of the reference nucleic acid are used, the DNAm values decrease continuously as the concentration of the reference nucleic acid increases ( 3B ). The ratio of the logarithmic value of the reference DNA per cell for DNA methylation gives an approximately linear dependence in the central region, the methylation levels determined according to the invention correlating very well with calculated, expected DNAm values ( 3C ). The cell numbers determined on the basis of a reference nucleic acid according to the invention (reference nucleotide sequence "LSM14B") furthermore clearly correlate with cell numbers which were determined by conventional counting methods ( 3D ). The method according to the invention is consequently suitable for the determination of absolute cell numbers, wherein the cell number determination by means of the method according to the invention can also be advantageously combined, for example, with the generation of an epigenetic differential blood picture ( 3E ).

The accuracy of the method according to the invention is especially high when the degrees of methylation are between 20% and 80%, ie when the number of reference nucleotide sequences corresponds approximately to the number of genomic nucleic acid molecules ( 3C ). In order to widen the scope of the method according to the invention, it may be advantageous to combine different reference nucleotide sequences, if appropriate in different concentrations (for example in higher and lower concentrations) ( 4 ).

The methylation levels can be determined advantageously, for example by means of pyrosequencing. However, it is also possible to use the "MassARRAY" technology for determining the DNAm values, where a correction value may be used to increase the accuracy ( 5 ).

Surprisingly, a comparable accuracy and reliability can be achieved with the method according to the invention as with conventional methods for cell number determination ( 1 ). However, it will never be able to completely replace the conventional methods since the method according to the invention can not quantify cells which contain very little DNA (such as erythrocytes and platelets). Overall, however, the method according to the invention is very well suited for the absolute quantification of eukaryotic cells and thus represents a real alternative to conventional methods for many applications because of the abovementioned advantages. TABLE 1 Primer for Pyrosequencing primer sequence LSM14B Forward 5'-GAGAGGAGGAGGTAGAATTTAGGGAAGATTGAA-3 '(SEQ ID NO: 4) Backward 5'-biotin-TACACCCCAAAAACTCCTCCAACATC-3 '(SEQ ID No: 5) sequencing 5'-GTAGAATTTAGGGAAGATTG-3` (SEQ ID No: 6) cg0941498 Forward 5'-biotin-ATTTTTGTTGTGGGAATATTTAGGTTATGTGTTT-3 '(SEQ ID No: 7) Backward 5'-CCTTCTCCCCACAATTCACCAAT-3 '(SEQ ID No: 8) sequencing 5'-AATCCATACCCATATATACTT-3 '(SEQ ID No: 9) ZC3H3 Forward 5'-TGGGGATGTGTGTGTTATATGGGTTGAG-3 '(SEQ ID No: 10) Backward 5'-biotin CTCAAAACAAAACCAAACAACCCAATTCC-3 '(SEQ ID No: 11) sequencing 5'-ATTGTATTTATTAGTAAGGTGATT-3 '(SEQ ID No: 12) primer Sequence (capital letters: gene-specific bases) LSM14B Forward 5'-aggaagagagTTGAAATGTTGTGGAAAAGGTAGTT-3 '(SEQ ID No: 13) Backward 5'-cagtaatacgactcactatagggagaaggctTTACCAAACAAAAACAAATCACTCA-3 '(SEQ ID No: 14)

Non-patent literature:

1. 1. M. Buttarello, M. Plebani, Automated Blood Cell Counts: State of the Art. At J Clin Pathol 130, 104-116 (2008) ,
2. Second LEISERIUS, N. Acevedo, M. Joerink, G. Pershagen, SE Dahlen, D. Greco, C. Soderhall, A. Scheynius, J. KERE, Differential DNA methylation in purified human blood cells: implications for cell lineage and studies on disease susceptibility. PLoS ONE 7, e41361 (2012) ,
3. Third M. Zilbauer, TF Rayner, C. Clark, AJ Coffey, CJ Joyce, P. Palta, A. Palotie, PA Lyons, KG Smith, Genome-wide methylation analyzes of primary human leukocyte subsets identifies functionally important cell-typespecific hypomethylated regions. Blood 122, e52-60 (2013) ,

QUOTES INCLUDE IN THE DESCRIPTION

This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Cited non-patent literature

• M. Buttarello, M. Plebani, Automated Blood Cell Counts: State of the Art. At J Clin Pathol 130, 104-116 (2008) [0054]
• LEISERIUS, N. Acevedo, M. Joerink, G. Pershagen, SE Dahlen, D. Greco, C. Soderhall, A. Scheynius, J. KERE, Differential DNA methylation in purified human blood cells: implications for cell lineage and studies on disease susceptibility. PLoS ONE 7, e41361 (2012) [0054]
• M. Zilbauer, T.F. Rayner, C. Clark, A.J. Coffey, C.J. Joyce, P. Palta, A. Palotie, P.A. Lyons, K.G. Smith, Genome-wide methylation analyzes of primary human leukocyte subsets identifies functionally important cell-typespecific hypomethylated regions. Blood 122, e52-60 (2013) [0054]

Claims (10)

Method for determining the cell number of eukaryotic cells in a sample, which comprises: Identifying at least one specific region in the genome of at least one cell or cell type, wherein the specific region comprises at least one CpG dinucleotide which is basically methylated in the cell or cell type; Providing at least one non-methylated reference nucleic acid molecule comprising at least one reference nucleotide sequence corresponding to the specific region and comprising at least one CpG dinucleotide; Introducing a predetermined amount of the reference nucleic acid molecule into the sample; Then determining the methylation level of the CpG dinucleotide in the sample; and Calculating the number of cells based on the determined degree of methylation, wherein the degree of methylation represents a ratio of the number of reference nucleotide sequences to the number of cells. Method according to Claim 1 , characterized in that two or more different reference nucleic acid molecules comprising different specific regions are introduced into the sample. Method according to Claim 1 or 2 characterized in that the specific region comprises at least one nucleotide sequence within a region of approximately 50,000, 20,000, 10,000, 5,000, 4,000, 3,000, 2,000, 1,000, 500 or 100 nucleotides upstream and / or downstream of one of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 3. A method for producing a reference nucleic acid molecule for determining the cell number of eukaryotic cells in a sample, which comprises: Identifying at least one specific region in the genome of at least one cell or cell type, wherein the specific region comprises at least one CpG dinucleotide which is basically methylated in the cell or cell type; Isolating or synthesizing at least one reference nucleotide sequence comprising the specific region and the at least one CpG dinucleotide; Increase the reference nucleotide sequence outside the cell or cell type to obtain an unmethylated nucleic acid molecule. Nucleic acid molecule, which in the method Claim 4 was produced. Nucleic acid molecule comprising at least a nucleotide sequence which corresponds to at least one specific region of the genome of at least one eukaryotic cell or a eukaryotic cell type, wherein the specific region includes at least one CpG dinucleotide is methylated in principle in the cell or cell type, characterized in that in that the CpG dinucleotide is in a non-methylated state. Use of a nucleic acid molecule for determining the cell number of eukaryotic cells in a sample by the method according to any one of Claims 1 to 3 wherein the nucleic acid molecule comprises at least one nucleotide sequence selected from the group consisting of: a) at least one nucleotide sequence comprising at least one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 3; b) at least one nucleotide sequence which differs from one of the nucleotide sequences according to SEQ ID NO: 1 to SEQ ID NO: 3 with the exception of the CpG dinucleotide by exchanging at most 10%, preferably at most 5%, of the nucleotides and c) at least a nucleotide sequence corresponding to the strand complementary to the nucleotide sequence according to a) or b). An artificial nucleic acid molecule comprising at least one nucleotide sequence selected from the group consisting of: a) at least one nucleotide sequence which comprises at least one sequence of the nucleotide sequences SEQ ID NO: 4 to SEQ ID NO: 14, b) at least one nucleotide sequence which is at least 90%, preferably at least 95%, identical to the nucleotide sequence according to a), and c) at least one nucleotide sequence which corresponds to the strand complementary to one of the nucleotide sequences according to a) or b). Kit, which detects the nucleic acid molecule Claim 5 or 6 and / or a combination of at least two different artificial nucleic acid molecules Claim 8 includes. Use of the nucleic acid molecule according to Claim 5 or 6 and / or the artificial nucleic acid molecule Claim 8 and / or the kit Claim 9 for determining the cell number of eukaryotic cells in a sample.

Images