DE102014102695A1

DE102014102695A1 - Treatment of amyloidosis

Info

Publication number: DE102014102695A1
Application number: DE102014102695.0A
Authority: DE
Inventors: Zhiyuan Zhang; Hermann Schlüsener
Original assignee: Eberhard Karls Universitaet Tuebingen
Current assignee: Eberhard Karls Universitaet Tuebingen
Priority date: 2014-02-28
Filing date: 2014-02-28
Publication date: 2015-09-03

Abstract

Die vorliegende Erfindung betrifft ein Arzneimittel zur Prophylaxe und/oder Behandlung einer Amyloidose.The present invention relates to a medicament for the prophylaxis and / or treatment of amyloidosis.

Description

Eine Amyloidose bezeichnet einen Zustand, in dem normalerweise lösliche, funktionelle Proteine unlöslich und im Extrazellularraum verschiedener Organe oder Gewebe abgelagert werden. Die normale Funktion der Organe und Gewebe werden dadurch beeinträchtigt. Die unlöslichen fibrösen Proteinaggregate, die sich bei einer Amyloidose entwickeln, werden als Amyloide bezeichnet. Diese resultieren aus einer Veränderung in der Sekundärstruktur des jeweiligen Proteins, die dazu führt, dass das Protein eine spezielle aggregierte und unlösliche Form einnimmt, die ähnlich ist zu den β-Faltblättern. Amyloidosen können vererbt oder erworben sein.Amyloidosis refers to a condition in which normally soluble, functional proteins are insoluble and deposited in the extracellular space of various organs or tissues. The normal function of the organs and tissues are thereby impaired. The insoluble fibrous aggregates of proteins that develop in amyloidosis are called amyloids. These result from a change in the secondary structure of the particular protein, which causes the protein to take on a specific aggregated and insoluble form that is similar to the β-sheets. Amyloidoses can be inherited or acquired.

Amyloidosen sind mit einer Vielzahl von Symptomen assoziiert und variieren stark in Abhängigkeit davon, wo im Körper die amyloiden Ablagerungen akkumulieren. Die häufigsten Amyloidosen betreffen das Herz, wie beim Herzversagen und der Arhythmie. Ferner können die Atmungsorgane betroffen sein und eine Hemoptyse auslösen. Eine Amyloidose kann eine Vergrößerung der Milz bewirken. Auch kann es durch die Amyloidose zu Rissen in der Milz kommen. Außerdem ist beschrieben, dass der Gastrointestinaltrakt von Amyloidosen betroffen sein und es zum Erbrechen, Blutungen und Durchfall kommen kann. Amyloidosen können ferner die motorischen Funktionen des Körpers beeinträchtigen und Polyneuropathien verursachen.Amyloidoses are associated with a variety of symptoms and vary widely depending on where in the body the amyloid deposits accumulate. The most common amyloidosis affects the heart, as in heart failure and arrhythmia. In addition, the respiratory system may be affected and trigger hemoptysis. Amyloidosis can cause enlargement of the spleen. Amyloidosis can also lead to tears in the spleen. In addition, it is described that the gastrointestinal tract may be affected by amyloidosis and vomiting, bleeding and diarrhea may occur. Amyloidoses can also affect the motor functions of the body and cause polyneuropathy.

Amyloidosen können systemisch oder lokal auftreten. Sie können deshalb in systemische und lokale Amyloidosen klassifiziert werden. Systemische Amyloidosen betreffen mehr als ein Körperorgan oder -system. Beispiele hierfür sind Amyloid-Leichte-Ketten-Amyloidose (AL-Amyloidose), Serum-Amyloid-A-Protein-Amyloidose (SAA) und Hämodialyse-assoziierte Amyloidose (Aβ₂M). Bei 70% von über 100-Jährigen wurde in einer Studie als primäre Todesursache eine sog. senile systemische Amyloidose festgestellt. Lokale Amyloidosen betreffen lediglich ein Körperorgan oder Gewebetyp. Beispiele hierfür sind Amyloid-β-Amyloidose (Aβ), Amyloid-Polypeptid-Amyloidose (IAPP), isolierte atriale Amyloidose und Calcitonin-basierte Amyloidose.Amyloidoses can occur systemically or locally. They can therefore be classified into systemic and local amyloidoses. Systemic amyloidosis affects more than one body organ or system. Examples include amyloid light chain amyloidosis (AL amyloidosis), serum amyloid A protein amyloidosis (SAA), and hemodialysis-associated amyloidosis (Aβ ₂ M). In 70% of over 100 year olds, one study found a primary cause of death called senile systemic amyloidosis. Local amyloidosis affects only one body organ or tissue type. Examples include amyloid β-amyloidosis (Aβ), amyloid polypeptide amyloidosis (IAPP), isolated atrial amyloidosis and calcitonin-based amyloidosis.

Eine andere Klassifizierung betrifft primäre und sekundäre Amyloidosen. Primäre Amyloidosen entstehen aus einer Erkrankung mit ungeordneter Immunzellfunktion, wie bspw. dem multiplen Myelom. Sekundäre (reaktive) Amyloidosen bezeichnen solche, die als Komplikation anderer chronischer inflammatorischer oder gewebedestruktiver Erkrankungen auftreten. Beispiele hierfür sind die reaktive systemische Amyloidose und die sekundäre kutane Amyloidose.Another classification concerns primary and secondary amyloidoses. Primary amyloidosis arises from a disorder with disordered immune cell function, such as multiple myeloma. Secondary (reactive) amyloidoses are those that are a complication of other chronic inflammatory or tissue destructive diseases. Examples include reactive systemic amyloidosis and secondary cutaneous amyloidosis.

Amyloidosen werden derzeit regelmäßig chemotherapeutisch behandelt, bspw. mit Mephalan und/oder Dexamethason. Auch wird bei bestimmten Formen renaler Amyloidosen der Wirkstoff Eprodisat eingesetzt.Amyloidoses are currently treated chemotherapeutically on a regular basis, for example with mephalan and / or dexamethasone. Also, in certain forms of renal amyloidosis, the drug eprodisate is used.

Die derzeitigen therapeutischen Ansätze sind jedoch häufig unspezifisch und haben sich in der Praxis nicht als zufriedenstellend erwiesen.However, current therapeutic approaches are often nonspecific and have not proven to be satisfactory in practice.

Aufgabe der vorliegenden Erfindung ist es deshalb, eine neues Arzneimittel bzw. einen neuen Wirkstoff zur Prophylaxe und/oder Behandlung einer Amyloidose bereitzustellen, mit dem die klinischen bzw. verhaltensassoziierten Symptome zumindest vermindert, vorzugsweise gehemmt werden können.The object of the present invention is therefore to provide a new drug or a new active substance for the prophylaxis and / or treatment of amyloidosis, with which the clinical or behavior-associated symptoms can at least be reduced, preferably inhibited.

Diese Aufgabe wird durch die Verwendung von Hesperidin gelöst.This task is solved by the use of hesperidin.

Hesperidin, das auch als Cirantin, Hesperidosid oder (2S)-7-((6-O-(6-Desoxy-α-L-mannopyranosyl)-β-D-glucopyranosyl)oxy)-2,3-dihydro-5-hydroxy-2-(3-hydroxy-4-methoxyphenyl)-4H-1-benzopyran-4-on bezeichnet wird und die Summenformal C₂₈H₃₄O₁₅ und die CAS-Nr. 520-26-3 aufweist, gehört als Glykosid aus dem Flavanon Hesperetin und dem Disaccharid Rutinose zur Gruppe der Flavonoide, speziell zu den Bioflavonoiden. Hesperidin ist das Hauptflavonoid der Schalen von Orangen und Zitronen und kommt dort neben Hesperetin vor. Bei manchen Orangensorten macht es bis zu 4,1% der Trockenmasse der Schalen aus. Es ist auch in anderen Zitrusfrüchten verbreitet.Hesperidin, also known as cirantin, hesperidoside or (2S) -7 - ((6-O- (6-deoxy-α-L-mannopyranosyl) -β-D-glucopyranosyl) oxy) -2,3-dihydro-5- hydroxy-2- (3-hydroxy-4-methoxyphenyl) -4H-1-benzopyran-4-one and the summation formal C ₂₈ H ₃₄ O ₁₅ and CAS no. 520-26-3 belongs as glycoside from the flavanone hesperetin and the disaccharide rutinose to the group of flavonoids, especially to the bioflavonoids. Hesperidin is the main flavonoid of the peel of oranges and lemons and occurs there alongside hesperetin. For some orange varieties, it accounts for up to 4.1% of the dry matter of the skins. It is also common in other citrus fruits.

In der Pflanze schützt der Hesperidingehalt gegen bestimmte Pilzinfektionen. Hesperidin wird medizinisch in Form eines Kombinationspräparates mit Diosmin gegen venöse Beinbeschwerden wie Krampfadern eingesetzt und zeigt neben seiner Wirkung als Antioxidans auch eine Erhöhung des Venentonus und der Lymphdränage. Auch bei Hämorrhoiden haben klinische Studien die gute Wirkung eines Kombinationspräparates mit Diosmin gezeigt. Nach Ergebnissen aus Tierversuchen verfügt Hesperidin auch über entzündungshemmende und schmerzstillende Wirkung und senkte den Cholesterinspiegel und den Triglyceridspiegel im Blut.In the plant the Hesperidinehalt protects against certain fungal infections. Hesperidin is used medically in the form of a combination preparation with Diosmin for venous leg complaints such as varicose veins and shows in addition to its effect as an antioxidant also an increase in venous tone and lymphatic drainage. Also in hemorrhoids clinical studies have shown the good effect of a combination preparation with Diosmin. According to results from animal experiments, hesperidin also has anti-inflammatory and analgesic effects and lowered cholesterol levels and blood triglyceride levels.

In einer Vielzahl von Publikationen werden ferner die positiven Eigenschaften von Hesperidin gegen neurotoxische und neuroinflammatorische Faktoren beschrieben, bspw. in Menze et al. (2012), Potential neuroprotective effects of hesperidin on 3-nitropropionic acid-induced neurotoxicity in rats, Neurotoxicology 33(5), S. 1265–1275 , und Raza et al. (2011), Hesperidin ameliorates functional and histological outcome and reduces neuroinflammation in experimental stroke, Brain Res. 1420, S. 93–105 .In a variety of publications, the positive properties of hesperidin against neurotoxic and neuroinflammatory factors are further described, for example in Menze et al. (2012), Potential neuroprotective effects of hesperidin on 3-nitropropionic acid-induced neurotoxicity in rats, Neurotoxicology 33 (5), pp. 1265-1275 , and Raza et al. (2011), Hesperidin ameliorates functional and histological outcome and reduced neuroinflammation in experimental stroke, Brain Res. 1420, pp. 93-105 ,

Huang et al. (2012), Cytoprotective effect of hesperetin and hesperidin against amyloid β-induced impairment of glucose transport through downregulation of neuronal autophagy, Mol. Nutr. Food Res. 56, S. 601–609 , beschreiben Experimente in vitro an der Neuroblastomzelllinie Neuro-2A. Die Zelllinie wurde mit dem löslichen Amyloid-β-Peptidfragment (Aβ1-42) stimuliert. Dabei wurde festgestellt, dass die Glucoseaufnahme der so behandelten Zellen reduziert ist. Eine Behandlung von derart stimulierten Neuro-2A-Zellen mit Hesperidin zeigte eine Verbesserung der Glucoseaufnahme der Zellen. Die Autoren beschreiben, dass Hesperidin die Expression des Insulinrezeptors und der Glucosetransporter GLUT3 und GLUT4 stimuliert und die Autophagocytose inhibiert. Die Autoren schlussfolgern, dass Hesperidin die durch lösliches Amyloid-β-Peptid induzierten neurotoxischen Effekte aufgrund des beeinträchtigen Glucosetransportes, die bspw. in der Alzheimererkrankung zu beobachten sind, teilweise inhibieren kann. Huang et al. (2012), Cytoprotective effect of hesperetin and hesperidin against amyloid β-induced impairment of glucose transport through downregulation of neuronal autophagy, Mol. Nutr. Food Res. 56, pp. 601-609 , describe in vitro experiments on the neuroblastoma cell line Neuro-2A. The cell line was stimulated with the soluble amyloid β-peptide fragment (Aβ1-42). It was found that the glucose uptake of the cells treated in this way is reduced. Treatment of such stimulated neuro-2A cells with hesperidin showed an improvement in the glucose uptake of the cells. The authors describe that hesperidin stimulates the expression of the insulin receptor and the glucose transporters GLUT3 and GLUT4 and inhibits autophagocytosis. The authors conclude that hesperidin may partially inhibit the soluble amyloid β-peptide induced neurotoxic effects due to impaired glucose transport, which, for example, is seen in Alzheimer's disease.

Wang et al. (2013), Protective effects of hesperidin against amyloid-β (Aβ) induced neurotoxicity through the voltage dependent anion channel 1 (VDAC1-)mediated mitochondrial apoptotic pathway in PC12 cells, Neurochem. Res. 38, S. 1034–1044 , beschreiben Experimente in vitro an der Pheochromocytom-Zelllinie PC12 der Ratte. Dabei wurden PC12-Zellen mit dem löslichen Amyloid-β-Peptidfragment Aβ_25-35 stimuliert und wurden dabei apoptotisch. Eine Vorbehandlung derart stimulierter Zellen mit Hesperidin reduzierte die Apoptoserate. Die Autoren beschreiben, dass Hesperidin die durch Aβ induzierte mitochondriale Fehlfunktion in den stimulierten PC12-Zellen abmildert und die Aktivität der apoptotischen Proteine Caspase3 und 9 inhibiert. Die Autoren schlagen deshalb die Verwendung von Hesperidin zur Behandlung von neurodegenerativen Krankheiten, die mit einer mitochondrialen Fehlfunktion assoziiert sind, wie bspw. die Alzheimererkrankung, durch Hesperidin vor. Wang et al. (2013), Protective effects of hesperidin against amyloid-β (Aβ) -induced neurotoxicity by the voltage dependent anion channel 1 (VDAC1) mediated mitochondrial apoptotic pathway in PC12 cells, Neurochem. Res. 38, pp. 1034-1044 , describe experiments in vitro on rat pheochromocytoma cell line PC12. PC12 cells were stimulated with the soluble amyloid β-peptide fragment Aβ _25-35 and became apoptotic. Pretreatment of such stimulated cells with hesperidin reduced the rate of apoptosis. The authors describe that hesperidin mitigates Aβ-induced mitochondrial dysfunction in the stimulated PC12 cells and inhibits the activity of the apoptotic proteins caspase3 and 9. The authors therefore suggest the use of hesperidin for the treatment of neurodegenerative diseases associated with mitochondrial dysfunction, such as Alzheimer's disease, by hesperidin.

Die Verwendung von Hesperidin zur Behandlung von durch Ablagerungen unlöslicher Proteine verursachten Amyloidosen wird im Stand der Technik weder beschrieben noch nahegelegt.The use of hesperidin to treat amyloidoses caused by deposits of insoluble proteins has neither been described nor suggested in the prior art.

Im Rahmen der erfindungsgemäßen Verwendung wird Hesperidin zielgerichtet als entweder alleiniger Wirkstoff des Arzneimittels oder in Kombination mit anderen Wirkstoffen eingesetzt.In the context of the use according to the invention, hesperidin is used purposefully as either the sole active ingredient of the drug or in combination with other active ingredients.

Die der Erfindung zugrunde liegende Aufgabe wird hiermit vollkommen gelöst.The object underlying the invention is hereby completely solved.

Die Erfinder konnten an einem etablierten Tiermodell feststellen, dass Hesperidin die Ablagerung von unlöslichem Amyloid-β im Zwischenzellraum vermindert. Hesperidin eignet sich dadurch zur Behandlung von Amyloidosen, die vollkommen unabhängig von etwaigen toxischen Effekten von β-Amyloid auftreten, wie bspw. für die Alzheimererkrankung beschrieben. Die erfindungsgemäße Verwendung zielt deshalb insbesondere auf Amyloidosen ab, die in keinem Zusammenhang mit der Alzheimererkrankung stehen.The inventors were able to establish in an established animal model that hesperidin reduces the deposition of insoluble amyloid β in the intercellular space. Hesperidin is thereby suitable for the treatment of amyloidoses which occur completely independently of any toxic effects of β-amyloid, as described, for example, for Alzheimer's disease. The use according to the invention is therefore aimed in particular at amyloidoses which are unrelated to Alzheimer's disease.

Nach einer bevorzugten Weiterbildung der Erfindung handelt es sich bei der Amyloidose um eine zerebrale Amyloidose.According to a preferred development of the invention, the amyloidosis is a cerebral amyloidosis.

Die Erfinder haben ein Tiermodell zur zerebralen Amyloidose eingesetzt und konnten dabei nachweisen, dass mittels Hesperidins dieses Krankheitsbild behandelt bzw. einer Entstehung vorgebeugt werden kann.The inventors have used an animal model for cerebral amyloidosis and were able to demonstrate that it is possible to treat or prevent the development of this disease by means of hesperidin.

Nach einer bevorzugten Weiterbildung der Erfindung wird das Hesperidin zur gezielten Reduktion der β-Amyloid-Ablagerung im Gehirn verwendet.According to a preferred development of the invention, hesperidin is used for the targeted reduction of β-amyloid deposition in the brain.

Wie die Erfinder überraschenderweise zeigen konnten, vermindert Hesperidin signifikant die β-Amyloid-Ablagerung im Gehirn der untersuchten Tiere. Dadurch erfolgt erstmals eine gezielte pharmakologische Intervention an einer krankheitsverursachenden Schlüsselstelle. As the inventors have surprisingly demonstrated, hesperidin significantly reduces β-amyloid deposition in the brain of the animals studied. As a result, for the first time, a targeted pharmacological intervention takes place at a disease-causing key site.

Nach einer bevorzugten erfindungsgemäßen Ausgestaltung wird Hesperidin zur gezielten Verbesserung der durch die Amyloidose verursachten Verhaltensstörungen eingesetzt. According to a preferred embodiment of the invention hesperidin is used for the targeted improvement of the behavioral disorders caused by amyloidosis.

Diese Maßnahme hat den Vorteil, dass Hesperidin Abhilfe schafft gegen die bei Amyloidosen häufig auftretenden Verhaltensstörungen, wie bspw. gestörtes Sozialverhalten, Apathie, Antriebslosigkeit, Agitiertheit, Verwirrtheit, Aggression, motorische Störungen, etc.This measure has the advantage that hesperidin remedies the often occurring in amyloidosis behavioral disorders, such as disturbed social behavior, apathy, listlessness, agitation, confusion, aggression, motor disorders, etc.

Wie die Erfinder feststellen konnten, eignet sich isoliertes bzw. gereinigtes Hesperidin, um als alleiniger Wirkstoff zur Behandlung und/oder Prophylaxe einer Amyloidose, bspw. einer zerebralen Amyloidose, verwendet zu werden. Nach einer bevorzugten Weiterbildung der Erfindung wird jedoch das Hesperidin mit einem weiteren Wirkstoff zur Prophylaxe und/oder Behandlung einer Amyloidose verwendet.As the inventors have found, isolated or purified hesperidin is suitable for use as the sole active ingredient for the treatment and / or prophylaxis of amyloidosis, for example cerebral amyloidosis. According to a preferred embodiment of the invention, however, the hesperidin is used with another active ingredient for the prophylaxis and / or treatment of amyloidosis.

Durch diese Kombination können sich synergistische Effekte durch Interaktion der beiden Wirkstoffe ergeben. Als weiterer Wirkstoff kommen bspw. Chemotherapeutika in Frage, wie Mephalan, Dexamethason, aber auch Substanzen wie Colchicin, Etanercept, Eprodisat, oder weitere gegen Amyloidosen wirksame Wirkstoffe.This combination can result in synergistic effects through interaction of the two drugs. Chemotherapeutics, such as mephalan, dexamethasone, but also substances such as colchicine, Etanercept, Eprodisat, or other active against amyloidoses active ingredients.

Die genaue Dosis bzw. Konzentration des eingesetzten Hesperidins kann vom behandelnden Arzt individuell bestimmt werden und richtet sich nach verschiedenen Faktoren. Dazu zählen u. a. die Schwere der Erkrankung des Patienten, die Form der Amyloidose, das Alter, Geschlecht, Vorerkrankung, etc.The exact dose or concentration of the hesperidin used can be determined individually by the attending physician and depends on various factors. These include u. a. the severity of the patient's disease, the form of amyloidosis, age, gender, previous illness, etc.

Nach einer bevorzugten Weiterbildung wird das Hesperidin in einer Konzentration von ca. 1 µg, weiter bevorzugt von ca. 10 µg, weiter bevorzugt von ca. 100 µg, weiter bevorzugt von ca. 1 mg, weiter bevorzugt von ca. 10 mg, und höchst bevorzugt von ca. 24 mg pro kg Körpergewicht und pro Tag eingesetzt.According to a preferred embodiment, the hesperidin is in a concentration of about 1 micrograms, more preferably about 10 micrograms, more preferably about 100 micrograms, more preferably about 1 mg, more preferably about 10 mg, and most preferably used by about 24 mg per kg of body weight and per day.

Diese Maßnahme hat den Vorteil, dass bei der angegebenen Konzentration eine optimale Wirkung bei gleichzeitig minimierten Nebenwirkungen erreicht wird. Dies konnten die Erfinder in dem Tiermodell demonstrieren.This measure has the advantage that at the specified concentration, an optimal effect is achieved with minimized side effects. This could be demonstrated by the inventors in the animal model.

Es versteht sich, dass die vorstehend genannten und die nachstehend noch zu erläuternden Merkmale nicht nur in der jeweils angegebenen Kombination, sondern in auch in anderen Kombinationen oder in Alleinstellung verwendbar sind, ohne den Rahmen der vorliegenden Erfindung zu verlassen.It is understood that the features mentioned above and those yet to be explained below can be used not only in the particular combination indicated, but also in other combinations or in isolation, without departing from the scope of the present invention.

Die Erfindung wird nun anhand von Ausführungsbeispielen näher erläutert, aus denen sich weitere Merkmale und Vorteile ergeben. Die Ausführungsbeispiele sind rein illustrativ und schränken die Reichweite der Erfindung nicht ein. Dabei wird Bezug genommen auf die beigefügten Figuren in denen Folgendes dargestellt ist:The invention will now be explained in more detail with reference to embodiments, from which further features and advantages. The embodiments are purely illustrative and do not limit the scope of the invention. Reference is made to the accompanying figures in which:

1 zeigt die molekulare Struktur von Hesperidin; 1 shows the molecular structure of hesperidin;

2 zeigt den "Nestbauwert" von Kontrollmäusen und mit Hesperidin behandelten Mäusen in sozialer Isolation. (A) Die Balkengraphik zeigt die Ergebnisse aus den Nestbauexperimenten mit Papiertüchern an Kontrollmäusen und an mit Hesperidin behandelten Mäusen am Tag 1. Die Nestbauwerte wurden zwischen den beiden Gruppen abgeglichen. (B) Ergebnisse aus den Nestbauexperimenten mit Papiertüchern an Kontrollmäusen und an mit Hesperidin behandelten Mäusen am Tag 11. Die Unterschiede der Nestbauwerte waren statistisch signifikant. Mäuse, die mit Hesperidin behandelt wurden, bauten Nester von besserer Qualität. *P < 0,05; 2 shows the "nesting value" of control mice and hesperidin-treated mice in social isolation. (A) The bar graph shows results from nesting experiments on paper towels on control mice and on hesperidin-treated mice on day 1. Nest values were compared between the two groups. (B) Results from nesting experiments with paper towels on control mice and on hesperidin-treated mice on day 11. The differences in nest building values were statistically significant. Mice treated with hesperidin made nests of better quality. * P <0.05;

3 zeigt die zurückgelegten Entfernungen und Anzahl von unabhängigen und interaktiven Ereignissen für die Resident-Maus in dem Resident-Intruder-Assay. (A) Zurückgelegte Entfernungen in beiden 15-minütigen Zeiträumen am Tag 1 und Tag 11. Sämtliche zurückgelegten Entfernungen wurden zwischen den Kontrollmäusen und den mit Hesperidin behandeten Mäusen für jeden Zeitpunkt abgeglichen. (B) Anzahl von unabhängigen Ereignissen in den beiden 15-minütigen Zeiträumen am Tag 1 und Tag 11. Die Häufigkeiten von unabhängigen Verhaltensereignissen zwischen den Kontrollmäusen und den mit Hesperidin behandelten Mäusen wurden zu sämtlichen Zeitpunkten abgeglichen. (C) Die Anzahl von interaktiven Ereignissen im zweiten 15-minütigen Zeitraum am Tag 1 zwischen den Kontrollmäusen und den mit Hesperidin behandelten Mäusen wurden abgeglichen. (D) Anzahl von interaktiven Ereignissen im zweiten 15-minütigen Zeitraum am Tag 11. Die mit Hesperidin behandelten Mäuse zeigten eine signifikant höhere Frequenz von interaktiven Verhaltensereignissen. *P < 0,05. F15: erster 15-minütiger Zeitraum; S15: zweiter 15-minütiger Zeitraum; 3 Figure 12 shows the distances traveled and number of independent and interactive events for the resident mouse in the resident intruder assay. (A) Distance traveled in both 15-minute periods on Day 1 and Day 11. All distances traveled were matched between the control mice and the hesperidin-treated mice at each time point. (B) Number of independent events in the two 15-minute periods on day 1 and day 11. The frequencies of independent behavioral events between the control mice and the hesperidin-treated mice were compared at all times. (C) The number of interactive events in the second 15-minute period on day 1 between the control mice and the hesperidin-treated mice were adjusted. (D) Number of interactive events in the second 15-minute period on day 11. The mice treated with hesperidin showed a significantly higher frequency of interactive behavioral events. * P <0.05. F15: first 15-minute period; S15: second 15-minute period;

4 Anzahl der amyloiden Plaques und Bereich im Cortex und Hippocampus bei den transgenen Mäusen. (A, B) Immunhistochemie. Gezeigt sind repräsentative koronale Schnitte durch den Cortex (A) und Hippocampus (B) von Kontrollmäusen und mit Hesperidin behandelten Mäusen. (C, D) Die Anzahl der amyloiden Plaques (C) und der prozentuale Anteil des mit Plaques (D) besetzten Cortex war bei den mit Hesperidin behandelten Mäusen im Vergleich zu den Kontrollmäusen signifikant reduziert. (E) Obwohl der Unterschied in der Anzahl der amyloiden Plaques im Hippocampus zwischen den mit Hesperidin behandelten Mäusen und den Kontrollmäusen nicht signifikant war, war ein Abwärtstrend klar ersichtlich. (F) Der prozentuale Anteil im Hippocampus, der durch Plaques besetzt war, war in den mit Hesperidin behandelten Mäusen im Vergleich zu den Kontrollmäusen signifikant reduziert. *P < 0,05; 4 Number of amyloid plaques and area in the cortex and hippocampus in the transgenic mice. (A, B) Immunohistochemistry. Shown are representative coronal sections through the cortex (A) and hippocampus (B) of control mice and hesperidin-treated mice. (C, D) The number of amyloid plaques (C) and the percentage of plaque (D) occupied cortex was significantly reduced in the hesperidin-treated mice compared to the control mice. (E) Although the difference in the number of amyloid plaques in the hippocampus between the hesperidin-treated mice and the control mice was not significant, a downward trend was evident. (F) The percent hippocampal occupied by plaques was significantly reduced in the hesperidin-treated mice compared to the control mice. * P <0.05;

5 Iba1-positive Mikroglia im Cortex und Hippocampus der transgenen Mäuse. (A, B) Immunhistochemie. Gezeigt sind repräsentative koronale Schnitte durch den Cortex (A) und den Hippocampus (B) von Kontrollmäusen und mit Hesperidin behandelten Mäusen. (C, D) Die Anzahl von Iba1-positiven Mikroglia (C) und der prozentuale Anteil der durch Iba1-positive Mikroglia im Cortex (D) besetzt ist, waren in den mit Hesperidin behandelten Mäusen im Vergleich zu den Kontrollmäusen signifikant reduziert. *P < 0,05; 5 Iba1-positive microglia in the cortex and hippocampus of the transgenic mice. (A, B) Immunohistochemistry. Shown are representative coronal sections through the cortex (A) and hippocampus (B) of control mice and hesperidin-treated mice. (C, D) The number of Iba1-positive microglia (C) and the percentage occupied by Iba1-positive microglia in the cortex (D) were significantly reduced in the hesperidin-treated mice compared to the control mice. * P <0.05;

6 Doppelfärbung von Plaques mit Mikroglia und Astrocyten im Cortex der transgenen Mäuse. (A) Das Verhältnis von Plaque-assoziierten Mikroglia zu dem Plaque-IR-Bereich war im Cortex von APP/PS1-Mäusen signifikant niedriger. (B) Obwohl der Unterschied der Verhältnisse von Plaque-assoziierten GFAP⁺-Astrocyten zum Plaque-IR-Bereich nicht signifikant zwischen den mit Hesperidin behandelten Mäusen und Kontrollmäusen war, war ein Abwärtstrend klar ersichtlich. *P < 0,05; 6 Double staining of plaques with microglia and astrocytes in the cortex of the transgenic mice. (A) The ratio of plaque-associated microglia to plaque IR region was significantly lower in the cortex of APP / PS1 mice. (B) Although the difference in ratios of plaque-associated GFAP ⁺ astrocytes to plaque IR range was not significantly different between those treated with hesperidin Mice and control mice, a downtrend was clearly evident. * P <0.05;

7 Anti-inflammatorischer Effekt von Hesperidin auf RAW-Zellen in vitro. Die antiinflammatorischen Effekte von Hesperidin auf die inflammatorische Makrophagenaktivierung wurden in vitro unter Verwendung der murinen Makrophagenzelllinie RAW analysiert. RAW-Zellen wurden mit Lipopolysaccharid mit und ohne Hesperidin (LPS; Konzentration 1, 3 und 9 µM) für 24 Stunden inkubiert. (A): Die Überstände wurden für die Analyse der NO-Konzentrationen mittels eines Standard-Griess-Assays (die Daten als Balkengraphiken zeigen Mittelwerte aus 9 Proben). (B): Die Balkengraphen zeigen semi-quantifizierte Ergebnisse der Bildintensität relativ zu dem Haushaltsgen β-Actin. Gesamt-RNA aus kultivieretn Zellen wurde präpariert und mRNA-Spiegel von iNOS, TNF-α und IL-1β wurden mittels PCR gemessen. Die Ergenisse wurden berechnet als Spiegel von Ziel-mRNAs relativ zu jenen von β-Actin (drei Proben von jeder Gruppe). Ein ungepaarter T-Test wurde durchgeführt, um Unterschiede zwischen der Kontrolle und der Hesperidin-Behandlung zu vergleichen (Graph Pad Prism 5.0 für Windows). *: p < 0,05 im Vergleich zu der jeweiligen LPS-Allein-Gruppe. Hes1, Hes3 und Hes9: Hesperidinkonzentrationen 1, 3 und 9μM. 7 Anti-inflammatory effect of hesperidin on RAW cells in vitro. The anti-inflammatory effects of hesperidin on inflammatory macrophage activation were analyzed in vitro using the murine macrophage cell line RAW. RAW cells were incubated with lipopolysaccharide with and without hesperidin (LPS, concentration 1, 3 and 9 μM) for 24 hours. (A): The supernatants were used for the analysis of NO concentrations by a standard Griess assay (the data as bar graphs show averages of 9 samples). (B): The bar graphs show semi-quantified image intensity results relative to the household gene β-actin. Total RNA from cultured cells was prepared and mRNA levels of iNOS, TNF-α and IL-1β were measured by PCR. The results were calculated as levels of target mRNAs relative to those of β-actin (three samples from each group). An unpaired T-test was performed to compare differences between control and hesperidin treatment (Graph Pad Prism 5.0 for Windows). *: p <0.05 compared to the respective LPS alone group. Hes1, Hes3 and Hes9: Hesperidin concentrations 1, 3 and 9μM.

1. Material und Methoden1. Material and methods

1.1 Tiere1.1 animals

Männliche APP/PS1-21-Mäuse mit einem C57BL/69-Hintergrund wurden von Prof. M. Jucker erhalten. Heterozygote männliche APP/PS1-21-Mäuse wurden mit weiblichen C57BL/6J-Wildtyp-Mäusen (Charles River Deutschland, Sulzfeld, Deutschland) gepaart. Den Nachkommen wurde aus dem Schwanz biologisches Material entnommen. Eine Genotypisierung erfolgte unter Verwendung einer PCR mit Primern, die spezifisch sind für die APP-Sequenz (vorwärts: GAATTCCGACATGACTCAGG [SEQ ID Nr. 1], rückwärts: GTTCTGCTGCATCTTGGACA [SEQ ID Nr. 2]). Die Tiere wurden in einem Zyklus mit 12 Stunden Helligkeit und 12 Stunden Dunkelheit und bei freiem Zugang zu Futter und Wasser gehalten. Die Nahrung der Mäuse stammte von SSNIFF Spezialdiäten GmbH (Soest, Deutschland), Diätnummer V1124-703 für die gepaarten Mäuse, und Diätnummer V2534-703 für alle anderen Mäuse. Sämtliche Experimente und Protokolle wurden lizensiert und von den lokalen Behörden als im Einklang stehend mit dem deutschen Tierschutzgesetz aus dem Jahre 2006 bestätigt.Male APP / PS1-21 mice with a C57BL / 69 background were obtained from Prof. M. Jucker. Heterozygous male APP / PS1-21 mice were mated with female C57BL / 6J wild-type mice (Charles River Germany, Sulzfeld, Germany). The offspring were taken from the tail biological material. Genotyping was performed using PCR with primers specific for the APP sequence (forward: GAATTCCGACATGACTCAGG [SEQ ID NO: 1], reverse: GTTCTGCTGCATCTTGGACA [SEQ ID NO: 2]). The animals were kept in a cycle with 12 hours brightness and 12 hours darkness and with free access to food and water. The diet of the mice was from SSNIFF Spezialdiäten GmbH (Soest, Germany), diet number V1124-703 for the paired mice, and diet number V2534-703 for all other mice. All experiments and protocols were licensed and confirmed by the local authorities as being in line with the 2006 German Animal Welfare Act.

Die transgene APP/PS1-21-Maus exprimiert sowohl humanes mutiertes Amyloid-Vorläuferprotein APP (K670N/M671L) als auch mutiertes Presenilin 1 PS1 (L166P). Die Mäuse entwickeln zu einem sehr frühen Zeitpunkt eine zerebrale Amyloidose, nach ca. zwei Monaten im Neocortex und 4 Monaten im Hippocampus. Die Mäuse zeigen mit zunehmendem Alter erhöhte Aβ-Spiegel in bestimmten Gehirnbereichen und entwickeln Verhaltens- und Gedächtnisstörungen.The transgenic APP / PS1-21 mouse expresses both human mutated amyloid precursor protein APP (K670N / M671L) and mutant presenilin 1 PS1 (L166P). The mice develop cerebral amyloidosis at a very early stage, after about two months in the neocortex and four months in the hippocampus. The mice show increased Aβ levels in certain areas of the brain as they age and develop behavioral and memory disorders.

1.2 Materialien1.2 Materials

Hesperidin (> 98%) wurde von Huike Botanical Development Co., Ltd (Shaanxi, Volksrepublik China) bezogen. Es wurde in 1% Carboxymethylcellulose (CMC, Blanose^®, Herkules-Aquanon, Düsseldorf, Deutschland) suspendiert und oral mit einer Dosis von 100 mg/kg (12,5 mg pro ml) verabreicht. Die Kontrolltiere erhielten das gleiche Volumen an Lösungsmittel und wurden ansonsten behandelt wie die mit Hesperidin behandelte Gruppe.Hesperidin (> 98%) was purchased from Huike Botanical Development Co., Ltd. (Shaanxi, People's Republic of China). It was dissolved in 1% carboxymethylcellulose (CMC, Blanose ^®, Hercules Aquanon, Dusseldorf, Germany) was suspended and administered orally at a dose of 100 mg / kg (12.5 mg per ml). The control animals received the same volume of solvent and were otherwise treated as the hesperidin-treated group.

Die molekulare Struktur von Hesperidin ist in der 1 dargestellt.The molecular structure of hesperidin is in the 1 shown.

1.3 Behandlung mit Hesperidin1.3 Treatment with hesperidin

Sämtliche Mäuse waren 5 Monate alt und wurden in zwei Gruppen unterteilt. Gruppe 1: sechs APP-PS1-21-Mäuse, fünf männliche und drei weibliche, erhielten für zehn Tage eine Behandlung mit Hesperidin. Das Hesperidin (100 mg/kg Körpergewicht, suspendiert in 1% CMC) wurde täglich mittels einer Sonde verabreicht. Gruppe 2: sechs bezüglich des Geschlechts abgestimmte APP-PS1-21-Mäuse, als Kontrolle, erhielten das gleiche Volumen einer 1% CMC wässrigen Lösung für zehn Tage.All mice were 5 months old and divided into two groups. Group 1: six APP PS1-21 mice, five male and three female, received hesperidin for ten days. The hesperidin (100 mg / kg body weight suspended in 1% CMC) was administered daily by gavage. Group 2: six sex matched APP PS1-21 mice, as controls, received the same volume of 1% CMC aqueous solution for ten days.

1.4 Design und Evaluierung des Nestbau-Assays1.4 Design and Evaluation of the Nest Assay

Ein Nestbau-Assay ( Wesson und Wilson 2011 ) wurde modifiziert, um die Defizite der APP/PS1-Mäuse im Anschluss-orientierten Sozialverhalten und um die potentiellen Veränderungen nach der Behandlung zu bestimmen. Die Mäuse wurden individuell für zumindest 24 Stunden in transparenten Kunststoffkäfigen mit ungefähr 1 cm Einstreu aus Holzschnitzeln und codierten Identifizierungskarten gehalten, so dass der Experimentator keine Kenntnisse über Geschlecht, Alter und Genotyp der Mäuse hatte. 2 Stunden vor dem Beginn der Dunkelphase des Lichtzyklus wurden zu den Käfigen ein 20 × 20 cm großes Papiertuchstück gegeben, das in ungefähr 5 × 5 cm große Stücke zerkleinert wurde. Die Mäuse wurden in ausgeglichenen Gruppen von gemischten Genotypen getestet, um die Variabilität in den Unterbringungsbedingungen zu vermindern.A nest-building assay ( Wesson and Wilson 2011 ) was modified to determine the deficits of APP / PS1 mice in follow-up social behavior and potential changes after treatment. The mice were kept individually for at least 24 hours in transparent plastic cages with about 1 cm of litter of wood chips and coded identification cards so that the experimenter had no knowledge of the sex, age and genotype of the mice. Two hours before the beginning of the dark phase of the light cycle, the cages were given a 20 x 20 cm paper towel which was chopped into approximately 5 x 5 cm pieces. The mice were tested in balanced groups of mixed genotypes to reduce variability in the housing conditions.

Am nächsten Morgen (ungefähr 16 Stunden später) wurden die Käfige bezüglich des Nestbaus inspiziert. Vor der Evaluierung wurden zur Dokumentation Fotos aufgenommen. Die Nestkonstruktion aus dem Papiertuch wurde über ein 3-Punkte-System bewertet: 1 = keine Beißspuren oder Risse auf dem Papier, 2 = moderate Beißspuren und/oder Risse auf dem Papier, aber kein stimmiges Nest (nicht in einer Ecke des Käfigs gruppiert), und 3 = der größte Teil des Papiers wurde in Stücke gerissen und in einer Ecke des Käfigs gruppiert.The next morning (about 16 hours later), the cages were inspected for nest building. Before the evaluation, photos were taken for documentation. The nest construction from the paper towel was over a 3-point system rated: 1 = no biting marks or cracks on the paper, 2 = moderate biting marks and / or cracks on the paper, but no consistent nest (not grouped in one corner of the cage), and 3 = most of the paper was torn to pieces and grouped in a corner of the cage.

1.5 Soziale Interaktion Resident-Intruder-Test1.5 Social Interaction Resident Intruder Test

Der Sozialinteraktionstest wurde gemäß früheren Studien ( Bolivar et al. 2007 ; Hibbits et al. 2009 ) mit geringen Veränderungen durchgeführt. Um eine Vielzahl von Aktivitäten zu erfassen, wurde der Resident-Intruder-Test auf Video aufgenommen, um alle unterschiedlichen Verhaltensweisen von Kontroll- und mit Zerumbone behandelten Mäusen als "Resident"- in Gegenwart oder Abwesenheit einer "Intruder"-Maus in Kombination mit der Analyse von Bewegungen zu quantifizieren, um einen Gesamtaktivitätsspiegel zu erfassen und neurobiologische Unterschiede offenzulegen. Individuelle Mäuse (ohne dass der Beobachter Kenntnis über die Behandlungskategorie hatte) wurden für 15 min in einen transparenten Beherbergungskäfig platziert, der identisch war mit dem Käfig, in dem die Tiere gehalten wurden (325 mm × 210 mm × 185 mm), um jede als "Resident"-Maus zu etablieren. Eine alters-, gewichts- und geschlechtsabgestimmte nicht-behandelte natürliche Maus wurde als "Intruder" für weitere 15 min eingesetzt. Die Anzahl von unabhängigen (die ersten 15 min ohne "Intruder" und die zweiten 15 min mit "Intruder") und interaktiven Verhaltensereignissen (15 min mit "Intruder") wurde für die "Resident"-Maus bewertet. Die unterschiedlichen Verhaltensereignisse umfassten das Beschnüffeln der Umgebung, Aufbäumen längsseits des Käfigs, unabhängiges Aufbäumen, Graben, Kreisen im Uhrzeigersinn, Kreisen entgegen des Uhrzeigersinns, gegenseitige Fellpflege, Verharren und Kratzen. Diese interaktiven Verhaltensereignisse umfassten das Beschnüffeln der anderen Maus, das Folgen, Fellpflegen und Aufbäumen gegenüber der anderen Maus, Sitzen bei und Lehnen gegen die andere Maus, das Folgen und Wegrennen der bzw. von der anderen Maus, Beißen, Boxen oder Kämpfen, Besteigen, Festhalten und Schwanzschlagen. Die Videoaufnahmen wurden analysiert und die Ereignisse wurden von drei unabhängigen Beobachtern gezählt, denen die Behandlungsbedingungen unbekannt waren.The social interaction test was conducted according to previous studies ( Bolivar et al. 2007 ; Hibbits et al. 2009 ) with minor changes. To capture a variety of activities, the Resident Intruder test was videotaped to record all the different behaviors of control and Zerumbone treated mice as "resident" in the presence or absence of an "intruder" mouse in combination with the mouse To quantify motion analysis to capture a total activity level and reveal neurobiological differences. Individual mice (without the observer being aware of the treatment category) were placed for 15 minutes in a transparent accommodation cage identical to the cage in which the animals were kept (325 mm x 210 mm x 185 mm) to each as "Resident" mouse to establish. An age-, weight- and sex-matched untreated natural mouse was used as an "intruder" for another 15 min. The number of independent (the first 15 min without intruder and the second 15 min with intruder) and interactive behavior events (15 min with intruder) was rated for the resident mouse. The various behavioral events included sniffing the environment, raising trees beside the cage, independently rearing, digging, clockwise circles, counterclockwise circles, mutual grooming, persistence, and scratching. These interactive behavioral events included snooping the other mouse, following, grooming, and raising against the other mouse, sitting and leaning against the other mouse, following and running away from the other mouse, biting, boxing, or fighting, climbing, Clinging and tail beating. The video footage was analyzed and the events were counted by three independent observers, who were unaware of the treatment conditions.

Zur Berechnung der insgesamt zurückgelegten Entfernungen und Bewertung sämtlicher identifizierbarer distinkter Verhaltensweisen wurde beide 15-minütigen Zeiträume für spezifizierte Zeiträume bei einer Bildfrequenz von 15 Hz auf Video aufgenommen. Damit wurde sichergestellt, dass schnelle Bewegungen der Mäuse ausreichend erfasst wurden und eine hochauflösende Analyse der Bewegungsbahn möglich war, wobei gleichzeitig die Dateien für eine Handhabung klein genug waren. Der interessierende Bereich in dem aufgenommenen Video mit einer Größe von 500 × 310 Pixeln wurde direkt auf einen Computer für die spätere Analyse gespeichert.To calculate the total distances traveled and evaluate all identifiable distinct behaviors, both 15-minute periods were recorded on video for specified periods of time at a frame rate of 15 Hz. This ensured that fast movements of the mice were adequately captured and a high-resolution analysis of the trajectory was possible, while at the same time the files were small enough for handling. The area of interest in the captured video with a size of 500x310 pixels was stored directly on a computer for later analysis.

Nach der Erfassung des Videos wurde die Position der Maus in jedem Rahmen verfolgt. Für diese Untersuchung wurde die Verfolgung in der IT-Umgebung Java mit der ICY-Software ( de Chaumont, Dallongeville et al., 2012 ) durchgeführt. Um die Lokalisierung der Maus zu bestimmen, wurde das Pixel mit maximaler Intensität in jedem Rahmen ermittelt und ein Untergruppenbild um diese Pixel herum wurde extrahiert. Das Zentrum der Intensität der Untergruppenaufnahme wurde berechnet und dazu verwendet, um die X- und Y-Koordinaten des Objektes zu bestimmen. Anschließend konnte die gesamte zurückgelegte Entfernung pro transgener Maus einfach berechnet werden, indem mittels einer von den Erfindern entwickelten Software zur Analyse des Mausverhaltens verwendet wurde.After capturing the video, the position of the mouse was tracked in each frame. For this investigation, the tracking in the IT environment Java with the ICY software ( de Chaumont, Dallongeville et al., 2012 ) carried out. To determine the location of the mouse, the maximum intensity pixel in each frame was detected and a subgroup image around those pixels was extracted. The center of the intensity of subgroup recording was calculated and used to determine the X and Y coordinates of the object. Subsequently, the total distance traveled per transgenic mouse could be easily calculated using mouse analysis software developed by the inventors.

1.6 Immunhistochemie (IHC), Doppelfärbung und Evaluierung/Analyse der Aufnahmen (Quantifizierung der β-Amyloid-Ablagerung und Mikroglia- oder Astrocyten-Aktivierung)1.6 Immunohistochemistry (IHC), dual staining and evaluation / analysis of images (quantification of β-amyloid deposition and microglial or astrocyte activation)

Die mit Hesperidin behandelten Mäuse und die Kontrollmäuse wurden nach 10-tägiger Behandlung getötet. Die Mäuse wurden mit Äther tiefenanästhesiert und intrakardial mit 4%igem Paraformaldehyd in PBS bei 4°C perfundiert. Die Gehirne wurden rasch entnommen und anschließend in 4%igem Paraformaldehyd über Nacht bei 4°C nachfixiert. Die nachfixierten Gehirne wurden in 2 Hemisphären geschnitten; die Hemisphären wurden in Paraffin eingebettet, seriell geschnitten (3 µm) und auf mit Silan beschichteten Objektträgern aufgebracht. Die Schnitte der Hemisphären wurden mit IHC gefärbt. Die folgenden Antikörper wurden verwendet: Anti-β-Amyloid (1:100; Abcam, Cambridge, Vereinigtes Königreich) für die Aβ-Ablagerung, und Anti-Iba-1 (1:200; Wako, Neuss, Deutschland) für aktivierte Mikroglia und GFAP (1:500; Chemicon (Millipore), Billerica, MA, Vereinigte Staaten von Amerika) für Astrocyten.The hesperidin-treated mice and control mice were sacrificed after 10 days of treatment. The mice were deeply anaesthetized with ether and perfused intracardially with 4% paraformaldehyde in PBS at 4 ° C. The brains were removed rapidly and subsequently postfixed in 4% paraformaldehyde overnight at 4 ° C. The postfixed brains were cut into 2 hemispheres; the hemispheres were embedded in paraffin, serially cut (3 μm) and applied to silane-coated slides. The sections of the hemispheres were stained with IHC. The following antibodies were used: anti-β-amyloid (1: 100, Abcam, Cambridge, UK) for Aβ deposition, and anti-Iba-1 (1: 200; Wako, Neuss, Germany) for activated microglia and GFAP (1: 500; Chemicon (Millipore), Billerica, MA, United States of America) for astrocytes.

In Doppelfärbungsexperimenten wurden die Hemisphärenschnitte bezüglich einer Aβ-Ablagerung immunmarkiert, wie oben beschrieben. Dann wurden sie erneut einer Mikrowellenbestrahlung für fünfzehn Minuten im Citratpuffer unterzogen und mit 10%igem normalem Schweineserum (Biochrom) inkubiert. Anschließend wurden die Schnitte mit den jeweiligen zweiten primären monoclonalen Antikörpern für eine Stunde bei Raumtemperatur inkubiert. Die folgenden Antikörper wurden verwendet: Iba-1 (1:200; Wako, Neuss, Deutschland) für aktivierte Mikroglia und GFAP (1:500; Chemicon (Milipore), Billerica, MA, Vereinigte Staaten von Amerika) für Astrocyten. Eine Visualisierung erfolgte durch die Zugabe von sekundärem Antikörper bei einer Verdünnung von 1:400 in TBS-Rinderserum-Albumin (BSA) für 30 Minuten und dann dem mit alkalischer Phosphatase konjugiertem Avidin Komplex, verdünnt 1:100 in TBS-BSA für weitere 30 Minuten. Schließlich wurde die Immunfärbung mit Fast Blue BB Salz Chromogensubstratlösung entwickelt, ohne Gegenfärbung mit Hämalaum.In double staining experiments, the hemispherical sections were immunolabeled for Aβ deposition as described above. Then they were again subjected to microwave irradiation in the citrate buffer for fifteen minutes and incubated with 10% normal pig serum (biochrome). Subsequently, the sections were incubated with the respective second primary monoclonal antibodies for one hour at room temperature. The following antibodies were used: Iba-1 (1: 200; Wako, Neuss, Germany) for activated microglia and GFAP (1: 500; Chemicon (Milipore), Billerica, MA, United States of America) for astrocytes. Visualization was accomplished by the addition of secondary antibody at a 1: 400 dilution TBS bovine serum albumin (BSA) for 30 minutes and then the alkaline phosphatase-conjugated avidin complex, diluted 1: 100 in TBS-BSA for a further 30 minutes. Finally, immunostaining with Fast Blue BB salt chromogen substrate solution was developed without counterstaining with hemalice.

Nach HE- und Immunfärbung wurden die Hemisphärenschnitte mittels Lichtmikroskopie (Nikon Coolscope, Nikon, Düsseldorf, Deutschland) untersucht. Die Aβ-Ablagerung uns die Iba-1 und GFAP Immunfärbungen wurden an Querschnitten der Hemisphären evaluiert, speziell fokussiert auf den Neo-Cortex und Hippocampus. Sämtliche Schnitte wurden zufallsnummeriert und unabhängig von zwei Beobachtern analysiert, die weder die Behandlung noch die Zeitpunkte kannten. Aβ-Plaques, Iba-1⁺- und GFAP⁺-Zellen im Neo-Cortex und Hippocampus wurden manuell ausgezählt, und zwar im Bezug auf einen bestimmten Durchmesser und eine deutliche Ablagerung von Plaques.After HE and immunostaining, the hemispherical sections were examined by light microscopy (Nikon Coolscope, Nikon, Dusseldorf, Germany). The Aβ deposition and the Iba-1 and GFAP immunostaining were evaluated on cross sections of the hemispheres, specifically focused on the neo-cortex and hippocampus. All sections were randomly numbered and analyzed independently of two observers who knew neither the treatment nor the time points. Aβ plaques, Iba-1 ⁺ and GFAP ⁺ cells in the neo-cortex and hippocampus were manually counted for a given diameter and significant plaque deposition.

Um die Immunfärbedaten weiter zu evaluieren, wurden die prozentualen Flächen von spezifischer Immunreaktivität (IR) in den interessierenden Regionen berechnet. In Kürze, es wurden Aufnahmen von Hemisphärenquerschnitten unter 5-facher Vergrößerung unter Verwendung des Nikon Coolscope (Nikon, Düsseldorf, Deutschland) mit festgelegten Parametern gewonnen; der Cortex und Hippocampus wurden auf den Aufnahmen abgegrenzt und unter Verwendung der Software MetaMorph Offline 7.1 (Molecular Devices, Toronto, Kanada) weiter analysiert. Die Bereiche von IR wurden durch Farbschwellensegmentierung selektiert und sämtliche Parameter wurden für alle Aufnahmen festgelegt. Die Ergebnisse sind als arithmetische Mittel der Plaque/Zell-Zählungen oder prozentualen Anteile der Flächen von IR gegenüber interessierenden Flächen auf Querschnitten und mittlerem Standardfehler (SEM) angegeben. Ferner, zum Zwecke des Etablierens von quantitativen räumlichen Beziehungen zwischen Aβ-Plaques und Plaque-assoziierten Mikroglia/Astrocyten wurden sowohl das Verhältnis von Plaque zu Mikroglia-IR-Bereich und Plaque zu Astrocyten-IR-Bereich im Cortex berechnet.To further evaluate the immunostaining data, the percent areas of specific immunoreactivity (IR) in the regions of interest were calculated. Briefly, images of hemispherical cross-sections were taken at 5x magnification using the Nikon Coolscope (Nikon, Dusseldorf, Germany) with fixed parameters; the cortex and hippocampus were delineated on the recordings and further analyzed using the software MetaMorph Offline 7.1 (Molecular Devices, Toronto, Canada). The regions of IR were selected by color threshold segmentation and all parameters were set for all images. The results are reported as arithmetic mean plaque / cell counts or percentages of area of IR versus area of interest on cross sections and mean standard error (SEM). Furthermore, for purposes of establishing quantitative spatial relationships between Aβ plaques and plaque-associated microglia / astrocytes, both the plaque-to-microglia IR area plaque-to-astrocyte IR area ratio in the cortex were calculated.

1.7 In vitro-Assays1.7 In Vitro Assays

Die immortalisierte Makrophagenzelllinie der Maus RAW 264.7 und Mikroglia-Zelllinie N9 wurden verwendet, um die Auswirkungen von Hesperidin auf die inflammatorische Reaktion der Makrophagen und Mikroglia in vitro zu bestimmen. Die RAW 264.7-Zellen und N9-Zellen wurden bei 37°C und 5% CO₂ in vollständigem RPMI 1640-Medium (Gibco, Grand Island, New York) und DMEM-Medium (Gibco, Grand Island, New York) wachsen gelassen, welche Penicillin (100 U/ml), Streptomycin (100 U/ml) und 10% fötales Kälberserum enthielten. 10⁵ Zellen wurden in Zellkulturschalen mit 12 Vertiefungen gegeben und für 24 Stunden kultiviert. Anschließend wurden die Zellen mit Lipopolysaccharid (LPS) (Arbeitskonzentration von 1 µg/ml, Stammlösung 1 mg/ml in PBS) stimuliert und zusammen mit oder ohne Hesperidin (bei einer Arbeitskonzentration von 1 µg/ml gelöst in Medium) für weitere 24 Stunden inkubiert. Die gesamte RNA aus den kultivierten Zellen wurde unter Verwendung des RNeasy Mini Kit (Qiagen GmbH, Hilden, Deutschland) gemäß den Anweisungen des Herstellers präpariert. 1 µg RNA wurde unter Verwendung des QuantiTect Reverse Transkription Kit (Qiagen, Hilden, Deutschland) in cDNA revers transkribiert. Ein cDNA-Äquivalent zu 20 ng Gesamt-RNA wurde einer anschließenden semi-quantifizierten PCR-Analyse zugeführt, in der Primer verwendet wurden, die spezifisch sind für iNOS, IL-1 und TNF-α und dem Haushaltsgen β-Actin. In Vorversuchen wurden die optimalen Zyklierungsbedingungen etabliert, die eine Amplifizierung der cDNA im linearen Bereich ermöglichen. Die PCR-Produkte wurden auf 1,5%-igen Agarosegelen aufgetrennt, die 0,01% GelRed enthielten, fotografiert unter Verwendung des UVsolo-Systems (Whatman Biometra, Goettingen, Deutschland) und eine densitometrische Analyse wurde unter Verwendung der Software BioDocAnalyze (Whatman Biometra) durchgeführt. Die Ergebnisse wurden berechnet als Spiegel von Ziel mRNAs relativ zu jenen von β-Actin (drei Proben jeder Gruppe wurden mittels PCR analysiert).The immortalized mouse macrophage cell line RAW 264.7 and microglial cell line N9 were used to determine the effects of hesperidin on the inflammatory response of macrophages and microglia in vitro. RAW 264.7 cells and N9 cells were grown at 37 ° C and 5% CO ₂ in complete RPMI 1640 medium (Gibco, Grand Island, New York) and DMEM medium (Gibco, Grand Island, New York). which contained penicillin (100 U / ml), streptomycin (100 U / ml) and 10% fetal calf serum. 10 ⁵ cells were placed in 12-well cell culture dishes and cultured for 24 hours. Subsequently, the cells were stimulated with lipopolysaccharide (LPS) (working concentration of 1 μg / ml, stock solution 1 mg / ml in PBS) and incubated together with or without hesperidin (at a working concentration of 1 μg / ml dissolved in medium) for an additional 24 hours , Total RNA from the cultured cells was prepared using the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. 1 μg of RNA was reverse transcribed into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). A cDNA equivalent to 20 ng total RNA was added to a subsequent semi-quantified PCR analysis using primers specific for iNOS, IL-1 and TNF-α and the housekeeping gene β-actin. In preliminary experiments, the optimal cycling conditions were established, which allow an amplification of the cDNA in the linear region. The PCR products were separated on 1.5% agarose gels containing 0.01% GelRed, photographed using the UVsolo system (Whatman Biometra, Goettingen, Germany), and densitometric analysis was performed using the software BioDocAnalyze (Whatman Biometra). The results were calculated as levels of target mRNAs relative to those of β-actin (three samples of each group were analyzed by PCR).

1.8 Statistische Analyse1.8 Statistical analysis

Die Daten sind angegeben als Mittelwerte ± S.E.M. Die Verteilungen der Plaque/Zell-Zählungen oder prozentualen Anteile zwischen den behandelten und Kontrollgruppen wurden unter Verwendung des ungepaarten Student's T-Tests verglichen. Eine statistische Signifikanz wurde definiert über P-Werte < 0,05. Sämtliche statistischen Analysen wurden mit der Graph Pad Prism 5.0-Software (GraphPad Software Inc., San Diego, CA, Vereinigte Staaten von Amerika) durchgeführt. Data are reported as mean ± S.E.M. The distributions of plaque / cell counts or percentages between the treated and control groups were compared using Student's unpaired T test. Statistical significance was defined over P-values <0.05. All statistical analysis was done with Graph Pad Prism 5.0 software (GraphPad Software Inc., San Diego, CA, United States of America).

2. Ergebnisse2 results

2.1 Verbesserung des in APP/PS1-Mäusen eingeschränkten affiliativen Verhaltens-Nestbau-Assay2.1 Improvement of the Affiliative Behavior Nesting Assay Limited in APP / PS1 Mice

Als angeborenem Instinkt ist das Nestbauverhalten für kleine Nagetiere zur Wärmekonservierung, Reproduktion und dem Schutz wichtig. Die Mäuse zerreißen zunächst die Papiertücher und ordnen sie dann zu einem Nest. Frühere Studien zeigten eine beeinträchtigte Nestbaufähigkeit der transgenen APP/PS1-Mäuse im Vergleich zu natürlichen Mäusen.As an innate instinct, nesting behavior is important for small rodents for heat conservation, reproduction, and protection. The mice first tear the paper towels and then arrange them into a nest. Previous studies demonstrated impaired nesting capability of the transgenic APP / PS1 mice compared to natural mice.

Zu Beginn der Behandlung (Tag 1) gab es keinen signifikanten Unterschied zwischen der mit Hesperidin behandelten Gruppe und der Kontrollgruppe (Kontrolle = 1,58 ± 0,15, Hesperidin = 1,75 ± 0,28, P > 0,05, n = 6, 2A). Nach 10 Tagen der Behandlung (Tag 11) war das Nest der mit Hesperidin behandelten Mäusen von verbesserter Qualität, wie angezeigt durch signifikante Unterschiede in den Nestbauwerten im Vergleich zu ihren Gegenspielern (Kontrolle = 1,42 ± 0,15, Hesperidin = 2,08 ± 0,20, P < 0,05, n = 6, 2B). Nach 10 Tagen der Behandlung mit Hesperidin wurden unmittelbares Kauund Zerreißverhalten in Richtung der Papiertücher beobachtet; die Papiertücher wurden in Stücke gerissen und in einem Eck des Käfigs gruppiert. Hierzu in starkem Kontrast untersuchten die Kontrolltiere und zeigten geringes Kauverhalten, haben die Papiertücher jedoch nicht richtig zerrissen, wie sie dies 10 Tage zuvor bereits taten; die Papiertücher wurden über den gesamten Käfig verteilt gefunden, nicht gruppiert, oder aber sie waren gruppiert, jedoch nicht in der Ecke oder zu einem Nest geordnet. At the beginning of treatment (day 1), there was no significant difference between the hesperidin-treated group and the control group (control = 1.58 ± 0.15, hesperidin = 1.75 ± 0.28, P> 0.05, n = 6, 2A ). After 10 days of treatment (day 11), the nest of the hesperidin-treated mice was of improved quality as indicated by significant differences in nest building values compared to their opponents (control = 1.42 ± 0.15, hesperidin = 2.08 ± 0.20, P <0.05, n = 6, 2 B ). After 10 days of treatment with hesperidin, immediate chewing and tearing behavior was observed towards the tissues; the paper towels were torn to pieces and grouped in a corner of the cage. In contrast, the control animals examined in a strong contrast and showed low chewing behavior, but did not tear the paper towels properly, as they did 10 days earlier; the paper towels were found distributed over the entire cage, not grouped, or they were grouped, but not arranged in the corner or to a nest.

Nach der Ermittlung dieser positiven Ergebnisse wurden Assays zur Verbesserung der sozialen Interaktion durchgeführt und die Mäuse wurden für weitere pathologische Untersuchungen getötet.Following the identification of these positive results, assays to improve social interaction were performed and the mice were sacrificed for further pathology.

2.2 Verbesserung der beeinträchtigten sozialen Interaktion von APP/PS1-Mäusen-"Resident-Intruder-Test"2.2 Improvement of Impaired Social Interaction of APP / PS1 Mouse "Resident Intruder Test"

In dem Test zur sozialen Interaktion wurden sämtliche Bewegungen dieser transgenen Mäuse mit zwei Kameras aufgenommen, eine vertikal platzierte Kamera zur Berechnung der Entfernungen der Bewegungen und eine andere von der Seite der Käfige zur Zählung der individuellen und interaktiven Verhaltensweisen. Beide Kameras wurden auf die richtige Höhe justiert, wodurch sichergestellt wurde, dass sämtliche Bewegungen der Tiere eingefangen wurden.In the social interaction test, all movements of these transgenic mice were recorded with two cameras, one vertically placed camera to calculate the distances of the movements and another from the side of the cages to count the individual and interactive behaviors. Both cameras were adjusted to the correct height, ensuring that all movements of the animals were captured.

Die Daten bestehen aus Koordinaten des sich bewegenden Tiers (was als ein Punkt betrachtet wird), die bei 15 Hz erfasst wurden. Diese berechneten zurückgelegten Entfernungen unter Verwendung von aufgezeichneten x, y-Koordinaten wurden in echte Entfernungen der Bewegung transformiert (Pixel zu cm). In dieser Studie, egal ob vor oder nach der Behandlung, waren die zurückgelegten Entfernungen zwischen der mit Hesperidin behandelten Gruppe und der Kontrollgruppe nach wie vor nicht unterschiedlich (3a), was darauf hindeutet, dass die motorische Funktion der Mäuse in beiden Armen normal und nicht signifikant unterschiedlich war.The data consists of coordinates of the moving animal (which is considered a point) detected at 15 Hz. These calculated traveled distances using recorded x, y coordinates were transformed into true distances of motion (pixels to cm). In this study, whether before or after treatment, the distances traveled between the hesperidin-treated group and the control group were still not different ( 3a ), suggesting that the motor function of the mice in both arms was normal and not significantly different.

Zwei nicht miteinander vertraute Mäuse, die in den gleichen Käfig gesetzt wurden, zeigen oft eine hohe Aktivität des Beschnüffelns, Folgens, der Fellpflege und des Aufbäumens gegenüber der anderen Maus, des Sitzens oder Lehnens gegen die andere Maus, usw. Die Forscher werteten die Videoaufnahmen hinsichtlich der Frequenz aus und definierten vorsichtig Verhaltensereignisse. In der Studie, vor der Behandlung, waren die Unterschiede der interaktiven Verhaltenszählungen (Kontrolle = 9,7 ± 1,4. Hesperidin = 1,7 ± 2,8. P > 0,05, n = 6, 3C) zwischen den beiden Gruppen nicht statistisch signifikant, während nach einer 10-tägigen Behandlung die "Resident"-APP/PS1-Mäuse in der mit Hesperidin behandelten Gruppe eine signifikant höhere Sequenz von interaktiven Verhaltensweisen im Vergleich zu denen der Kontrollmäuse zeigten (Kontrolle = 9,7 ± 1,4, Hesperidin = 22,7 ± 5,7, P > 0,05, n = 6, 3D). Mittlerweile waren die Häufigkeiten von unabhängigen Verhaltensereignissen zwischen den zwei Gruppen zu jedem Zeitpunkt nach wie vor ausgeglichen (3B).Two unfamiliar mice placed in the same cage often show high activity of snooping, following, grooming and rearing up against the other mouse, sitting or leaning against the other mouse, etc. Researchers evaluated the video recordings in terms of frequency and carefully defined behavioral events. In the study, before treatment, the differences in interactive behavioral counts (control = 9.7 ± 1.4, hesperidin = 1.7 ± 2.8, P> 0.05, n = 6, 3C ) were not statistically significant between the two groups, while after 10 days of treatment the "resident" APP / PS1 mice in the hesperidin-treated group showed a significantly higher sequence of interactive behaviors compared to control mice (control = 9 , 7 ± 1.4, hesperidin = 22.7 ± 5.7, P> 0.05, n = 6, 3D ). Meanwhile, the incidence of independent behavioral events between the two groups was still balanced at all times ( 3B ).

Nach 10-tägiger Behandlung waren sowohl der Nestbau als auch die Verhaltensweisen zur sozialen Interaktion in der mit Hesperidin behandelten Gruppe signifikant verbessert. Deshalb wurden alle Mäuse getötet und die Wirkung von Hesperidin auf neuropathologische Veränderungen wurde weiter untersucht.After 10 days of treatment, both nesting and social interaction behaviors were significantly improved in the hesperidin-treated group. Therefore, all mice were sacrificed and the effect of hesperidin on neuropathological changes was further investigated.

2.3 Verbesserung der Pathologie der Amyloidose in APP/PS1-Mäusen2.3 Improvement of the pathology of amyloidosis in APP / PS1 mice

Amyloide Plaques waren über den gesamten Cortex und Hippocampus sämtlicher APP/PS1 transgenen Mäuse verteilt. Einige von ihnen waren klein und hatten dichte Kerne und einige von ihnen waren größer mit einem dichten Kern und einem großen Hof von diffusem Amyloid. Im Hippocampus wurde eine geringere Plaque-Dichte festgestellt.Amyloid plaques were distributed throughout the entire cortex and hippocampus of all APP / PS1 transgenic mice. Some of them were small and had dense cores and some of them were larger with a dense nucleus and a large courtyard of diffuse amyloid. In the hippocampus a lower plaque density was found.

Anschließend wurden die relativen Wirksamkeiten einer Hesperidin-Behandlung auf die Plaque-Pathologie in den APP/PS1-Mäusen während der Plaque-Ablagerung untersucht. Eine Immunfärbung mit Anti-Aβ zeigte, dass es bei den mit Hesperidin behandelten Mäusen eine deutliche Reduzierung der Plaque-Anzahl im Cortex gibt (Kontrolle = 124,3 ± 8,1, Hesperidin = 157,8 ± 4,2, P < 0,01, n = 6, 4C). Auf den immungefärbten Schnitten wurde mittels MetaMorph eine quantitative Analyse der Amyloid-Last bestimmt, die definiert ist als prozentualer Anteil des untersuchten Gewebebereichs, der mit Aβ-Plaques besetzt ist. Nach 10-tägiger Hesperidin-Verabreichung waren die Aβ-IR-Bereiche in den mit Hesperidin behandelten Tieren im Vergleich mit geschlechts- und altersabgestimmten Kontrollmäusen signifikant reduziert, und zwar um 32% im Cortex (Kontrolle = 0,73 ± 0,07%, Hesperidin = 0,41 ± 0,03%, P < 0,01, n = 6, 4D) und um 12,3% im Hippocampus (Hesperidin = 0,14 ± 0,03%, Kontrolle = 0,26 ± 0.04%, P < 0,01, n = 6, 4F). Obwohl es einen signifikanten Unterschied zwischen den beiden Gruppen in Bezug auf die Plaque-Zählungen im Hippocampus gab (Hesperididin = 13,2 ± 2,6%, Kontrolle = 8,3 ± 1,9%, P > 0,05, n = 6, 4E), war der Abwärtstrend in der mit Hesperidin behandelten Gruppe klar zu erkennen. Ferner haben in der mit Hesperidin behandelten Gruppe die Aβ-Plaques eine geringere Größe und weniger Verzweigungen (4A, 4B).Subsequently, the relative efficacies of hesperidin treatment were examined for plaque pathology in the APP / PS1 mice during plaque deposition. Immunostaining with anti-Aβ showed that in the hesperidin-treated mice there was a significant reduction in the plaque count in the cortex (control = 124.3 ± 8.1, hesperidin = 157.8 ± 4.2, P <0 , 01, n = 6, 4C ). On the immunostained sections, MetaMorph was used to determine a quantitative analysis of the amyloid load, which is defined as the percentage of the examined tissue area occupied by Aβ plaques. After 10 days of hesperidin administration, the Aβ-IR regions in the hesperidin-treated animals were significantly reduced compared to sex and age-matched control mice, by 32% in the cortex (control = 0.73 ± 0.07%, Hesperidin = 0.41 ± 0.03%, P <0.01, n = 6, 4D ) and by 12.3% in the hippocampus (hesperidin = 0.14 ± 0.03%, control = 0.26 ± 0.04%, P <0.01, n = 6, 4F ). Although there is a significant difference between the two Groups with respect to hippocampal plaque counts (hesperidin = 13.2 ± 2.6%, control = 8.3 ± 1.9%, P> 0.05, n = 6, 4E ), the downtrend in the hesperidin-treated group was clearly evident. Furthermore, in the hesperidin-treated group, the Aβ plaques are smaller in size and less branched ( 4A . 4B ).

Zusätzlich zu der Analyse der Aβ-Akkumulierung wurden die Auswirkungen von einer Hesperidin-Behandlung auf die inflammatorischen Reaktionen evaluiert. Nachfolgend wurden deshalb Färbungen auf Iba1 und GFAP durchgeführt. Sowohl im Cortex als auch im Hippocampus wurden Amöboid-Iba1-positive Mikroglia beobachtet, die um die Amyloiden-Ablagerungen herum geclustert waren (5A, 5B). Es gab signifikante Trends für eine Reduzierung von Iba1⁺-Zellen (Kontrolle = 88,2 ± 4,8, Hesperidin = 36,0 ± 3,9, P < 0,01, n = 6, 5C) und deren IR-Bereich (Kontrolle = 0,38,2 ± 0,02, Hesperidin = 0,23 ± 0,01%, P < 0,01, n = 6, 5D) im Cortex, wobei die Unterschiede im Hippocampus statistisch nicht signifikant waren. Ein großer Teil der Iba1⁺-Zellen war weniger geclustert nach der Behandlung mit Hesperidin, was auf eine reduzierte Mikroglia-Aktivierung hindeutet. Eine Vielzahl der GFAP⁺ war weit über den gesamten Cortex und Hippocampus verteilt. Sie zeigten allesamt die typische Morphologie von Astrocyten, einschließlich sternartige Form und vielfache Verzweigung. Keine signifikante Änderung in der GFAP⁺ Zellintensität wurde zwischen den mit Hesperidin behandelten Zellen und den Kontrollzellen beobachtet (Daten nicht gezeigt). Im Bezug auf die Doppelfärbung war das Verhältnis von Plaques zu Plaque-assoziierten Mikroglia-IR-Bereich signifikant geringer im Cortex der APP/PS1-Mäuse aus der Hesperidin-Gruppe (Kontrolle = 131,1 ± 14,7%, Hesperidin = 72,6 ± 6,4%, P < 0,05, n = 6, 6A). Für das Verhältnis von Plaques zu Plaque-assoziierten GFAP⁺-Asytrocyten-IR-Bereich wurde im Cortex zwischen diesen beiden Gruppen kein signifikanter Unterschied festgestellt (6B). In addition to the analysis of Aβ accumulation, the effects of hesperidin treatment on the inflammatory responses were evaluated. Subsequently, staining was therefore carried out on Iba1 and GFAP. Amoeboid Iba1-positive microglia clustered around the amyloid deposits were observed both in the cortex and in the hippocampus ( 5A . 5B ). There were significant trends for reduction of Iba1 ⁺ cells (control = 88.2 ± 4.8, hesperidin = 36.0 ± 3.9, P <0.01, n = 6, 5C and their IR range (control = 0.38.2 ± 0.02, hesperidin = 0.23 ± 0.01%, P <0.01, n = 6, 5D ) in the cortex, with differences in hippocampus not being statistically significant. Much of the Iba1 ⁺ cells were less clustered after treatment with hesperidin, suggesting reduced microglial activation. A variety of GFAP ⁺ was widely distributed throughout the cortex and hippocampus. They all showed the typical morphology of astrocytes, including star-like shape and multiple branching. No significant change in GFAP ⁺ cell intensity was observed between the hesperidin-treated cells and the control cells (data not shown). With respect to double staining, the plaque to plaque-associated microglia IR ratio was significantly lower in the cortex of APP / PS1 mice from the hesperidin group (control = 131.1 ± 14.7%, hesperidin = 72, 6 ± 6.4%, P <0.05, n = 6, 6A ). There was no significant difference in the ratio of plaques to plaque-associated GFAP ⁺ -sytrocyte IR in the cortex between these two groups ( 6B ).

2.4 Reduzierung der Freisetzung von inflammatorischen Cytokinen in vitro2.4 Reduction of the release of inflammatory cytokines in vitro

In einer weiteren Studie in vitro wurde die murine Makrophagen-Zelllinie RAW 264.7 mit LPS (1 µg/mL) induziert; mit oder ohne einer Behandlung mit steigenden Mengen Hesperidin für 24 Stunden. Nach der LPS-Induktion waren die NO-Produktion und die mRNA-Expression von iNOS, IL-1β und TNF-α signifikant erhöht, was auf eine inflammatorische Aktivierung hindeutet. Nach 24-stündiger Behandlung mit Hesperidin war die NO-Konzentration konzentrationsabhängig signifikant reduziert (7A). Ferner waren die mRNA-Spiegel von iNOS und TNF-α und IL-1β in der mit Hesperidin behandelten Gruppe konzentrationsabhängig deutlich reduziert (7B).In another in vitro study, the murine macrophage cell line RAW 264.7 was induced with LPS (1 μg / mL); with or without treatment with increasing amounts of hesperidin for 24 hours. After LPS induction, NO production and mRNA expression of iNOS, IL-1β and TNF-α were significantly increased, indicating inflammatory activation. After treatment with hesperidin for 24 hours, the concentration of NO was significantly reduced depending on the concentration ( 7A ). Furthermore, the mRNA levels of iNOS and TNF-α and IL-1β in the hesperidin-treated group were significantly reduced in concentration ( 7B ).

3. Fazit3. Conclusion

Die Erfinder konnten anhand eines etablierten Tiermodelles auf eindrucksvolle Art und Weise die Eignung von Hesperidin als Arzneimittel zur Prophylaxe und/oder Behandlung einer Amyloidose demonstrieren.The inventors were able to demonstrate the suitability of hesperidin as a drug for the prophylaxis and / or treatment of amyloidosis on the basis of an established animal model in an impressive manner.

ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION

Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.

Zitierte Nicht-PatentliteraturCited non-patent literature

Menze et al. (2012), Potential neuroprotective effects of hesperidin on 3-nitropropionic acid-induced neurotoxicity in rats, Neurotoxicology 33 (5), pp. 1265-1275 [0012]
Raza et al. (2011), Hesperidin ameliorates functional and histological outcome and reduced neuroinflammation in experimental stroke, Brain Res. 1420, pp. 93-105 [0012]
Huang et al. (2012), Cytoprotective effect of hesperetin and hesperidin against amyloid β-induced impairment of glucose transport through downregulation of neuronal autophagy, Mol. Nutr. Food Res. 56, pp. 601-609 [0013]
Wang et al. (2013), Protective effects of hesperidin against amyloid-β (Aβ) -induced neurotoxicity by the voltage dependent anion channel 1 (VDAC1) mediated mitochondrial apoptotic pathway in PC12 cells, Neurochem. Res. 38, pp. 1034-1044 [0014]
Wesson and Wilson 2011 [0044]
Bolivar et al. 2007 [0046]
Hibbits et al. 2009 [0046]
de Chaumont, Dallongeville et al., 2012 [0048]

Claims

Hesperidin for use as a medicament for the prophylaxis and / or treatment of amyloidosis.

Hesperidin for use according to claim 1, characterized in that the amyloidosis is a cerebral amyloidosis.

Hesperidin for use according to claim 1 or 2, characterized by a targeted reduction of β-amyloid deposition in the brain.

A hesperidin for use as claimed in any one of the preceding claims for the targeted improvement of behavioral disorders caused by amyloidosis.

Hesperidin for use according to one of the preceding claims, characterized in that the medicament comprises a further active ingredient for the prophylaxis and / or treatment of amyloidosis.

Hesperidin for use according to one of the preceding claims, characterized in that the hesperidin in a concentration of about 1 micrograms, preferably from about 10 micrograms, more preferably from about 100 micrograms, more preferably from about 1 mg, more preferably from about 10 mg, and most preferably about 25 mg per kg of body weight and per day is used.

Use of hesperidin for the prophylaxis and / or treatment of amyloidosis.

Use according to claim 7, characterized in that the amyloidosis is a cerebral amyloidosis.

Use according to claim 7 or 8, characterized by a targeted reduction of β-amyloid deposition in the brain.

Use according to one of the preceding claims, characterized by a targeted improvement of behavioral disorders caused by the neurodegenerative disease.

Use according to one of the preceding claims, characterized in that the hesperidin in a concentration of about 1 μg, preferably from about 10 μg, more preferably from about 100 μg, more preferably from about 1 mg, further preferably from about 10 mg, and most preferably about 25 mg per kg of body weight and per day.

Use according to one of the preceding claims, characterized in that the hesperidin is combined with another active ingredient for the prophylaxis and / or treatment of amyloidosis.