DE102015226287B4 - Process for the production of sinus node cells ("cardiac pacemaker cells") from stem cells and process for the purification of sinus node cells generated from stem cells - Google Patents

Abstract

Process for the production of sinus node cells ("cardiac pacemaker cells") from stem cells, with the exception of human embryonic stem cells, in whichi. at least one sinus node cell-producing polynucleotide or at least one protein encoded by this at least one sinus node cell-producing polynucleotide is introduced into stem cells; ii the resulting stem cells in the presence of the at least one sinus node cell-producing polynucleotide or the at least one protein are differentiated into sinus node cells, the at least a polynucleotide generating sinus node cells comprises a nucleic acid sequence which is selected from the group consisting ofa) nucleic acid sequence selected from the group consisting of Gm20685, Gm21989, 1700027A07Rik, 4930448N21 Rik, Acadvl, Actn2, Adm, Adprhl1k, Ak1, Afap1l , Amfr, Angptl2, Ank, Ankrd1, Ap1m1, Art3, Atp2a2, Atp5a1, BC090627, Chkb, Cpt1b, C230088H06Rik, C630028M04Rik, Cap2, Casq1, Casq2, Cav3, Cdh13, Cfl2, Cn1, Cn2, Ch9 , Ctgf, D430001F17Rik, Def8, Dhrs13os, Dkk3, Dlst, Dnaja4, Dpysl2, Dusp3, Ech1, Ehd4, Eno3, Eral1, Etfd h, Fads3, Fam134b, Fam54b, Fhl1, Foxs1, Fuca2, Gal, Gbas, Gfpt2, Gja1, Gm12940, Gm13938, Gm14812, Gm15418, Gm15494, Gm2990, Got1, Gpx3, Gtf2h3, Gygox, Hadf, Herg, Hadf, Her Hspala, Hspb7, Htra1, Idh3a, Immt, Kars, Kctd20, Lbh, Ldb3, Lmod2, Lpl, Lrrc10, Mb, Meg3, Mest, Mllt11, Mllt3, Mybpc3, Mybphl, Myh6, Myl3, Mylkoz, Myom1, Myom1 Ndrg2, Ndufs1, Ndufv1, Nexn, Nppa, Nppb, Nrg1, Ogdh, Pam, Pcsk2os2, Pdlim5, Pet112l, Phyh, Pkp2, Pln, Pmpcb, Popdc2, Ppp1cb, Ppp1r14c, Ppp1r3g3, Ppp1r3 Rcan1, Rdh13, RP23-149A5.3, RP23-52N2.4, RP24-425N5.7 (AC109204.21), Ryr2, Scrn2, Sdc4, Sdha, Sdhd, Sh3kbp1, Slc16a1, Slc38a4, Slc8a1, Slco3apn, Snap , Snurf, Sorbs2, Spcs3, Sprr1a, Srl, Supt6h, Synpo2l, Tbrg4, Tecrl, Tgfb2, Tgm2, Tmem109, Tmem38a, Tmod1, Tnnt3, Tom1l1, Trdn, Trim55, Ttn, Ugp2, Uqcrcp1, Vdacirc1, Vdac17, and b) nucleic acid sequence which has at least 70% sequence identity to a nucleic acid sequence of group a c) Nucleic acid sequence which hybridizes to a nucleic acid sequence according to a) or b) under stringent conditions.

Description

Cardiovascular diseases are the most common cause of death in Germany with 338,056 cases in 2014 (38.9% of all deaths). Acute and chronic ischemic heart diseases represent the largest proportion of cardiovascular diseases with fatal consequences (DESTATIS). Despite major advances in treatment, heart failure is still incurable and is associated with cardiomyocyte death. The complete regeneration of the diseased heart with the help of new cardiomyocytes is not possible due to the very low proliferation capacity of the terminally differentiated cardiomyocytes occurring in the adult heart (Cho et al, 2014). Ischemic heart diseases are also a major cause of the so-called sinus node syndrome, which is associated with a disturbed impulse in the sinus node or a disturbed conduction of the electrical impulses from the sinus node to the atrium and is a collective term for numerous diseases originating from a disturbed sinus node function (see below).

The only causal therapy for heart failure is only heart transplantation, although the number of transplants has decreased from over 500 in 1991 to around 300 in 2013 (DESTATIS) and is out of proportion to the number of patients. In addition, the willingness to donate has declined further due to recent scandals regarding the allocation of donor organs.

Cell therapy or tissue engineering offer new, promising therapeutic approaches for heart regeneration. The goal is to replace the dead tissue with the appropriate cells. Pluripotent cells can serve as a source for targeted cell programming.

By using the induced pluripotent stem cells (iPS) described by Takahashi and Yamanaka in 2006, on the one hand, ethical problems that arise when using embryonic stem cells can be avoided, and on the other hand, iPS cells can be produced by the patient without immune system rejection threatens.

Deciphering the biological processes during cardiovascular stem cell differentiation is essential for the targeted programming of pluripotent stem cells for cell therapy or tissue engineering. An important starting point for this is the analysis of cardiovascular stem cell differentiation using systems biology approaches such as Transcriptome analysis. An essential part of this is the research of cardiac transcription factors, which can be used for the targeted programming of pluripotent cells in the various cardiac cell types. It was shown that overexpression of the mesodermally expressed basic helix-loop-helix transcription factor mesoderm posterior 1 (MESP1) leads to a significant increase in cardiogenesis in the differentiation of pluripotent stem cells (David et al. 2008). Detailed subtype-specific electrophysiological analyzes of the Mesp1-programmed cells showed a significant accumulation of cardiomyocytes with an early / intermediate phenotype (David et al. 2008). At around 60%, these represented the largest proportion of the cardiomyocytes analyzed. Another example of successful forward programming of pluripotent cells is the programming of these cells by overexpression of the transcription factor Nkx2.5. This led to predominantly ventricular cardiomyocytes (approx. 80%) (David et al. 2009).

Chip analyzes identified Dickkopf-related protein 1 (Dkk1), an inhibitor of the WNT signaling pathway, as a Mesp1 target gene (David 2008). Furthermore, a regulator of Mesp1 was identified with Brachyury (T), a member of the T-box transcription factor family (David et al. 2011).

The literature describes the coexpression of another member of this transcription factor family, the transcriptional repressor TBX3 and Mesp1 in the mesoderm (Den Hartogh et al. 2014, Bondue et al. 2011). TBX3 is essential for the development and homeostasis of the sinus node or the conduction system (Bakker et al. 2012). A common term for numerous diseases originating from a disturbed sinus node function is the sinus node syndrome. These include: pathological, symptomatic sinus bradycardia, SA blockages (SA = sinu-atrial), sinus arrest (= sinus node arrest) and bradycardia-tachycardia syndrome.
In sinus node syndrome, as well as myocarditis, ischemic heart diseases are often the basic cardiac disease. These cause a disturbed impulse in the sinus node or a disturbed conduction of the electrical impulses from the sinus node to the atrium (so-called sinuatrial line disturbance; see above). Current therapeutic approaches for “sick sinus syndrome” are based on the implantation of an artificial pacemaker. However, this has several disadvantages: it is cost-intensive, artificial pacemakers cannot be regulated by hormones and complications such as infections and battery depletion occur again and again.

The work of Bakker et al. Provides the first approaches to targeted programming of pacemaker cells. (2012) in which it could be shown that with the help of TBX3 terminally differentiated murine cardiomyocytes are reprogrammed into sinus-like cells. However, this is only a partial programming because the cells lack essential properties of the sinus node, such as the expression of the funny channel protein HCN4 (Bakker et al, 2012).

Another starting point is that of Kapoor et al. (2013) described viral-based reprogramming of ventricular myocardium in sinus node-like tissue by means of permanent overexpression of TBX18. However, these cells show abnormal cholinergic reactions, their contraction frequency also does not correspond to that of the sinus node and the effect of reprogramming was lost again after a short time (Hu et al. 2014). In addition, TBX18 is naturally only transiently expressed in part of the developing sinus node, while TBX3 is permanently present in the sinus node (Wiese et al. 2009).

It has recently been shown that the combination of overexpression of TBX3 and a Myh6 promoter-based antibiotic selection enables programming of pluripotent stem cells into previously unobserved aggregates of cardiomyocytes. With 300-400 beats per minute, these “induced sino-atrial bodies (“ iSABs ”) show a frequency never seen before in vitro (Jung et al. 2014; Rimmbach et al. 2015; DE 10 2013 114 671 B4 ). This almost corresponds to that of the mouse heart. Detailed analysis using confocal microscopy, FACS, single cell patch-chlamp, funny-channe / density measurement and Ca ²⁺ imaging showed that iSABs consist of more than 80% terminally differentiated sinus node cells. The analysis of the remaining cells showed that these are not yet fully differentiated sinus node cells. With the help of an ex vivo model of ventricular slice cultures, the pacemaker function of the iSABs could be demonstrated: They were able to integrate into the slice and stimulate it to robust synchronous contractions. iSABs are the first example of high-purity functional sinus node tissue generated in vitro.

It has recently been shown that so-called “long non-coding RNAs” (IncRNAs) are essential for the development of cardiomyocytes (Grote, 2013; Klattenhoff, 2013). However, neither specific IncRNAs nor specific ones were previously available for the development of sinus node cells Surface markers known.

Although initial approaches to the creation of sinus node cells exist, there was a further need for improved methods for the generation of sinus node cells. One object of the present invention was therefore to provide an improved method for generating sinus node cells from stem cells.

Surprisingly, it has now been found that an improved method for producing sinus node cells from stem cells can be provided if factors are used which have been identified by means of a next-generation sequencing analysis of the transcriptome of sinus node cells generated in vitro.

• i. mindestens ein Sinusknotenzellen-erzeugendes Polynukleotid oder mindestens ein durch dieses mindestens eine Sinusknotenzellen-erzeugende Polynukleotid codiertes Protein in Stammzellen eingebracht wird;
• ii die resultierenden Stammzellen in Gegenwart des mindestens einen Sinusknotenzellen-erzeugenden Polynukleotids oder des mindestens einen Proteins zu Sinusknotenzellen differenziert werden,

wobei das mindestens eine Sinusknotenzellen-erzeugende Polynukleotid eine Nukleinsäuresequenz umfasst, die ausgewählt ist aus der Gruppe bestehend aus

1. a) Nukleinsäuresequenz, ausgewählt aus der Gruppe bestehend aus Gm20685, Gm21989, 1700027A07Rik, 4930448N21 Rik, Acadvl, Actn2, Adm, Adprhl1, Adsl, Afap1l1, Ak1, Alpk2, Amfr, Angptl2, Ank, Ankrd1, Ap1m1, Art3, Atp2a2, Atp5a1, BC090627, Chkb, Cpt1b, C230088H06Rik, C630028M04Rik, Cap2, Casq1, Casq2, Cav3, Cdh13, Cfl2, Chsy1, Clu, Cnn1, Coq9, Coro6, Cs, Ctgf, D430001F17Rik, Def8, Dhrs13os, Dkk3, Dlst, Dnaja4, Dpysl2, Dusp3, Ech1, Ehd4, Eno3, Eral1, Etfdh, Fads3, Fam134b, Fam54b, Fhl1, Foxs1, Fuca2, Gal, Gbas, Gfpt2, Gja1, Gm12940, Gm13938, Gm14812, Gm15418, Gm15494, Gm2990, Got1, Gpx3, Gtf2h3, Gyg, Hadha, Hbegf, Herpud1, Hoxa1, Hspala, Hspb7, Htra1, Idh3a, Immt, Kars, Kctd20, Lbh, Ldb3, Lmod2, Lpl, Lrrc10, Mb, Meg3, Mest, Mllt11, Mllt3, Mybpc3, Mybphl, Myh6, Myl3, Mylk3, Myom1, Myoz2, Ncs1, Ndrg2, Ndufs1, Ndufv1, Nexn, Nppa, Nppb, Nrg1, Ogdh, Pam, Pcsk2os2, Pdlim5, Pet1121, Phyh, Pkp2, Pln, Pmpcb, Popdc2, Ppp1cb, Ppp1r14c, Ppp1r3c, Ppp2r1a, Ppp6r3, Prkar1a, Pygm, Rapgef4os3, Rcan1, Rdh13, RP23-149A5.3, RP23-52N2.4, RP24-425N5.7 (AC109204.21), Ryr2, Scrn2, Sdc4, Sdha, Sdhd, Sh3kbp1, Slc16a1, Slc38a4, Slc8a1, Slco3a1, Snap47, Snrpn, Snurf, Sorbs2, Spcs3, Sprr1a, Srl, Supt6h, Synpo2l, Tbrg4, Tecrl, Tgfb2, Tgm2, Tmem109, Tmem38a, Tmod1, Tnnt3, Tom1l1, Trdn, Trim55, Ttn, Ugp2, Uqcrc1, Vdac1, Wwox, Xirp1 und Zfp174;
2. b) Nukleinsäuresequenz, welche mindestens 70% Sequenzidentität zu einer Nukleinsäuresequenz der unter a) genannten Gruppe aufweist,
3. c) Nukleinsäuresequenz, welche unter stringenten Bedingungen an eine Nukleinsäuresequenz gemäß a) oder b) hybridisiert.

Das erfindungsgemäße Verfahren zur Erzeugung von Sinusknotenzellen aus Stammzellen ist ein in vitro-Verfahren, d.h. es wird in vitro durchgeführt. Die gemäß dem Verfahren zur Erzeugung von Sinusknotenzellen aus Stammzellen erzeugten Sinusknotenzellen werden synonym verkürzt auch als „erzeugte Sinusknotenzellen“ bezeichnet. „Polynukleotid“ im Rahmen der vorliegenden Erfindung bezieht sich auf ein lineares oder kreisförmiges Nukleinsäuremolekül, bevorzugt auf ein lineares Nukleinsäuremolekül. Umfasst sind Desoxyribonukleinsäure(DNA)- wie auch Ribonukleinsäure(RNA)-Moleküle, bevorzugt sind RNA-Moleküle (nähere Erläuterung im Folgenden).The present invention therefore relates to a method for producing sinus node cells (“cardiac pacemaker cells”) from stem cells, in which

• i. at least one polynucleotide generating sinus node cells or at least one protein encoded by this polynucleotide generating at least one sinus cell is introduced into stem cells;
• ii the resulting stem cells are differentiated into sinus node cells in the presence of the at least one polynucleotide generating sinus node cells or the at least one protein,

wherein the at least one sinus node cell-generating polynucleotide comprises a nucleic acid sequence that is selected from the group consisting of

1. a) Nucleic acid sequence, selected from the group consisting of Gm20685, Gm21989, 1700027A07Rik, 4930448N21 Rik, Acadvl, Actn2, Adm, Adprhl1, Adsl, Afap1l1, Ak1, Alpk2, Amfr, Angptl2, Ank, Ankrd1, Atp1m1a1, Art , BC090627, Chkb, Cpt1b, C230088H06Rik, C630028M04Rik, Cap2, Casq1, Casq2, Cav3, Cdh13, Cfl2, Chsy1, Clu, Cnn1, Coq9, Coro6, Cs, Ctgf, D430001F17khr ,134, D30001F17Rikp, Defos , Dusp3, Ech1, Ehd4, Eno3, Eral1, Etfdh, Fads3, Fam134b, Fam54b, Fhl1, Foxs1, Fuca2, Gal, Gbas, Gfpt2, Gja1, Gm12940, Gm13938, Gm14812, Gm15418, Gm29f3h3, Gm29x3h3, Gm29x3h3 , Gyg, Hadha, Hbegf, Herpud1, Hoxa1, Hspala, Hspb7, Htra1, Idh3a, Immt, Kars, Kctd20, Lbh, Ldb3, Lmod2, Lpl, Lrrc10, Mb, Meg3, Mest, Mllt11, Mllt3, Myphpc3, My , Myl3, Mylk3, Myom1, Myoz2, Ncs1, Ndrg2, Ndufs1, Ndufv1, Nexn, Nppa, Nppb, Nrg1, Ogdh, Pam, Pcsk2os2, Pdlim5, Pet1121, Phyh, Pkp2, Pln, Pmpcb, Popdc2, Ppp1rr6, Ppp1rr3, Ppp1rr3 Prkar1a, Pygm, Rapgef4os3, Rcan1, Rdh13, RP23-149A5.3, RP23-52N2.4, RP24-425N5.7 (AC109204.21), Ryr2, Scrn2, Sdc4, Sdha, Sdhd, Sh3kbp1, Slc16a1, Slc38a1 , Slco3a1, Snap47, Snrpn, Snurf, Sorbs2, Spcs3, Sprr1a, Srl, Supt6h, Synpo2l, Tbrg4, Tecrl, Tgfb2, Tgm2, Tmem109, Tmem38a, Tmod1, Tnnt3, Tom1l1, Trdn, Ug55, T55c, T55 , Wwox, Xirp1 and Zfp174;
2. b) nucleic acid sequence which has at least 70% sequence identity to a nucleic acid sequence of the group mentioned under a),
3. c) nucleic acid sequence which hybridizes under stringent conditions to a nucleic acid sequence according to a) or b).

The method according to the invention for generating sinus node cells from stem cells is an in vitro method, ie it is carried out in vitro. The sinus node cells generated in accordance with the method for generating sinus node cells from stem cells are also referred to as "generated sinus node cells". “Polynucleotide” in the context of the present invention relates to a linear or circular nucleic acid molecule, preferably to a linear nucleic acid molecule. Deoxyribonucleic acid (DNA) - as well as ribonucleic acid (RNA) molecules are included; RNA molecules are preferred (more detailed explanation below).

A stable, double-transfected pluripotent stem cell line (PSC cell line) with overexpression of TBX3 is preferably used to generate the sinus node cells. For cultivation, this cell line is kept in the pluripotent status by means of suitable cultivation conditions (coculture with fibroblasts or by means of specific media additives which are contained in the common PSC media). The differentiation is made using “embryoid bodies”. A three-dimensional aggregate of cells is generated from a suitable number of cells, which is dependent on the species and the starting cell line. Depending on the starting species and the subsequent application, this cell aggregate is adherently or cardially differentiated in suspension culture with the help of species-specific “small molecules”.

In one embodiment of the method for generating sinus node cells from stem cells, a construct for the expression of an antibiotic resistance gene which is controlled by an alpha-MHC (MYH6) promoter is additionally introduced in i) and the resulting stem cells are introduced into ii) differentiated in the presence of the antibiotic. In other words, in addition to TBX3 overexpression, an antibiotic resistance gene for the selection of mammalian cells under the control of the Myh6 promoter is preferably used for the PSC cell line. The “antibiotic resistance gene” is preferably selected from aminoglycoside antibiotic resistance genes, more preferably from neomycin and puromycin resistance genes, most preferably neomycin resistance gene; and the antibiotic is appropriately selected from the aminoglycoside antibiotics, particularly neomycin and puromycin, and is most preferably neomycin. The selection by means of an antibiotic takes place during the differentiation after the start of the contraction and continues until there are only contracting pacemaker cells.

The method according to the invention for generating sinus node cells from stem cells preferably additionally comprises verifying the sinus node cells obtained according to ii).

“Verifying the sinus node cells obtained according to ii)” means that it is checked (in vitro or ex vivo) whether sinus node cells have been successfully produced by the differentiation.

To verify the successful generation of sinus node cells, the electrophysiological properties can be analyzed with the single cell patch clamp technique and the measurement of the density of the HCN (or funny) channels as described (David et al. 2008; David et al. 2009; David et al. 2013).

As proof of the successful generation of sinus node cells, a conductivity of Funny channels of -75 pS / pF and / or a positive MDP (maximum diastolic potential) of> -65 can be ≥40, preferably in the days 40 to 50 mV and / or a DDR ₁₀₀ (diastolic depolarization rate) value of ≥ 30 mV / s can be considered.

The reaction to the administration of isoproterenol can be used as further proof of the successful generation of sinus node cells: in the case of successfully generated sinus node cells, the administration of isoproterenol leads to an acceleration of the AP rate by at least a factor of 0.5.

The reaction to HCN channel blockers serves as further proof of the successful generation of sinus node cells. By administering an HCN channel blocker, for example the HCN channel blocker ZD 7288, the frequency of the Ca ²⁺ transients is reduced in a time-dependent manner with successfully generated sinus node cells by at least 50%, preferably within 20 min.

Furthermore, the frequency of the Ca ²⁺ transients is also based on the activity of the voltage-dependent T-type and L-type Ca ²⁺ channels. In addition, the spontaneous frequencies of the Ca ²⁺ transients in successfully generated sinus node cells can be reduced after inhibiting the L-type Ca ²⁺ channels with nifedipine and / or by inhibiting the T-type Ca ²⁺ channels with mibefradil , which is further proof of the successful generation of sinus node cells.

A functional sarcoplasmic reticulum (SR) marks the maturity stage of the cardiomyocytes. The Ca ²⁺ from the SR therefore plays an important role in spontaneous activity. This influence of the Ca ²⁺ originating from the SR on spontaneous Ca ²⁺ transients is evident when a complete release of Ca ²⁺ from the SR with caffeine or an inhibition of SERCA (calcium pump of the sarcoplasmic and endoplasmic reticulum) is induced with thapsigargin . In successfully generated sinus node cells, the caffeine-induced Ca ²⁺ release from the SR increases the diastolic Ca ²⁺ level comparable to a Ca ²⁺ peak, but with recognizable spontaneous Ca ²⁺ transients over the course of time of the Ca ²⁺ - Peaks and with unchanged systolic Ca ²⁺ values, which is further evidence of the successful generation of sinus node cells. A similar, caffeine-induced effect on SR-Ca ²⁺ release cannot be demonstrated in unsuccessfully generated sinus node cells. The blockade of the reuptake of Ca ²⁺ into the SR by thapsigargin results in an increase in the diastolic Ca ²⁺ level only in successfully generated sinus node cells, which is further proof of the successful generation of sinus node cells.

The vast majority of the Ca ²⁺ transients underlying Ca ²⁺ derived from the extracellular space. Therefore, an exchange of the extracellular Ca ²⁺ leads to a cancellation of the Ca ²⁺ transients. If the sarcolemma Ca ²⁺ influx is eliminated by blocking the Na + / Ca ²⁺ exchanger and the Ca ²⁺ channels, only an intracellular Ca ²⁺ circuit can be detected. In this case, the addition of caffeine in successfully generated sinus node cells induced a Ca ²⁺ peak, which is increased by at least a factor of 2 compared to that of unsuccessfully generated sinus node cells, which is further evidence of the successful generation of sinus node cells.

In one embodiment, an ex vivo model based on cultured ventricular sections of murine hearts is used as further evidence to ultimately examine the generated sinus node cells for functional pacemaker activity [Halbach et al. 2006]. While these usually have a spontaneous impact activity immediately after preparation, a stable contraction of up to -60 bpm can be induced with electrodes, making them an ideal test system for the functionality of the generated sinus node cells. For this purpose, the generated sinus node cells on cultured ventricular sections sawn out of murine hearts, the sowing is checked by means of Dil marking. In order to determine the effect of the sowing of the sinus cells generated, the spontaneous cutting activity in naive cuts is first carefully quantified. After the generated sinus node cells have been sown, the spontaneous impact activity is checked regularly, at least daily. An increase in the stroke activity by at least a factor of 3, preferably by at least a factor of 3.5, more preferably by at least a factor of 4, is regarded as further evidence of the successful differentiation into sinus node cells.

In the context of the present invention, at least one of the cited verifications, preferably at least two, more preferably at least three, must be positive so that one can speak of a successful differentiation into sinus node cells. More preferably, the measurement of the density of the HCN (or funny) channels and the analysis of the (further) electrophysiological properties with the single cell patch clamp technique must be positive, ie on a day ≥40, preferably in days 40 to 50 , there must be a conductivity of Funny channels of -75 pS / pF and a positive MDP (maximum diastolic potential) of> -65 mV and a DDR ₁₀₀ (diastolic depolarization rate) value of ≥ 30 mV / s in order to be successful Differentiation to sinus spinal cells can be spoken of. Most preferably, all of the above-mentioned evidence must be positive so that there is successful differentiation into sinus node cells.

“Sequence identity” means an identity at the nucleotide level, whereby a sequence identity with any percentage value means that one or more nucleotides have been removed, replaced or supplemented, the resulting sequence and possibly the protein produced on this basis maintaining its function. The Nucleic acid sequence according to b) preferably has a sequence identity of at least 80%, more preferably of at least 90%, more preferably of at least 91%, more preferably of at least 92%, more preferably of at least 93%, more preferably of at least 94% more preferably of at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, or more preferably at least 99%, most preferably from 100%.

The percentage identity values are preferably calculated over the entire nucleic acid sequence region. A number of programs based on a large number of algorithms are available to the person skilled in the art for comparing different sequences. In this context, the algorithms from Needleman and Wunsch or Smith and Waterman provide particularly reliable results. The program PileUp (J. Mol. Evolution., 25, 351-360, 1987, Higgins et al., CABIOS, 5 1989: 151-153) or the programs Gap and BestFit [Needleman and Wunsch (J Mol. Biol. 48; 443-453 (1970)) and Smith and Waterman (Adv. Appl. Math. 2; 482-489 (1981))], which are part of the GCG software package [Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711 (1991)]. The sequence identity values given above in percent (%) are preferably to be determined using the program GAP over the entire sequence region with the following settings: gap weight: 50, length weight: 3, average match: 10,000 and average mismatch: 0.000, which, if not different should always be used as the default settings for sequence alignments.

“Stringent hybridization conditions” in the present sense are preferably hybridization conditions in 6 × sodium chloride / sodium citrate (= SSC) at approximately 45 ° C., followed by one or more washing steps in 0.2 × SSC, 0.1% SDS at 53 to 65 ° C. , preferably at 55 ° C, 56 ° C, 57 ° C, 58 ° C, 59 ° C, 60 ° C, 61 ° C, 62 ° C, 63 ° C, 64 ° C or 65 ° C. The person skilled in the art knows that these hybridization conditions differ depending on the type of nucleic acid and, for example if organic solvents are present, with regard to the temperature and concentration of the buffer. For example, under “standard hybridization conditions” the temperature varies between 42 ° C and 58 ° C in an aqueous buffer with a concentration of 0.1 to 5 × SSC (pH 7.2) depending on the type of nucleic acid. If an organic solvent is present in the above buffer, for example 50% formamide, the temperature is about 42 ° C under standard conditions. The hybridization conditions for DNA: DNA hybrids are preferably, for example, 0.1 × SSC and 20 ° C. to 45 ° C., preferably between 30 ° C. and 45 ° C. The hybridization conditions for DNA: RNA hybrids are preferably, for example, 0.1 × SSC and 30 ° C. to 55 ° C., preferably between 45 ° C. and 55 ° C. The above-mentioned hybridization temperatures are determined, for example, for a nucleic acid with a length of about 100 bp (= base pairs) and a G + C content of 50% in the absence of formamide.

The nucleic acid sequence according to a) is preferably selected for the method for generating sinus node cells from stem cells from the group consisting of Dkk3, Zfp174, Dhrs13os, Gm2990, Gm15494, 1700027A07Rik, Gm20685, Gm21989, RP23-52N2.4, 493044814N21 Rik, Gm20685 -149A5.3, C230088H06Rik, Gm15418, C630028M04Rik, D430001F17Rik, Gm12940, Gm13938, Pcsk2os2, Rapgef4os3 RP24-425N5.7, BC090627 and Meg3.

The polynucleotides, in particular the nucleic acid sequences according to a), are also referred to as “programming factors”. Table 1 below lists all the programming factors in accordance with a) together with their respective database identification names, in each case for the murine and the human representatives. In the context of the method according to the invention, the human programming factors are preferably used to generate the sinus node cells, the use of non-human, in particular murine, programming factors or a mixture of human and non-human, in particular murine, programming factors also being possible. Table 1 Nucleic acid sequence GenBank * GenBank * Blast (blastn) homology human (RNA) (human) (murine) MGI ID ** VEGA ID *** vs murin in% Gm20685 - - MGI: 5313132 OTTMUSG00000042246 Gm21989 - - MGI: 5439458 OTTMUSG00000042297 1700027A07Rik - - MGI: 1917246 OTTMUSG00000021020 4930448N21Rik - - MGI: 1926155 OTTMUSG00000044654 Acadvl NM_001270447.1 GI: 394025722 NM_017366.3 GI: 425876777 - - 84 Actn2 NM_001103.3 GI: 507588246 NM_033268.4 GI: 157951642 - - 91 Adm NM_001124.2 GI: 675022745 NM_009627.1 GI: 6752987 - - 78 Adprhl1 NM_138430.4 GI: 565324228 NM_172750.3 GI: 146198706 - - 80 Adsl NM_000026.3 GI: 961652660 NM_009634.6 GI: 443497954 - - 88 Afap1 | 1 NM_152406.2 GI: 226437593 NM_178928.4 GI: 118130646 - - 87 Ak1 NM_000476.2 GI: 149999601 NM_001198792.1 GI: 311771691 - - 81 Alpk2 NM_052947.3 GI: 148596991 NM_001037294.1 GI: 254675180 - - 71 On Friday NM_001144.5 GI: 378744169 NM_011787.2 GI: 113205072 - - 87 Angptl2 NM_012098.2 GI: 34577067 NM_011923.4 GI: 141803564 - - 76 Arrival NC_000002.12 GI: 568815596 NC_000076.6 GI: 372099100 - - Ankrd1 NM_014391.2 GI: 38327521 NM_013468.3 GI: 133893293 - - 83 Ap1m1 NM_001130524.1 GI: 194473723 NM_007456.4 GI: 158517945 - - 87 Art3 NM_001130016.2 GI: 362999609 NM_001310664.1 GI: 893571721 - - 71 Atp2a2 KU177931.1 GI: 957948980 NM_009722.3 GI: 160948582 - - 86 Atp5a1 NM_001001937.1 GI: 50345983 NM_007505.2 GI: 126506325 - - 88 BC090627 - NR_004843.2 GI: 311083022 - - 84 Chkb NM_005198.4 GI: 242246959 NR_037154.1 GI: 311083399 - - 82 Cpt1b NM_004377.3 GI: 311213909 NM_009948.2 GI: 162287164 - - 83 C230088H06Rik - - MGI: 2444536 - C630028M04 Rick - - MGI: 3045376 OTTMUSG00000006984 Cap2 U02390.1 GI: 409928 NM_026056.4 GI: 298676468 - - 79 Casq1 NM_001231.4 GI: 227430326 NM_009813.2 GI: 227430321 - - 85 Casq2 - NM_009814.3 GI: 409971433 - - 79 Cav3 NM_033337.2 GI: 299115915 NM_007617.3 GI: 480354949 - - 86 Cdh13 NM_001257.4 GI: 333944011 NM_019707.5 GI: 949474745 - - 81 Cfl2 NM_021914.7 GI: 254692875 NM_007688.2 GI: 126513132 - - 80 Chsy1 NM_014918.4 GI: 258613868 NM_001081163.1 GI: 124487198 - - 84 Clu NM_001831.3 GI: 355594752 NM_013492.3 GI: 951232921 - - 80 Cnn1 NM_001299.5 GI: 816197618 NM_009922.4 GI: 226423896 - - 83 Coq9 NM_020312.3 GI: 305855066 NM_026452.2 GI: 118129840 - - 84 Coro6 NM_032854.3 GI: 255982619 NM_139130.2 GI: 118129989 - - 89 Cs NM_004077.2 GI: 38327624 NM_026444.3 GI: 118129843 - - 80 Ctgf NM_001901.2 GI: 98986335 NM_010217.2 GI: 171846282 - - 80 D430001F17Rik - XR_385050.2 GI: 755555247 MGI: 2441973 OTTMUSG00000025508 Def8 NM_207514.2 GI: 338797786 BC003306.1 GI: 13097038 - - 88 Dhrs13os - XR_106205.3 GI: 755540541 MGI: 1924478 OTTM USG00000000076 89 Dkk3 NM_015881.5 GI: 66346686 NM_015814.2 GI: 31560475 - - 83 Dlst NM_001933.4 GI: 254588100 NM_030225.4 GI: 255308882 - - 83 Dnaja4 NM_018602.3 GI: 194328757 NM_021422.4 GI: 299890777 - - 77 Dpysl2 NM_001197293.2 GI: 347543826 NM_009955.3 GI: 162287190 - - 86 Dusp3 NM_004090.3 GI: 167466211 NM 028207.3 GI: 315113874 - - 69 Ech1 NM_001398.2 GI: 70995210 NM_016772.1 GI: 7949036 - - 81 Ehd4 NM_139265.3 GI: 237649102 NM_133838.4 GI: 146149325 - - 88 Eno3 NM_001976.4 GI: 301897468 CT010193.1 GI: 71059714 - - 90 Eral1 NM_005702.2 GI: 52851406 NM_022313.2 GI: 165377196 - - 82 Etfdh NM_001281737.1 GI: 528881080 NM_025794.2 GI: 254588013 - - 89 Fads3 NM_021727.4 GI: 541862102 NM_021890.3 GI: 70887800 - - 82 Fam134b NM_001034850.2 GI: 356582279 NM_001277315.1 GI: 474451724 - - 77 Fam54b KU178724.1 GI: 957951384 NM_001256112.1 GI: 368711319 - - 80 Fhl1 NM_001159702.2 GI: 268607695 NM_001287800.1 GI: 568384814 - - 83 Foxs1 NM_004118.3 GI: 34304365 NM_010226.2 GI: 142371908 - - 78 Fuca2 NM_032020.4 GI: 304361738 NM_025799.4 GI: 146134981 - - 82 Gal NM_015973.4 GI: 908212431 NM_010253.3 GI: 118129967 - - 74 Gbas NM_001483.2 GI: 321267475 NM_008095.4 GI: 160298167 - - 81 Gfpt2 NM_005110.3 GI: 960139189 NM_013529.3 GI: 226874802 - - 85 Gja1 NM_000165.4 GI: 635574611 NM_010288.3 GI: 166091435 - - 82 Gm12940 - NR_045010.1 GI: 343488491 MGI: 3702626 OTTM USG00000009329 Gm13938 - - MGI: 3651046 OTTMUSG00000015133 Gm14812 - NR_033544.2 GI: 379642568 MGI: 3642165 OTTMUSG00000018066 Gm15418 - XR_378714 / GI: 568953665 MGI: 3705275 OTTM USG00000021318 Gm15494 - - MGI: 3782940 OTTM USG00000022760 Gm2990 - - MGI: 3781168 - Got1 NM_002079.2 GI: 197304792 NM_010324.2 GI: 160298208 - - 79 GPX3 NM_002084.3 GI: 89903006 NM_008161.3 GI: 378744204 - - 84 Gtf2h3 NM_001271866.1 GI: 428673521 NM_181410.3 GI: 258679478 - - 86 Gyg NM_004130.3 GI: 296040503 NM_013755.3 GI: 612149772 - - 86 Hadha NM_000182.4 GI: 105990523 NM_178878.2 GI: 142357440 - - 89 Hbegf NM_001945.2 GI: 194018480 NM_010415.2 GI: 257196256 - - 77 Herpud1 NM_014685.3 GI: 442535516 NM_022331.1 GI: 11612514 - - 85 Hoxa1 NM_005522.4 GI: 84697023 NM_010449.4 GI: 160358775 - - 83 Hspala NM_005345.5 GI: 194248071 NM_010479.2 GI: 124339828 - - 92 Hspb7 NM_014424.4 GI: 164519093 NM_013868.4 GI: 146149132 - - 80 Htra1 NM_002775.4 GI: 190014575 NM_019564.3 GI: 229093138 - - 83 Idh3a NM_005530.2 GI: 28178835 NM_029573.2 GI: 31560055 - - 83 Immt NM_006839.2 GI: 154354963 NM_029673.3 GI: 358439477 - - 86 Kars NM_001130089.1 GI: 194272209 NM_001286384.1 GI: 556503823 - - 87 Kctd20 NM_173562.4 GI: 557440893 NM_025888.5 GI: 146134949 - - 82 Lbh NM_030915.3 GI: 149274623 NM_029999.4 GI: 239915966 - - 74 Bdb3 NM_007078.2 GI: 122056615 NM_011918.4 GI: 122056485 - - 78 Lmod2 NM_207163.1 GI: 150378502 NM_053098.2 GI: 141801988 - - 83 Lpl CR457054.1 GI: 48146224 NM_008509.2 GI: 126723005 - - 83 Lrrc10 NM_201550.3 GI: 747811812 NM_146242.2 GI: 113930741 - - 79 Mb NM_203377.1 GI: 44955884 NM_001164047.1 GI: 255708422 - - 82 Meg3 NR_046468.2 GI: 383209667 NR_027652.1 GI: 236460413 - - 68 Mest D78611.1 GI: 1655421 NM_001252292.1 GI: 356582502 - - 89 Mllt11 NM_006818.3 GI: 55774979 NM_019914.4 GI: 240120167 - - 75 Mllt3 NM_004529.3 GI: 557878693 NM_027326.3 GI: 114205415 - - 83 Mybpc3 NM_000256.3 GI: 148596956 NM_008653.2 GI: 134031946 - - 85 Mybphl NM_001010985.2 GI: 194018538 NM_026831.1 GI: 74316016 - - 86 Myh6 NM_002471.3 GI: 289803014 NM_001164171.1 GI: 255918224 - - 91 Myl3 NM_000258.2 GI: 115527085 NM_010859.2 GI: 142383792 - - 81 Mylk3 NM_182493.2 GI: 146219831 NM_175441.5 GI: 146198833 - - 82 Fibroid1 NM_003803.3 GI: 140560918 NM_010867.2 GI: 145279174 - - 86 Myoz2 NM_016599.4 GI: 343403769 NM_021503.2 GI: 240120170 - - 86 NCS1 NM_014286.3 GI: 192447421 NM_019681.3 GI: 118130553 - - 84 Ndrg2 NM_201536.1 GI: 42544212 NM_013864.2 GI: 225543194 - - 82 Ndufs1 NM_001199982.1 GI: 316983157 NM_001160038.1 GI: 229892317 - - 89 Ndufv1 NM_001166102.1 GI: 260656004 NM_133666.3 GI: 509155846 - - 87 Nexn NM_144573.3 GI: 148839338 NM_199465.2 GI: 240849435 - - 87 Nppa NM_006172.3 GI: 239915969 NM_008725.3 GI: 937500799 - - 75 Nppb NM_002521.2 GI: 83700236 NM_008726.5 GI: 565671788 - - 72 No. 1 NM_013959.3 GI: 236459369 NM_178591.2 GI: 124377985 - - 91 Ogdh NM_002541.3 GI: 259013550 NM_001252287.1 GI: 356582488 - - 87 Pam NM_138822.2 GI: 293336288 NM_013626.3 GI: 153792656 - - 86 Pcsk2os2 - NR_040625.1 GI: 341926229 MGI: 3649365 OTTMUSG00000006467 Pdlim5 NM_001011513.3 GI: 374093200 NM_001190856.1 GI: 300069040 - - 79 Pet112l NM_004564.2 GI: 296278253 NM_144896.4 GI: 146149293 - - 86 Phyh NM_006214.3 GI: 83281448 NM_010726.2 GI: 162287377 - - 81 Pkp2 NM_001005242.2 GI: 148664185 NM_026163.2 GI: 142349260 - - 86 Pln NM_002667.3 GI: 194306634 NM_001141927.1 GI: 213512815 - - 72 Pmpcb NM_004279.2 GI: 94538353 NM_028431.2 GI: 142357637 - - 86 Popdc2 NM_022135.3 GI: 815930081 NM_001081984.2 GI: 798957062 - - 82 Ppp1cb NM_206876.1 GI: 46249375 NM_172707.3 GI: 161484667 - - 88 Ppp1r14c NM_030949.2 GI: 118722343 NM_133485.2 GI: 118130995 - - 74 Ppp1r3c NM_005398.5 GI: 349732222 NM_016854.2 GI: 148540121 - - 80 Ppp2r1a NM_014225.5 GI: 294774554 NM_016891.3 GI: 118131166 - - 88 Ppp6r3 NM_001164163.1 GI: 255918197 NM_028999.1 GI: 255918185 - - 85 Prkar1a NM_001276289.1 GI: 443497963 NM_001313976.1 GI: 928192557 - - 82 Pygm NM_005609.2 GI: 164663907 NM_011224.2 GI: 957801613 - - 88 Rapgef4os3 - - MGI: 2442080 OTTMUSG00000013151 Rcan1 NM_004414.6 GI: 557786106 NM_019466.4 GI: 575077470 - - 75 Rdh13 NM_001145971.1 GI: 225579077 NM_001290411.1 GI: 594150418 - - 80 RP23-149A5.3 - - - OTTMUSG00000047508 RP23-52N2.4 - - - OTTMUSG00000046937 RP24-425N5.7 / AC 109204.21 - - - OTTMUSG00000045323 AC109204.21 - NG_032840.1 GI: 394953449 - - Ryr2 NM_001035.2 GI: 112799846 NM_023868.2 GI: 124430577 - - 87 Scrn2 NM_138355.3 GI: 222537731 NM_146027.2 GI: 256574753 - - 85 Ndc4 NM_002999.3 GI: 318037226 NM_011521.2 GI: 118130129 - - 70 Sdha NM_001294332.1 GI: 661567359 NM_023281.1 GI: 54607097 - - 84 Sdhd NM_001276506.1 GI: 452406067 NM_025848.3 GI: 257796246 - - 82 Sh3kbp1 NM_031892.2 GI: 215490004 NM_001135727.2 GI: 594591615 - - 84 Slc16a1 NM_003051.3 GI: 115583684 NM_009196.4 GI: 530537275 - - 80 Slc38a4 NM_018018.4 GI: 219689130 NM_027052.3 GI: 142365242 - - 75 Slc8a1 NM_001112802.1 GI: 163914372 NM_011406.3 GI: 557878599 - - 80 Slco3a1 NM_013272.3 GI: 222831574 NM_023908.2 GI: 84579879 - - 90 Snap47 NM_053052.3 GI: 224465201 NM_144521.2 GI: 118130016 - - 75 Snrpn NM_003097.3 GI: 29540556 NM_013670.3 GI: 133725811 - - 86 Snurf NM_005678.3 GI: 29540557 NM_033174.3 GI: 364023834 - - 86 Sorbs2 NM_001270771.1 GI: 398650629 NM_172752.4 GI: 327315369 - - 80 Spcs3 NM_021928.3 GI: 221139766 NM_029701.1 GI: 125988402 - - 74 Sprr1a NM_001199828.1 GI: 315360634 NM_009264.2 GI: 61675694 - - 74 Srl NM_001098814.1 GI: 149363671 NM_175347.4 GI: 118129867 - - 86 Supt6h NM_003170.3 GI: 75677341 NM_009297.2 GI: 166091433 - - 86 Synpo2l NM_001114133.2 GI: 564473360 NM_175132.4 GI: 882939089 - - 81 Rbrg4 NM_004749.3 GI: 387912539 NM_134011.2 GI: 194394225 - - 81 Tecrl NM_001010874.4 GI: 196259813 NM_153801.3 GI: 254540075 - - 82 Rgfb2 NM_001135599.2 GI: 305682568 NM_009367.3 GI: 166706904 - - 81 Tgm2 NM_004613.2 GI: 39777596 NM_009373.3 GI: 118130416 - - 84 Tmem109 NM_024092.2 GI: 215983102 NM_134142.1 GI: 19527377 - - 72 Tmem38a NM_024074.1 GI: 13129059 NM_144534.1 GI: 21362330 - - 86 Tmod1 NM_003275.3 GI: 260763920 NM_021883.2 GI: 144922650 - - 80 Tnnt3 NM_001297646.1 GI: 663071011 NM_001163664.1 GI: 254750712 - - 83 Tom1l1 NM_005486.2 GI: 191252811 NM_028011.2 GI: 141803263 - - 80 Trdn NM_006073.3 GI: 354682006 NM_029726.2 GI: 226437650 - - 85 Trim55 - NM_001081281.1 GI: 124486876 - - 84 Ttn NM_184085.1 GI: 34878835 NM_011652.3 GI: 77812696 - - Ugp2 NM_006759.3 GI: 48255965 NM_139297.6 GI: 594591613 - - 86 Uqcrc1 NM_003365.2 GI: 46593006 NM_025407.2 GI: 46593020 - - 84 Vdac1 NM_003374.2 GI: 307133764 NM_011694.5 GI: 928589410 - - 80 Wwox NM_016373.3 GI: 635172867 NM_019573.3 GI: 255982975 - - 78 Xirp1 NM_194293.2 GI: 40255271 NM_011724.3 GI: 285002265 - - 80 Zfp174 NM_001032292.2 NM_001081217.1 GI: 124487046 - - 78 * Version: NCBI-GenBank Release 210.0 from October 15, 2015 ** Mouse Genome Informatics; http://www.informatics.jax.org/mgihome/projects/aboutmgi.shtml; Version from 08/12/2015; MGI 6.01 *** Vertebrate Genome Annotation (Vega) database; http://vega.sanger.ac.uk; Vega Genome Browser release 63 - December 2015

In one embodiment of the method for generating sinus node cells from stem cells, the at least one polynucleotide is introduced by means of a vector.

“Vector” in the sense of the present invention preferably comprises phage, plasmid, viral or retroviral vectors as well as artificial chromosomes, such as bacterial or artificial yeast chromosomes. Furthermore, the term also relates to targeted constructs, which allow a random or location-specific integration of the targeted construct into genomic DNA. Such target constructs preferably comprise DNA of sufficient length for either homologous or heterologous recombination, as described in detail below. The vector can be incorporated into a stem cell by various techniques that are well known in the art. When introduced into a stem cell, the vector can be in the cytoplasm or can be incorporated into the genome. In the latter case it is clear that the vector can further comprise nucleic acid sequences which enable homologous recombination or heterologous insertion. Vectors can be introduced into eukaryotic cells (including prokaryotic cells) by conventional transformation or transfection techniques. The terms "transformation" and "transfection" as used in the present context are intended to encompass several prior art methods for introducing foreign nucleic acid (for example DNA) into a host cell, including calcium phosphate, rubidium chloride or calcium chloride co-precipitation , DEAE-dextran-mediated transfection, lipofection, natural competence, carbon-based clusters, chemically mediated transfers, electroporation or particle bombardment (eg "gene-gun"). Suitable methods for the transformation or transfection of host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989) and other laboratory manuals, such as Methods in Molecular Biology, 1995, Volume 44, Agrobacterium protocols, Hrg .: Gartland and Davey, Humana Press, Totowa, New Jersey. Alternatively, a plasmid vector can be introduced by thermal shock or electroporation techniques. If the vector is a virus, it can be packaged in vitro using a suitable packaging cell line prior to application to host cells. Retroviral vectors can be replication-competent or replication-defective. In the latter case, viral replication generally only takes place in complementing hosts / cells.

In particular, the vector of the present invention is an expression vector. In such an expression vector, the polynucleotide comprises an expression cassette which enables expression in eukaryotic cells or fractions isolated therefrom. An expression vector may include other regulatory elements in addition to the polynucleotide of the invention, including transcriptional as well as translational enhancers. The expression vector is preferably also a gene transfer or targeting vector. Expression vectors derived from viruses, such as retroviruses, vaccinia virus, adeno-associated virus, herpes viruses or bovine papilloma virus, can be used to deliver the polynucleotides or the vector of the invention into a stem cell population. Methods that are well known to those skilled in the art can be used to construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994).

In a preferred embodiment of the method according to the invention for generating sinus node cells from stem cells, the at least one Sinus node cell-producing polynucleotide introduced into the stem cells as mRNA (messenger RNA; English: messenger RNA) which comprises a nucleic acid sequence which is selected from the group consisting of a) and b) as indicated above, the nucleic acid sequence according to a) as described above is selected from the 168 programming factors according to Table 1 and more preferably is selected from the group consisting of Dkk3, Zfp174, Dhrs13os, Gm2990, Gm15494, 1700027A07Rik, Gm20685, Gm21989, RP23-52N2.4, 4930448N21Rik, Gm148A5, RP23-249A5 .3, C230088H06Rik, Gm15418, C630028M04Rik, D430001F17Rik, Gm12940, Gm13938, Pcsk2os2, Rapgef4os3 RP24-425N5.7, BC090627 and Meg3. The at least one sinus node cell-producing polynucleotide is more preferably introduced into the stem cells as mRNA, which comprises a nucleic acid sequence according to a), ie one of the 168 programming factors according to Table 1. More preferably, the at least one sinus node cell-producing polynucleotide is introduced into the stem cells as mRNA comprising a nucleic acid sequence (a programming factor) selected from Dkk3, Zfp174, Dhrs13os, Gm2990, Gm15494, 1700027A07Rik, Gm20685, Gm21989, RP23-52N2.4, 4930448N21Rik, Gm14812, RP23-149A5.3, C230088H06Rik, Gm15418, C630028M04Rik, D430001F17Rik, Gm12940, Gm13938, Pcsk2os2, Rapgef4os3 RP24-425N5.7, BC090627 and Meg3.

Further preferably for the method for generating sinus node cells from stem cells, the mRNA is introduced as a modified mRNA (mmRNA), in which at least one nucleic acid naturally occurring in RNA is replaced by a corresponding modified nucleic acid base, the modified nucleic acid base preferably being selected from 5-methylcytosine , Pseudouracil, pseudocytidine, pseudoisocytidine, more preferably from methylcytosine, pseudouracil. The nucleotides naturally occurring in RNA are adenine, guanine, cytosine and uracil. “Replaced by a corresponding modified nucleic base” means that a modified nucleic base based on the same basic structure is used for the nucleic base to be replaced, for example cytosine is replaced by 5-methylcytosine. The generation of mRNA is known from the literature and is within the scope of the present invention as described by Hausburg et al. described (Hausburg, 2015).

With regard to the mRNA and the mmRNA, it is also the case that the human RNA is preferably used, it also being possible to use non-human, in particular murine, RNA or a mixture of human and non-human, in particular murine, RNA.

In addition to the programming factors for cell programming according to Table 1, a new surface marker for cell isolation Lrpap1 (human: NM_002337.3 GI: 336595168, murin: NM_013587.2 GI: 63999379) was generated based on the next-generation sequencing analysis of the transcriptome of sinus node cells generated in vitro , GenBank, Version: NCBI-GenBank Release 210.0 from 10/15/2015).

In one embodiment of the method for generating sinus node cells from stem cells, the sinus node cells obtained according to ii) are therefore purified on the basis of Lrpap1 (protein) present on the sinus node cells obtained. The purification is carried out, in particular, using antibodies using magnetic cell sorting (“MACS”) or fluorescence-based (“FACS”). For this purpose, the cells are preferably differentiated until the start of the contraction and labeled with an antibody directed against the extracellular part of Lrpap1. The Lrpap1 positive cells are isolated by means of FACS or MACS and the pacemaker cells are thus purified.

When introducing the nucleic acid sequences mentioned under a) or under a), b) and c), a combination with a Myh6-based antibiotic selection is advantageously required in order to purify the sinus node cells. This means that in step i) an additional construct for the expression of an antibiotic resistance gene, which is controlled by an alpha-MHC (MYH6) promoter, has to be introduced and the resulting stem cells in ii) have to be differentiated in the presence of the antibiotic. The Lrpap1 protein is a transmembrane protein, the part outside of which is used to recognize and purify the sinus node cells (surface marker). In an advantageous embodiment, the introduction of an antibiotic resistance gene and the purification by means of antibiotic selection are omitted in this variant.

Furthermore, the invention also relates to a method for purifying sinus node cells produced from stem cells by a method according to the present invention, the sinus node cells obtained being purified using Lrpap1 (protein) present on them. It is conceivable that this is not restricted to the purification of sinus node cells which were generated from stem cells by the method according to the invention, but rather can encompass all types of sinus node cells, in particular in vitro, in particular from stem cells. The purification is carried out, in particular, using antibodies using magnetic cell sorting (“MACS”) or fluorescence-based (“FACS”). For this purpose, the cells are preferably differentiated until the start of the contraction and labeled with an antibody directed against the extracellular part of Lrpap1. The Lrpap1 positive cells are isolated by means of FACS or MACS and the pacemaker cells are thus purified.

Multipotent or pluripotent, preferably pluripotent, stem cells are preferably used for the process for the production of sinus node cells from stem cells, but also, if appropriate, for the process for the purification of sinus node cells generated from stem cells.

For the process for the production of sinus node cells from stem cells, but also optionally for the process for the purification of sinus node cells generated from stem cells, the stem cells selected from human or non-human embryonic stem cells or human or non-human induced stem cells or human induced stem cells are further preferred or parthenogenetic stem cells or spermatogonial stem cells. These are preferably non-human embryonic stem cells or non-human induced stem cells or human induced stem cells or parthenogenetic stem cells or spermatogonal stem cells, particularly preferably non-human embryonic stem cells or non-human induced stem cells or human induced stem cells. Human embryonic stem cells are explicitly excluded in the preferred and particularly preferred variant. This applies both to the process for generating sinus node cells from stem cells and, if appropriate, to the process for purifying sinus node cells generated from stem cells.

Sinus node cells (human or non-human) are generated in any case, with human sinus node cells being preferred. For this purpose, human stem cells are combined with preferably human polynucleotide. Cross combinations, such as the introduction of human polynucleotides into non-human, e.g. murine, stem cells are also possible, even the pure combination of the non-human representatives to generate non-human cardiac pacemaker cells.

As explained above with regard to the “verification”, the sinus node cells according to the invention, produced in vitro from stem cells, show the expected behavior when brought into contact with pharmaceuticals: for example, the administration of the β-adrenoreceptor agonist isoprotenerol leads to an increased stroke rate. Since the sinus node cells according to the invention, produced from stem cells, reacted to the administered pharmaceuticals in the same way as sinus node cells in vivo, they are suitable as a model for normal sinus node cells. Sinus node cells generated in vitro from stem cells, in particular the sinus node cells produced according to the invention (in vitro) from stem cells are therefore, inter alia, also used for in vitro evaluation of medicinal products. This includes the investigation of active substances, i.e. potential drugs to understand their actual suitability as such ("in vitro drug testing"). Potential candidates for new drugs must be tested for their quality, safety and efficacy in prescribed preclinical and clinical studies before they are approved for marketing by the drug authorities. Since the biochemical as well as the cheminformatics preliminary examinations do not provide final certainty as to how a new active ingredient behaves in vivo, new active ingredients have to be tested in preclinical studies, which has so far made animal experiments indispensable. The use of sinus node cells generated in vitro from stem cells, in particular the sinus node cells according to the invention, can at least help to reduce the number of animal experiments. Sinus node cells generated in vitro from stem cells, in particular the sinus node cells according to the invention, are also used in the run-up to the preclinical stage, since cell-based in vitro assays can often be used in the search for drug candidates and in toxicity testing, due to the fact that these are essential aspects of in vivo Can reflect pharmacology and toxicology.

Sinus node cells generated from stem cells, in particular the sinus node cells produced according to the invention from stem cells, are also useful in cardiac tissue construction and / or cardiac tissue breeding, in particular for implantation purposes, but also for de novo generation in vivo. The focus here is in particular on the production of cell-based biological cardiac pacemakers.

• Durch Next-Generation-Sequencing Analysen wurde das Transkriptom von in vitro generierten Sinusknotenzellen definiert und mit Hilfe eines standardisierten Verfahrens (Wolfien et. al. 2015) analysiert.

The investigations on which the invention is based are presented below:

• The transcriptome of sinus node cells generated in vitro was defined by next-generation sequencing analyzes and analyzed using a standardized procedure (Wolfien et. Al. 2015).

The differentiated cardiac pacemaker cells were lysed, the RNA isolated and transcribed into cDNA using reverse transcriptase. This cDNA was then used to produce a sequencing library provided with a barcode, which was used for the analysis of the transcriptome in a next generation sequencing device (Illumina Genome Analyzer llx).
The transcriptome data analysis is based on the comparison of the nucleotide sequences (sequence length 78 bp; sequence depth 21 million - 32 million per experimental replica). The first step in the sequence processing of the .fastq formatted data was to remove the Illumina adapter sequences that were added by the experimental procedure
(GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGTGATCTCGTATGCCGTCTT CTGCTT). Thereafter, nucleotide sequences with a quality value less than 20 were also removed so that these sequences with lower quality do not falsify the analysis. The sequence pieces were then placed on the mouse reference genome using the TopHat2 software (Galaxy Tool Version 0.9) (mm9 - https://support.illumina.com/ sequencing / sequencing_software / igenome.htm /) aligned [Kim 2013]. The analysis of the differentially expressed genes was carried out with the help of Cufflinks2 (Galaxy Tool Version 2.2.1.0) and subsequent analysis with Cuffdiff2 (Galaxy Tool Version 2.2.1.0) [Trapnell 2013, Trapnell 2012]. The expression of the genes was normalized using the RPKM algorithm. In the gene expression comparison, genes with an absolute fold change of greater than two and a q value (false discovery rate) less than 0.05 were considered to be statistically significant. The level of significance α was also less than 0.05.

The murine programming factors determined by these next-generation sequencing analyzes and the corresponding human representatives are shown in Table 1. The additionally identified murine surface marker Lrpap1 is also described in detail above and named together with its human representative.

literature

• Bakker ML, Boink GJ, Boukens BJ, Verkerk AO, van den Boogaard M, den Haan AD, Hoogaars WM, Buermans HP, de Bakker JM, Seppen J, Tan HL, Moorman AF, t Hoen PA, Christoffels VM. T-box transcription factor tbx3 reprogrammes mature cardiac myocytes into pacemaker-like cells. Cardiovascular research. 2012; 94: 439-449
• Bondue A, Tannler S, Chiapparo G, Chabab S, Ramialison M, Paulissen C, Beck B, Harvey R, Blanpain C. Defining the earliest step of cardiovascular progenitor specification during embryonic stem cell differentiation. The Journal of Cell Biology. 2011; 192: 751-765
• Burridge PW, Matsa E, Shukla P, Lin ZC, Churko JM, Ebert AD, Lan F, Diecke S, Huber B, Mordwinkin NM, Plews JR, Abilez OJ, Cui B, Gold JD, Wu JC. Chemically defined generation of human cardiomyocytes. Nature methods. 2014; 11: 855-860
• Cho GS, Fernandez L, Kwon C. Regenerative medicine for the heart: Perspectives on stem-cell therapy. Antioxidants & redox signaling. 2014; 21: 2018-2031
• David R, Brenner C, Stieber J, Schwarz F, Brunner S, Vollmer M, Mentele E, Muller-Hocker J, Kitajima S, Lickert H, Rupp R, Franz WM. Mesp1 drives vertebrate cardiovascular differentiation through dkk-1-mediated blockade of wnt-signaling. Nature cell biology. 2008; 10: 338-345
• David R, Jarsch VB, Schwarz F, Nathan P, Gegg M, Lickert H, Franz WM. Induction of mesp1 by brachyury (t) generates the common multipotent cardiovascular stem cell. Cardiovascular research. 2011; 92: 115-122
• David, R., et al., Forward programming of pluripotent stem cells towards distinct cardiovascular cell types. Cardiovasc Res., 2009. 84 (2): pp. 263-72.
• David, R., et al., Selection of a common multipotent cardiovascular stem cell using the 3.4-kb MesP1 promoter fragment. Basic Res Cardiol, 2013. 108 (1): p. 312.
• DESTATIS - Database of the Federal Statistical Office (https://www.destatis.de/DE/Startseite.html)
• Den Hartogh SC, Schreurs C, Monshouwer-Kloots JJ, Davis RP, Elliott DA, Mummery C, Passier R. Dual reporter mesp1 -nkx2-5 hescs enable studying early human cardiac differentiation. Stem cells. 2014
• Grote, P., L. Wittler, D. Hendrix, F. Koch, S. Wahrisch, A. Beisaw, K. Macura, G. Blass, M. Kellis, M. Werber and B. G. Herrmann (2013). "The tissue-specific IncRNA Fendrr is an essential regulator of heart and body wall development in the mouse." Dev Cell 24 (2): 206-214.
• Halbach, M., et al., Ventricular slices of adult mouse hearts - a new multicellular in vitro model for electrophysiological studies. Cell Physiol Biochem, 2006. 18 (1-3): pp. 1-8 .
• Hardening S, Schwanke K, Haase A, David R, Franz WM, Martin U, Zweigerdt R. Directing cardiomyogenic differentiation of human pluripotent stem cells by plasmid-based transient overexpression of cardiac transcription factors. Stem cells and development. 2013; 22: 1112-1125 .
• Hausburg F, Naß S, Voronina N, Skorska A, Müller P, Steinhoff G, David R. Defining optimized properties of modified mRNA to enhance Virus. And DNA- independent protein expression in adult stem cells and fibroblasts. Cell Physiol Biochem. 2015; 35: 1360-1371 .
• Jung JJ, Husse B, Rimmbach C, Krebs S, Stieber J, Steinhoff G, Dendorfer A, Franz WM, David R. Programming and isolation of highly pure physiologically and pharmacologically functional sinus-nodal bodies from pluripotent stem cells. Stem cell reports. 2014; 2: 592-605
• Klattenhoff, CA, JC Scheuermann, LE Surface, RK Bradley, PA Fields, ML Steinhauser, H. Ding, VL Butty, L. Torrey, S. Haas, R. Abo, M. Tabebordbar, RT Lee, CB Burge and LA Boyer (2013). "Braveheart, a long noncoding RNA required for cardiovascular lineage commitment." Cell 152 (3): 570-583 .
• Kapoor N, Liang W, Marban E, Cho HC. Direct conversion of quiescent cardiomyocytes to pacemaker cells by expression of tbx18. Nature biotechnology. 2013; 31: 54-62 .
• Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL: TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biology 2013, 14 (4) .
• Lian X, Hsiao C, Wilson G, Zhu K, Hazeltine LB, Azarin SM, Raval KK, Zhang J, Kamp TJ, Palecek SP. Robust cardiomyocyte differentiation from human pluripotent stem cells via temporal modulation of canonical wnt signaling. Proceedings ofthe National Academy of Sciences of the United States ofAmerica. 2012; 109: E1848-1857
• Rimmbach C., Jung JJ., David R. Generation of murine cardiac pacemaker cell aggregates based on ES-cell-programming in combination with Myh6-promoter-selection. J Vis Exp. 2015 Feb 17; (96): e52465 .
• Schade A, Muller P, Delyagina E, Voronina N, Skorska A, Lux C, Steinhoff G, David R. Magnetic nanoparticle based nonviral microrna delivery into freshly isolated cd 105 (+) hmscs. Stem cells international. 2014; 2014: 197154
• Takahashi K, Yamanaka S. Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006; 126: 663-676
• Trapnell C, Hendrickson DG, Sauvageau M, Goff L, Rinn JL, Pachter L: Differential analysis of gene regulation at transcript resolution with RNA-seq. Nature Biotechnology 2013, 31 (1) .
• Trapnell C, Roberts A, Goff L, Pertea G, Kim D, Kelley DR, Pimentel H, Salzberg SL, Rinn JL, Pachter L: Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks. Nat Protoc 2012, 7 (3): 562-578 .
• Wiese C, Grieskamp T, Airik R, Mommersteeg MT, Gardiwal A, de Gier-de Vries C, Schuster-Gossler K, Moorman AF, Kispert A, Christoffels VM. Formation of the sinus node head and differentiation of sinus node myocardium are independently regulated by tbx18 and tbx3. Circulation research. 2009; 104: 388-397
• Wolfien M, Rimmbach C, Schmitz U, Jung JJ, Krebs S, Steinhoff G, David R, and Wolkenhauer O, TRAPLINE: A standardized and automated pipeline for RNA sequencing data analysis, evaluation and annotation, BMC Bioinformatics in press DE 10 2013 114 671 B4

Claims (14)

Process for the production of sinus node cells (“cardiac pacemaker cells”) from stem cells, with the exception of human embryonic stem cells, in which i. at least one polynucleotide generating sinus node cells or at least one protein encoded by this polynucleotide generating at least one sinus cell is introduced into stem cells; ii the resulting stem cells are differentiated into sinus node cells in the presence of the at least one sinus node cell-producing polynucleotide or the at least one protein, the at least one sinus node cell-producing polynucleotide comprising a nucleic acid sequence that is selected from the group consisting of a) nucleic acid sequence selected from the group Group consisting of Gm20685, Gm21989, 1700027A07Rik, 4930448N21 Rik, Acadvl, Actn2, Adm, Adprhl1, Adsl, Afap1l1, Ak1, Alpk2, Amfr, Angptl2, Ank, Ankrd1, Ap1m1, Art3, Atp2ab, Ch, Bp905a1, BC05271 C230088H06Rik, C630028M04Rik, Cap2, Casq1, Casq2, Cav3, Cdh13, Cfl2, Chsy1, Clu, Cnn1, Coq9, Coro6, Cs, Ctgf, D430001F17Rik, Def8, Dhrs13os, Dkk3jal, Dlp, Echp Eno3, Eral1, Etfdh, Fads3, Fam134b, Fam54b, Fhl1, Foxs1, Fuca2, Gal, Gbas, Gfpt2, Gja1, Gm12940, Gm13938, Gm14812, Gm15418, Gm15494, Gm2990, Got1, Gf2h3h3 Herpud1, Hoxa1, Hspala, Hspb7, Htra1, Idh3a, Immt, Kars, Kctd20, Lbh, Ldb3, Lmod2, Lpl, Lrrc10, Mb, Meg3, Mest, Mllt11, Mllt3, Mybpc3, Mybphl, Myh6, Myl3, Mylk3, Myom1, Myoz2, Ncsduf, Nufv1, Ndrg1, Nexn, Nppa, Nppb, Nrg1, Ogdh, Pam, Pcsk2os2, Pdlim5, Pet112l, Phyh, Pkp2, Pln, Pmpcb, Popdc2, Ppp1cb, Ppp1r14c, Ppp1r3c, Ppp2r1a, Pppagef4g3, Rp1p6gef3, Pr3 149A5.3, RP23-52N2.4, RP24-425N5.7 (AC109204.21), Ryr2, Scrn2, Sdc4, Sdha, Sdhd, Sh3kbp1, Slc16a1, Slc38a4, Slc8a1, Slco3a1, Snap47, Snrpn2, Snurfcsorb , Sprr1a, Srl, Supt6h, Synpo2l, Tbrg4, Tecrl, Tgfb2, Tgm2, Tmem109, Tmem38a, Tmod1, Tnnt3, Tom1l1, Trdn, Trim55, Ttn, Ugp2, Uqcrc1, Vdac1, Wwoxf, Xir171 and b) nucleic acid sequence which has at least 70% sequence identity to a nucleic acid sequence of the group mentioned under a), c) nucleic acid sequence which hybridizes under stringent conditions to a nucleic acid sequence according to a) or b). Process for the production of sinus node cells from stem cells Claim 1 , the method additionally comprising iii. Verify the sinus node cells obtained according to ii). Process for the production of sinus node cells from stem cells Claim 1 or 2nd , wherein the nucleic acid sequence according to a) is selected from the group consisting of Dkk3, Zfp174, Dhrs13os, Gm2990, Gm15494, 1700027A07Rik, Gm20685, Gm21989, RP23-52N2.4, 4930448N21Rik, Gm14812, RP23-2300G5.34, G18298M5.3 C630028M04Rik, D430001F17Rik, Gm12940, Gm13938, Pcsk2os2, Rapgef4os3 RP24-425N5.7, BC090627 and Meg3. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 3rd , in which i) additionally a construct for the expression of an antibiotic resistance gene, which is controlled by an alpha-MHC (MYH6) promoter, is introduced and the resulting stem cells in ii) are differentiated in the presence of the antibiotic. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 4th , wherein the sinus node cells obtained according to ii) are purified on the basis of Lrpap1 (protein) present on the sinus node cells obtained. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 5 , wherein at least one sinus node cell-producing polynucleotide is introduced into the stem cells as mRNA, which comprises a nucleic acid sequence which is selected from the group consisting of a) and b) according to Claim 3 . Process for the production of sinus node cells from stem cells Claim 6 , wherein the mRNA is introduced as a modified mRNA (mmRNA), in which at least one nucleic base naturally occurring in RNA is replaced by a corresponding modified nucleic base, the modified nucleic base preferably being selected from 5-methylcytosine, pseudouracil, pseudocytidine, pseudoisocytidine, more preferably from methylcytosine, pseudouracil. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 7 , where multipotent or pluripotent, preferably pluripotent, stem cells are used. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 8th , using non-human embryonic stem cells or non-human induced stem cells or human induced stem cells or parthenogenetic stem cells or spermatogonal stem cells, preferably non-human embryonic stem cells or non-human induced stem cells or human induced stem cells. Method for generating sinus node cells from stem cells according to one of the Claims 1 to 9 , wherein the at least one polynucleotide is introduced by means of a vector. Use of a method according to one of the Claims 1 to 10th Sinus node cells generated from stem cells for in vitro evaluation of medicinal products. Use of a method according to one of the Claims 1 to 10th Sinus node cells generated from stem cells for cardiac tissue construction and / or cardiac tissue cultivation. Use of a method according to one of the Claims 1 to 10th Sinus node cells generated from stem cells for the production of cell-based biological cardiac pacemakers. Process for the purification of stem cells by a process according to one of the Claims 1 to 10th generated sinus node cells, the sinus node cells obtained being purified on the basis of Lrpap1 (protein) present on them.