DE102011118606A1 - Stilbene compounds as PPAR beta / delta inhibitors for the treatment of PPAR beta / delta-mediated diseases - Google Patents
Stilbene compounds as PPAR beta / delta inhibitors for the treatment of PPAR beta / delta-mediated diseases Download PDFInfo
- Publication number
- DE102011118606A1 DE102011118606A1 DE102011118606A DE102011118606A DE102011118606A1 DE 102011118606 A1 DE102011118606 A1 DE 102011118606A1 DE 102011118606 A DE102011118606 A DE 102011118606A DE 102011118606 A DE102011118606 A DE 102011118606A DE 102011118606 A1 DE102011118606 A1 DE 102011118606A1
- Authority
- DE
- Germany
- Prior art keywords
- following radicals
- nhr
- alkyl
- independently
- cycloalkyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
- C07D295/04—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms
- C07D295/14—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
- C07D295/155—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with substituted hydrocarbon radicals attached to ring nitrogen atoms substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals with the ring nitrogen atoms and the carbon atoms with three bonds to hetero atoms separated by carbocyclic rings or by carbon chains interrupted by carbocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
- A61P35/04—Antineoplastic agents specific for metastasis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C215/00—Compounds containing amino and hydroxy groups bound to the same carbon skeleton
- C07C215/68—Compounds containing amino and hydroxy groups bound to the same carbon skeleton having amino groups bound to carbon atoms of six-membered aromatic rings and hydroxy groups bound to acyclic carbon atoms or to carbon atoms of rings other than six-membered aromatic rings of the same carbon skeleton
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C223/00—Compounds containing amino and —CHO groups bound to the same carbon skeleton
- C07C223/06—Compounds containing amino and —CHO groups bound to the same carbon skeleton having amino groups bound to carbon atoms of six-membered aromatic rings of the carbon skeleton
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C255/00—Carboxylic acid nitriles
- C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
- C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
- C07C255/34—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring with cyano groups linked to the six-membered aromatic ring, or to the condensed ring system containing that ring, by unsaturated carbon chains
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C255/00—Carboxylic acid nitriles
- C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
- C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
- C07C255/35—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring the carbon skeleton being further substituted by halogen atoms, or by nitro or nitroso groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C255/00—Carboxylic acid nitriles
- C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
- C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
- C07C255/37—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring the carbon skeleton being further substituted by etherified hydroxy groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C255/00—Carboxylic acid nitriles
- C07C255/01—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms
- C07C255/32—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring
- C07C255/42—Carboxylic acid nitriles having cyano groups bound to acyclic carbon atoms having cyano groups bound to acyclic carbon atoms of a carbon skeleton containing at least one six-membered aromatic ring the carbon skeleton being further substituted by singly-bound nitrogen atoms, not being further bound to other hetero atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D211/00—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings
- C07D211/04—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D211/06—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members
- C07D211/08—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms
- C07D211/10—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms
- C07D211/14—Heterocyclic compounds containing hydrogenated pyridine rings, not condensed with other rings with only hydrogen or carbon atoms directly attached to the ring nitrogen atom having no double bonds between ring members or between ring members and non-ring members with hydrocarbon or substituted hydrocarbon radicals directly attached to ring carbon atoms with radicals containing only carbon and hydrogen atoms attached to ring carbon atoms with hydrocarbon or substituted hydrocarbon radicals attached to the ring nitrogen atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
- C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
- C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D213/24—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with substituted hydrocarbon radicals attached to ring carbon atoms
- C07D213/54—Radicals substituted by carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals
- C07D213/57—Nitriles
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C2601/00—Systems containing only non-condensed rings
- C07C2601/12—Systems containing only non-condensed rings with a six-membered ring
- C07C2601/14—The ring being saturated
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- General Health & Medical Sciences (AREA)
- General Chemical & Material Sciences (AREA)
- Diabetes (AREA)
- Oncology (AREA)
- Emergency Medicine (AREA)
- Endocrinology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Obesity (AREA)
- Pain & Pain Management (AREA)
- Rheumatology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
Abstract
Die vorliegende Erfindung betrifft Substanzen, die als selektive Liganden von nukleären Rezeptoren des PPAR beta/delta-Subtyps wirken und für die Behandlung von PPAR beta/delta-vermittelten Erkrankungen verwendet werden können. Die erfindungsgemäßen Substanzen wirken als Inhibitoren des PPAR beta/delta Rezeptors.The present invention relates to substances which act as selective ligands of PPAR beta / delta subtype nuclear receptors and can be used for the treatment of PPAR beta / delta-mediated diseases. The substances according to the invention act as inhibitors of the PPAR beta / delta receptor.
Description
Die vorliegende Erfindung betrifft Substanzen, die als selektive Liganden von nukleären Rezeptoren des PPAR beta/delta-Subtyps wirken und für die Behandlung von PPAR beta/delta-vermittelten Erkrankungen verwendet werden können. Die erfindungsgemäßen Substanzen wirken als Inhibitoren des PPAR beta/delta Rezeptors.The present invention relates to substances which act as selective ligands of PPAR beta / delta subtype nuclear receptors and can be used for the treatment of PPAR beta / delta-mediated diseases. The substances according to the invention act as inhibitors of the PPAR beta / delta receptor.
Peroxisom-Proliferator-aktivierte Rezeptoren (PPAR) sind nukleäre Rezeptoren, die als Liganden-induzierbare Transkriptionsfaktoren wirken. Die drei bekannten PPAR-Subtypen PPAR alpha, PPAR beta/delta und PPAR gamma bilden dabei mit Mitgliedern der Retinoid X-Rezeptorfamilie (RXR) Heterodimere, welche dann an PPAR Response Elemente (PPRE) der DNA binden und so die Aktivität ihrer Zielgene regulieren. PPARs fungieren als Sensoren für Fettsäuren und Eicosanoid-Metabolite, die – wie zum Beispiel bestimmte Prostaglandine, Leukotriene oder Hydroxyeicosatetraensäuren – eine Funktion bei der Immunregulation haben. Diese Eigenschaft verleiht den PPAR Rezeptoren eine zentrale Funktion im Fettstoffwechsel und bei inflammatorischen Vorgängen. Dadurch bedingt kommt den PPAR Rezeptoren auch eine wichtige Rolle bei Erkrankungen wie zum Beispiel Hyperlipidämie, Diabetes, Fibrose, inflammatorischen Erkrankungen und Krebs zu. Zu den inflammatorischen Erkrankungen gehören unter anderem Alzheimer, Arthritis, Asthma, Artheriosklerose, Morbus Crohn, Colitis, Dermatitis, Divertikulitis, Hepatitis, Reizdarm, Lupus erythematosus, Nephritis, Parkinson und Colitis ulcerosa.Peroxisome proliferator-activated receptors (PPARs) are nuclear receptors that act as ligand-inducible transcription factors. The three known PPAR alpha subtypes PPAR beta / delta and PPAR gamma form members of the retinoid X receptor family (RXR) heterodimers, which then bind to PPAR response elements (PPRE) of the DNA and thus regulate the activity of their target genes. PPARs act as sensors for fatty acids and eicosanoid metabolites that have a role in immune regulation, such as certain prostaglandins, leukotrienes, or hydroxyeicosatetraenoic acids. This property gives the PPAR receptors a central function in fat metabolism and in inflammatory processes. As a result, the PPAR receptors also play an important role in diseases such as hyperlipidemia, diabetes, fibrosis, inflammatory diseases and cancer. The inflammatory diseases include Alzheimer's, arthritis, asthma, atherosclerosis, Crohn's disease, colitis, dermatitis, diverticulitis, hepatitis, irritable bowel, lupus erythematosus, nephritis, Parkinson's disease and ulcerative colitis.
Rezeptoren des PPAR beta/delta-Subtyps erfüllen essentielle Funktionen im Lipid- und Glukose-Metabolismus sowie anderen krankheitsassoziierten biologischen Prozessen wie zum Beispiel Zelldifferenzierung, Proliferation, Apoptose und Immunregulation. Darüber hinaus kommt PPAR beta/delta eine Rolle bei der Tumorigenese zu. Ferner manifestiert sich die Beteiligung von PPAR beta/delta Rezeptoren an Inflammations-assoziierten Prozessen in verschiedenen Funktionen.PPAR beta / delta subtype receptors perform essential functions in lipid and glucose metabolism as well as other disease-associated biological processes such as cell differentiation, proliferation, apoptosis, and immune regulation. In addition, PPAR beta / delta has a role in tumorigenesis. Furthermore, the involvement of PPAR beta / delta receptors manifests itself in inflammation-associated processes in various functions.
Endogene Liganden für PPAR beta/delta Rezeptoren sind Fettsäuren wie Arachidonsäure, sowie deren Metabolite, wie 15-Hydroxyeicosetetraensäure (15-HETE) und Prostaglandin I2 (PGI2, Prostacyclin). In Abwesenheit eines Liganden liegt PPAR beta/delta häufig im Komplex mit Korepressoren wie SMRT oder SHARP (”SMRT/HDAC I-associated repressor protein”) vor. Substanzen, die als Agonisten der PPAR beta/delta Rezeptoren wirken, induzieren eine Konformationsänderung von PPAR beta/delta, welche zur Dissoziation von Korepressoren, wie zum Beispiel SMRT, führt und/oder eine Interaktion mit spezifischen Koaktivatoren, wie zum Beispiel Histon-Acetylasen, mit anschließender transkriptioneller Aktivierung von Genen bewirkt.Endogenous ligands for PPAR beta / delta receptors are fatty acids such as arachidonic acid, as well as their metabolites, such as 15-hydroxyeicosetetraenoic acid (15-HETE) and prostaglandin I2 (PGI2, prostacyclin). In the absence of a ligand, PPAR beta / delta is often complexed with corepressors such as SMRT or SHARP ("SMRT / HDAC I-associated repressor protein"). Substances acting as agonists of the PPAR beta / delta receptors induce a conformational change of PPAR beta / delta which results in dissociation of corepressors such as SMRT and / or interaction with specific coactivators such as histone acetylases. followed by transcriptional activation of genes.
Des Weiteren kann PPAR beta/delta Gene auch unabhängig von der Bindung an DNA regulieren. PPAR beta/delta interagiert in Abwesenheit eines Liganden beispielsweise mit BCL6 in Makrophagen und unterdrückt so die Repression (pro-)inflammatorischer Gene durch BCL6, wie beispielsweise mcp1, IL1b und mmp9. PPAR beta/delta hat auch eine Schlüsselfunktion bei Differenzierung, Polarisation und/oder Funktion spezifischer Immunzellen, wie zum Beispiel Makrophagen und T-Helferzellen, und ist mit den pro-inflammatorischen Mechanismen bei der Psoriasis assoziiert.Furthermore, PPAR can also regulate beta / delta genes independently of binding to DNA. For example, in the absence of a ligand, PPAR beta / delta interacts with BCL6 in macrophages, suppressing the repression of (pro) inflammatory genes by BCL6, such as mcp1, IL1b, and mmp9. PPAR beta / delta also has a key function in differentiation, polarization and / or function of specific immune cells, such as macrophages and T helper cells, and is associated with the pro-inflammatory mechanisms in psoriasis.
PPAR beta/delta Agonisten modulieren unter anderem auch die Wirkung von TGF-beta (Transforming growth factor beta) und können dabei zur Repression von Genen mit Funktionen in der Immunregulation beitragen. TGF-beta ist zudem ein in Tumoren häufig vorkommendes Cytokin. Die TGF-beta-vermittelten SMAD-Proteine induzieren unter anderem die Transkription des Gens für das Angiopoietin-ähnliche Protein ANGPTL4, das neben seiner Funktion in der Regulation des Lipid-Metabolismus vermutlich auch an der Angiogenese und an der Tumorprogression beteiligt ist. Es ist bekannt, dass die Expression des ANGPTL4-Gens auch durch die PPAR-Rezeptoren reguliert wird.Among other things, PPAR beta / delta agonists modulate the effect of transforming growth factor beta (TGF-beta) and may contribute to the repression of genes with functions in immune regulation. TGF-beta is also a common cytokine in tumors. The TGF-beta-mediated SMAD proteins induce, inter alia, the transcription of the angiopoietin-like protein ANGPTL4 gene, which, in addition to its function in the regulation of lipid metabolism, is believed to be involved in angiogenesis and tumor progression. It is known that the expression of the ANGPTL4 gene is also regulated by the PPAR receptors.
Der Stand der Technik kennt Substanzen, die als spezifische, hochaffine und bioverfügbare Agonisten für den beta/delta-Subtyp der PPAR-Rezeptoren wirken, wie GW501516, L165041, cPGI („Carbaprostazyklin”) und GW2433. Klinische Relevanz besitzt vor allem GW501516, das bereits in einer klinischen Studie (Phase II) bei der Behandlung von Dyslipidämie eingesetzt wird (GlaxoSmithKline, Studiennummer: NCT00158899). Es sind jedoch keine spezifischen und hochaffinen inhibitorischen Substanzen bekannt, die als bioverfügbare und reversible bzw. kompetitive Antagonisten oder inverse Agonisten für PPAR beta/delta verwendet werden können.The art recognizes substances that act as specific, high affinity and bioavailable agonists for the beta / delta subtype of PPAR receptors, such as GW501516, L165041, cPGI ("carbaprostazykline"), and GW2433. GW501516, which is already used in a clinical study (Phase II) in the treatment of dyslipidemia, has clinical relevance (GlaxoSmithKline, Study No. NCT00158899). However, no specific and high affinity inhibitory substances are known which can be used as bioavailable and reversible or competitive antagonists or inverse agonists for PPAR beta / delta.
Weiterhin kennt der Stand der Technik Antagonisten für den alpha- bzw. gamma Subtyp der PPAR Rezeptoren. So werden in
Aufgabe der vorliegenden Erfindung ist es, die Nachteile des Standes der Technik mittels neuer Verbindungen zu beseitigen.The object of the present invention is to eliminate the disadvantages of the prior art by means of new compounds.
Diese Aufgabe wird erfindungsgemäß durch die technische Lehre der unabhängigen Ansprüche gelöst. Weitere vorteilhafte Ausgestaltungen der Erfindung ergeben sich aus den abhängigen Ansprüchen, der Beschreibung, den Figuren sowie den Beispielen.This object is achieved by the technical teaching of the independent claims. Further advantageous embodiments of the invention will become apparent from the dependent claims, the description, the figures and the examples.
Überraschend wurde gefunden, dass die Verbindungen 1, bevorzugt die Verbindungen 2 gemäß allgemeiner Formel (I) bessere Inhibitoren von PPAR beta/delta für die Behandlung von PPAR beta/delta-vermittelten Erkrankungen sind, als die literaturbekannte Verbindung GSK0660, welche eine inhibitorische Wirkung zeigt.Surprisingly, it has been found that
Somit betrifft die vorliegende Erfindung Verbindungen 1 der allgemeinen Formel (I) worin
A für N oder C-R3 steht,
B für N oder C-R4 steht,
C für N oder C-R5 steht,
D für N oder C-R6 steht,
E für N oder C-R7 steht,
und keiner, einer, zwei oder drei der Gruppen A, B, C, D und E für Stickstoff stehen und die restlichen Gruppen A, B, C, D und E, welche nicht Stickstoff sind, für C-R3, C-R4, C-R5, C-R6 oder C-R7 stehen;
Z für eines der folgenden Molekülfragmente steht: R1 für einen der folgenden Reste steht:
-H, -CN, -NC, -CF3, -CHO, -COOH, -CH2-COOH, -COOR13, -CH2-COOR13, -OH, -CH2OH, -OR13, -CH2OR13, -CONH2, -CONH(R13), -CON(R13)(R14), -COR14, -SO2NH2, -SO2NH(R13), -SO2N(R13)(R14), -NO2, -NH2, -NHR13, -N(R13)(R14), -CH2-NH2, -CH2-NHR13, -CH2-N(R13)(R14), C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R13 und R14 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R2 für einen der folgenden Reste steht:
-H, C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R3-R8, R12 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -CH2OH, -OR18, -CH2OR18, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR18, -COOH, -CH2-COOH, -COOR18, -CH2-COOR18, -CONH2, -CN, -CONH(R18), -CON(R18)(R19), -SO2NH2, -SO2NH(R18), -SO2N(R18)(R19), -NO2, -NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2-N(R18)(R19), -O-CO-R18, -NHCO-R18, -N(R18)-CO-R19, C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R9-R11 unabhängig voneinander folgende Reste bedeuten: -R15, -R16, -R17, R15 folgenden Rest bedeutet:
-NH2, -NHR18, -N(R18)(R19), CH2-NH2, -CH2-NHR18, -CH2N(R18)(R19);
R16 und R17 unabhängig voneinander folgende Reste bedeuten:
-H, -NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2N(R18)(R19), -OR18;
R18 und R19 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
X steht für: -O-, -S-, -N(R24)-
Y steht für: -O-, -S-, -N(R23)-
R20-R24 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -OR25, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR25, -COOH, -COOR25, -CONH2, -CONH(R25), -CON(R25)(R26), -NH2, -NHR25, -N(R25)(R26), -O-CO-R25, -NHCO-R25, -N(R25)-CO-R26, -SO2NH2, -SO2NH(R25), -SO2N(R25)(R26), C1-C10-Alkyl;
R25 und R26 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
sowie deren Metallkomplexe, Salze, Enantiomere, Enantiomerengemische, Diastereomere, Diastereomerengemische, Tautomere, Hydrate, Solvate, und Racemate der vorgenannten Verbindungen.Thus, the present invention relates to
A is N or CR 3 ,
B is N or CR 4 ,
C is N or CR 5 ,
D is N or CR 6 ,
E is N or CR 7 ,
and none, one, two or three of the groups A, B, C, D and E stand for nitrogen and the remaining groups A, B, C, D and E, which are not nitrogen, for CR 3 , CR 4 , CR 5 , CR 6 or CR 7 are;
Z is one of the following molecular fragments: R 1 is one of the following radicals:
-H, -CN, -NC, -CF 3 , -CHO, -COOH, -CH 2 -COOH, -COOR 13 , -CH 2 -COOR 13 , -OH, -CH 2 OH, -OR 13 , -CH 2 OR 13 , -CONH 2 , -CONH (R 13 ), -CON (R 13 ) (R 14 ), -COR 14 , -SO 2 NH 2 , -SO 2 NH (R 13 ), -SO 2 N ( R 13 ) (R 14 ), -NO 2 , -NH 2 , -NHR 13 , -N (R 13 ) (R 14 ), -CH 2 -NH 2 , -CH 2 -NHR 13 , -CH 2 -N (R 13 ) (R 14 ), C 1 -C 10 -alkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 -fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 alkynyl, C 2 -C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 13 and R 14 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 2 is one of the following radicals:
-H, C 1 -C 10 -alkyl, C 1 -C 10 -haloalkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 3 -R 8 , R 12 independently of one another represent the following radicals:
-H, -OH, -CH 2 OH, -OR 18 , -CH 2 OR 18 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 18 , -COOH, -CH 2 -COOH, -COOR 18 , -CH 2 -COOR 18 , -CONH 2 , -CN, -CONH (R 18 ), -CON (R 18 ) (R 19 ), -SO 2 NH 2 , -SO 2 NH (R 18 ), -SO 2 N (R 18 ) (R 19 ), -NO 2 , -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 ), -O-CO-R 18 , -NHCO-R 18 , -N (R 18 ) -CO-R 19 , C 1 -C 10 Alkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 fluoroalkenyl C 5 -C 10 fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 alkynyl, C 2 -C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 9 -R 11 are independently of one another the following radicals: -R 15 , -R 16 , -R 17 , R 15 means the following:
-NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 N (R 18 ) (R 19 );
R 16 and R 17 independently of one another represent the following radicals:
-H, -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 N (R 18 ) (R 19 ), OR 18 ;
R 18 and R 19 independently of one another represent the following radicals:
C 1 -C 10 -alkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -alkynyl, aryl, heteroaryl;
X stands for: -O-, -S-, -N (R 24 ) -
Y stands for: -O-, -S-, -N (R 23 ) -
R 20 -R 24 independently of one another represent the following radicals:
-H, -OH, -OR 25 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 25 , -COOH, -COOR 25 , -CONH 2 , -CONH (R 25 ), -CON (R 25 ) (R 26 ), -NH 2 , -NHR 25 , -N (R 25 ) (R 26 ), -O-CO-R 25 , -NHCO-R 25 , -N (R 25 ) -CO-R 26 , -SO 2 NH 2 , -SO 2 NH (R 25 ), -SO 2 N (R 25 ) (R 26 ), C 1 -C 10 alkyl;
R 25 and R 26 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
and their metal complexes, salts, enantiomers, enantiomer mixtures, diastereomers, diastereomer mixtures, tautomers, hydrates, solvates, and racemates of the abovementioned compounds.
In einer bevorzugten Ausführungsform umfasst die vorliegende Erfindung die folgenden Verbindungen 2 der allgemeinen Formel (I) worin
A für N oder C-R3 steht,
B für N oder C-R4 steht,
C für N oder C-R5 steht,
D für N oder C-R6 steht,
E für N oder C-R7 steht,
und keiner, einer, zwei oder drei der Gruppen A, B, C, D und E für Stickstoff stehen und die restlichen Gruppen A, B, C, D und E, welche nicht Stickstoff sind, für C-R3, C-R4, C-R5, C-R6 oder C-R7 stehen;
Z für folgendes Molekülfragment steht: R1 für einen der folgenden Reste steht:
-H, -CN, -NC, -CF3, -CHO, -COOH, -CH2-COOH, -COOR13, -CH2-COOR13, -OH, -CH2OH, -OR13, -CH2OR13, -CONH2, -CONH(R13), -CON(R13)(R14), -COR14, -SO2NH2, -SO2NH(R13), -SO2N(R13)(R14), -NO2, -NH2, -NHR13, -N(R13)(R14), -CH2-NH2, -CH2-NHR13, -CH2-N(R13)(R14), C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoroalkinyl, C2-C10-Perfluoralkinyl;
R13 und R14 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R2 für einen der folgenden Reste steht:
-H, C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R3-R8, R12 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -CH2OH, -OR18, -CH2OR18, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR18, -COOH, -CH2-COOH, -COOR18, -CH2COOR18, -CONH2, -CN, -CONH(R18), -CON(R18)(R19), -SO2NH2, -SO2NH(R18), -SO2N(R18)(R19), -NO2, -NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2-N(R18)(R19), -O-CO-R18, -NHCO-R18, -N(R18)-CO-R19, C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R9-R11 unabhängig voneinander folgende Reste bedeuten: -R15, -R16, -R17, R15 folgenden Rest bedeutet:
-NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2-N(R18)(R19);
R16 und R17 unabhängig voneinander folgende Reste bedeuten:
-H, -NH2, -NHR18, -N(R18)(R19), -CH2NH2, -CH2-NHR18, -CH2-N(R18)(R19), -OR18;
R18 und R19 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
X steht für: -O-, -S-, -N(R24)-
Y steht für: -O-, -S-, -N(R23)-
R20-R24 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -OR25, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR25, -COOH, -COOR25, -CONH2, -CONH(R25), -CON(R25)(R26), -NH2, -NHR25, -N(R25)(R26), -O-CO-R25, -NHCO–R25, -N(R25)-CO-R26, -SO2NH2, -SO2NH(R25), -SO2N(R25)(R26), C1-C10-Alkyl;
R25 und R26 unabhängig voneinander folgende Reste bedeuten:
C1-C10-alkyl, C3-C10-cycloalkyl, C2-C10-alkenyl, C5-C10-cycloalkenyl, C2-C10-alkinyl, aryl, heteroaryl;
sowie deren Metallkomplexe, Salze, Enantiomere, Enantiomerengemische, Diastereomere, Diastereomerengemische, Tautomere, Hydrate, Solvate, und Racemate der vorgenannten Verbindungen.In a preferred embodiment, the present invention comprises the following
A is N or CR 3 ,
B is N or CR 4 ,
C is N or CR 5 ,
D is N or CR 6 ,
E is N or CR 7 ,
and none, one, two or three of the groups A, B, C, D and E stand for nitrogen and the remaining groups A, B, C, D and E, which are not nitrogen, for CR 3 , CR 4 , CR 5 , CR 6 or CR 7 are;
Z stands for the following molecule fragment: R 1 is one of the following radicals:
-H, -CN, -NC, -CF 3 , -CHO, -COOH, -CH 2 -COOH, -COOR 13 , -CH 2 -COOR 13 , -OH, -CH 2 OH, -OR 13 , -CH 2 OR 13 , -CONH 2 , -CONH (R 13 ), -CON (R 13 ) (R 14 ), -COR 14 , -SO 2 NH 2 , -SO 2 NH (R 13 ), -SO 2 N ( R 13 ) (R 14 ), -NO 2 , -NH 2 , -NHR 13 , -N (R 13 ) (R 14 ), -CH 2 -NH 2 , -CH 2 -NHR 13 , -CH 2 -N (R 13 ) (R 14 ), C 1 -C 10 alkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 -fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 -alkynyl, C 2 - C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 13 and R 14 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 2 is one of the following radicals:
-H, C 1 -C 10 -alkyl, C 1 -C 10 -haloalkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 3 -R 8 , R 12 independently of one another represent the following radicals:
-H, -OH, -CH 2 OH, -OR 18 , -CH 2 OR 18 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 18 , -COOH, -CH 2 -COOH, -COOR 18 , -CH 2 COOR 18 , -CONH 2 , -CN, -CONH (R 18 ), -CON (R 18 ) (R 19 ), -SO 2 NH 2 , -SO 2 NH ( R 18 ), -SO 2 N (R 18 ) (R 19 ), -NO 2 , -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 ), -O-CO-R 18 , -NHCO-R 18 , -N (R 18 ) -CO-R 19 , C 1 -C 10 - Alkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 alkynyl, C 2 -C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 9 -R 11 are independently of one another the following radicals: -R 15 , -R 16 , -R 17 , R 15 means the following:
-NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 );
R 16 and R 17 independently of one another represent the following radicals:
-H, -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 ), OR 18 ;
R 18 and R 19 independently of one another represent the following radicals:
C 1 -C 10 -alkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -alkynyl, aryl, heteroaryl;
X stands for: -O-, -S-, -N (R 24 ) -
Y stands for: -O-, -S-, -N (R 23 ) -
R 20 -R 24 independently of one another represent the following radicals:
-H, -OH, -OR 25 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 25 , -COOH, -COOR 25 , -CONH 2 , -CONH (R 25 ), -CON (R 25 ) (R 26 ), -NH 2 , -NHR 25 , -N (R 25 ) (R 26 ), -O-CO-R 25 , -NHCO-R 25 , -N (R 25 ) -CO-R 26 , -SO 2 NH 2 , -SO 2 NH (R 25 ), -SO 2 N (R 25 ) (R 26 ), C 1 -C 10 alkyl;
R 25 and R 26 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
and their metal complexes, salts, enantiomers, enantiomer mixtures, diastereomers, diastereomer mixtures, tautomers, hydrates, solvates, and racemates of the abovementioned compounds.
Ein weiterer Aspekt der vorliegenden Erfindung betrifft die Verwendung der vorgenannten Verbindungen in der Medizin, d. h. als pharmakologisch aktive Wirkstoffe zur Behandlung von Krankheiten. Insbesondere sind die vorgenannten Verbindungen als Inhibitor eines Rezeptors des Typs PPAR beta/delta zu verwenden und damit zur Behandlung von Krankheiten, welche mit einem Rezeptor des Typs PPAR beta/delta in Verbindung stehen.Another aspect of the present invention relates to the use of the aforementioned compounds in medicine, d. H. as pharmacologically active agents for the treatment of diseases. In particular, the abovementioned compounds are to be used as inhibitors of a receptor of the type PPAR beta / delta and thus for the treatment of diseases which are associated with a receptor of the type PPAR beta / delta.
Des Weiteren betrifft die vorliegende Erfindung die Verwendung der Verbindungen 3 gemäß allgemeiner Formel (I) worin
A für N oder C-R3 steht,
B für N oder C-R4 steht,
C für N oder C-R5 steht,
D für N oder C-R6 steht,
E für N oder C-R7 steht,
und keiner, einer, zwei oder drei der Gruppen A, B, C, D und E für Stickstoff stehen und die restlichen Gruppen A, B, C, D und E, welche nicht Stickstoff sind, für C-R3, C-R4, C-R5, C-R6 oder C-R7 stehen;
Z für eines der folgenden Molekülfragmente steht: R1 für einen der folgenden Reste steht:
-H, -CN, -NC, -CF3, -CHO, -COOH, -CH2-COOH, -COOR13, -CH2-COOR13, -OH, -CH2OH, -OR13, -CH2OR13, -CONH2, -CONH(R13), -CON(R13)(R14), -COR14, -SO2NH2, -SO2NH(R13), -SO2N(R13)(R14), -NO2, -NH2, -NHR13, -N(R13)(R14), -CH2-NH2, -CH2-NHR13, -CH2-N(R13)(R14), C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R13 und R14 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloakenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R2 für einen der folgenden Reste steht:
-H, C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R3-R8, R12, R15-R17 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -CH2OH, -OR18, -CH2OR18, -CF3, -OCF3, -F, -Cl, -Br, -I, -VOR18, -COOH, -CH2-COOH, -COOR18, -CH2COOR18, -CONH2, -CN, -CONH(R18), -CON(R18)(R19), -SO2NH2, -SO2NH(R18), -SO2N(R18)(R19), -NO2, -NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2-N(R18)(R19), -O-CO-R18, -NHCO-R18, -N(R18)-CO-R19, C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R9-R11 unabhängig voneinander folgende Reste bedeuten: -R15, -R16, -R17, R18 und R19 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
X steht für: -O-, -S-, -N(R24)-
Y steht für: -O-, -S-, -N(R23)-
R20-R24 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -OR25, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR25, -COOH, -COOR25, -CONH2, -CONH(R25), -CON(R25)(R26), -NH2, -NHR25, -N(R25)(R26), -O-CO-R25, -NHCO-R25, -N(R25)-CO-R26, -SO2NH2, -SO2NH(R25), -SO2N(R25)(R26), C1-C10-Alkyl;
R25 und R26 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
zur Behandlung von inflammatorischen Prozessen, Entzündungen, Zelldifferenzierungsprozessen oder proliferativen Erkrankungen.Furthermore, the present invention relates to the use of the
A is N or CR 3 ,
B is N or CR 4 ,
C is N or CR 5 ,
D is N or CR 6 ,
E is N or CR 7 ,
and none, one, two or three of the groups A, B, C, D and E stand for nitrogen and the remaining groups A, B, C, D and E, which are not nitrogen, for CR 3 , CR 4 , CR 5 , CR 6 or CR 7 are;
Z is one of the following molecular fragments: R 1 is one of the following radicals:
-H, -CN, -NC, -CF 3 , -CHO, -COOH, -CH 2 -COOH, -COOR 13 , -CH 2 -COOR 13 , -OH, -CH 2 OH, -OR 13 , -CH 2 OR 13 , -CONH 2 , -CONH (R 13 ), -CON (R 13 ) (R 14 ), -COR 14 , -SO 2 NH 2 , -SO 2 NH (R 13 ), -SO 2 N ( R 13 ) (R 14 ), -NO 2 , -NH 2 , -NHR 13 , -N (R 13 ) (R 14 ), -CH 2 -NH 2 , -CH 2 -NHR 13 , -CH 2 -N (R 13 ) (R 14 ), C 1 -C 10 alkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 -fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 -alkynyl, C 2 - C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 13 and R 14 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 2 is one of the following radicals:
-H, C 1 -C 10 -alkyl, C 1 -C 10 -haloalkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 3 -R 8 , R 12 , R 15 -R 17 independently of one another represent the following radicals:
-H, -OH, -CH 2 OH, -OR 18 , -CH 2 OR 18 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -VOR 18 , -COOH, -CH 2 -COOH, -COOR 18 , -CH 2 COOR 18 , -CONH 2 , -CN, -CONH (R 18 ), -CON (R 18 ) (R 19 ), -SO 2 NH 2 , -SO 2 NH ( R 18 ), -SO 2 N (R 18 ) (R 19 ), -NO 2 , -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 ), -O-CO-R 18 , -NHCO-R 18 , -N (R 18 ) -CO-R 19 , C 1 -C 10 - Alkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 alkynyl, C 2 -C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 9 -R 11 are independently of one another the following radicals: -R 15 , -R 16 , -R 17 , R 18 and R 19 independently of one another represent the following radicals:
C 1 -C 10 -alkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -alkynyl, aryl, heteroaryl;
X stands for: -O-, -S-, -N (R 24 ) -
Y stands for: -O-, -S-, -N (R 23 ) -
R 20 -R 24 independently of one another represent the following radicals:
-H, -OH, -OR 25 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 25 , -COOH, -COOR 25 , -CONH 2 , -CONH (R 25 ), -CON (R 25 ) (R 26 ), -NH 2 , -NHR 25 , -N (R 25 ) (R 26 ), -O-CO-R 25 , -NHCO-R 25 , -N (R 25 ) -CO-R 26 , -SO 2 NH 2 , -SO 2 NH (R 25 ), -SO 2 N (R 25 ) (R 26 ), C 1 -C 10 alkyl;
R 25 and R 26 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
for the treatment of inflammatory processes, inflammations, cell differentiation processes or proliferative diseases.
In einer bevorzugten Ausführungsform umfasst die vorliegende Erfindung die Verwendung der Verbindungen 4 der allgemeinen Formel (I) worin
A für N oder C-R3 steht,
B für N oder C-R4 steht,
C für N oder C-R5 steht,
D für N oder C-R6 steht,
E für N oder C-R7 steht,
und keiner, einer, zwei oder drei der Gruppen A, B, C, D und E für Stickstoff stehen und die restlichen Gruppen A, B, C, D und E, welche nicht Stickstoff sind, für C-R3, C-R4, C-R5, C-R6 oder C-R7 stehen;
Z für folgendes Molekülfragment steht: R1 für einen der folgenden Reste steht:
-H, -CN, -NC, -CF3, -CHO, -COOH, -CH2-COOH, -COOR13, -CH2-COOR13, -OH, -CH2OH, -OR13, -CH2OR13, -CONH2, -CONH(R13), -CON(R13)(R14), -COR14, -SO2NH2, -SO2NH(R13), -SO2N(R13)(R14), -NO2, -NH2, -NHR13, -N(R13)(R14), -CH2-NH2, -CH2-NHR13, -CH2-N(R13)(R14), C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R13 und R14 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R2 für einen der folgenden Reste steht:
-H, C1-C10-Alkyl, C1-C10-Halogenalkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
R3-R8, R12, R15-R17 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -CH2OH, -OR18, -CH2OR18, -CF3, -OCF3, -F, -Cl, -Br, -I, -COOR18, -COOH, -CH2-COOH, -COOR18, -CH2-COOR18, -CONH2, -CN, -CONH(R18), -CON(R18)(R19), -SO2NH2, -SO2NH(R18), -SO2N(R18)(R19), -NO2, -NH2, -NHR18, -N(R18)(R19), -CH2-NH2, -CH2-NHR18, -CH2-N(R18)(R19), -O-CO-R18, -NHCO-R18, -N(R18)-CO-R19, C1-C10-Alkyl, C1-C10-Fluoralkyl, C1-C10-Perfluoralkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Fluoralkenyl, C5-C10-Fluorcycloalkenyl, C2-C10-Perfluoralkenyl, C5-C10-Perfluorcycloalkenyl, C2-C10-Alkinyl, C2-C10-Fluoralkinyl, C2-C10-Perfluoralkinyl;
R9-R11 unabhängig voneinander folgende Reste bedeuten: -R15, -R16, -R17, R18 und R19 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C1-C6-Heterocyclyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
X steht für: -O-, -S-, -N(R24)-
Y steht für: -O-, -S-, -N(R23)-
R20-R24 unabhängig voneinander folgende Reste bedeuten:
-H, -OH, -OR25, -CF3, -OCF3, -F, -Cl, -Br, -I, -COR25, -COOH, -COOR25, -CONH2, -CONH(R25), -CON(R25)(R26), -NH2, -NHR25, -N(R25)(R26), -O-CO-R25, -NHCO-R25, -N(R25)-CO-R26, -SO2NH2, -SO2NH(R25), -SO2N(R25)(R26), -C1-C10-Alkyl;
R25 und R26 unabhängig voneinander folgende Reste bedeuten:
C1-C10-Alkyl, C3-C10-Cycloalkyl, C2-C10-Alkenyl, C5-C10-Cycloalkenyl, C2-C10-Alkinyl, Aryl, Heteroaryl;
zur Behandlung von inflammatorischen Prozessen, Entzündungen, Zelldifferenzierungsprozessen oder proliferativen Erkrankungen.In a preferred embodiment, the present invention comprises the use of the compounds 4 of the general formula (I) wherein
A is N or CR 3 ,
B is N or CR 4 ,
C is N or CR 5 ,
D is N or CR 6 ,
E is N or CR 7 ,
and none, one, two or three of the groups A, B, C, D and E stand for nitrogen and the remaining groups A, B, C, D and E, which are not nitrogen, for CR 3 , CR 4 , CR 5 , CR 6 or CR 7 are;
Z stands for the following molecule fragment: R 1 is one of the following radicals:
-H, -CN, -NC, -CF 3 , -CHO, -COOH, -CH 2 -COOH, -COOR 13 , -CH 2 -COOR 13 , -OH, -CH 2 OH, -OR 13 , -CH 2 OR 13 , -CONH 2 , -CONH (R 13 ), -CON (R 13 ) (R 14 ), -COR 14 , -SO 2 NH 2 , -SO 2 NH (R 13 ), -SO 2 N ( R 13 ) (R 14 ), -NO 2 , -NH 2 , -NHR 13 , -N (R 13 ) (R 14 ), -CH 2 -NH 2 , -CH 2 -NHR 13 , -CH 2 -N (R 13 ) (R 14 ), C 1 -C 10 alkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -fluoroalkenyl, C 5 -C 10 -fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 -alkynyl, C 2 - C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 13 and R 14 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 1 -C 10 haloalkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 2 is one of the following radicals:
-H, C 1 -C 10 -alkyl, C 1 -C 10 -haloalkyl, C 1 -C 10 -fluoroalkyl, C 1 -C 10 -perfluoroalkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
R 3 -R 8 , R 12 , R 15 -R 17 independently of one another represent the following radicals:
-H, -OH, -CH 2 OH, -OR 18 , -CH 2 OR 18 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COOR 18 , -COOH, -CH 2 -COOH, -COOR 18 , -CH 2 -COOR 18 , -CONH 2 , -CN, -CONH (R 18 ), -CON (R 18 ) (R 19 ), -SO 2 NH 2 , -SO 2 NH (R 18 ), -SO 2 N (R 18 ) (R 19 ), -NO 2 , -NH 2 , -NHR 18 , -N (R 18 ) (R 19 ), -CH 2 -NH 2 , -CH 2 -NHR 18 , -CH 2 -N (R 18 ) (R 19 ), -O-CO-R 18 , -NHCO-R 18 , -N (R 18 ) -CO-R 19 , C 1 -C 10 Alkyl, C 1 -C 10 fluoroalkyl, C 1 -C 10 perfluoroalkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 fluoroalkenyl C 5 -C 10 fluorocycloalkenyl, C 2 -C 10 perfluoroalkenyl, C 5 -C 10 perfluorocycloalkenyl, C 2 -C 10 alkynyl, C 2 -C 10 fluoroalkynyl, C 2 -C 10 perfluoroalkynyl;
R 9 -R 11 are independently of one another the following radicals: -R 15 , -R 16 , -R 17 , R 18 and R 19 independently of one another represent the following radicals:
C 1 -C 10 -alkyl, C 3 -C 10 -cycloalkyl, C 1 -C 6 -heterocyclyl, C 2 -C 10 -alkenyl, C 5 -C 10 -cycloalkenyl, C 2 -C 10 -alkynyl, aryl, heteroaryl;
X stands for: -O-, -S-, -N (R 24 ) -
Y stands for: -O-, -S-, -N (R 23 ) -
R 20 -R 24 independently of one another represent the following radicals:
-H, -OH, -OR 25 , -CF 3 , -OCF 3 , -F, -Cl, -Br, -I, -COR 25 , -COOH, -COOR 25 , -CONH 2 , -CONH (R 25 ), -CON (R 25 ) (R 26 ), -NH 2 , -NHR 25 , -N (R 25 ) (R 26 ), -O-CO-R 25 , -NHCO-R 25 , -N (R 25 ) -CO-R 26 , -SO 2 NH 2 , -SO 2 NH (R 25 ), -SO 2 N (R 25 ) (R 26 ), -C 1 -C 10 alkyl;
R 25 and R 26 independently of one another represent the following radicals:
C 1 -C 10 alkyl, C 3 -C 10 cycloalkyl, C 2 -C 10 alkenyl, C 5 -C 10 cycloalkenyl, C 2 -C 10 alkynyl, aryl, heteroaryl;
for the treatment of inflammatory processes, inflammations, cell differentiation processes or proliferative diseases.
In einer weiteren Ausführungsform umfasst die vorliegende Erfindung die Verwendung der Verbindungen 1, bevorzugt die Verbindungen 2 der allgemeinen Formel (I) zur Behandlung von inflammatorischen Prozessen, Entzündungen, Zelldifferenzierungsprozessen oder proliferativen Erkrankungen.In a further embodiment, the present invention comprises the use of the
Bei den proliferativen Erkrankungen handelt es sich vorzugsweise um Tumoren, Metastasen und/oder Krebs.The proliferative diseases are preferably tumors, metastases and / or cancer.
Die hierin offenbarten Verbindungen 1–4 der allgemeinen Formel (I), bevorzugt die Verbindungen 1, mehr bevorzugt die Verbindungen 2, sind aber auch sehr gut zur Behandlung von Lebererkrankungen einzusetzen.The compounds 1-4 of the general formula (I) disclosed herein, preferably the
Des Weiteren betrifft die vorliegende Erfindung die Verwendung der hierin offenbarten Verbindungen 3 der allgemeinen Formel (I), bevorzugt die Verbindungen 4, mehr bevorzugt die Verbindungen 1 und am meisten bevorzugt die Verbindungen 2 zur Behandlung von Erkrankungen des Fettsäurestoffwechsels und des Glukosestoffwechsels, bei denen Insulinresistenz involviert ist.Furthermore, the present invention relates to the use of the
Die Verbindungen 2 und 4 umfassen Verbindungen der folgenden allgemeinen Formel: wobei die Reste A bis E und R1, R2 sowie R8 bis R12 die hierin beschriebene Bedeutung haben.
Der Begriff ”C1-C10-Alkyl” bezeichnet vorzugsweise die folgenden Reste:
-CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11, -CH(CH3)-C3H7, -CH2-CH(CH3)-C2H5, -CH(CH3)-CH(CH3)2, -C(CH3)2-C2H5, -CH2-C(CH3)3, -CH(C2H5)2, -C2H4-CH(CH3)2, -C6H13, -C3H6-CH(CH3)2, -C2H4-CH(CH3)-C2H5, -CH(CH3)-C4H9, -CH2-CH(CH3)-C3H7, -CH(CH3)-CH2-CH(CH3)2, -CH(CH3)-CH(CH3)-C2H5, -CH2-CH(CH3)-CH(CH3)2, -CH2-C(CH3)2-C2H5, -C(CH3)2-C3H7, -C(CH3)2-CH(CH3)2, -C2H4-C(CH3)3, -CH(CH3)-C(CH3)3, -C7H15, C8H17, -C9H19 und -C10H21. Bevorzugt sind davon die folgenden Reste: -CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5 , -C(CH3)3 und -C5H11. Insbesondere bevorzugt sind: -CH3, -C2H5, -C3H7 und -CH(CH3)2.The term "C 1 -C 10 -alkyl" preferably denotes the following radicals:
-CH 3 , -C 2 H 5 , -C 3 H 7 , -CH (CH 3 ) 2 , -C 4 H 9 , -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -C 2 H 5 , -C (CH 3 ) 3 , -C 5 H 11 , -CH (CH 3 ) -C 3 H 7 , -CH 2 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -CH (CH 3 ) 2 , -C (CH 3 ) 2 -C 2 H 5 , -CH 2 -C (CH 3 ) 3 , -CH (C 2 H 5 ) 2 , -C 2 H 4 -CH ( CH 3 ) 2 , -C 6 H 13 , -C 3 H 6 -CH (CH 3 ) 2 , -C 2 H 4 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -C 4 H 9 , -CH 2 -CH (CH 3 ) -C 3 H 7 , -CH (CH 3 ) -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -CH (CH 3 ) -C 2 H 5 , -CH 2 -CH (CH 3 ) -CH (CH 3 ) 2 , -CH 2 -C (CH 3 ) 2 -C 2 H 5 , -C (CH 3 ) 2 -C 3 H 7 , - C (CH 3 ) 2 -CH (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) 3 , -CH (CH 3 ) -C (CH 3 ) 3 , -C 7 H 15 , C 8 H 17 , -C 9 H 19 and -C 10 H 21 . Preferred are the following radicals: -CH 3 , -C 2 H 5 , -C 3 H 7 , -CH (CH 3 ) 2 , -C 4 H 9 , -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -C 2 H 5 , -C (CH 3 ) 3 and -C 5 H 11 . Particularly preferred are: -CH 3 , -C 2 H 5 , -C 3 H 7 and -CH (CH 3 ) 2 .
Der Begriff ”C1-C10-Fluoralkyl” bezeichnet vorzugsweise die folgenden Reste:
-CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11, -CH(CH3)-C3H7, -CH2-CH(CH3)-C2H5, -CH(CH3)-CH(CH3)2, -C(CH3)2-C2H5, -CH2-C(CH3)3, -CH(C2H5)2, -C2H4-CH(CH3)2, -C6H13, -C3H6-CH(CH3)2, -C2H4-CH(CH3)-C2H5, -CH(CH3)-C4H9, -CH2-CH(CH3)-C3H7, -CH(CH3)-CH2-CH(CH3)2, -CH(CH3)-CH(CH3)-C2H5, -CH2-CH(CH3)-CH(CH3)2, -CH2-C(CH3)2-C2H5, -C(CH3)2-C3H7, -C(CH3)2-CH(CH3)2, -C2H4-C(CH3)3, -CH(CH3)-C(CH3)3, -C7H15, -C8H17, -C9H19 und -C10H21, worin ein oder mehrere Wasserstoffatome durch Fluoratome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -CH2F, -CHF2, -CH2-CH2F, -CH2-CHF2, -CH2-CF3, -C2H4-CH2F, -C2H4-CHF2, -C2H4-CF3, und -CH(CF3)2.The term "C 1 -C 10 fluoroalkyl" preferably denotes the following radicals:
- CH 3 , -C 2 H 5 , -C 3 H 7 , -CH (CH 3 ) 2 , -C 4 H 9 , -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -C 2 H 5 , -C (CH 3 ) 3 , -C 5 H 11 , -CH (CH 3 ) -C 3 H 7 , -CH 2 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) - CH (CH 3 ) 2 , -C (CH 3 ) 2 -C 2 H 5 , -CH 2 -C (CH 3 ) 3 , -CH (C 2 H 5 ) 2 , -C 2 H 4 -CH (CH 3 ) 2 , -C 6 H 13 , -C 3 H 6 -CH (CH 3 ) 2 , -C 2 H 4 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -C 4 H 9 , -CH 2 -CH (CH 3 ) -C 3 H 7 , -CH (CH 3 ) -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -CH (CH 3 ) -C 2 H 5 , -CH 2 -CH (CH 3 ) -CH (CH 3 ) 2 , -CH 2 -C (CH 3 ) 2 -C 2 H 5 , -C (CH 3 ) 2 -C 3 H 7 , -C (CH 3 ) 2 -CH (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) 3 , -CH (CH 3 ) -C (CH 3 ) 3 , -C 7 H 15 , -C 8 H 17 , -C 9 H 19 and -C 10 H 21 , wherein one or more hydrogen atoms are replaced by fluorine atoms. Preferred are the following radicals: -CH 2 F, -CHF 2 , -CH 2 -CH 2 F, -CH 2 -CHF 2 , -CH 2 -CF 3 , -C 2 H 4 -CH 2 F, -C 2 H 4 -CHF 2 , -C 2 H 4 -CF 3 , and -CH (CF 3 ) 2 .
Der Begriff ”C1-C10-Perfluoralkyl” bezeichnet vorzugsweise die folgenden Reste:
-CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11, -CH(CH3)-C3H7, -CH2-CH(CH3)-C2H5, -CH(CH3)-CH(CH3)2, -C(CH3)2-C2H5, -CH2-C(CH3)3, -CH(C2H5)2, -C2H4-CH(CH3)2, -C6H13, C3H6-CH(CH3)2, -C2H4-CH(CH3)-C2H5, -CH(CH3)-C4H9, -CH2-CH(CH3)-C3H7, -CH(CH3)-CH2-CH(CH3)2, -CH(CH3)-CH(CH3)-C2H5, -CH2-CH(CH3)-CH(CH3)2, -CH2-C(CH3)2-C2H5, -C(CH3)2-C3H7, -C(CH3)2-CH(CH3)2, -C2H4-C(CH3)3, -CH(CH3)-C(CH3)3, -C7H15, -C8H17, -C9H19 und -C10H21, worin sämtliche Wasserstoffatome durch Fluoratome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -CF3, -C2F5, -C3F7, -CF(CF3)2, -C4F9, -CF2-CF(CF3)2, -CF(CF3)-C2F5, -C(CF3)3 und -C5F11.The term "C 1 -C 10 perfluoroalkyl" preferably denotes the following radicals:
-CH 3 , -C 2 H 5 , -C 3 H 7 , -CH (CH 3 ) 2 , -C 4 H 9 , -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -C 2 H 5 , -C (CH 3 ) 3 , -C 5 H 11 , -CH (CH 3 ) -C 3 H 7 , -CH 2 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -CH (CH 3 ) 2 , -C (CH 3 ) 2 -C 2 H 5 , -CH 2 -C (CH 3 ) 3 , -CH (C 2 H 5 ) 2 , -C 2 H 4 -CH ( CH 3 ) 2 , -C 6 H 13 , C 3 H 6 -CH (CH 3 ) 2 , -C 2 H 4 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -C 4 H 9 , -CH 2 -CH (CH 3 ) -C 3 H 7 , -CH (CH 3 ) -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -CH (CH 3 ) -C 2 H 5 , -CH 2 -CH (CH 3 ) -CH (CH 3 ) 2 , -CH 2 -C (CH 3 ) 2 -C 2 H 5 , -C (CH 3 ) 2 -C 3 H 7 , -C (CH 3 ) 2 -CH (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) 3 , -CH (CH 3 ) -C (CH 3 ) 3 , -C 7 H 15 , -C 8 H 17 , -C 9 H 19 and -C 10 H 21 , wherein all hydrogen atoms are replaced by fluorine atoms. Of these, the following radicals are preferred: -CF 3 , -C 2 F 5 , -C 3 F 7 , -CF (CF 3 ) 2 , -C 4 F 9 , -CF 2 -CF (CF 3 ) 2 , -CF (CF 3 ) -C 2 F 5 , -C (CF 3 ) 3 and -C 5 F 11 .
Der Begriff ”C1-C10-Halogenalkyl” bezeichnet vorzugsweise die folgenden Reste:
-CH3, -C2H5, -C3H7, -CH(CH3)2, -C4H9, -CH2-CH(CH3)2, -CH(CH3)-C2H5, -C(CH3)3, -C5H11, -CH(CH3)-C3H7, -CH2-CH(CH3)-C2H5, -CH(CH3)-CH(CH3)2, -C(CH3)2-C2H5, -CH2-C(CH3)3, -CH(C2H5)2, -C2H4-CH(CH3)2, -C6H13, -C3H6-CH(CH3)2, -C2H4-CH(CH3)-C2H5, -CH(CH3)-C4H9, -CH2-CH(CH3)-C3H7, -CH(CH3)-CH2-CH(CH3)2, -CH(CH3)-CH(CH3)-C2H5, -CH2-CH(CH3)-CH(CH3)2, -CH2-C(CH3)2-C2H5, -C(CH3)2-C3H7, -C(CH3)2-CH(CH3)2, -C2H4-C(CH3)3, -CH(CH3)-C(CH3)3, -C7H15, C8H17, -C9H19 und -C10H21, worin ein oder mehrere Wasserstoffatome durch Halogenatome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -CH2F, -CHF2, -CH2-CH2F, -CH2-CHF2, -CH2-CF3, -C2H4-CH2F, -C2H4-CHF2, -C2H4-CF3, -CH2Br, -CH2Cl, -CH2I, -CH2-CH2Cl, -CH2-CH2Br, -CH2-CH2I, -C2H4-CH2Cl, -C2H4-CH2Br, -C2H4-CH2I und -CH(CF3)2.The term "C 1 -C 10 -haloalkyl" preferably denotes the following radicals:
-CH 3 , -C 2 H 5 , -C 3 H 7 , -CH (CH 3 ) 2 , -C 4 H 9 , -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -C 2 H 5 , -C (CH 3 ) 3 , -C 5 H 11 , -CH (CH 3 ) -C 3 H 7 , -CH 2 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -CH (CH 3 ) 2 , -C (CH 3 ) 2 -C 2 H 5 , -CH 2 -C (CH 3 ) 3 , -CH (C 2 H 5 ) 2 , -C 2 H 4 -CH ( CH 3 ) 2 , -C 6 H 13 , -C 3 H 6 -CH (CH 3 ) 2 , -C 2 H 4 -CH (CH 3 ) -C 2 H 5 , -CH (CH 3 ) -C 4 H 9 , -CH 2 -CH (CH 3 ) -C 3 H 7 , -CH (CH 3 ) -CH 2 -CH (CH 3 ) 2 , -CH (CH 3 ) -CH (CH 3 ) -C 2 H 5 , -CH 2 -CH (CH 3 ) -CH (CH 3 ) 2 , -CH 2 -C (CH 3 ) 2 -C 2 H 5 , -C (CH 3 ) 2 -C 3 H 7 , - C (CH 3 ) 2 -CH (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) 3 , -CH (CH 3 ) -C (CH 3 ) 3 , -C 7 H 15 , C 8 H 17 , -C 9 H 19 and -C 10 H 21 , wherein one or more hydrogen atoms are replaced by halogen atoms. Preferred are the following radicals: -CH 2 F, -CHF 2 , -CH 2 -CH 2 F, -CH 2 -CHF 2 , -CH 2 -CF 3 , -C 2 H 4 -CH 2 F, -C 2 H 4 -CHF 2 , -C 2 H 4 -CF 3 , -CH 2 Br, -CH 2 Cl, -CH 2 I, -CH 2 -CH 2 Cl, -CH 2 -CH 2 Br, -CH 2 -CH 2 I, -C 2 H 4 -CH 2 Cl, -C 2 H 4 -CH 2 Br, -C 2 H 4 -CH 2 I and -CH (CF 3 ) 2 .
Der Begriff ”C3-C10-Cycloalkyl” bezeichnet vorzugsweise die folgenden Reste: The term "C 3 -C 10 -cycloalkyl" preferably denotes the following radicals:
Der Begriff ”C1-C6-Heterocyclyl” bezeichnet vorzugsweise die folgenden Reste: The term "C 1 -C 6 -heterocyclyl" preferably denotes the following radicals:
Der Begriff ”C2-C10-Alkenyl” bezeichnet vorzugsweise die folgenden Reste:
-CH=CH2, -CH=CH-Ph, -CH2-CH=CH2, -C(CH3)=CH2, -CH=CH-CH3, -C2H4-CH=CH2, -CH2-CH=CH-CH3, -CH=CH-C2H5, -CH2-C(CH3)=CH2, -CH(CH3)-CH=CH, -CH=C(CH3)2, -C(CH3)=CH-CH3, -CH=CH-CH=CH2, -C3H6-CH=CH2, -C2H4-CH=CH-CH3, -CH2-CH=CH-C2H5, -CH=CH-C3H7, -CH2-CH=CH-CH=CH2, -CH=CH-CH=CH-CH3, -CH=CH-CH2-CH=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C2H4-C(CH3)=CH2, -CH2-CH(CH3)-CH=CH2, -CH(CH3)-CH2-CH=CH2, -CH2CH=C(CH3)2, -CH2-C(CH3)=CH-CH3, -CH(CH3)-CH=CH-CH3, -CH=CH-CH(CH3)2, -CH=C(CH3)-C2H5, -C(CH3)=CH-C2H5, -C(CH3)=C(CH3)2, -C(CH3)2-CH=CH2, -CH(CH3)-C(CH3)=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C4H8-CH=CH2, -C3H6-CH=CH-CH3, -C2H4-CH=CH-C2H5, -CH2-CH=CH-C3H7, -CH=CH-C4H9, -C3H6-C(CH3)=CH2, -C2H4-CH(CH3)-CH=CH2, -CH2-CH(CH3)-CH2-CH=CH2, -CH(CH3)-C2H4-CH=CH2, -C2H4-CH=C(CH3)2, -C2H4-C(CH3)=CH-CH3, -CH2-CH(CH3)-CH=CH-CH3, -CH(CH3)-CH2-CH=CH-CH3, -CH2-CH=CH-CH(CH3)2, -CH2-CH=C(CH3)-C2H5, -CH2-C(CH3)=CH-C2H5, -CH(CH3)-CH=CH-C2H5, -CH=CH-CH2-CH(CH3)2, -CH=CH-CH(CH3)-C2H5, -CH=C(CH3)-C3H7, -C(CH3)=CH-C3H7, -CH2-CH(CH3)-C(CH3)=CH2, -CH(CH3)-CH2-C(CH3)=CH2, -CH(CH3)-CH(CH3)-CH=CH2, -CH2-C(CH3)2-CH=CH2, -C(CH3)2-CH2-CH=CH2, -CH2-C(CH3)=C(CH3)2, -CH(CH3)-CH=C(CH3)2, -C(CH3)2-CH=CH-CH3, -CH(CH3)-C(CH3)=CH-CH3, -CH=C(CH3)-CH(CH3)2, -C(CH3)=CH-CH(CH3)2, -C(CH3)=C(CH3)-C2H5, -CH=CH-C(CH3)3, -C(CH3)2-C(CH3)=CH2, -CH(C2H5)-C(CH3)=CH2, -C(CH3)(C2H5)-CH=CH2, -CH(CH3)-C(C2H5)=CH2, -CH2-C(C3H7)=CH2, -CH2-C(C2H5)=CH-CH3, -CH(C2H5)-CH=CH-CH3, -C(C4H9)=CH2, -C(C3H7)=CH-CH3, -C(C2H5)=CH-C2H5, -C(C2H5)=C(CH3)2, -C[C(CH3)3]=CH2, -C[CH(CH3)(C2H5)]=CH2, -C[CH2-CH(CH3)2]=CH2, -C2H4-CH=CH-CH=CH2, -CH2-CH=CH-CH2-CH=CH2, -CH=CH-C2H4-CH=CH2, -CH2-CH=CH-CH=CH-CH3, -CH=CH-CH2-CH=CH-CH3, -CH=CH-CH=CH-C2H5, -CH2-CH=CH-C(CH3)=CH2, -CH2-CH=C(CH3)-CH=CH2, -CH2-C(CH3)=CH-CH=CH2, -CH(CH3)-CH=CH-CH=CH2, -CH=CH-CH2-C(CH3)=CH2, -CH=CH-CH(CH3)-CH=CH2, -CH=C(CH3)-CH2-CH=CH2, -C(CH3)=CH-CH2-CH=CH2, -CH=CH-CH=C(CH3)2, -CH=CH-C(CH3)=CH-CH3, -CH=C(CH3)-CH=CH-CH3, -C(CH3)=CH-CH=CH-CH3, -CH=C(CH3)-C(CH3)=CH2, -C(CH3)=CH-C(CH3)=CH2, -C(CH3)=C(CH3)-CH=CH2 und -CH=CH-CH=CH-CH=CH2. Bevorzugt sind davon die folgenden Reste: -CH=CH2, -CH2-CH=CH2, -C(CH3)=CH2, -CH=CH-CH3, -C2H4-CH=CH2 und -CH2-CH-CH-CH3. Insbesondere bevorzugt sind -CH=CH2, -CH2-CH=CH2 und -CH=CH-CH3.The term "C 2 -C 10 alkenyl" preferably denotes the following radicals:
-CH = CH 2 , -CH = CH-Ph, -CH 2 -CH = CH 2 , -C (CH 3 ) = CH 2 , -CH = CH-CH 3 , -C 2 H 4 -CH = CH 2 , -CH 2 -CH = CH-CH 3 , -CH = CH-C 2 H 5 , -CH 2 -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH = CH, -CH = C (CH 3 ) 2 , -C (CH 3 ) = CH-CH 3 , -CH = CH-CH = CH 2 , -C 3 H 6 -CH = CH 2 , -C 2 H 4 -CH = CH-CH 3 , -CH 2 -CH = CH-C 2 H 5 , -CH = CH-C 3 H 7 , -CH 2 -CH = CH-CH = CH 2 , -CH = CH-CH = CH-CH 3 , -CH = CH-CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 2 H 4 -C (CH 3 ) = CH 2 , -CH 2 -CH (CH 3 ) -CH = CH 2 , -CH (CH 3 ) -CH 2 -CH = CH 2 , -CH 2 CH = C (CH 3 ) 2 , -CH 2 -C (CH 3 ) = CH- CH 3 , -CH (CH 3 ) -CH = CH-CH 3 , -CH = CH-CH (CH 3 ) 2 , -CH = C (CH 3 ) -C 2 H 5 , -C (CH 3 ) = CH-C 2 H 5 , -C (CH 3 ) = C (CH 3 ) 2 , -C (CH 3 ) 2 -CH = CH 2 , -CH (CH 3 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 4 H 8 -CH = CH 2 , -C 3 H 6 -CH = CH-CH 3 , -C 2 H 4 -CH = CH-C 2 H 5 , -CH 2 -CH = CH-C 3 H 7 , -CH = CH-C 4 H 9 , -C 3 H 6 -C (CH 3 ) = CH 2 , -C 2 H 4 -CH (CH 3 ) -CH = CH 2 , -CH 2 -CH (CH 3 ) -CH 2 -CH = CH 2 , -CH (CH 3 ) -C 2 H 4 -CH = CH 2 , -C 2 H 4 -CH = C (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) = CH- CH 3 , -CH 2 -CH (CH 3 ) -CH = CH-CH 3 , -CH (CH 3 ) -CH 2 -CH = CH-CH 3 , -CH 2 -CH = CH-CH (CH 3 ) 2 , -CH 2 -CH = C (CH 3 ) -C 2 H 5 , -CH 2 -C (CH 3 ) = CH-C 2 H 5 , -CH (CH 3 ) -CH = CH-C 2 H 5 , -CH = CH-CH 2 -CH (CH 3 ) 2 , -CH = CH-CH (CH 3 ) -C 2 H 5 , -CH = C (CH 3 ) -C 3 H 7 , -C ( CH 3 ) = CH-C 3 H 7 , -CH 2 -CH (CH 3 ) -C (CH 3 ) CHCH 2 , -CH (CH 3 ) -CH 2 -C (CH 3 ) CHCH 2 , - CH (CH 3 ) -CH (CH 3 ) -CH = CH 2 , -CH 2 -C (CH 3 ) 2 -CH = CH 2 , -C (CH 3 ) 2 -CH 2 -CH = CH 2 , - CH 2 -C (CH 3 ) = C (CH 3 ) 2 , -CH (CH 3 ) -CH = C (CH 3 ) 2 , -C (CH 3 ) 2 -CH = CH-CH 3 , -CH (CH 3 ) -C (CH 3 ) = CH-CH 3 , -CH = C (CH 3 ) -CH (CH 3 ) 2 , -C (CH 3 ) = CH-CH (CH 3 ) 2 , -C (CH 3 ) = C (CH 3 ) -C 2 H 5 , -CH = CH-C (CH 3 ) 3 , -C (CH 3 ) 2 -C (CH 3 ) = CH 2 , -CH (C 2 H 5 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) (C 2 H 5 ) -CH = CH 2 , -CH (CH 3 ) -C (C 2 H 5 ) = CH 2 , -CH 2 -C (C 3 H 7 ) = CH 2 , -CH 2 -C (C 2 H 5 ) = CH-CH 3 , -CH (C 2 H 5 ) -CH = CH-CH 3 , -C (C 4 H 9 ) = CH 2 , -C (C 3 H 7 ) = CH-CH 3 , -C (C 2 H 5 ) = CH-C 2 H 5 , -C (C 2 H 5 ) = C (CH 3 ) 2 , -C [C (CH 3 ) 3 ] = CH 2 , -C [CH (CH 3 ) (C 2 H 5 )] = CH 2 , -C [CH 2 -CH (CH 3 ) 2 ] = CH 2 , -C 2 H 4 -CH = CH-CH = CH 2 , -CH 2 -CH = CH-CH 2 -CH = CH 2 , -CH = CH-C 2 H 4 -CH = CH 2 , -CH 2 -CH = CH-CH = CH-CH 3 , -CH = CH-CH 2 -CH = CH-CH 3 , -CH = CH-CH = CH-C 2 H 5 , -CH 2 -CH = CH-C (CH 3 ) = CH 2 , -CH 2 -CH = C (CH 3 ) -CH = CH 2 , CH 2 -C (CH 3 ) = CH-CH = CH 2 , -CH (CH 3 ) -CH = CH-CH = CH 2 , -CH = CH-CH 2 -C (CH 3 ) = CH 2 , CH = CH-CH (CH 3 ) -CH = CH 2 , -CH = C (CH 3 ) -CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH 2 -CH = CH 2 , CH = CH-CH = C (CH 3) 2, -CH = CH-C (CH 3) = CH-CH 3, -CH = C (CH 3) -CH = CH-CH 3 , -C (CH 3 ) = CH-CH = CH-CH 3 , -CH = C (CH 3 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) = CH-C (CH 3 ) = CH 2 , -C (CH 3 ) = C (CH 3 ) -CH = CH 2 and -CH = CH-CH = CH-CH = CH 2 . Preferred are the following radicals: -CH = CH 2 , -CH 2 -CH = CH 2 , -C (CH 3 ) = CH 2 , -CH = CH-CH 3 , -C 2 H 4 -CH = CH 2 and -CH 2 -CH-CH-CH 3 . Particularly preferred are -CH = CH 2 , -CH 2 -CH = CH 2 and -CH = CH-CH 3 .
Der Begriff ”C5-C10-Cycloalkenyl” bezeichnet vorzugsweise die folgenden Reste: The term "C 5 -C 10 cycloalkenyl" preferably denotes the following radicals:
Der Begriff ”C2-C10-Fluoralkenyl” bezeichnet vorzugsweise die folgenden Reste:
-CH=CH2, -CH=CH-Ph, -CH2-CH=CH2, -C(CH3)=CH2, -CH=CH-CH3, -C2H4-CH=CH2, -CH2-CH=CH-CH3, -CH=CH-C2H5, -CH2-C(CH3)=CH2, -CH(CH3)-CH=CH, -CH=C(CH3)2, -C(CH3)=CH-CH3, -CH=CH-CH=CH2, -C3H6-CH=CH2, -C2H4-CH=CH-CH3, -CH2-CH=CH-C2H5, -CH=CH-C3H7, -CH2-CH=CH-CH=CH2, -CH=CH-CH-CH-CH3, -CH=CH-CH2-CH=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C2H4-C(CH3)=CH2, -CH2-CH(CH3)-CH=CH2, -CH(CH3)-CH2-CH=CH2, -CH2-CH=C(CH3)2, -CH2-C(CH3)=CH-CH3, -CH(CH3)-CH=CH-CH3, -CH=CH-CH(CH3)2, -CH=C(CH3)-C2H5, -C(CH3)=CH-C2H5, -C(CH3)=C(CH3)2, -C(CH3)2-CH=CH2, -CH(CH3)-C(CH3)=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C4H8-CH=CH2, -C3H6-CH=CH-CH3, -C2H4-CH=CH-C2H5, -CH2-CH=CH-C3H7, -CH=CH-C4H9, -C3H6-C(CH3)=CH2, -C2H4-CH(CH3)-CH=CH2, -CH2-CH(CH3)-CH2-CH=CH2, -CH(CH3)-C2H4-CH=CH2, -C2H4-CH=C(CH3)2, -C2H4-C(CH3)=CH-CH3, -CH2-CH(CH3)-CH=CH-CH3, -CH(CH3)-CH2-CH=CH-CH3, -CH2-CH=CH-CH(CH3)2, -CH2-CH=C(CH3)-C2H5, -CH2-C(CH3)=CH-C2H5, -CH(CH3)-CH=CH-C2H5, -CH=CH-CH2-CH(CH3)2, -CH=CH-CH(CH3)-C2H5, -CH=C(CH3)-C3H7, -C(CH3)=CH-C3H7, -CH2-CH(CH3)-C(CH3)=CH2, -CH(CH3)-CH2-C(CH3)=CH2, -CH(CH3)-CH(CH3)-CH=CH2, -CH2-C(CH3)2-CH=CH2, -C(CH3)2-CH2-CH=CH2, -CH2-C(CH3)=C(CH3)2, -CH(CH3)-CH=C(CH3)2, -C(CH3)2-CH=CH-CH3, -CH(CH3)-C(CH3)=CH-CH3, -CH=C(CH3)-CH(CH3)2, -C(CH3)=CH-CH(CH3)2, -C(CH3)=C(CH3)-C2H5, -CH=CH-C(CH3)3, -C(CH3)2-C(CH3)=CH2, -CH(C2H5)-C(CH3)=CH2, -C(CH3)(C2H5)-CH=CH2, -CH(CH3)-C(C2H5)=CH2, -CH2-C(C3H7)=CH2, -CH2-C(C2H5)=CH-CH3, -CH(C2H5)-CH=CH-CH3, -C(C4H9)=CH2, -C(C3H7)=CH-CH3, -C(C2H5)=CH-C2H5, -C(C2H5)=C(CH3)2, -C[C(CH3)3]=CH2, -C[CH(CH3)(C2H5)]=CH2, -C[CH2-CH(CH3)2]=CH2, -C2H4-CH=CH-CH=CH2, -CH2-CH=CH-CH2-CH=CH2, -CH=CH-C2H4-CH=CH2, -CH2-CH=CH-CH=CH-CH3, -CH=CH-CH2-CH=CH-CH3, -CH=CH-CH=CH-C2H5, -CH2-CH=CH-C(CH3)=CH2, -CH2-CH=C(CH3)-CH=CH2, -CH2-C(CH3)=CH-CH=CH2, -CH(CH3)-CH=CH-CH=CH2, -CH=CH-CH2-C(CH3)=CH2, -CH=CH-CH(CH3)-CH=CH2, -CH=C(CH3)-CH2-CH=CH2, -C(CH3)=CH-CH2-CH=CH2, -CH=CH-CH=C(CH3)2, -CH=CH-C(CH3)=CH-CH3, -CH=C(CH3)-CH=CH-CH3, -C(CH3)=CH-CH=CH-CH3, -CH=C(CH3)-C(CH3)=CH2, -C(CH3)=CH-C(CH3)=CH2, -C(CH3)=C(CH3)-CH=CH2 und -CH=CH-CH=CH-CH=CH2, worin ein oder mehrere Wasserstoffatome durch Fluoratome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -CF=CH2, -CH=CHF, -CH=CF2, -CF2-CH=CH2, -CH2-CF=CH2, -CH2-CH=CHF, -CH2-CH=CF2, -CF=CH-CH3, -CH=CF-CH3, -CF=CF-CH3, -CH=CH-CF3, -CF2-CH=CH-CH3, -CH2-CF=CH-CH3, -CH2-CH=CF-CH3, -CH2-CF=CF-CH3 und -CH2-CH=CH-CF3.The term "C 2 -C 10 fluoroalkenyl" preferably denotes the following radicals:
- CH = CH 2 , -CH = CH-Ph, -CH 2 -CH = CH 2 , -C (CH 3 ) = CH 2 , -CH = CH-CH 3 , -C 2 H 4 -CH = CH 2 , -CH 2 -CH = CH-CH 3 , -CH = CH-C 2 H 5 , -CH 2 -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH = CH, -CH = C ( CH 3 ) 2 , -C (CH 3 ) = CH-CH 3 , -CH = CH-CH = CH 2 , -C 3 H 6 -CH = CH 2 , -C 2 H 4 -CH = CH-CH 3 , -CH 2 -CH = CH-C 2 H 5 , -CH = CH-C 3 H 7 , -CH 2 -CH = CH-CH = CH 2 , -CH = CH-CH-CH-CH 3 , CH = CH-CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 2 H 4 -C (CH 3 ) = CH 2 , -CH 2 -CH (CH 3 ) -CH = CH 2 , -CH (CH 3 ) -CH 2 -CH = CH 2 , - CH 2 -CH = C (CH 3 ) 2 , -CH 2 -C (CH 3 ) = CH-CH 3 , -CH (CH 3 ) -CH = CH-CH 3 , -CH = CH-CH (CH 3 ) 2 , -CH = C (CH 3 ) -C 2 H 5 , -C (CH 3 ) = CH-C 2 H 5 , -C (CH 3 ) = C (CH 3 ) 2 , -C (CH 3 ) 2 -CH = CH 2 , -CH (CH 3 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 4 H 8 -CH = CH 2 , -C 3 H 6 -CH = CH-CH 3 , -C 2 H 4 -CH = CH- C 2 H 5 , -CH 2 -CH = CH-C 3 H 7 , -CH = CH-C 4 H 9 , -C 3 H 6 -C (CH 3 ) = CH 2 , -C 2 H 4 -CH (CH 3 ) -CH = CH 2 , -CH 2 -CH (CH 3 ) -CH 2 -CH = CH 2 , - CH (CH 3 ) -C 2 H 4 -CH = CH 2 , -C 2 H 4 -CH = C (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) = CH-CH 3 , -CH 2 -CH (CH 3 ) -CH = CH-CH 3 , -CH (CH 3 ) -CH 2 -CH = CH-CH 3 , -CH 2 -CH = CH-CH (CH 3 ) 2 , -CH 2 -CH = C (CH 3 ) -C 2 H 5 , -CH 2 -C (CH 3 ) = CH-C 2 H 5 , -CH (CH 3 ) -CH = CH-C 2 H 5 , -CH = CH-CH 2 -CH (CH 3 ) 2 , -CH = CH-CH (CH 3 ) -C 2 H 5 , -CH = C (CH 3 ) -C 3 H 7 , -C (CH 3 ) = CH -C 3 H 7 , -CH 2 -CH (CH 3 ) -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH 2 -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH (CH 3 ) -CH = CH 2 , -CH 2 -C (CH 3 ) 2 -CH = CH 2 , -C (CH 3 ) 2 -CH 2 -CH = CH 2 , -CH 2 -C ( CH 3) = C (CH 3) 2, -CH (CH 3) -CH = C (CH 3) 2, -C (CH 3) 2 -CH = CH-CH 3, -CH (CH 3) -C (CH 3 ) = CH-CH 3 , -CH = C (CH 3 ) -CH (CH 3 ) 2 , -C (CH 3 ) = CH-CH (CH 3 ) 2 , -C (CH 3 ) = C (CH 3 ) -C 2 H 5 , -CH = CH-C (CH 3 ) 3 , -C (CH 3 ) 2 -C (CH 3 ) = CH 2 , -CH (C 2 H 5 ) -C ( CH 3 ) = CH 2 , -C (CH 3 ) (C 2 H 5 ) -CH = CH 2 , -CH (CH 3 ) -C (C 2 H 5 ) = CH 2 , -CH 2 -C (C 3 H 7 ) = CH 2 , -CH 2 -C (C 2 H 5 ) = CH-CH 3 , -CH (C 2 H 5 ) -CH = CH-CH 3 , -C (C 4 H 9 ) CH 2 , -C (C 3 H 7 ) = CH-CH 3 , -C (C 2 H 5 ) = CH-C 2 H 5 , -C (C 2 H 5 ) = C (CH 3 ) 2 , -C [C (CH 3 ) 3 ] = CH 2 , -C [CH (CH 3 ) (C 2 H 5 )] = CH 2 , -C [CH 2 -CH (CH 3 ) 2 ] = CH 2 , -C 2 H 4 -CH = CH-CH = CH 2 , -CH 2 -CH = CH-CH 2 -CH = CH 2 , -CH = CH-C 2 H 4 -CH = CH 2 , -CH 2 -CH = CH-CH = CH-CH 3 , -CH = CH-CH 2 -CH = CH-CH 3 , -CH = CH-CH = CH-C 2 H 5 , -CH 2 -CH = CH-C (CH 3 ) = CH 2 , -CH 2 -CH = C (CH 3 ) -CH = CH 2 , -CH 2 -C (CH 3 ) = CH-CH = CH 2 , -CH (CH 3 ) -CH = CH-CH = CH 2 , -CH = CH-CH 2 -C (CH 3 ) = CH 2 , -CH = CH-CH (CH 3 ) -CH = CH 2 , -CH = C (CH 3 ) -CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH 2 -CH = CH 2 , -CH = CH-CH = C (CH 3 ) 2 , -CH = CH-C (CH 3) = CH-CH 3, -CH = C (CH 3) -CH = CH-CH 3, -C (CH 3) = CH-CH = CH-CH 3, -CH = C (CH 3) -C (CH 3) = CH 2, -C (CH 3) = CH-C (CH 3) = CH 2, -C (CH 3) = C (CH 3) -CH = CH 2 and -CH = CH-CH = CH-CH = CH 2 , wherein one or more hydrogen atoms are replaced by fluorine atoms. Preferred are the following radicals: -CF = CH 2 , -CH = CHF, -CH = CF 2 , -CF 2 -CH = CH 2 , -CH 2 -CF = CH 2 , -CH 2 -CH = CHF, -CH 2 -CH = CF 2 , -CF = CH-CH 3 , -CH = CF-CH 3 , -CF = CF-CH 3 , -CH = CH-CF 3 , -CF 2 -CH = CH-CH 3 , -CH 2 -CF = CH-CH 3 , -CH 2 -CH = CF-CH 3 , -CH 2 -CF = CF-CH 3 and -CH 2 -CH = CH-CF 3 .
Der Begriff ”C2-C10-Perfluoralkenyl” bezeichnet vorzugsweise die folgenden Reste:
-CH=CH2, -CH=CH-Ph, -CH2-CH=CH2, -C(CH3)=CH2, -CH=CH-CH3, -C2H4-CH=CH2, -CH2=CH=CH-CH3, -CH=CH-C2H5, -CH2-C(CH3)=CH2, -CH(CH3)-CH=CH, -CH=C(CH3)2, -C(CH3)=CH-CH3, -CH=CH-CH=CH2, -C3H6-CH=CH2, -C2H4-CH=CH-CH3, -CH2-CH=CH-C2H5, -CH=CH-C3H7, -CH2-CH=CH-CH=CH2, -CH=CH-CH=CH-CH3, -CH=CH-CH2-CH=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C2H4-C(CH3)=CH2, -CH2-CH(CH3)-CH=CH2, -CH(CH3)-CH2-CH=CH2, -CH2-CH=C(CH3)2, -CH2-C(CH3)=CH-CH3, -CH(CH3)-CH=CH-CH3, -CH=CH-CH(CH3)2, -CH=C(CH3)-C2H5, -C(CH3)=CH-C2H5, -C(CH3)=C(CH3)2, -C(CH3)2-CH=CH2, -CH(CH3)-C(CH3)=CH2, -C(CH3)=CH-CH=CH2, -CH=C(CH3)-CH=CH2, -CH=CH-C(CH3)=CH2, -C4H8-CH=CH2, -C3H6-CH=CH-CH3, -C2H4-CH=CH-C2H5, -CH2-CH=CH-C3H7, -CH=CH-C4H9, -C3H6-C(CH3)=CH2, -C2H4-CH(CH3)-CH=CH2, -CH2-CH(CH3)-CH2-CH=CH2, -CH(CH3)-C2H4-CH-CH2, -C2H4-CH=C(CH3)2, -C2H4-C(CH3)=CH-CH3, -CH2-CH(CH3)-CH=CH-CH3, -CH(CH3)-CH2-CH=CH-CH3, -CH2-CH=CH-CH(CH3)2, -CH2-CH=C(CH3)-C2H5, -CH2-C(CH3)=CH-C2H5, -CH(CH3)-CH=CH-C2H5, -CH=CH-CH2=CH(CH3)2, -CH=CH-CH(CH3)-C2H5, -CH=C(CH3)-C3H7, -C(CH3)=CH-C3H7, -CH2-CH(CH3)-C(CH3)=CH2, -CH(CH3)-CH2-C(CH3)=CH2, -CH(CH3)-CH(CH3)-CH=CH2, -CH2-C(CH3)2-CH=CH2, -C(CH3)2-CH2-CH=CH2, -CH2-C(CH3)=C(CH3)2, -CH(CH3)-CH=C(CH3)2, -C(CH3)2-CH=CH-CH3, -CH(CH3)-C(CH3)=CH-CH3, -CH=C(CH3)-CH(CH3)2, -C(CH3)=CH-CH(CH3)2, -C(CH3)=C(CH3)-C2H5, -CH=CH-C(CH3)3, -C(CH3)2-C(CH3)=CH2, -CH(C2H5)-C(CH3)=CH2, -C(CH3)(C2H5)-CH=CH2, -CH(CH3)-C(C2H5)=CH2, -CH2=C(C3H7)=CH2, -CH2-C(C2H5)=CH-CH3, -CH(C2H5)-CH=CH-CH3, -C(C4H9)=CH2, -C(C3H7)=CH-CH3, -C(C2H5)=CH-C2H5, -C(C2H5)=C(CH3)2, -C[C(CH3)3]=CH2, -C[CH(CH3)(C2H5)]=CH2, -C[CH2-CH(CH3)2]=CH2, -C2H4-CH=CH-CH=CH2, -CH2-CH=CH-CH2-CH=CH2, -CH=CH-C2H4-CH=CH2, -CH2-CH=CH-CH=CH-CH3, -CH=CH-CH2-CH=CH-CH3, -CH=CH-CH=CH-C2H5, -CH2-CH=CH-C(CH3)=CH2, -CH2-CH=C(CH3)-CH=CH2, -CH2=C(CH3)=CH-CH=CH2, -CH(CH3)-CH=CH-CH=CH2, -CH=CH-CH2-C(CH3)=CH2, -CH=CH-CH(CH3)-CH=CH2, -CH=C(CH3)-CH2-CH=CH2, -C(CH3)=CH-CH2-CH=CH2, -CH=CH-CH=C(CH3)2, -CH=CH-C(CH3)=CH-CH3, -CH=C(CH3)-CH=CH-CH3, -C(CH3)=CH-CH=CH-CH3, -CH=C(CH3)-C(CH3)=CH2, -C(CH3)=CH-C(CH3)=CH2, -C(CH3)=C(CH3)-CH=CH2 und -CH=CH-CH=CH-CH=CH2, worin sämtliche Wasserstoffatome durch Fluoratome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -CF=CF2, -CF2-CF=CF2, -C(CF3)=CF2, -CF=CF-CF3, -C2F4-CF=CF2 und -CF2-CF=CF-CF3. Insbesondere bevorzugt sind -CF=CF2, -CF2-CF=CF2 und -CF=CF-CF3.The term "C 2 -C 10 perfluoroalkenyl" preferably denotes the following radicals:
-CH = CH 2 , -CH = CH-Ph, -CH 2 -CH = CH 2 , -C (CH 3 ) = CH 2 , -CH = CH-CH 3 , -C 2 H 4 -CH = CH 2 , -CH 2 = CH = CH-CH 3 , -CH = CH-C 2 H 5 , -CH 2 -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH = CH, -CH = C (CH 3 ) 2 , -C (CH 3 ) = CH-CH 3 , -CH = CH-CH = CH 2 , -C 3 H 6 -CH = CH 2 , -C 2 H 4 -CH = CH-CH 3 , -CH 2 -CH = CH-C 2 H 5 , -CH = CH-C 3 H 7 , -CH 2 -CH = CH-CH = CH 2 , -CH = CH-CH = CH-CH 3 , -CH = CH-CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 2 H 4 -C (CH 3 ) = CH 2 , -CH 2 -CH (CH 3 ) -CH = CH 2 , -CH (CH 3 ) -CH 2 -CH = CH 2 , -CH 2 -CH = C (CH 3 ) 2 , -CH 2 -C (CH 3 ) = CH-CH 3 , -CH (CH 3 ) -CH = CH-CH 3 , -CH = CH-CH (CH 3 ) 2 , -CH = C (CH 3 ) -C 2 H 5 , -C (CH 3 ) = CH-C 2 H 5 , -C (CH 3 ) = C (CH 3 ) 2 , -C (CH 3 ) 2 -CH = CH 2 , -CH (CH 3 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) = CH-CH = CH 2 , -CH = C (CH 3 ) -CH = CH 2 , -CH = CH-C (CH 3 ) = CH 2 , -C 4 H 8 -CH = CH 2 , -C 3 H 6 -CH = CH-CH 3 , -C 2 H 4 -CH = CH -C 2 H 5 , -CH 2 -CH = CH-C 3 H 7 , -CH = CH-C 4 H 9 , -C 3 H 6 -C (CH 3 ) = CH 2 , -C 2 H 4 - CH (CH 3 ) -CH = CH 2 , -CH 2 -CH (CH 3 ) -CH 2 -CH = CH 2 , -CH (CH 3 ) -C 2 H 4 -CH-CH 2 , -C 2 H 4 -CH = C (CH 3 ) 2 , -C 2 H 4 -C (CH 3 ) = CH-CH 3 , - CH 2 -CH (CH 3 ) -CH = CH-CH 3 , -CH (CH 3 ) -CH 2 -CH = CH-CH 3 , -CH 2 -CH = CH-CH (CH 3 ) 2 , -CH 2 -CH = C (CH 3 ) -C 2 H 5 , -CH 2 -C (CH 3 ) = CH-C 2 H 5 , -CH (CH 3 ) -CH = CH-C 2 H 5 , -CH = CH-CH 2 = CH (CH 3 ) 2 , -CH = CH-CH (CH 3 ) -C 2 H 5 , -CH = C (CH 3 ) -C 3 H 7 , -C (CH 3 ) = CH-C 3 H 7 , -CH 2 -CH (CH 3 ) -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH 2 -C (CH 3 ) = CH 2 , -CH (CH 3 ) -CH (CH 3 ) -CH = CH 2 , -CH 2 -C (CH 3 ) 2 -CH = CH 2 , -C (CH 3 ) 2 -CH 2 -CH = CH 2 , -CH 2 -C (CH 3 ) = C (CH 3 ) 2 , -CH (CH 3 ) -CH = C (CH 3 ) 2 , -C (CH 3 ) 2 -CH = CH-CH 3 , -CH (CH 3 ) - C (CH 3) = CH-CH 3, -CH = C (CH 3) -CH (CH 3) 2, -C (CH 3) = CH-CH (CH 3) 2, -C (CH 3) = C (CH 3 ) -C 2 H 5 , -CH = CH-C (CH 3 ) 3 , -C (CH 3 ) 2 -C (CH 3 ) = CH 2 , -CH (C 2 H 5 ) -C (CH 3 ) = CH 2 , -C (CH 3 ) (C 2 H 5 ) -CH = CH 2 , -CH (CH 3 ) -C (C 2 H 5 ) = CH 2 , -CH 2 = C ( C 3 H 7 ) = CH 2 , -CH 2 -C (C 2 H 5 ) = CH-CH 3 , -CH (C 2 H 5 ) -CH = CH-CH 3 , -C (C 4 H 9 ) = CH 2 , -C (C 3 H 7 ) = CH-CH 3 , -C (C 2 H 5 ) = CH-C 2 H 5 , -C ( C 2 H 5 ) = C (CH 3 ) 2 , -C [C (CH 3 ) 3 ] = CH 2 , -C [CH (CH 3 ) (C 2 H 5 )] = CH 2 , -C [CH 2 -CH (CH 3 ) 2 ] = CH 2 , -C 2 H 4 -CH = CH-CH = CH 2 , -CH 2 -CH = CH-CH 2 -CH = CH 2 , -CH = CH-C 2 H 4 -CH = CH 2 , -CH 2 -CH = CH-CH = CH-CH 3 , -CH = CH-CH 2 -CH = CH-CH 3 , -CH = CH-CH = CH-C 2 H 5 , -CH 2 -CH = CH-C (CH 3 ) = CH 2 , -CH 2 -CH = C (CH 3 ) -CH = CH 2 , -CH 2 = C (CH 3 ) = CH-CH = CH 2 , -CH (CH 3 ) -CH = CH-CH = CH 2 , -CH = CH-CH 2 -C (CH 3 ) = CH 2 , -CH = CH-CH (CH 3 ) -CH = CH 2 , -CH = C (CH 3 ) -CH 2 -CH = CH 2 , -C (CH 3 ) = CH-CH 2 -CH = CH 2 , -CH = CH-CH = C (CH 3 ) 2 , -CH = CH-C (CH 3) = CH-CH 3, -CH = C (CH 3) -CH = CH-CH 3, -C (CH 3) = CH-CH = CH-CH 3, - CH = C (CH 3) -C (CH 3) = CH 2, -C (CH 3) = CH-C (CH 3) = CH 2, -C (CH 3) = C (CH 3) -CH = CH 2 and -CH = CH-CH = CH-CH = CH 2 , in which all hydrogen atoms have been replaced by fluorine atoms. Preferred are the following radicals: -CF = CF 2 , -CF 2 -CF = CF 2 , -C (CF 3 ) = CF 2 , -CF = CF-CF 3 , -C 2 F 4 -CF = CF 2 and -CF 2 -CF = CF-CF 3 . Particularly preferred are -CF = CF 2 , -CF 2 -CF = CF 2 and -CF = CF-CF 3 .
Der Begriff ”C5-C10-Fluorcycloalkenyl” bezeichnet vorzugsweise die folgenden Reste: worin ein oder mehrere Wasserstoffatome durch Fluoratome ersetzt sind.The term "C 5 -C 10 fluorocycloalkenyl" preferably denotes the following radicals: wherein one or more hydrogen atoms are replaced by fluorine atoms.
Der Begriff ”C5-C10-Perfluorcycloalkenyl” bezeichnet vorzugsweise die folgenden Reste: worin sämtliche Wasserstoffatome durch Fluoratome ersetzt sind.The term "C 5 -C 10 perfluorocycloalkenyl" preferably denotes the following radicals: wherein all hydrogen atoms are replaced by fluorine atoms.
Der Begriff ”C2-C10-Alkinyl” bezeichnet vorzugsweise die folgenden Reste:
-C≡CH, -C≡C-CH3, -CH2-C≡CH, -C2H4-C≡CH, -CH2-C≡C-CH3, -C≡C-C2H5, -C3H6-C≡CH, -C2H4-C≡C-CH3, -CH2-C≡C-C2H5, -C≡C-C3H7, -CH(CH3)-C≡CH, -CH2-CH(CH3)-C≡CH, -CH(CH3)-CH2-C≡CH, -CH(CH3)-C≡C-CH3, -C4H8-C≡CH, -C3H6-C≡C-CH3, -C2H4-C≡C-C2H5, -CH2-C≡C-C3H7, -C≡C-C4H9, -C2H4-CH(CH3)-C≡CH, -CH2-CH(CH3)-CH2-C≡CH, -CH(CH3)-C2H4-C≡CH, -CH2-CH(CH3)-C≡C-CH3, -CH(CH3)-CH2-C≡C-CH3, -CH(CH3)-C≡C-C2H5, -CH2-C≡C-CH(CH3)2, -C≡C-CH(CH3)-C2H5, -C≡C-CH2-CH(CH3)2, -C≡C-C(CH3)3, -CH(C2H5)-C≡C-CH3, -C(CH3)2-C≡C-CH3, -CH(C2H5)-CH2-C≡CH, -CH2-CH(C2H5)-C≡CH, -C(CH3)2-CH2-C≡CH, -CH2-C(CH3)2-C≡CH, -CH(CH3)-CH(CH3)-C≡CH, -CH(C3H7)-C≡CH, -C(CH3)(C2H5)-C≡CH, -C≡C-C≡CH, -CH2C≡C-C≡CH, -C≡C-C≡C-CH3, -CH(C≡CH)2, -C2H4-C≡C-C≡CH, -CH2-C≡C-CH2-C≡CH, -C≡C-C2H4-C≡CH, -CH2-C≡C-C≡C-CH3, -C≡C-CH2-C≡C-CH3, -C≡C-C≡C-C2H5, -C≡C-CH(CH3)-C≡CH, -CH(CH3)-C≡C-C≡CH, -CH(C≡CH)-CH2-C≡CH, -C(C≡CH)2-CH3, -CH2-CH(C≡CH)2, -C≡C-cyclo-C3H5 und -CH(C≡CH)-C≡C-CH3. Bevorzugt sind davon die folgenden Reste: -C≡CH und -C≡C-CH3.The term "C 2 -C 10 -alkynyl" preferably denotes the following radicals:
-C≡CH, -C≡C-CH 3 , -CH 2 -C≡CH, -C 2 H 4 -C≡CH, -CH 2 -C≡C-CH 3 , -C≡CC 2 H 5 , -C 3 H 6 -C≡CH, -C 2 H 4 -C≡C-CH 3 , -CH 2 -C≡CC 2 H 5 , -C≡CC 3 H 7 , -CH (CH 3 ) -C ≡CH, -CH 2 -CH (CH 3 ) -C≡CH, -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C≡C-CH 3 , -C 4 H 8 -C≡CH, -C 3 H 6 -C≡C-CH 3 , -C 2 H 4 -C≡CC 2 H 5 , -CH 2 -C≡CC 3 H 7 , -C≡CC 4 H 9 , -C 2 H 4 -CH (CH 3 ) -C≡CH, -CH 2 -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C 2 H 4 -C≡CH, - CH 2 -CH (CH 3 ) -C≡C-CH 3 , -CH (CH 3 ) -CH 2 -C≡C-CH 3 , -CH (CH 3 ) -C≡CC 2 H 5 , -CH 2 -C≡C-CH (CH 3 ) 2 , -C≡C-CH (CH 3 ) -C 2 H 5 , -C≡C-CH 2 -CH (CH 3 ) 2 , -C≡CC (CH 3 ) 3 , -CH (C 2 H 5 ) -C≡C-CH 3 , -C (CH 3 ) 2 -C≡C-CH 3 , -CH (C 2 H 5 ) -CH 2 -C≡CH, -CH 2 -CH (C 2 H 5 ) -C≡CH, -C (CH 3 ) 2 -CH 2 -C≡CH, -CH 2 -C (CH 3 ) 2 -C≡CH, -CH (CH 3 ) -CH (CH 3 ) -C≡CH, -CH (C 3 H 7 ) -C≡CH, -C (CH 3 ) (C 2 H 5 ) -C≡CH, -C≡CC≡CH, -CH 2 C≡CC≡CH, -C≡CC≡C-CH 3 , -CH (C≡CH) 2 , -C 2 H 4 -C≡CC≡CH, -CH 2 -C≡C-CH 2 -C≡CH, -C≡CC 2 H 4 -C≡CH, -CH 2 -C≡CC≡C-CH 3 , -C≡C-CH 2 -C≡C-CH 3 , -C≡CC≡CC 2 H 5 , -C≡C-CH (CH 3 ) -C≡CH, -CH (CH 3 ) -C≡CC≡CH, -CH (C≡CH) -CH 2 -C≡CH, -C (C≡CH) 2 -CH 3 , -CH 2 -CH (C≡CH) 2 , -C≡C-cyclo-C 3 H 5 and -CH (C≡CH) -C≡C-CH 3 . Preferred are the following radicals: -C≡CH and -C≡C-CH 3 .
Der Begriff ”C2-C10-Fluoralkinyl” bezeichnet vorzugsweise die folgenden Reste:
-C≡CH, -C≡C-CH3, -CH2-C≡CH, -C2H4-C≡CH, -CH2-C≡C-CH3, -C≡C-C2H5, -C3H6-C≡CH, -C2H4-C≡C-CH3, -CH2-C≡C-C2H5, -C≡C-C3H7, -CH(CH3)-C≡CH, -CH2-CH(CH3)-C≡CH, -CH(CH3)-CH2-C≡CH, -CH(CH3)-C≡C-CH3, -C4H8-C≡CH, -C3H6-C≡C-CH3, -C2H4-C≡C-C2H5, -CH2-C≡C-C3H7, -C≡C-C4H9, -C2H4-CH(CH3)-C≡CH, -CH2-CH(CH3)-CH2-C≡CH, -CH(CH3)-C2H4-C≡CH, -CH2-CH(CH3)-C≡C-CH3, -CH(CH3)-CH2-C≡C-CH3, -CH(CH3)-C≡C-C2H5, -CH2-C≡C-CH(CH3)2, -C≡C-CH(CH3)-C2H5, -C≡C-CH2-CH(CH3)2, -C≡C-C(CH3)3, -CH(C2H5)-C≡C-CH3, -C(CH3)2-C≡C-CH3, -CH(C2H5)-CH2-C≡CH, -CH2-CH(C2H5)-C≡CH, -C(CH3)2-CH2-C≡CH, -CH2-C(CH3)2-C≡CH, -CH(CH3)-CH(CH3)-C≡CH, -CH(C3H7)-C≡CH, -C(CH3)(C2H5)-C≡CH, -C≡C-C≡CH, -CH2-C≡C-C≡CH, -C≡C-C≡C-CH3, -CH(C≡CH)2, -C2H4-C≡C-C≡CH, -CH2-C≡C-CH2-C≡CH, -C≡C-C2H4-C≡CH, -CH2-C≡C-C≡C-CH3, -C≡C-CH2-C≡C-CH3, -C≡C-C≡C-C2H5, -C≡C-CH(CH3)-C≡CH, -CH(CH3)-C≡C-C≡CH, -CH(C≡CH)-CH2C≡CH, -C(C≡CH)2-CH3, -CH2-CH(C≡CH)2, -C≡C-cyclo-C3H5 und -CH(C≡CH)-C≡C-CH3, worin ein oder mehrere Wasserstoffatome durch Fluoratome ersetzt sind.The term "C 2 -C 10 fluoroalkynyl" preferably denotes the following radicals:
-C≡CH, -C≡C-CH 3 , -CH 2 -C≡CH, -C 2 H 4 -C≡CH, -CH 2 -C≡C-CH 3 , -C≡CC 2 H 5 , -C 3 H 6 -C≡CH, -C 2 H 4 -C≡C-CH 3 , -CH 2 -C≡CC 2 H 5 , -C≡CC 3 H 7 , -CH (CH 3 ) -C ≡CH, -CH 2 -CH (CH 3 ) -C≡CH, -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C≡C-CH 3 , -C 4 H 8 -C≡CH, -C 3 H 6 -C≡C-CH 3 , -C 2 H 4 -C≡CC 2 H 5 , -CH 2 -C≡CC 3 H 7 , -C≡CC 4 H 9 , -C 2 H 4 -CH (CH 3 ) -C≡CH, -CH 2 -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C 2 H 4 -C≡CH, - CH 2 -CH (CH 3 ) -C≡C-CH 3 , -CH (CH 3 ) -CH 2 -C≡C-CH 3 , -CH (CH 3 ) -C≡CC 2 H 5 , -CH 2 -C≡C-CH (CH 3 ) 2 , -C≡C-CH (CH 3 ) -C 2 H 5 , -C≡C-CH 2 -CH (CH 3 ) 2 , -C≡CC (CH 3 ) 3 , -CH (C 2 H 5 ) -C≡C-CH 3 , -C (CH 3 ) 2 -C≡C-CH 3 , -CH (C 2 H 5 ) -CH 2 -C≡CH, -CH 2 -CH (C 2 H 5 ) -C≡CH, -C (CH 3 ) 2 -CH 2 -C≡CH, -CH 2 -C (CH 3 ) 2 -C≡CH, -CH (CH 3 ) -CH (CH 3 ) -C≡CH, -CH (C 3 H 7 ) -C≡CH, -C (CH 3 ) (C 2 H 5 ) -C≡CH, -C≡CC≡CH, -CH 2 -C≡CC≡CH, -C≡CC≡C-CH 3 , -CH (C≡CH) 2 , -C 2 H 4 -C≡CC≡CH, -CH 2 -C≡C-CH 2 -C≡CH , -C≡CC 2 H 4 -C≡CH, -CH 2 -C≡CC≡C-CH 3 , -C≡C-CH 2 -C≡C-CH 3 , -C≡CC≡CC 2 H 5 , -C≡C-CH (CH 3 ) -C≡CH, -CH (CH 3 ) -C≡CC≡CH, -CH (C≡CH) -CH 2 C≡CH, -C (C≡CH) 2 -CH 3 , -CH 2 -CH (C≡CH) 2 , -C≡C-cyclo-C 3 H 5 and -CH (C≡CH) -C≡C-CH 3 , in which one or more hydrogen atoms Fluorine atoms are replaced.
Der Begriff ”C2-C10-Perfluoralkinyl” bezeichnet vorzugsweise die folgenden Reste:
-C≡CH, -C≡C-CH3, -CH2-C≡CH, -C2H4-C≡CH, -CH2-C≡C-CH3, -C≡C-C2H5, -C3H6-C≡CH, -C2H4-C≡C-CH3, -CH2-C≡C-C2H5, -C≡C-C3H7, -CH(CH3)-C≡CH, -CH2-CH(CH3)-C≡CH, -CH(CH3)-CH2-C≡CH, -CH(CH3)-C≡C-CH3, -C4H8-C≡CH, -C3H6-C≡C-CH3, -C2H4-C≡C-C2H5, -CH2-C≡C-C3H7, -C≡C-C4H9, -C2H4-CH(CH3)-C≡CH, -CH2-CH(CH3)-CH2-C≡CH, -CH(CH3)-C2H4-C≡CH, -CH2-CH(CH3)-C≡C-CH3, -CH(CH3)-CH2-C≡C-CH3, -CH(CH3)-C≡C-C2H5, -CH2-C≡C-CH(CH3)2, -C≡C-CH(CH3)-C2H5, -C≡C-CH2-CH(CH3)2, -C≡C-C(CH3)3, -CH(C2H5)-C≡C-CH3, -C(CH3)2-C≡C-CH3, -CH(C2H5)-CH2-C≡CH, -CH2-CH(C2H5)-C≡CH, -C(CH3)2-CH2-C≡CH, -CH2-C(CH3)2-C≡CH, -CH(CH3)-CH(CH3)-C≡CH, -CH(C3H7)-C≡CH, C(CH3)(C2H5)-C≡CH, -C≡C-C≡CH, -CH2-C≡C-C≡CH, -C≡C-C≡C-CH3, -CH(C≡CH)2, -C2H4-C≡C-C≡CH, -CH2-C≡C-CH2-C≡CH, -C≡C-C2H4-C≡CH, -CH2-C≡C-C≡C-CH3, -C≡C-CH2-C≡C-CH3, -C≡C-C≡C-C2H5, -C≡C-CH(CH3)-C≡CH, -CH(CH3)-C≡C-C≡CH, -CH(C≡CH)-CH2-C≡CH, -C(C≡CH)2-CH3, -CH2-CH(C≡CH)2, -C≡C-cyclo-C3H5 und -CH(C≡CH)-C≡C-CH3, worin sämtliche Wasserstoffatome durch Fluoratome ersetzt sind. Bevorzugt sind davon die folgenden Reste: -C≡CF und -C≡C-CF3.The term "C 2 -C 10 perfluoroalkynyl" preferably denotes the following radicals:
-C≡CH, -C≡C-CH 3 , -CH 2 -C≡CH, -C 2 H 4 -C≡CH, -CH 2 -C≡C-CH 3 , -C≡CC 2 H 5 , -C 3 H 6 -C≡CH, -C 2 H 4 -C≡C-CH 3 , -CH 2 -C≡CC 2 H 5 , -C≡CC 3 H 7 , -CH (CH 3 ) -C ≡CH, -CH 2 -CH (CH 3 ) -C≡CH, -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C≡C-CH 3 , -C 4 H 8 -C≡CH, -C 3 H 6 -C≡C-CH 3 , -C 2 H 4 -C≡CC 2 H 5 , -CH 2 -C≡CC 3 H 7 , -C≡CC 4 H 9 , -C 2 H 4 -CH (CH 3 ) -C≡CH, -CH 2 -CH (CH 3 ) -CH 2 -C≡CH, -CH (CH 3 ) -C 2 H 4 -C≡CH, - CH 2 -CH (CH 3 ) -C≡C-CH 3 , -CH (CH 3 ) -CH 2 -C≡C-CH 3 , -CH (CH 3 ) -C≡CC 2 H 5 , -CH 2 -C≡C-CH (CH 3 ) 2 , -C≡C-CH (CH 3 ) -C 2 H 5 , -C≡C-CH 2 -CH (CH 3 ) 2 , -C≡CC (CH 3 ) 3 , -CH (C 2 H 5 ) -C≡C-CH 3 , -C (CH 3 ) 2 -C≡C-CH 3 , -CH (C 2 H 5 ) -CH 2 -C≡CH, -CH 2 -CH (C 2 H 5 ) -C≡CH, -C (CH 3 ) 2 -CH 2 -C≡CH, -CH 2 -C (CH 3 ) 2 -C≡CH, -CH (CH 3 ) -CH (CH 3 ) -C≡CH, -CH (C 3 H 7 ) -C≡CH, C (CH 3 ) (C 2 H 5 ) -C≡CH, -C≡CC≡CH, - CH 2 -C≡CC≡CH, -C≡CC≡C-CH 3 , -CH (C≡CH) 2 , -C 2 H 4 -C≡CC≡CH, -CH 2 -C≡C-CH 2 -C≡CH, -C≡CC 2 H 4 -C≡CH, -CH 2 -C≡CC≡C-CH 3 , -C≡C-CH 2 -C≡C-CH 3 , -C≡CC≡CC 2 H 5 , -C≡C-CH (CH 3 ) -C≡CH, -CH (CH 3 ) -C≡CC≡CH, -CH (C≡CH) -CH 2 -C≡CH, -C (C≡CH) 2 -CH 3 , -CH 2 -CH (C≡CH) 2 , -C≡C-cyclo-C 3 H 5 and -CH (C≡CH) -C≡C-CH 3 , wherein all hydrogen atoms replaced by fluorine atoms are. Of these, the following radicals are preferred: -C≡CF and -C≡C-CF 3 .
Der Begriff ”Aryl” bezeichnet vorzugsweise aromatische Reste mit 6, 10 oder 14 Kohlenstoffatomen und weiter bevorzugt Phenyl und Naphthyl. The term "aryl" preferably denotes aromatic radicals having 6, 10 or 14 carbon atoms and more preferably phenyl and naphthyl.
Der Begriff ”Heteroaryl” bezeichnet vorzugsweise die folgenden Reste: The term "heteroaryl" preferably denotes the following radicals:
Des Weiteren sind die folgenden Verbindungen bevorzugt: Furthermore, the following compounds are preferred:
Die hierin offenbarten Verbindungen 4 der allgemeinen Formel (I) können gemäß folgendem Reaktionsschema 1 hergestellt werden: wobei die aromatische Carbonylkomponente mit einem CH-aziden Benzylderivat umgesetzt wird. Die Reste A bis E, Z und R1, R2 sowie R8 bis R12 haben die hierin beschriebene Bedeutung. In einer bevorzugten Ausführungsform werden die Verbindungen 1 der allgemeinen Formel (I), wobei in der allgemeinen Formel (I) das Molekülfragment Z die folgende Formel bedeutet: nach obigen Reaktionsschema 1 hergestellt, wobei die aromatische Carbonylkomponente mit einem CH-aziden Benzylderivat umgesetzt wird. Die Reste A bis E und R1, R2 sowie R8 bis R12 dieser Verbindungen 2 haben die hierin beschriebene Bedeutung.The compounds 4 of the general formula (I) disclosed herein can be prepared according to the following Reaction Scheme 1: wherein the aromatic carbonyl component is reacted with a CH-acid benzyl derivative. The radicals A to E, Z and R 1 , R 2 and R 8 to R 12 have the meaning described herein. In a preferred embodiment, the
Die experimentelle Wirksamkeit der Verbindungen wird im Folgenden beschrieben. Die erfindungsgemäßen Substanzen binden in vitro an die Liganden-Bindedomäne des PPAR beta/delta-Rezeptors. Dabei zeigen die Substanzen SCH138, SCH149 und SCH172 im TR-FRET-Ligandenbindungstest eine Subtyp-spezifische signifikante Kompetitionseffizienz gegenüber dem fluoreszierenden Liganden Fluormone® Pan-PPAR-Green.The experimental effectiveness of the compounds will be described below. The substances according to the invention bind in vitro to the ligand-binding domain of the PPAR beta / delta receptor. In the drawings, the substances SCH138, SCH149 and SCH172 in the TR-FRET ligand binding assay a subtype-specific significant Kompetitionseffizienz against the fluorescent ligand Fluormone ® pan-PPAR Green.
Ferner induzieren die erfindungsgemäßen Substanzen SCH138, SCH149 und SCH172 in vitro die Interaktion der Liganden-Bindedomäne des PPAR beta/delta-Rezeptors mit einem synthetischen Peptidfragment des bekannten Korepressors SMRT (SMRT-ID2). Die Expression des für das Angiopoietin-ähnliche Protein 4 (ANGPTL4) kodierenden Gens ANGPTL4 wird durch PPAR beta/delta oder andere Stimuli induziert. ANGPTL4 ist vermutlich an Tumorwachstum, Tumorprogression und Tumormetastasierung beteiligt. Mit Hilfe der erfindungsgemäßen Substanzen SCH138, SCH149 oder SCH172 wird die basale Expression von ANGPTL4 in murinen C2C12 Myoblasten und Peritaneal-Makrophagen signifikant um mindestens 50% gesenkt. Die Werte der mittleren inhibitorischen Konzentration (IC50) der erfindungsgemäßen Substanzen betragen dabei zwischen 10 bis 75 nM. Die Induktion der ANGPTL4-Expression durch den dem Fachmann bekannten Stimulus Tumor Growth Factor-beta (TGF-beta1, TGF-beta2) in humanen Fibroblasten kann ferner durch die erfindungsgemäßen Substanzen signifikant herabgesetzt werden. Werden Zellen der Brustkrebs-Zelllinie MDA-MB-231-luc21H4 mit den erfindungsgemäßen Substanzen behandelt, führt dies ebenfalls zu einer drastischen Reduktion der ANGPTL4-Expression. Diese Eigenschaften klassifizieren die erfindungsgemäßen Substanzen SCH138, SCH149 und SCH172 als Inhibitor und insbesondere als inverse Agonisten des PPAR beta/delta-Rezeptors.Furthermore, the induce Inventive substances SCH138, SCH149 and SCH172 in vitro the interaction of the ligand-binding domain of the PPAR beta / delta receptor with a synthetic peptide fragment of the known corepressor SMRT (SMRT-ID2). The expression of the angiopoietin-like protein 4 (ANGPTL4) encoding gene ANGPTL4 is induced by PPAR beta / delta or other stimuli. ANGPTL4 is thought to be involved in tumor growth, tumor progression and tumor metastasis. With the aid of the substances SCH138, SCH149 or SCH172 according to the invention, the basal expression of ANGPTL4 in murine C2C12 myoblasts and peritaneal macrophages is significantly reduced by at least 50%. The values of the mean inhibitory concentration (IC 50 ) of the substances according to the invention are between 10 and 75 nM. The induction of ANGPTL4 expression by the tumor growth factor-beta stimulus (TGF-beta1, TGF-beta2) known to those skilled in the art in human fibroblasts can furthermore be significantly reduced by the substances according to the invention. If cells of the breast cancer cell line MDA-MB-231-luc21H4 are treated with the substances according to the invention, this likewise leads to a drastic reduction in ANGPTL4 expression. These properties classify the substances SCH138, SCH149 and SCH172 according to the invention as inhibitors and in particular as inverse agonists of the PPAR beta / delta receptor.
Die vorliegende Erfindung betrifft also ferner Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 gemäß der allgemeinen Formel (I) zur Verwendung als Inhibitoren oder Antagonisten, insbesondere bevorzugt als inverse Agonisten, eines Rezeptors des Typs PPAR beta/delta. Als ein Agonist im Sinne der vorliegenden Erfindung wird eine VerbindungThe present invention thus furthermore relates to
Inverse Agonisten sind hierin Verbindungen, die an einen Rezeptor mit konstitutiver Aktivität binden und dessen Aktivität herabsetzen. Ein inverser Agonist führt im Gegensatz zu einem vollen Agonisten somit zu einem negativen Effekt, bzw. einem pharmakologischen Effekt, welcher dem des Agonisten entgegengesetzt ist. Im Fall der vorliegenden Erfindung sind dies bevorzugt solche Verbindungen, die die Bindung eines Korepressors bewirken bzw. fördern.Inverse agonists herein are compounds that bind to a receptor with constitutive activity and decrease its activity. An inverse agonist, in contrast to a full agonist thus leads to a negative effect, or a pharmacological effect, which is opposite to that of the agonist. In the case of the present invention, these are preferably those compounds which effect or promote the binding of a corepressor.
Ferner betrifft die vorliegende Erfindung pharmazeutische Zusammensetzungen, welche unter Verwendung mindestens einer Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 gemäß allgemeiner Formel (I) oder eines Salzes davon hergestellt wurden. Neben mindestens einer Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) enthalten die pharmazeutischen Zusammensetzungen einen pharmakologisch verträglichen Träger, Hilfsstoff und/oder Lösungsmittel.Further, the present invention relates to pharmaceutical compositions prepared using at least one compound of
Abhängig von den Substituenten (z. B. Aminogruppe oder Stickstoffheterocyclus) an den Verbindungen 1–4 der allgemeinen Formel (I) bilden diese auch mit organischen und anorganischen Basen pharmazeutisch verträgliche Salze. Beispiele für geeignete Basen für eine derartige Salzbildung sind wie zum Beispiel NaOH, KOH, NH4OH, Tetraalkylammoniumhydroxid und dergleichen, die dem Fachmann bekannt sind.Depending on the substituents (eg amino group or nitrogen heterocycle) on the compounds 1-4 of the general formula (I), these also form pharmaceutically acceptable salts with organic and inorganic bases. Examples of suitable bases for such salt formation are, for example, NaOH, KOH, NH 4 OH, tetraalkylammonium hydroxide and the like, which are known to the person skilled in the art.
Etliche der Verbindungen 1–4 der allgemeinen Formel (I) sind basisch und können mit Säuren Salze bilden. Beispiele für geeignete Säuren für eine derartige Säureadditionssalzbildung sind Chlorwasserstoffsäure, Bromwasserstoffsäure, Schwefelsäure, Phosphorsäure, Essigsäure, Zitronensäure, Oxalsäure, Apfelsäure, Salicylsäure, p-Aminosalicylsäure, Malonsäure, Fumarsäure, Bernsteinsäure, Ascorbinsäure, Maleinsäure, Sulfonsäure, Phosphonsäure, Perchlorsäure, Salpetersäure, Ameisensäure, Propionsäure, Gluconsäure, Milchsäure, Weinsäure, Hydroxymaleinsäure, Brenztraubensäure, Phenylessigsäure, Benzoesäure, p-Aminobenzoesäure, p-Hydroxybenzoesäure, Methansulfonsäure, Ethansulfonsäure, salpetrige Säure, Hydroxyethansulfonsäure, Ethylensulfonsäure, p-Toluolsulfonsäure, Naphthylsulfonsäure, Sulfanilsäure, Camphersulfonsäure, Chinasäure, Mandelsäure, o-Methylmandelsäure, Hydrogenbenzolsulfonsäure, Pikrinsäure, Adipinsäure, d-o-Tolylweinsäure, Tartronsäure, α-Toluylsäure, (o-, m-, p-) Toluylsäure, Naphthylaminsulfonsäure und andere mineralische oder carboxylische Säuren, die dem Fachmann bekannt sind. Es ist auch möglich, Säureadditionssalze von den Verbindungen 1–4 der allgemeinen Formel (I) mit Aminosäuren, wie Methionin, Tryptophan, Lysin oder Arginin zu bilden.Several of the compounds 1-4 of the general formula (I) are basic and can form salts with acids. Examples of suitable acids for such acid addition salt formation are hydrochloric, hydrobromic, sulfuric, phosphoric, acetic, citric, oxalic, malic, salicylic, p-aminosalicylic, malonic, fumaric, succinic, ascorbic, maleic, sulfonic, phosphonic, perchloric, nitric, formic , Propionic, gluconic, lactic, tartaric, hydroxymaleic, pyruvic, phenylacetic, benzoic, p-aminobenzoic, p-hydroxybenzoic, methanesulfonic, ethanesulfonic, nitrous, hydroxyethanesulfonic, ethylene sulfonic, p-toluenesulfonic, naphthylsulfonic, sulfanilic, camphorsulfonic, quinic, mandelic o-methyl malonic acid, hydrogenbenzenesulfonic acid, picric acid, adipic acid, do-tolyltartaric acid, tartronic acid, α-toluic acid, (o-, m-, p-) toluic acid, naphthylamine sulfonic acid and other mineral ode r carboxylic acids, which are known in the art. It is also possible to form acid addition salts of the compounds 1-4 of the general formula (I) with amino acids such as methionine, tryptophan, lysine or arginine.
Die Verbindungen 1–4 der allgemeinen Formel (I) können ferner in Form ihrer pharmazeutisch aktiven Salze optional unter Verwendung von im Wesentlichen nicht toxischen pharmazeutisch verträglichen Trägern, Hilfsstoffen oder Verdünnern verabreicht werden. Die Medikationen der vorliegenden Erfindung werden in einem herkömmlichen festen oder flüssigen Träger oder Verdünnern und einem herkömmlichen pharmazeutisch hergestellten Hilfsstoff mit einem geeigneten Dosisgrad in einer bekannten Weise hergestellt. Die bevorzugten Präparationen sind in einer verabreichbaren Form, die für orale Anwendung geeignet ist. Diese verabreichbaren Formen schließen zum Beispiel Pillen, Tabletten, Schichttabletten, Filmtabletten, beschichtete Tabletten, Kapseln, Pulver und Deposits ein.The compounds 1-4 of general formula (I) may also be optionally administered in the form of their pharmaceutically active salts, optionally using substantially non-toxic pharmaceutically acceptable carriers, excipients or diluents. The medications of the present invention are prepared in a conventional solid or liquid carrier or diluent and a conventional pharmaceutically-produced excipient at a suitable dose level in a known manner. The preferred preparations are in an administrable form suitable for oral use. These administrable forms include, for example, pills, tablets, coated tablets, coated tablets, coated tablets, capsules, powders and deposits.
Die bevorzugten verabreichbaren Formen sind Tabletten, Filmtabletten, beschichtete Tabletten, Gelatinkapseln und opake Kapseln. Jede pharmazeutische Zusammensetzung enthält mindestens eine Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) und/oder pharmazeutisch verträgliche Salze davon in einer Menge von 50 mg bis 150 mg, bevorzugt 80 mg bis 120 mg und am meisten bevorzugt in einer Menge von 100 mg pro Formulierung.The preferred administrable forms are tablets, film-coated tablets, coated tablets, gelatin capsules and opaque capsules. Each pharmaceutical composition contains at least one compound of
Außerdem schließt der Gegenstand der vorliegenden Erfindung auch pharmazeutische Präparationen für parenterale, einschließlich dermale, intradermale, intragastrale, intrakutane, intravasale, intravenöse, intramuskuläre, intraperitoneale, intranasale, intravaginale, intrabuccale, perkutane, rektale, subkutane, sublinguale, topische oder transdermale Anwendung ein, die zusätzlich zu typischen Vehikeln und Verdünnern eine Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) und/oder ein pharmazeutisch verträgliches Salz davon als einen aktiven Bestandteil enthalten.In addition, the subject of the present invention also includes pharmaceutical preparations for parenteral, including dermal, intradermal, intragastric, intracutaneous, intravascular, intravenous, intramuscular, intraperitoneal, intranasal, intravaginal, intrabuccal, percutaneous, rectal, subcutaneous, sublingual, topical or transdermal application, which, in addition to typical vehicles and diluents, contain a compound of
Innerhalb der offenbarten Verfahren werden die pharmazeutischen Zusammensetzungen der vorliegenden Erfindung, die Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) als aktive Bestandteile enthalten, typischerweise in einer Mischung mit geeigneten Trägermaterialien verabreicht, ausgewählt im Hinblick auf die beabsichtigte Form der Verabreichung, d. h. orale Tabletten, Kapseln (entweder fest gefüllt, halbfest gefüllt oder flüssig gefüllt), Pulver für Zusammensetzungen, orale Gele, Elixiere, dispergierbare Granulate, Sirups, Suspensionen und dergleichen und in Übereinstimmung mit herkömmlichen pharmazeutischen Praktiken. Zum Beispiel kann für die orale Verabreichung in der Form von Tabletten oder Kapseln die aktive Wirkstoffkomponente mit einem beliebigen oralen nicht toxischen pharmazeutisch verträglichen inerten Träger, wie Laktose, Stärke, Sucrose, Zellulose, Magnesiumstearat, Dikalziumphosphat, Kalziumsulfat, Talkum, Mannitol, Ethylalkohol (flüssige Formen) und dergleichen kombiniert werden. Außerdem können bei Wunsch oder Bedarf geeignete Bindemittel, Gleitmittel, Sprengmittel und Färbemittel ebenfalls der Mischung beigefügt werden. Pulver und Tabletten können aus von etwa 5 bis zu etwa 95 Prozent der erfinderischen Zusammensetzung umfasst sein.Within the methods disclosed, the pharmaceutical compositions of the present
Geeignete Bindemittel schließen Stärke, Gelatine, natürliche Zucker, Maissüßstoffe, natürliche und synthetische Gummis, wie Akaziengummi, Natriumalginat, Carboxymethyl-Cellulose, Polyethylenglycol und Wachse ein. Unter den Gleitmitteln können für die Verwendung in diesen Dosierungsformen Borsäure, Natriumbenzoat, Natriumacetat, Natriumchlorid und dergleichen erwähnt werden. Sprengmittel schließen Stärke, Methylcellulose, Guargummi und dergleichen ein. Süßstoffe und Geschmacksstoffe und Konservierungsstoffe können, falls dienlich, ebenfalls eingeschlossen sein. Einige der oben angeführten Ausdrücke, nämlich Sprengmittel, Verdünnen, Gleitmittel, Bindemittel und dergleichen werden unten genauer diskutiert. Zusätzlich können die Zusammensetzungen der vorliegenden Erfindung in einer Form mit verzögerter Freisetzung formuliert werden, um die geschwindigkeitsgesteuerte Freisetzung einer oder mehrerer Verbindungen der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 gemäß allgemeiner Formel (I) zu ermöglichen und deren therapeutische Wirkung zu optimieren. Geeignete Dosierungsformen für eine verzögerte Freisetzung schließen Schichttabletten ein, die Schichten mit variierenden Abbaugeschwindigkeiten oder polymere Matrizen mit gesteuerter Freisetzung enthalten, die mit den aktiven Komponenten imprägniert sind, und in Tablettenform oder Kapseln gestaltet sind, die derartige imprägnierte oder verkapselte poröse polymere Matrizen beinhalten.Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethyl cellulose, polyethylene glycol and waxes. Among the lubricants, boric acid, sodium benzoate, sodium acetate, sodium chloride and the like may be mentioned for use in these dosage forms. Disintegrants include starch, methyl cellulose, guar gum and the like. Sweeteners and flavorings and preservatives may also be included, if appropriate. Some of the above terms, namely disintegrants, diluents, lubricants, binders, and the like are discussed in more detail below. In addition, the compositions of the present invention may be formulated in a sustained-release form to facilitate the rate-controlled release of one or more compounds of
Präparationen in flüssiger Form schließen Lösungen, Suspensionen und Emulsionen ein. Als ein Beispiel können Wasser oder Wasser-Propylenglycol-Lösungen für parenterale Injektionen oder der Zusatz von Süßstoffen und Trübungsmitteln für orale Lösungen, Suspensionen und Emulsionen erwähnt werden. Präparationen in flüssiger Form können ferner Lösungen für intranasale Verabreichung einschließen.Preparations in liquid form include solutions, suspensions and emulsions. As an example may be mentioned water or water-propylene glycol solutions for parenteral injections or the addition of sweeteners and opacifiers for oral solutions, suspensions and emulsions. Preparations in liquid form may further include solutions for intranasal administration.
Zur Inhalation geeignete Aerosol-Präparationen können Lösungen und Feststoffe in Pulverform einschließen, die mit einem pharmazeutisch verträglichen Träger, wie ein komprimiertes Inertgas, z. B. Stickstoff, in Kombination sein können.Aerosol preparations suitable for inhalation may include solutions and solids in powder form which are contacted with a pharmaceutically acceptable carrier, such as a compressed inert gas, e.g. As nitrogen, may be in combination.
Für die Zubereitung von Suppositorien wird zuerst ein niedrig schmelzendes Wachs, wie z. B. eine Mischung von Fettsäureglyceriden, wie z. B. Kakaobutter, geschmolzen und der aktive Bestandteil wird darin durch Rühren oder ähnliches Vermischen homogen dispergiert. Die geschmolzene homogene Mischung wird dann in passend bemessene Formen gegossen, man lässt abkühlen und dadurch verfestigen.For the preparation of suppositories, first a low-melting wax, such. B. a mixture of fatty acid glycerides, such as. Cocoa butter, is melted and the active ingredient is homogeneously dispersed therein by stirring or similar mixing. The molten homogeneous mixture is then poured into appropriately sized molds, allowed to cool and thereby solidified.
Ferner eingeschlossen sind Präparationen in fester Form, die kurz vor der Verwendung zu Präparationen in flüssiger Form für entweder orale oder parenterale Verabreichung umgewandelt werden sollen. Solche flüssigen Formen schließen Lösungen, Suspensionen und Emulsionen ein.Also included are preparations in solid form intended to be converted shortly before use to liquid form preparations for either oral or parenteral administration. Such liquid forms include solutions, suspensions and emulsions.
Die Verbindungen 1–4 der allgemeinen Formel (I) können ferner transdermal verabreichbar sein. Die transdermalen Zusammensetzungen können die Form von Cremes, Lotionen, Aerosolen und/oder Emulsionen annehmen und können in einen transdermalen Aufkleber des Matrix- oder Reservoir-Typs eingeschlossen werden, wie sie in der Technik für diesen Zweck gebräuchlich sind. The compounds 1-4 of the general formula (I) can furthermore be administered transdermally. The transdermal compositions may take the form of creams, lotions, aerosols and / or emulsions and may be included in a transdermal label of the matrix or reservoir type as commonly used in the art for this purpose.
Der Ausdruck Kapsel bezieht sich auf einen speziellen Behälter oder Gehäuse, das aus Methylzellulose, Polyvinylalkoholen oder denaturierten Gelatinen oder Stärke hergestellt ist, zum Halten oder Beinhalten von Zusammensetzungen, die die aktiven Bestandteile umfassen. Hartmantelkapseln sind typischerweise aus Mischungen von Knochen und Schweinehautgelatinen relativ hoher Gelstärke hergestellt. Die Kapsel selbst kann kleine Mengen von Farbstoffen, Trübungsmitteln, Weichmachern und Konservierungsstoffen enthalten.The term capsule refers to a particular container or housing made of methyl cellulose, polyvinyl alcohols or denatured gelatins or starch for holding or containing compositions comprising the active ingredients. Hard shell capsules are typically made from blends of bone and porcine gelatin of relatively high gel strength. The capsule itself may contain small amounts of dyes, opacifiers, emollients, and preservatives.
Tablette bedeutet komprimierte oder gegossene feste Dosierungsform, die die aktiven Bestandteile mit geeigneten Verdünnern enthält. Die Tablette kann durch Komprimieren von Mischungen oder Granulaten hergestellt werden, die durch Nassgranulierung, Trockengranulierung oder durch Kompaktierung erhalten wurden, die einem Fachmann bekannt sind.Tablet means compressed or poured solid dosage form containing the active ingredients with suitable diluents. The tablet may be prepared by compressing mixtures or granules obtained by wet granulation, dry granulation or compaction known to one skilled in the art.
Orale Gele beziehen sich auf die aktiven Bestandteile, die in einer hydrophilen halbfesten Matrix dispergiert oder solubilisiert sind.Oral gels refer to the active ingredients that are dispersed or solubilized in a hydrophilic semi-solid matrix.
Pulver für Zusammensetzungen beziehen sich auf Pulvermischungen, die die aktiven Bestandteile und geeignete Verdünner beinhalten, die in Wasser oder Säften suspendiert werden können.Powders for compositions refer to powder mixtures that include the active ingredients and suitable diluents that can be suspended in water or juices.
Geeignete Verdünner sind Substanzen, die für gewöhnlich den Großteil der Zusammensetzung oder Dosierungsform ausmachen. Geeignete Verdünner schließen Zucker, wie Lactose, Sucrose, Mannitol und Sorbitol, von Weizen, Mais, Reis und Kartoffeln abgeleitete Stärken, und Zellulosen, wie mikrokristalline Zellulose ein. Die Menge an Verdünnern in der Zusammensetzung kann sich von etwa 5 bis etwa 95 Gew.-% der gesamten Zusammensetzung, bevorzugt von etwa 25 bis etwa 75 Gew.-% und weiter bevorzugt von etwa 30 bis etwa 60 Gew.-% erstrecken.Suitable diluents are substances that usually make up the majority of the composition or dosage form. Suitable diluents include sugars such as lactose, sucrose, mannitol and sorbitol, starches derived from wheat, corn, rice and potatoes, and celluloses such as microcrystalline cellulose. The amount of diluents in the composition can range from about 5 to about 95 weight percent of the total composition, preferably from about 25 to about 75 weight percent, and more preferably from about 30 to about 60 weight percent.
Der Ausdruck Sprengmittel bezieht sich auf Materialien, die der Zusammensetzung hinzugefügt wurden, um sie beim Aufbrechen (Zersprengen) und Freigeben der Medikamente zu unterstützen. Geeignete Sprengmittel schließen Stärken, ”Kaltwasser-lösliche” modifizierte Stärken, wie Natrium-Carboxymethylstärke, natürliche und synthetische Gummis, wie Johannisbrotkernmehl, Karaya, Guar, Tragacanth und Agar, Cellulosederivate, wie Methylcellulose und Natrium-Carboxymethylcellulose, mikrokristalline Cellulosen und quervernetzte mikrokristalline Cellulosen, wie Natrium-Croscarmellose, Alginate, wie Alginsäure und Natriumalginat, Tonerden, wie Bentonite, und schäumende Mischungen. Die Menge an Sprengmittel in der Zusammensetzung kann sich von etwa 2 bis 20 Gew.-% der Zusammensetzung und weiter bevorzugt von etwa 5 bis etwa 10 Gew.-% erstrecken.The term disintegrants refers to materials that have been added to the composition to aid in breaking up and releasing the drugs. Suitable disintegrants include starches, "cold water-soluble" modified starches such as sodium carboxymethyl starch, natural and synthetic gums such as locust bean gum, karaya, guar, tragacanth and agar, cellulose derivatives such as methyl cellulose and sodium carboxymethyl cellulose, microcrystalline celluloses and cross-linked microcrystalline celluloses. such as sodium croscarmellose, alginates such as alginic acid and sodium alginate, clays such as bentonites, and effervescent mixtures. The amount of disintegrant in the composition can range from about 2 to 20 weight percent of the composition, and more preferably from about 5 to about 10 weight percent.
Bindemittel charakterisieren Substanzen, die Pulver miteinander binden oder ”verkleben” und sie durch Bildung von Granulaten bindig machen und somit als der ”Kleber” in der Formulierung dienen. Bindemittel fügen eine Kohäsionsstärke hinzu, die in den Verdünnern oder dem Aufgehmittel bereits verfügbar ist. Geeignete Bindemittel schließen Zucker, wie Sucrose, von Weizen, Mais, Reis und Kartoffeln abgeleitete Stärken, natürliche Gummis, wie Akaziengummi, Gelatine und Tragacanth, Derivate von Seetang, wie Alginsäure, Natriumalginat und Ammonium-Calcium-Alginat, Zellulosematerialien, wie Methylcellulose und Natrium-Carboxymethylcellulose und Hydroxypropyl-methylcellulose, Polyvinylpyrrolidon und anorganische Verbindungen, wie Magnesium-Aluminium-Silicat ein. Die Menge der Bindemittel in der Zusammensetzung kann sich von etwa 2 bis etwa 20 Gew.-% der Zusammensetzung, weiter bevorzugt von etwa 3 bis etwa 10 Gew.-% und noch weiter bevorzugt von etwa 3 bis etwa 6 Gew.-% erstrecken.Binders characterize substances that bind or "stick together" powders and make them coagulate through the formation of granules and thus serve as the "glue" in the formulation. Binders add a cohesive strength that is already available in the thinners or the grafting agent. Suitable binders include sugars such as sucrose, starches derived from wheat, corn, rice and potatoes, natural gums such as acacia, gelatin and tragacanth, derivatives of seaweed such as alginic acid, sodium alginate and ammonium calcium alginate, cellulosic materials such as methylcellulose and sodium Carboxymethyl cellulose and hydroxypropyl methyl cellulose, polyvinyl pyrrolidone and inorganic compounds such as magnesium aluminum silicate. The amount of binder in the composition can range from about 2 to about 20 weight percent of the composition, more preferably from about 3 to about 10 weight percent, and even more preferably from about 3 to about 6 weight percent.
Gleitmittel bezieht sich auf eine der Dosierungsform hinzugefügte Substanz, um zu ermöglichen, dass die Tablette, Granulat usw., nachdem sie komprimiert wurden, aus der Gießform oder Pressform durch Verringern der Friktion oder Reibung freigegeben werden. Geeignete Gleitmittel schließen metallische Stearate, wie Magnesiumstearat, Calciumstearat oder Kaliumstearat, Stearinsäure, Wachse mit hohem Schmelzpunkt, und wasserlösliche Gleitmittel, wie Natriumchlorid, Natriumbenzoat, Natriumacetat, Natriumoleat, Polyethylenglycole und D,L-Leucin ein. Gleitmittel werden gewöhnlich bei dem letzten Schritt vor dem Komprimieren hinzugefügt, da sie auf den Oberflächen der Granulate und zwischen ihnen und den Teilen der Tablettenpresse vorhanden sein müssen. Die Menge an Gleitmittel in der Zusammensetzung kann sich von etwa 0,2 bis etwa 5 Gew.-% der Zusammensetzung, bevorzugt von etwa 0,5 bis etwa 2 Gew.-% und weiter bevorzugt von etwa 0,3 bis etwa 1,5 Gew.-% erstrecken.Lubricant refers to a substance added to the dosage form to allow the tablet, granules, etc., after being compressed, to be released from the mold or die by reducing friction or friction. Suitable lubricants include metallic stearates such as magnesium stearate, calcium stearate or potassium stearate, stearic acid, high melting waxes, and water-soluble lubricants such as sodium chloride, sodium benzoate, sodium acetate, sodium oleate, polyethylene glycols and D, L-leucine. Lubricants are usually added at the last step before compression because they must be present on the surfaces of the granules and between them and the parts of the tablet press. The amount of lubricant in the composition can range from about 0.2 to about 5 weight percent of the composition, preferably from about 0.5 to about 2 weight percent, and more preferably from about 0.3 to about 1.5 Wt .-% extend.
Gleitmittel sind Materialien, die eine Anbackung verhindern und die Fließcharakteristika von Granulaten verbessern, so dass der Fluss glatt und einheitlich ist. Geeignete Gleitmittel schließen Siliziumdioxid und Talkum ein. Die Menge von Gleitmittel in der Zusammensetzung kann sich von 0,1 bis etwa 5 Gew.-% der gesamten Zusammensetzung und bevorzugt von etwa 0,5 bis etwa 2 Gew.-% erstrecken. Lubricants are materials that prevent caking and improve the flow characteristics of granules so that the flow is smooth and uniform. Suitable lubricants include silica and talc. The amount of lubricant in the composition can range from about 0.1 to about 5 weight percent of the total composition, and preferably from about 0.5 to about 2 weight percent.
Färbemittel sind Hilfsstoffe, die der Zusammensetzung oder der Dosierungsform eine Färbung bereitstellen. Derartige Hilfsstoffe können Farbstoffe mit Lebensmittelqualität einschließen, die auf einem geeigneten Adsorptionsmittel, wie Tonerde oder Aluminiumoxid adsorbiert sind. Die Menge des Färbemittels kann von etwa 0,1 bis etwa 5 Gew.-% der Zusammensetzung und bevorzugt von etwa 0,1 bis etwa 1 Gew.-% variieren.Colorants are adjuvants that provide color to the composition or dosage form. Such adjuvants may include food grade dyes adsorbed on a suitable adsorbent such as alumina or alumina. The amount of colorant may vary from about 0.1 to about 5 weight percent of the composition, and preferably from about 0.1 to about 1 weight percent.
Wie hierin verwendet ist eine ”pharmazeutisch wirksame Menge” eines Inhibitors eine Menge, die wirksam ist, um das erwünschte physiologische Ergebnis entweder in in vitro behandelten Zellen oder in einem in vivo behandelten Patienten zu erreichen. Spezifisch ist eine pharmazeutisch wirksame Menge eine Menge, die ausreichend ist, um für eine gewisse Zeitspanne ein oder mehrere der klinisch definierten pathologischen Prozesse, die mit einem PPAR beta/delta Rezeptor assoziiert sind, zu inhibieren und/oder zu aktivieren. Die wirksame Menge kann in Abhängigkeit des spezifischen Inhibitors variieren und ist ferner von einer Vielfalt von Faktoren und Zuständen abhängig, die mit dem zu behandelnden Subjekt und der Schwere der Erkrankung in Beziehung stehen. Wenn zum Beispiel ein Inhibitor in vivo verabreicht werden soll, dann wären Faktoren, wie das Alter, Gewicht und die Gesundheit des Patienten als auch Dosisreaktionskurven und Toxizitätsdaten, die aus vorklinischen Arbeiten erhalten wurden, unter den berücksichtigten Faktoren. Falls der Inhibitor mit den Zellen in vivo in Kontakt gebracht werden soll, würde man ferner eine Vielfalt von vorklinischen in vitro Studien entwerfen, um solche Parameter, wie Aufnahme, Halbwertszeit, Dosis, Toxizität, usw. zu bestimmen. Die Bestimmung einer pharmazeutisch wirksamen Menge für einen gegebenen pharmazeutisch aktiven Wirkstoff liegt völlig in der Fähigkeit eines Fachmanns.As used herein, a "pharmaceutically effective amount" of an inhibitor is an amount effective to achieve the desired physiological result in either in vitro treated cells or in an in vivo treated patient. Specifically, a pharmaceutically effective amount is an amount sufficient to inhibit and / or activate, for a period of time, one or more of the clinically defined pathological processes associated with a PPAR beta / delta receptor. The effective amount may vary depending on the specific inhibitor and is further dependent on a variety of factors and conditions related to the subject to be treated and the severity of the disease. For example, if an inhibitor is to be administered in vivo, then factors such as age, weight and health of the patient as well as dose response curves and toxicity data obtained from preclinical work would be among the factors considered. Further, if the inhibitor is to be contacted with the cells in vivo, a variety of preclinical in vitro studies would be designed to determine such parameters as uptake, half-life, dose, toxicity, and so on. The determination of a pharmaceutically effective amount for a given pharmaceutically active agent is entirely within the ability of one skilled in the art.
Es ist für einen Fachmann leicht ersichtlich, dass andere geeignete Modifikationen und Adaptationen der hierin beschriebenen Zusammensetzungen offensichtlich sind und ohne Abweichung von dem hierin offenbarten Schutzumfang der Erfindung oder den Ausführungsformen vorgenommen werden können.It will be readily apparent to one skilled in the art that other suitable modifications and adaptations of the compositions described herein will be apparent and may be made without departing from the scope of the invention or the embodiments disclosed herein.
Ferner betrifft die vorliegende Erfindung pharmazeutische Zusammensetzungen enthaltend mindestens eine Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) zur Behandlung von inflammatorischen Prozessen, Entzündungen, Zelldifferenzierungsprozessen, proliferativen Erkrankungen, Tumoren, Metastasen, Krebs, Lebererkrankungen sowie Erkrankungen des Fettsäurestoffwechsels und des Glukosestoffwechsels, bei denen Insulinresistenz involviert ist.Furthermore, the present invention relates to pharmaceutical compositions comprising at least one compound of the
Die Verbindungen der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) sowie die hierin offenbarten pharmazeutischen Zusammensetzungen enthaltend mindestens eine Verbindung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der allgemeinen Formel (I) können somit zur Behandlung und/oder Prävention von Erkrankungen verwendet werden, bei denen inflammatorische Prozesse, Entzündungen, oder Zelldifferenzierungsprozesse beteiligt sind sowie zur Behandlung proliferativer Erkrankungen. Diese Erkrankungen sind zum Beispiel, aber nicht erschöpfend: Arteriosklerose, wie beispielsweise Koronarsklerose inklusive Angina pectoris oder Myokardinfarkt, Schlaganfall, vaskuläre Restenose oder Reokklusion, chronische inflammatorische Darmerkrankungen wie zum Beispiel Morbus Crohn und ulzerative Kolitis, Pankreatitis, andere inflammatorische Zustände wie, Retinopathie. Weitere endzündliche Erkrankungen, die durch PPAR beta/delta beeinflusst werden, sind zum Beispiel, polyzystisches Ovarialsyndrom, Asthma, Osteoarthritis, Lupus erythematosus (LE) oder inflammatorische rheumatische Erkrankungen wie zum Beispiel rheumatoide Arthritis, Vaskulitis, Kachexie, Gicht, Ischämie, Reperfusionssyndrom und akutes respiratorisches Atemnotsyndrom. Erythematosquamöse Dermatosen wie zum Beispiel Psoriasis und Akne vulgaris. Weitere Hauterkrankungen, die durch PPAR-beta/delta beeinflusst werden, und daher mögliche Erkrankungen sind die unter Verwendung der Verbindungen 3, bevorzugt Verbindungen 4, mehr bevorzugt Verbindungen 1 und am meisten bevorzugt Verbindungen 2 der Formel (I) behandelt werden können, sind: Ekzeme und Neurodermitis, Dermatitis wie zum Beispiel seborrhoische Dermatitis oder Photodermatitis, Keratitis und Keratosen wie zum Beispiel seborrhoische Keratosen, Alterskeratose, aktinische Keratose, lichtinduzierte Keratose, Keratosis follicularis Geschwüre, Warzen inklusive Condylomata oder Condylomata acuminata, Infektionen mit dem humanen Papillomvirus (HPV) wie beispielsweise Papillome der Geschlechtsorgane, virale Warzen wie zum Beispiel Molluscum contagiosum, leukoplakiapapulöse Dermatosen wie zum Beispiel Flechten, Hautkrebs wie beispielsweise Basalzellkarzinome, Melanome oder kutane T-Zell-Lymphome, lokale gutartige epidermale Tumoren wie zum Beispiel Keratoderma, epidermaler Nävus und Beulen, Pannikulitis, Konjunktivitis, Balanitis, Intertrigo, Vaginitis, Cheilitis, Sonnenbrand, Alopecia areata.The compounds of
Bei den proliferativen Erkrankungen handelt es sich vorwiegend um Tumore wie z. B. benigne Tumore, Krebs und Metastasen sowie entzündungsbedingte Krankheiten wie z. B. Arthritis oder Psoriasis. Die Tumorerkrankungen können ausgewählt werden aus der Gruppe enthaltend oder bestehend aus: Sarkome (wie z. B. Liposarkome), Karzinome (wie z. B des Gastrointestinaltrakts, der Leber, des Gallentrakts und der Bauchspeicheldrüse, der Lunge, des Uorgenitaltrakts, der Brustdrüse usw.), endokrine Tumoren, akute und chronische Leukämien und andere myeloproliferative Erkrankungen und Lymphome.The proliferative diseases are mainly tumors such. As benign tumors, cancer and metastases and inflammatory diseases such. As arthritis or psoriasis. The tumors may be selected from the group consisting of or consisting of: sarcomas (such as liposarcomas), carcinomas (such as the gastrointestinal tract, the liver, the biliary tract and the pancreas, the lung, the urogenital tract, the mammary gland, etc .), endocrine tumors, acute and chronic leukemias and other myeloproliferative disorders and lymphomas.
Die erfindungsgemäßen Verbindungen 1, bevorzugt Verbindungen 2 der allgemeinen Formel (I) sind auch zur Behandlung von Lebererkrankungen wie Steatosis, Steatohepatitis und Hepatitis geeignet. Die erfindungsgemäßen Verbindungen 1, bevorzugt. Verbindungen 2 der Formel (I) sind weiterhin geeignet für die Behandlung von Erkrankungen des Fettsäurestoffwechsels und des Glukosestoffwechsels, bei denen Insulinresistenz involviert ist. Dazu gehören Hyperlipidämie, Hypertriglyceridämie, Hypercholesterinämie. Zu diesen Erkrankungen gehören weiterhin Diabetes mellitus, insbesondere Typ 2 Diabetes, inklusive der Prävention assoziierter Folgeerscheinungen, wie beispielsweise Hyperglykämie, Zunahme der Insulinresistenz, gestörte Glukosehomöostase, Schutz der beta-Zellen des Pankreas, Verhinderung makro- und mikrovaskulärer Erkrankungen. Weiterhin gehören dazu Dyslipidämien und ihre Folgen, wie zum Beispiel Arteriosklerose, koronare Herzerkrankungen, zerebrovaskuläre Erkrankungen, insbesondere, solche, die durch folgende Faktoren charakterisiert sind: hohe Plasma-Triglycerid-Konzentrationen, hohe postprandiale Plasma-Triglycerid-Konzentrationen, niedrige HDL Cholesterol-Konzentrationen, niedrige ApoA Lipoprotein-Konzentrationen, hohe LDL Cholesterol-Konzentrationen, LDL Cholesterol-Partikel mit geringer Dichte, hohe ApoB Lipoprotein-Konzentrationen. Verschiedene andere Erkrankungen können mit dem metabolischen Syndrom assoziiert sein: Übergewicht, Thrombosen, Hyperkoagulations- und prothrombotische Stadien (arteriell und venös), hoher Blutdruck, Herzversagen wie zum Beispiel, aber nicht beschränkt auf Myokardinfarkt, hypertensive Herzerkrankung oder Kardiomyopathie.The
Bevorzugte erfindungsgemäße Ausführungen sind nachfolgend erläutert, wobei die Erfindung alle nachfolgend aufgeführten bevorzugten Ausführungsformen einzeln und in Kombination umfasst.Preferred embodiments according to the invention are explained below, wherein the invention comprises all the preferred embodiments listed below individually and in combination.
Figurenbeschreibungfigure description
BeispieleExamples
Beispiel 1: Charakterisierung der erfindungsgemäßen SubstanzenExample 1: Characterization of the substances according to the invention
PPAR beta/delta Subtyp-spezifische Bindung der erfindungsgemäßen Substanzen
- A) Die kompetitive Ligandenbindung der erfindungsgemäßen Substanzen wurde in vitro mit Hilfe von zeitaufgelöstem Fluoreszenz-Resonanz-Energietransfer (TR-FRET) durch Kompetition mit dem kommerziell erhältlichen fluoreszierenden Fluormone® Pan-PPAR-Green um die Bindung an das Fusionsprotein GST-PPAR beta/delta LBD (GST = Glutathion S-Transferase; LBD = Liganden-Bindungsdomäne) (Invitrogen, Darmstadt, Deutschland) in einem VICTOR3V Multilabel Counter (WALLAC 1420; PerkinElmer Life and Analytical Sciences, Rodgau, Deutschland) gemessen. Die Messung erfolgt in 100 mM KCl, 20 mM Tris pH 7.9, 0.01% Triton X100 and 1 μg/μL bovinem Serumalbumin. GST ist dem Fachmann als geeigneter Fusionspartner für Proteine bekannt. Dazu wird das Verhältnis der Fluoreszenzintensitäten bei 520 nm (Fluorescein-Emission angeregt durch Terbium-Emission) und bei 495 nm (Terbium-Emission) bestimmt.
1A –C zeigt für die erfindungsgemäßen Substanzen SCH138, SCH149 und SCH172 eine signifikante Kompetitionseffizienz. - B) Die Liganden-induzierte Bindung des kommerziell erhältlichen Fluorescein-markierten Korepressor-Peptids SMRT-ID2 (HASTNMGLEAIIRKALMGKYDQW) (Invitrogen, Darmstadt, Deutschland) an GST-PPAR beta/delta wird beispielsweise im TR-FRET-Verfahren mit Hilfe eines Terbium-markierten anti-GST-Antikörpers in einem VICTOR3V Multilabel Counter (WALLAC 1420; PerkinElmer Life and Analytical Sciences, Rodgau, Deutschland) gemessen. Die Messung erfolgt in einem Puffer aus 100 mM KCl, 20 mM Tris pH 7.9, 001% Triton X100 and 1 μg/μL bovinem Serumalbumin.
2A –C zeigt deutlich die Interaktion zwischen SMRT-ID2 und GST-PPAR beta/delta LBD für die erfindungsgemäßen Substanzen SCH138, SCH149 und SCH172 in Abhängigkeit von der eingesetzten Konzentration. - C) Die Subtyp-Spezifität der erfindungsgemäßen Substanzen für den PPAR-Subtyp beta/delta wurde in vitro anhand von TR-FRET Messungen durch Kompetition mit dem fluoreszierenden Fluormone® Pan-PPAR-Green um die Bindung an die Fusionsproteine GST-PPAR alpha, beta/delta oder gamma LBD (GST = Glutathion S-Transferase; LBD = Liganden-Bindungsdomäne) (Invitrogen, Darmstadt, Deutschland) in einem VICTOR3V Multilabel Counter (WALLAC 1420; PerkinElmer Life and Analytical Sciences, Rodgau, Deutschland) bestimmt. Die Messung erfolgt in 100 mM KCl, 20 mM Tris pH 7.9, 0.01% Triton X100 and 1 μg/μL bovinem Serumalbumin.
3.1A –C bis3.3A –C zeigen für die erfindungsgemäßen Substanzen SCH138, SCH149 und SCH172 eine signifikante Kompetitionseffizienz ausschließlich für den PPAR-Subtyp beta/delta.
- A) The competitive ligand binding of the substances according to the invention was tested in vitro by means of time-resolved fluorescence resonance energy transfer (TR-FRET) by competing with the commercially available fluorescent Fluormone ® pan-PPAR Green for binding to the fusion protein GST-PPAR beta / delta LBD (GST = glutathione S-transferase; LBD = ligand binding domain) (Invitrogen, Darmstadt, Germany) in a VICTOR3V multilabel counter (WALLAC 1420, PerkinElmer Life and Analytical Sciences, Rodgau, Germany). The measurement takes place in 100 mM KCl, 20 mM Tris pH 7.9, 0.01% Triton X100 and 1 μg / μL bovine serum albumin. GST is known to those skilled in the art as a suitable fusion partner for proteins. For this purpose, the ratio of the fluorescence intensities at 520 nm (fluorescein emission excited by terbium emission) and at 495 nm (terbium emission) is determined.
1A -C shows a significant competition efficiency for the substances according to the invention SCH138, SCH149 and SCH172. - B) The ligand-induced binding of the commercially available fluorescein-labeled co-repressor peptide SMRT-ID2 (HASTNMGLEAIIRKALMGKYDQW) (Invitrogen, Darmstadt, Germany) to GST-PPAR beta / delta is, for example, in the TR-FRET method using a terbium-labeled anti-GST antibody in a VICTOR3V Multilabel Counter (WALLAC 1420; PerkinElmer Life and Analytical Sciences, Rodgau, Germany). The measurement is carried out in a buffer of 100 mM KCl, 20 mM Tris pH 7.9, 001% Triton X100 and 1 μg / μL bovine serum albumin.
2A C clearly shows the interaction between SMRT-ID2 and GST-PPAR beta / delta LBD for the substances SCH138, SCH149 and SCH172 according to the invention, depending on the concentration used. - C) The subtype specificity of the substances of the invention for the PPAR subtype beta / delta was in vitro based on TR-FRET measurements by competition with the fluorescent Fluormone ® pan-PPAR Green for binding to the fusion proteins GST-PPAR alpha, beta / delta or gamma LBD (GST = glutathione S-transferase; LBD = ligand binding domain) (Invitrogen, Darmstadt, Germany) in a VICTOR3V multilabel counter (WALLAC 1420, PerkinElmer Life and Analytical Sciences, Rodgau, Germany). The measurement takes place in 100 mM KCl, 20 mM Tris pH 7.9, 0.01% Triton X100 and 1 μg / μL bovine serum albumin.
3.1A -C to3.3A -C show for the substances according to the invention SCH138, SCH149 and SCH172 a significant competition efficiency exclusively for the PPAR subtype beta / delta.
Einfluss der erfindungsgemäßen Substanzen auf die Transkription von PPAR beta/delta-ZielgenenInfluence of the substances according to the invention on the transcription of PPAR beta / delta target genes
Der Einfluss der erfindungsgemäßen Substanzen auf durch PPAR-beta/delta regulierte Gene wie beispielsweise ANGPTL4, welches für das Angiopoietin-ähnliche Protein ANGPTL4 kodiert, wird in verschiedenen Zellen mit einer Konfluenz von 70% bis 80% in einer 6-well-Zellkulturplatte getestet. Dazu werden kultivierte humane Myofibroblasten (WPMY-1), murine Myoblasten (C2C12), peritoneale Makrophagen der Maus oder Zellen der humanen Brustkrebszelllinie MDA-MB-231 mit den erfindungsgemäßen Substanzen für 24 Stunden behandelt. Die Zellen der Brustkrebszelllinie werden zusätzlich für 6 Stunden mit TGF-beta2 (2 ng/ml), welches kommerziell erhältlich ist, stimuliert. Die humanen Myofibroblasten werden zusätzlich für 6 Stunden mit L165,041 (500 nM) stimuliert. Anschließend wird aus den Zellen RNA mit dem Fachmann bekannten Methoden isoliert und in einer dem Fachmann ebenfalls bekannten quantitativen PCR (qPCR, Realtime qPCR, RT-qPCR) analysiert. Dazu wird cDNA von 0,25 μg bis 1 μg RNA mit Hilfe von oligo(dT)-Primern und einem kommerziell erhältlichen cDNA-Synthese-Kit synthetisiert. Die qPCR wird anschließend in einem Mx3000P RT-qPCR System (Stratagene, La Jolla, Kalifornien, USA) nach Angaben des Herstellers mit 40 Zyklen und einer Annealing-Temperatur von 60°C mit beispielsweise humanen ANGPTL4 Primern (fw: GATGGCTCAGTGGACTTCAACC; rv: CCCGTGATGCTATGCACCTTC) und dem dem Fachmann bekannten ribosomalen l27 (fw: AAAGCCGTCATCGTGAAGAAC; rv: GCTGTCACTTTCCGGGGATAG) als Normalisierungsgen durchgeführt.
Beispiel 2: Allgemeine SynthesebeschreibungExample 2: General Description of Synthesis
Als Ausgangsmaterialien dienen kommerziell erhältliche sowie nach bekannten Synthesen darstellbare aromatische Aldehyde und Ketone sowie Benzylderivate, bevorzugt für R1 sind Nitrile. Bevorzugte Basen sind Kaliumhydroxid oder Pyrrolidin unter deren Katalyse die Umsetzung bei Raumtemperatur oder 60°C in geeigneten Lösungsmitteln (bevorzugt Methanol) 1–48 Stunden erfolgt. Ferner können bei geeigneter Abgangsgruppe (bevorzugt Brom in Position R9-R11) Amine über eine Buchwald-Hartwig-Reaktion an Position R9-R11 eingeführt werden (Bsp.: 151, 169, 174, 175, 178). Bervorzugtes Katalysatorsystem ist Tris(dibenzylideneacetone)dipalladium(0) mit tri-tert-Butylphosphin bzw. 2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl und Natrium tert-butanolat in Toluol bei 80°C und einer Reaktionszeit von zwei Stunden. Weitere Modifikationen beinhalten die Reduktion von Nitrogruppen mit Zinn(II)chlorid (Bsp.: 125) zu primären Aminen, Hydrierung der zentralen Doppelbindung mit Palladiumkatalysatoren (Bsp.: 127) und Cyclisierungen mit geeigneten Reagenzien wie Triethylphosphit (Bsp.: 161).The starting materials used are commercially available aromatic aldehydes and ketones which can be prepared by known syntheses, as well as benzyl derivatives, and R 1 is preferably nitrites. Preferred bases are potassium hydroxide or pyrrolidine whose catalysis is carried out at room temperature or 60 ° C. in suitable solvents (preferably methanol) for 1-48 hours. Further, with a suitable leaving group (preferably bromine in position R 9 -R 11 ) amines can be introduced via a Buchwald-Hartwig reaction at position R 9 -R 11 (Ex .: 151, 169, 174, 175, 178). Preferred catalyst system is tris (dibenzylideneacetone) dipalladium (0) with tri-tert-butylphosphine or 2,2'-bis (diphenylphosphino) -1,1'-binaphthyl and sodium tert-butoxide in toluene at 80 ° C and a reaction time of two hours. Further modifications include the reduction of nitro groups with tin (II) chloride (Ex: 125) to primary amines, hydrogenation of the central double bond with palladium catalysts (Ex: 127) and cyclizations with suitable reagents such as triethyl phosphite (Ex: 161).
Beispiel 3: (Z)-3-[4-(Dimethylamino)phenyl]-2-phenylacrylnitril (SCH117):Example 3: (Z) -3- [4- (Dimethylamino) phenyl] -2-phenylacrylonitrile (SCH117):
Zu einer Lösung von Benzylcyanid (0.400 ml, 3.47 mmol, 1 eq.) und 4-Dimethylaminobenzaldehyd (517 mg, 3.47 mmol, 1 eq.) in MeOH (5 ml) wurde Kaliumhydroxid (194 mg, 3.47 mmol, 1 eq) zugegeben. Nach einer Stunde wurde der ausgefallene Feststoff abfiltriert, mit Wasser und Cyclohexan gewaschen und im Vakuum getrocknet um die Titelverbindung (555 mg, 2.24 mmol, 65% Ausbeute) als gelben Feststoff zu erhalten. 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 9.2 Hz; H-8),-7.32 (dt, 1H; 3J = 7.3, 4J = 1.2 Hz; H-1), 7.38-7.44 (m, 2H; H-2), 7.41 (s, 1H; H-5), 7.62-7.65 (m, 2H; H-3), 7.86 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 248 (100, M+·). HRMS (EI+): berechnet: 248.131349, gefunden 248.131279. EA: berechnet: 82.22% C, 6.49% H; 11.28% N gefunden 82.14% C, 6.54% H; 11.22% N. Schmelzpunkt (nichtkorrigiert): 138°C.To a solution of benzyl cyanide (0.400 mL, 3.47 mmol, 1 eq.) And 4-dimethylaminobenzaldehyde (517 mg, 3.47 mmol, 1 eq.) In MeOH (5 mL) was added potassium hydroxide (194 mg, 3.47 mmol, 1 eq) , After 1 h, the precipitated solid was filtered off, washed with water and cyclohexane and dried in vacuo to afford the title compound (555 mg, 2.24 mmol, 65% yield) as a yellow solid. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-8 ), - 7.32 (dt, 1H, 3 J = 7.3, 4 J = 1.2 Hz, H-1), 7.38-7.44 (m, 2H, H-2), 7.41 (s, 1H, H-5), 7.62 -7.65 (m, 2H, H-3), 7.86 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 248 (100, M + * ). HRMS (EI +): calculated: 248.131349, found 248.131279. EA: calculated: 82.22% C, 6.49% H; 11.28% N found 82.14% C, 6.54% H; 11.22% N. Melting point (uncorrected): 138 ° C.
Beispiel 4: Herstellung von SCH151Example 4: Preparation of SCH151
(Z)-3-(4-(4-Methylpiperidin-1-yl)phenyl]-2-phenylacrylnitril (SCH151):(Z) -3- (4- (4-Methylpiperidin-1-yl) phenyl] -2-phenylacrylonitrile (SCH151):
(Z)-3-(4-Bromphenyl)-2-phenylacrylnitril (SCH102, 200 mg, 0.70 mmol, 1 eq.), 2,2'-Bis(diphenylphosphino)-1,1'-binaphthyl (32.9 mg, 0.053 mmol, 0.075 eq.), Natrium tert-butanolat (101 mg, 1.06 mmol, 1.5 eq.) und Tris(dibenzylideneacetone)dipalladium(0) (32.2 mg, 0.035 mmol, 0.05 eq.) wurden unter Argon Atmosphäre in trockenem Toluol (4 ml) suspendiert und nach Zugabe von 4-Methylpiperidin (166 μl, 1.41 mmol, 2 eq.) für 17 Stunden bei 80°C in einem geschlossenem Druckgefäß gerührt. Anschließend wurde die Suspension über Celite abfiltriert und das Filtrat auf Kieselgel absorbiert. Säulenchromatographie (isoHexan:Dichlormethan = 5:2) ergab die Titelverbindung (195 mg, 0.65 mmol, 92% Ausbeute) als gelben Feststoff. 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 0.90 (d, 3H; 3J = 6.4 Hz; CH3), 1.08-1.20 (sm, 2H; H-11), 1.50-1.63 (sm, 1H; H-12), 1.62-1.69 (sm 2H; H-11), 2.76-2.85 (sm, 2H; H-10), 3.85-3.93 (sm, 2H; H-10), 7.00 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.31-7.36 (sm, 1H; H-1), 7.41-7.47 (sm, 2H; H-2), 7.63-7.68 (sm, 2H; H-3), 7.78 (s, 1H; H-5), 7.83 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 302 (100, M+·). HRMS (EI+): berechnet: 302.178299, gefunden 302.178744.(Z) -3- (4-Bromophenyl) -2-phenylacrylonitrile (SCH102, 200 mg, 0.70 mmol, 1 eq.), 2,2'-bis (diphenylphosphino) -1,1'-binaphthyl (32.9 mg, 0.053 mmol, 0.075 eq.), sodium tert-butoxide (101 mg, 1.06 mmol, 1.5 eq.) and tris (dibenzylideneacetone) dipalladium (0) (32.2 mg, 0.035 mmol, 0.05 eq.) were dissolved under argon atmosphere in dry toluene ( 4 ml) and after addition of 4-methylpiperidine (166 μl, 1.41 mmol, 2 eq.) For Stirred for 17 hours at 80 ° C in a closed pressure vessel. The suspension was then filtered through Celite and the filtrate was absorbed on silica gel. Column chromatography (isohexane: dichloromethane = 5: 2) gave the title compound (195 mg, 0.65 mmol, 92% yield) as a yellow solid. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 0.90 (d, 3H, 3 J = 6.4 Hz, CH 3 ), 1.08-1.20 (sm, 2H; 11), 1.50-1.63 (sm, 1H, H-12), 1.62-1.69 (sm 2H, H-11), 2.76-2.85 (sm, 2H, H-10), 3.85-3.93 (sm, 2H; H -10) 7.00 (psd, 2H, 3 J = 9.2 Hz + 5 J H-8), 7:31 to 7:36 (sm, 1H; H-1), 7:41 to 7:47 (sm, 2H; H-2), 7.63-7.68 (sm, 2H; H-3), 7.78 (s, 1H, H-5), 7.83 (psd, 2H, 3 J = 8.9 Hz + 5 J H-7). MS (EI +): m / z (%) = 302 (100, M + * ). HRMS (EI +): calculated: 302.178299, found 302.178744.
Beispiel 5: Herstellung von SCH195Example 5: Preparation of SCH195
(Z)-2-(2-Chlorphenyl)-3-[4-(4-methylpiperazin-1-yl)phenyl]acrylnitril (SCH195) (dihydrochlorid)(Z) -2- (2-Chlorophenyl) -3- [4- (4-methylpiperazin-1-yl) phenyl] acrylonitrile (SCH195) (dihydrochloride)
Zu einer Lösung von 4-(4-Methylpiperazin-1-yl)benzaldehyd (200 mg, 1.96 mol, 1 eq.) und 2-(2-Chlorphenyl)acetonitril (297 mg, 125 μL, 1.96 mmol, 1 eq) in Methanol (1.5 ml) wurde Pyrrolidin (139 mg, 81 μL, 1.96 mmol, 1 eq.) gegeben und für 50 h auf 60°C erhitzt. Die Lösung wurde auf Kieselgel absorbiert und säulenchromatographisch (Dichlormethan/Methanol = 0–25% über 10 min) getrennt. Fällen mit Salzsäure (5–6 M in Isopropanol) aus Ethylacetat ergab die Titelverbindung (181 mg, 0.81 mmol, 41% Ausbeute) als leicht gelben Feststoff. 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.77 (d, 3H; J = 4.8Hz; CH3), 3.03-3.15 (sm, 2H; H-12), 3.22-3.31 (sm, 2H; H-12), 3.41-3.49 (sm, 2H; H-11), 4.00-4.08 (sm, 2H; H-11), 7.12 (psd, 2H; 3J + 5J = 9.2 Hz; H-9), 7.41-7.47 (m, 3H; H-2+3+6), 7.52-7.58 (m, 2H; H-1+4), 7.86 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 11.20 (bs, 1H; HCl). MS (EI+): m/z (%) = 337 (100, M+·). HRMS (EI+): berechnet: 337.134576, gefunden 337.134666.To a solution of 4- (4-methylpiperazin-1-yl) benzaldehyde (200 mg, 1.96 mol, 1 eq.) And 2- (2-chlorophenyl) acetonitrile (297 mg, 125 μL, 1.96 mmol, 1 eq) in Methanol (1.5 mL) was added to pyrrolidine (139 mg, 81 μL, 1.96 mmol, 1 eq.) And heated to 60 ° C for 50 h. The solution was absorbed on silica gel and separated by column chromatography (dichloromethane / methanol = 0-25% over 10 min). Precipitation with hydrochloric acid (5-6 M in isopropanol) from ethyl acetate gave the title compound (181 mg, 0.81 mmol, 41% yield) as a light yellow solid. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.77 (d, 3H, J = 4.8Hz, CH 3 ), 3.03-3.15 (sm, 2H, H-12 ), 3:22 to 3:31 (sm, 2H; H-12), 3:41 to 3:49 (sm, 2H; H-11), 4:00 to 4:08 (sm, 2H; H-11), 7.12 (psd, 2H; J + 3 5 J = 9.2 Hz, H-9), 7.41-7.47 (m, 3H, H-2 + 3 + 6), 7.52-7.58 (m, 2H, H-1 + 4), 7.86 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-8), 11.20 (bs, 1H, HCl). MS (EI +): m / z (%) = 337 (100, M + * ). HRMS (EI +): calculated: 337.134576, found 337.134666.
Beispiel 6: Herstellung von SCH181 Example 6: Preparation of SCH181
(Z)-3-(4-(Dimethylamino)phenyl)-2-phenylacrylaldehyd (SCH181)(Z) -3- (4- (dimethylamino) phenyl) -2-phenylacrylaldehyde (SCH181)
Zu einer Lösung von (Z)-3-[4-(Dimethylamino)phenyl]-2-phenylacrylnitril (SCH117, 500 mg, 2.02 mmol, 1 eq.) in wasserfreiem Toluol (20 ml) wurde bei –78°C Diisobutylaluminiumhydrid (1.5 M in Toluol, 2.73 mL, 4.03 mmol, 2 eq.) über eine Stunde zugetropft. Nach weiteren zwei Stunden bei –78°C wurde über eine Stunde auf 0°C erwärmt und mit ges. Natrium-Kaliumtartrat-Lösung gequencht. Es wurde mit Diethylether verdünnt und die organische Phase mit ges. Kochsalzlösung gewaschen, über Magnesiumsulfat getrocknet, filtiriert und auf Kieselgel absorbiert. Säulenchromatographie (isoHexan/Dichlormethan = 1:1) ergab die Titelverbindung (263 mg, 1.5 mmol, 52% Ausbeute) als orangegelben Feststoff. 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.89 (s, 3H, CH3), 6.52 (psd, 2H, 3J + 5J = 8.9 Hz; H-8), 7.02 (psd, 2H, 3J + 5J = 8.9 Hz; H-7), 7.08-7.11 (m, 2H, H-3), 7.33-7.43 (m, 3H, H-1+2), 7.45 (s, 1H, H-5), 9.56 (s, 1H, CHO). MS (ESI+): m/z (%) = 274 (100, [M+Na]+).To a solution of (Z) -3- [4- (dimethylamino) phenyl] -2-phenylacrylonitrile (SCH117, 500 mg, 2.02 mmol, 1 eq.) In anhydrous toluene (20 mL) at -78 ° C was added diisobutylaluminum hydride ( 1.5 M in toluene, 2.73 mL, 4.03 mmol, 2 eq.) Was added dropwise over one hour. After a further two hours at -78 ° C was heated to 0 ° C over one hour and washed with sat. Quenched sodium potassium tartrate solution. It was diluted with diethyl ether and the organic phase with sat. Washed brine, dried over magnesium sulfate, filtered and absorbed on silica gel. Column chromatography (isohexane / dichloromethane = 1: 1) gave the title compound (263 mg, 1.5 mmol, 52% yield) as an orange-yellow solid. 1 H-NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.89 (s, 3H, CH 3 ), 6.52 (psd, 2H, 3 J + 5 J = 8.9 Hz; H -8), 7:02 (psd, 2H, 3 J = 8.9 Hz + 5 J H-7), 7:08 to 7:11 (m, 2H, H-3), 7:33 to 7:43 (m, 3H, H-1 + 2 ), 7.45 (s, 1H, H-5), 9.56 (s, 1H, CHO). MS (ESI +): m / z (%) = 274 (100, [M + Na] + ).
Beispiel 7: Herstellung von SCH187Example 7: Preparation of SCH187
(Z)-3-(4-(Dimethylamino)phenyl)-2-phenylprop-2-en-1-ol (SCH187)(Z) -3- (4- (Dimethylamino) phenyl) -2-phenylprop-2-en-1-ol (SCH187)
Zu einer Lösung von (Z)-3-(4-(Dimethylamino)phenyl)-2-phenylacrylaldehyd (SCH181, 100 mg, 0.40 mol, 1 eq.) und Cer(III)chlorid (98 mg, 0.40 mg, 1 eq.) in Methanol (3 mL) wurde bei 0°C Natriumborhydrid (15.1 mg., 0.40 mmol, 1 eq.) zugegeben. Nach 30 min bei 0°C wurde mit Ethylacetat verdünnt und die organische Phase erst mit ges. Natriumhydrogencarbonat-Lösung, dann mit ges. Kochsalzlösung gewaschen und anschließend über Magnesiumsulfat getrocknet. Säulenchromatographie des Filtrats (Dichlormethan/Methanol = 19:1) ergab die Titelverbindung (85 mg, 0.33 mmol, 83% Ausbeute) als weißen Feststoff. 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.89 (s, 6H; CH3), 4.43 (d, 2H; J = 1.1 Hz; CH2), 6.48-6.56 (m, 2H, H-9), 6.57 (s, 1H, H-6), 6.90 (psd, 2H, 3J + 5J = 8.9 Hz; H-8), 7.25-7.32 (m, 3H, H-1+2), 7.33-7.38 (m, 2H, H-3).To a solution of (Z) -3- (4- (dimethylamino) phenyl) -2-phenylacrylaldehyde (SCH181, 100 mg, 0.40 mol, 1 eq.) And cerium (III) chloride (98 mg, 0.40 mg, 1 eq in methanol (3 mL) at 0 ° C was added sodium borohydride (15.1 mg, 0.40 mmol, 1 eq.). After 30 min at 0 ° C was diluted with ethyl acetate and the organic phase with sat. Sodium bicarbonate solution, then with sat. Washed brine and then dried over magnesium sulfate. Column chromatography of the filtrate (dichloromethane / methanol = 19: 1) gave the title compound (85 mg, 0.33 mmol, 83% yield) as a white solid. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.89 (s, 6H, CH 3 ), 4.43 (d, 2H, J = 1.1 Hz, CH 2 ), 6.48 -6.56 (m, 2H, H-9), 6:57 (s, 1H, H-6), 6.90 (psd, 2H, 3 J = 8.9 Hz + 5 J H-8), 7:25 to 7:32 (m, 3H , H-1 + 2), 7.33-7.38 (m, 2H, H-3).
Beispiel 8: Herstellung von SCH194Example 8: Preparation of SCH194
(Z)-3-[4-(Dimethylamino)-2-methoxyphenyl]-2-phenylacrylnitril (SCH194)(Z) -3- [4- (Dimethylamino) -2-methoxyphenyl] -2-phenylacrylonitrile (SCH194)
Zu einer Lösung von Benzylcyanid (163 mg, 161 μL, 1.40 mmol, 1 eq.) und 4-(Dimethylamino)-2-methoxybenzaldehyd (250 mg, 1.40 mmol, 1 eq.) in Methanol (2 mL) wurde Pyrrolidin (198 mg, 231 μL, 2.79 mmol, 2 eq.) gegeben. Nach 24 h wurde der ausgefallene Feststoff abfiltriert, mit Wasser und Cyclohexan gewaschen und im Vakuum getrocknet um die Titelverbindung (308 mg, 1.11 mmol, 79% Ausbeute) als gelben Feststoff zu erhalten. 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; NCH3), 3.88 (s, 3H; OCH3), 6.18 (s, 1H; H-7), 6.40 (dd, 1H; 3J = 8.9, 4J = 1.8 Hz; H-8), 7.27-7.32 (sm, 1H; H-1), 7.37-7.42 (m, 2H; H-2), 7.63-7.67 (m, 2H; H-3), 7.93 (s, 1H; H-5), 8.26 (d, 1H, 3J = 8.9 Hz; H-9).MS (EI+): m/z (%) = 278 (100, HRMS (EI+): berechnet: 278.141913, gefunden 278.138746. EA: berechnet: 77.67% C, 6.52% H; 10.06% N, gefunden: 77.52% C, 6.51% H; 9.88% N.To a solution of benzyl cyanide (163 mg, 161 μL, 1.40 mmol, 1 eq.) And 4- (dimethylamino) -2-methoxybenzaldehyde (250 mg, 1.40 mmol, 1 eq.) In methanol (2 mL) was added pyrrolidine (198 mg, 231 μL, 2.79 mmol, 2 eq.). After 24 h, the precipitated solid was filtered off, washed with water and cyclohexane and dried in vacuo to give the title compound (308 mg, 1.11 mmol, 79% yield) as a yellow solid. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, NCH 3 ), 3.88 (s, 3H, OCH 3 ), 6.18 (s, 1H, H). 7), 6.40 (dd, 1H, 3 J = 8.9, 4 J = 1.8 Hz; H-8), 7:27 to 7:32 (sm, 1H; H-1), 7:37 to 7:42 (m, 2H; H-2) , 7.63-7.67 (m, 2H; H-3), 7.93 (s, 1H, H-5), 8.26 (d, 1H, 3 J = 8.9 Hz; H-9); MS (EI +): m / z (%) = 278 (100, HRMS (EI +): calculated: 278.141913, found 278.138746 EA: calculated: 77.67% C, 6.52% H, 10.06% N, found: 77.52% C, 6.51% H, 9.88% N.
Beispiele 9–51: Charakterisierung der VerbindungenExamples 9-51: Characterization of the compounds
SCH101 (Z)-2,3-Diphenylacrylnitril (SCH101) SCH101 (Z) -2,3-diphenylacrylonitrile (SCH101)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.38-7.50 (m, 6H; H-1+2+9+8), 7.55 (s, 1H; H-5), 7.68-7.70 (m, 2H; H-3), 7.89-7.91 (m, 2H; H-7). MS (EI+): m/z (%) = 205 (100, M+·). HRMS (EI+): berechnet: 205.089149, gefunden 205.090917. EA: berechnet: 87.77% C, 5.40% H; 6.82% N, gefunden: 87.72% C, 5.62% H; 6.89% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.38-7.50 (m, 6H, H-1 + 2 + 9 + 8), 7.55 (s, 1H, H-5 ), 7.68-7.70 (m, 2H, H-3), 7.89-7.91 (m, 2H, H-7). MS (EI +): m / z (%) = 205 (100, M + * ). HRMS (EI +): calculated: 205.089149, found 205.090917. EA: calculated: 87.77% C, 5.40% H; 6.82% N, found: 87.72% C, 5.62% H; 6.89% N.
SCH102 (Z)-3-(4-Bromphenyl)-2-phenylacrylnitril (SCH102) SCH102 (Z) -3- (4-bromophenyl) -2-phenylacrylonitrile (SCH102)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.39-7.48 (m, 4H; H-1+2+5), 7.60 (psd, 2H; 3J + 5J = 8.7 Hz; H-8), 7.65-7.68 (m, 2H; H-3), 7.76 (psd, 2H; 3J + 5J = 8.5 Hz; H-7). MS (EI+): m/z (%) = 283/285(95, M+·), 204 (100, [M-Br]+·). HRMS (EI+): berechnet: 284.997614, gefunden 284.997165. EA: berechnet: 63.40% C, 3.55% H; 4.93% N, gefunden: 63.44% C, 3.79% H; 4.91% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.39-7.48 (m, 4H, H-1 + 2 + 5), 7.60 (psd, 2H, 3 J + 5 J = 8.7 Hz, H-8), 7.65-7.68 (m, 2H, H-3), 7.76 (psd, 2H, 3 J + 5 J = 8.5 Hz, H-7). MS (EI +): m / z (%) = 283/285 (95, M + ), 204 (100, [M-Br] + · ). HRMS (EI +): calculated: 284.997614, found 284.997165. EA: calculated: 63.40% C, 3.55% H; 4.93% N, found: 63.44% C, 3.79% H; 4.91% N.
SCH107 (Z)-3-(2-Bromphenyl)-2-phenylacrylnitril (SCH107) SCH107 (Z) -3- (2-bromophenyl) -2-phenylacrylonitrile (SCH107)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.30 (dt, 1H; 3J = 7.6, 4 4J = 1.6 Hz; H-1), 7.41-7.50 (m, 4H; H-2+H-3), 7.67 (dd, 1H; 3J = 8.0, 4J = 1.1 Hz; H-7), 7.71-7.74 (m, 2H; H-8+H-9), 7.84 (s, 1H; H-5), 8.07 (dd, 1H; 3J = 7.8, 4J = 1.6 Hz; H-10). MS (EI+): m/z (%) = 283/285 (42, M+·), 204 (100, [M-Br]+·). HRMS (EI+): berechnet: 282.999661, gefunden 283.000236. EA: berechnet: 63.40% C, 3.55% H; 4.93% N, gefunden: 63.27% C, 3.66% H; 5.11% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.30 (dt, 1H, 3 J = 7.6, 4 4 J = 1.6 Hz, H-1), 7.41-7.50 (m , 4H, H-2 + H-3), 7.67 (dd, 1H, 3 J = 8.0, 4 J = 1.1 Hz, H-7), 7.71-7.74 (m, 2H, H-8 + H-9) , 7.84 (s, 1H, H-5), 8.07 (dd, 1H, 3 J = 7.8, 4 J = 1.6 Hz, H-10). MS (EI +): m / z (%) = 283/285 (42, M + ), 204 (100, [M-Br] + · ). HRMS (EI +): calculated: 282.999661, found 283.000236. EA: calculated: 63.40% C, 3.55% H; 4.93% N, found: 63.27% C, 3.66% H; 5.11% N.
SCH108 (Z)-3-(4-Methoxyphenyl)-2-phenylacrylnitril (SCH108) SCH108 (Z) -3- (4-methoxyphenyl) -2-phenylacrylonitrile (SCH108)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.86 (s, 3H; CH3), 6.98 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 7.36–7.39 (sm, 1H; H-1), 7.41-7.45 (m, 2H; H-7), 7.46 (s, 1H; H-5), 7.63-7.66 (m, 2H; H-3), 7.89 (psd, 2H; 3J + 5J = 8.5 Hz; H-2). MS (EI+): m/z (%) = 235 (100, M+·). HRMS (EI+): berechnet: 235.099714, gefunden 235.103443. EA: berechnet: 81.68% C, 5.57% H; 5.95% N, gefunden: 81.58% C, 5.64% H; 5.94% N. 1 H NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.86 (s, 3H, CH 3 ), 6.98 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8 ), 7.36-7.39 (sm, 1H, H-1), 7.41-7.45 (m, 2H, H-7), 7.46 (s, 1H, H-5), 7.63-7.66 (m, 2H, H-3 ), 7.89 (psd, 2H, 3 J + 5 J = 8.5 Hz, H-2). MS (EI +): m / z (%) = 235 (100, M + * ). HRMS (EI +): calculated: 235.099714, found 235.103443. EA: calculated: 81.68% C, 5.57% H; 5.95% N, found: 81.58% C, 5.64% H; 5.94% N.
SCH109 (Z)-3-(4-Chlorphenyl)-2-phenylacrylnitril (SCH109) SCH109 (Z) -3- (4-chlorophenyl) -2-phenylacrylonitrile (SCH109)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.38-7.47 (m, 5H; H-1+H-2+H-3), 7.48 (s, 1H; H5), 7.65-7.68 (m, 2H; H-8), 7.83 (psd, 2H; 3J + 5J = 8.5 Hz; H-7). MS (EI+): m/z (%) = 239 (93, M+·), 204 (100, [M-CI]+·). HRMS (EI+): berechnet: 241.047227, gefunden 241.047909. EA: berechnet: 75.16% C, 4.21% H; 5.84% N, gefunden: 75.07% C, 4.49% H; 5.87% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.38-7.47 (m, 5H, H-1 + H-2 + H-3), 7.48 (s, 1H, H5 ), 7.65-7.68 (m, 2H, H-8), 7.83 (psd, 2H, 3 J + 5 J = 8.5 Hz, H-7). MS (EI +): m / z (%) = 239 (93, M + ), 204 (100, [M-CI] + · ). HRMS (EI +): calculated: 241.047227, found 241.047909. EA: calculated: 75.16% C, 4.21% H; 5.84% N, found: 75.07% C, 4.49% H; 5.87% N.
SCH110 (Z)-2-Phenyl-3-[4-(trifluormethyl)phenyl]acrylnitril (SCH110) SCH110 (Z) -2-phenyl-3- [4- (trifluoromethyl) phenyl] acrylonitrile (SCH110)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.41-7.50 (m, 3H; H-1+H-2), 7.57 (s, 1H; H-5), 7.68-7.74 (m, 4H; H-3+H-8), 7.98 (psd, 2H; 3J + 5J = 8.5 Hz; H-7). MS (EI+): m/z (%) = 273 (100, M+·), 204(25, [M-CF3]+·). HRMS (EI+): berechnet: 273.076534, gefunden 273.077826. EA: berechnet: 70.33% C, 3.69% H; 5.13% N, gefunden: 70.50% C, 4.09% H; 5.11% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.41-7.50 (m, 3H, H-1 + H-2), 7.57 (s, 1H, H-5), 7.68-7.74 (m, 4H, H-3 + H-8), 7.98 (psd, 2H, 3 J + 5 J = 8.5 Hz, H-7). MS (EI +): m / z (%) = 273 (100, M + ), 204 (25, [M-CF 3 ] + · ). HRMS (EI +): calculated: 273.076534, found 273.077826. EA: calculated: 70.33% C, 3.69% H; 5.13% N, found: 70.50% C, 4.09% H; 5.11% N.
SCH114 (Z)-3-(3-Bromphenyl)-2-phenylacrylnitril (SCH114) SCH114 (Z) -3- (3-bromophenyl) -2-phenylacrylonitrile (SCH114)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.35 (t, 1H; 3J = 7.9 Hz; H-8), 7.40-7.49 (m, 4H; H-1+H-2+H-5), 7.56 (dq, 1H; 3J = 8.0, 4J = 0.9 Hz; H-9), 7.65-7.68 (m, 2H; H-3), 7.89 (dq, 1H; 3J = 7.8, 4J = 0.9 Hz; H-7), 7.93 (t, 1H; 4J = 1.8 Hz; H-10). MS (EI+): m/z (%) = 283/285 (71, M+·), 204 (100, [M-Br]+·). HRMS (EI+): berechnet: 284.997614, gefunden 284.001532. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.35 (t, 1H, 3 J = 7.9 Hz, H-8), 7.40-7.49 (m, 4H, H-1 + H-2 + H-5), 7.56 (dq, 1H, 3 J = 8.0, 4 J = 0.9 Hz, H-9), 7.65-7.68 (m, 2H, H-3), 7.89 (dq, 1H 3 J = 7.8, 4 J = 0.9 Hz, H-7), 7.93 (t, 1H, 4 J = 1.8 Hz, H-10). MS (EI +): m / z (%) = 283/285 (71, M + * ), 204 (100, [M-Br] + · ). HRMS (EI +): calculated: 284.997614, found 284.001532.
- SCH117 siehe obenSCH117 see above
SCH122 (Z)-3-[3-(Dimethylamino)phenyl]-2-phenylacrylnitril (SCH122) SCH122 (Z) -3- [3- (dimethylamino) phenyl] -2-phenylacrylonitrile (SCH122)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 2.74 (s, 6H; CH3), 6.45 (t, 1H; 4J = 2.1 Hz; H-10), 6.53 (dt, 1H; 3J = 7.6, 4J = 0.7 Hz; H-9), 6.65 (dd, 1H; 3J = 8.1, 4J = 2.1 Hz; H-7), 7.10 (t, 1H; 3J = 8.0 Hz; H-8), 7.31-7.45 (m, 6H; H-1+2+3+5). MS (EI+): m/z (%) = 248 (100, M+·). HRMS (EI+): berechnet: 248.131349, gefunden 248.136093. EA: berechnet: 82.22% C, 6.49% H; 11.28% N, gefunden: 81.88% C, 6.72% H; 11.18% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 2.74 (s, 6H, CH 3 ), 6.45 (t, 1H, 4 J = 2.1 Hz, H-10), 6.53 (dt, 1H, 3 J = 7.6, 4 J = 0.7 Hz, H-9), 6.65 (dd, 1H, 3 J = 8.1, 4 J = 2.1 Hz, H-7), 7.10 (t, 1H, 3 J = 8.0 Hz, H-8), 7.31-7.45 (m, 6H, H-1 + 2 + 3 + 5). MS (EI +): m / z (%) = 248 (100, M + * ). HRMS (EI +): calculated: 248.131349, found 248.136093. EA: calculated: 82.22% C, 6.49% H; 11.28% N, found: 81.88% C, 6.72% H; 11.18% N.
SCH125 (Z)-3-(4-Aminophenyl)-2-phenylacrylnitril (SCH125) SCH125 (Z) -3- (4-aminophenyl) -2-phenylacrylonitrile (SCH125)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 5.97 (s, 2H; NH2), 6.62 (psd, 2H; 3J + 5J = 8.5 Hz; H-8), 7.29-7.34 (sm, 1H; H-1), 7.39-7.45 (m, 2H; H-2), 7.60-7.64 (m, 2H; H-3), 7.69 (s, 1H; H-5), 7.71 (psd, 2H; 3J + 5J = 8.7 Hz; H-7). MS (EI+): m/z (%) = 220 (100, M+·). HRMS (EI+): berechnet: 220.100048, gefunden 220.099022. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 5.97 (s, 2H, NH 2 ), 6.62 (psd, 2H, 3 J + 5 J = 8.5 Hz; H -8), 7.29-7.34 (sm, 1H, H-1), 7.39-7.45 (m, 2H, H-2), 7.60-7.64 (m, 2H, H-3), 7.69 (s, 1H, H -5), 7.71 (psd, 2H, 3 J + 5 J = 8.7 Hz, H-7). MS (EI +): m / z (%) = 220 (100, M + * ). HRMS (EI +): calculated: 220.100048, found 220.099022.
SCH127 3-[4-(Dimethylamino)phenyl]-2-phenylpropannitril (SCH127) SCH127 3- [4- (dimethylamino) phenyl] -2-phenylpropanenitrile (SCH127)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 2.93 (s, 6H; CH3), 3.07(sm, 2H; H-5), 3.94 (dd, 1H; 3J = 6.4, 3J = 8.2 Hz; CH-CN), 6.67 (psd, 2H; 3J + 5J = 7.3 Hz; H-8), 7.01 (psd, 2H; 3J + 5J = 8.7 Hz; H-7), 7.25-7.39 (m, 5H; H-1+2+3). MS (EI+): m/z (%) = 250 (7, M+·), 134 (100, [CH2PhNMe2]+·). HRMS (EI+): berechnet: 250.146999, gefunden 250.148003. EA: berechnet: 81.56% C, 7.25% H; 11.19% N, gefunden: 81.39% C, 7.10% H; 11.03% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 2.93 (s, 6H, CH 3 ), 3.07 (sm, 2H, H-5), 3.94 (dd, 1H, 3 J = 6.4, 3 J = 8.2 Hz, CH-CN), 6.67 (psd, 2H, 3 J + 5 J = 7.3 Hz, H-8), 7.01 (psd, 2H, 3 J + 5 J = 8.7 Hz; H-7), 7.25-7.39 (m, 5H, H-1 + 2 + 3). MS (EI +): m / z (%) = 250 (7, M + ), 134 (100, [CH 2 PhNMe 2 ] + · ). HRMS (EI +): calculated: 250.146999, found 250.148003. EA: calculated: 81.56% C, 7.25% H; 11.19% N, found: 81.39% C, 7.10% H; 11.03% N.
SCH129 (Z)-3-[4-(Dimethylamino)phenyl]-2-(pyridin-2-yl)acrylnitril (SCH129) SCH129 (Z) -3- [4- (dimethylamino) phenyl] -2- (pyridin-2-yl) acrylonitrile (SCH129)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; CH3), 6.72 (psd, 2H; 3J + 5J = 9.2 Hz; H-9), 7.18 (ddd, 1H; 3J = 7.1 3J = 4.8, 4J = 1.4 Hz; H-2), 7.68 (dt, 1H; 3J = 8.0, 5J = 1.1 Hz; H-4), 7.72 (ddd, 1H; 3J = 8.0 3J = 7.3, 4J = 1.8 Hz; H-3), 7.97 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 8.33 (s, 1H; H-6), 8.59 (dq, 1H; 3J = 4.8, 5J = 0.9 Hz; H-1). MS (EI+): m/z (%) = 249 (100, M+·), 249 (96, [M-H]+·), 232 (20, [M-CH4H]+·). HRMS (EI+): berechnet: 249.126598, gefunden 249.128778. EA: berechnet: 77.08% C, 6.06% H; 16.85% N, gefunden: 76.81% C, 6.10% H; 16.79% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, CH 3 ), 6.72 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-9 ), 7.18 (ddd, 1H, 3 J = 7.1 3 J = 4.8, 4 J = 1.4 Hz, H-2), 7.68 (dt, 1H, 3 J = 8.0, 5 J = 1.1 Hz, H-4), 7.72 (ddd, 1H, 3 J = 8.0 3 J = 7.3, 4 J = 1.8 Hz, H-3), 7.97 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8), 8.33 (s, 1H, H-6), 8.59 (dq, 1H, 3 J = 4.8, 5 J = 0.9 Hz, H-1). MS (EI +): m / z (%) = 249 (100, M + ), 249 (96, [MH] + · ), 232 (20, [M-CH 4 H] + · ). HRMS (EI +): calculated: 249.126598, found 249.128778. EA: calculated: 77.08% C, 6.06% H; 16.85% N, found: 76.81% C, 6.10% H; 16.79% N.
SCH131 (Z)-3-(4-Morpholinphenyl)-2-phenylacrylnitril (SCH131) SCH131 (Z) -3- (4-morpholinophenyl) -2-phenylacrylonitrile (SCH131)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.29 (dd, 4H; 3J = 5.0, 3J = 4.8 Hz; H-10), 3.87 (dd, 4H; 3J = 5.0, 3J = 4.8 Hz; H-11), 6.92 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 7.32-7.38 (m, 1H; H-1), 7.42 (s, 1H; H-5), 7.39-7.45 (m, 2H; H-2), 7.62-7.66 (m, 2H; H-3), 7.87 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 290 (100, M+·), 232 (71, [M-CH2OCH2CH2]+·), 204 (29, [M-N(CH2CH2)2O]+·). HRMS (EI+): berechnet: 290.141913, gefunden 290.144040. EA: berechnet: C. 78.59% C, 6.25% H; 9.65% N, gefunden: 78.39% C, 6.33% H; 9.47% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.29 (dd, 4H, 3 J = 5.0, 3 J = 4.8 Hz, H-10), 3.87 (dd, 4H; 3 J = 5.0, 3 J = 4.8 Hz, H-11), 6.92 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8), 7.32-7.38 (m, 1H, H-1), 7.42 (s, 1H, H-5), 7.39-7.45 (m, 2H, H-2), 7.62-7.66 (m, 2H, H-3), 7.87 (psd, 2H, 3 J + 5 J = 8.9 Hz ; H-7). MS (EI +): m / z (%) = 290 (100, M + ), 232 (71, [M-CH 2 OCH 2 CH 2 ] + · ), 204 (29, [MN (CH 2 CH 2 ) 2 O] + · ). HRMS (EI +): calculated: 290.141913, found 290.144040. EA: calculated: C. 78.59% C, 6.25% H; 9.65% N, found: 78.39% C, 6.33% H; 9.47% N.
SCH132 (Z)-3-[4-(4-Methylpiperazin-1-yl)phenyl]-2-phenylacrylnitril (SCH132) SCH132 (Z) -3- [4- (4-methylpiperazin-1-yl) phenyl] -2-phenylacrylonitrile (SCH132)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.19 (s, 3H; CH3), 2.41 (t, 4H; 3J = 5.0 Hz; H-10), 3.30 (t, 4H; 3J = 5.0 Hz; H-11), 7.02 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.32-7.37 (sm, 1H; H-1), 7.41-7.47 (m, 2H; H-2), 7.64-7.69 (m, 2H; H-3), 7.81 (s, 1H; H-5), 7.84 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 303 (100, M+·). HRMS (EI+): berechnet: 303.173548, gefunden 303.171852. EA: berechnet: 79.17% C, 6.98% H; 13.85% N, gefunden: 78.95% C, 7.01% H; 13.86% N. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.19 (s, 3H, CH 3 ), 2.41 (t, 4H, 3 J = 5.0 Hz, H-10) , 3.30 (t, 4H, 3 J = 5.0 Hz, H-11), 7.02 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-8), 7.32-7.37 (sm, 1H, H-1) , 7.41-7.47 (m, 2H, H-2), 7.64-7.69 (m, 2H, H-3), 7.81 (s, 1H, H-5), 7.84 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 303 (100, M + * ). HRMS (EI +): calculated: 303.173548, found 303.171852. EA: calculated: 79.17% C, 6.98% H; 13.85% N, found: 78.95% C, 7.01% H; 13.86% N.
SCH136 (Z)-3-{4-[(Dimethylamino)methyl]phenyl}-2-phenylacrylnitril (SCH136) (Hydrochlorid) SCH136 (Z) -3- {4 - [(dimethylamino) methyl] phenyl} -2-phenylacrylonitrile (SCH136) (hydrochloride)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.68 (s, 6H; CH3), 4.31 (s, 2H; CH2), 7.42-7.47 (sm, 1H; H-1), 7.48-7.54 (m, 2H; H-2), 7.71-7.78 (m, 4H; H-3+8), 7.97 (psd, 2H; 3J + 5J = 8.2 Hz; H-7), 8.07 (s, 1H; H-5), 11.04 (bs, 1H; HCl). MS (EI+): m/z (%) = 262 (100, M+·), 218 (60, [M-N(CH3)2]+·). HRMS (EI+): berechnet: 262.146999, gefunden 262.145737. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.68 (s, 6H, CH 3 ), 4.31 (s, 2H, CH 2 ), 7.42-7.47 (sm, 1H, H-1), 7.48-7.54 (m, 2H, H-2), 7.71-7.78 (m, 4H, H-3 + 8), 7.97 (psd, 2H, 3 J + 5 J = 8.2 Hz; H-7), 8.07 (s, 1H, H-5), 11.04 (bs, 1H, HCl). MS (EI +): m / z (%) = 262 (100, M + * ), 218 (60, [MN (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 262.146999, found 262.145737.
SCH138 (Z)-2-(2-Chlorphenyl)-3-[4-(dimethylamino)phenyl]acrylnitril (SCH138) SCH138 (Z) -2- (2-Chlorophenyl) -3- [4- (dimethylamino) phenyl] acrylonitrile (SCH138)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 8.9 Hz; H-9), 7.12 (s, 1H; H-6), 7.26-7.33 (m, 2H; H-2+3), 7.40-7.46 (m, 2H; H-1+4), 7.85 (psd, 2H; 3J + 5J = 8.9 Hz; H-8). MS (EI+): m/z (%) = 282 (100, M+·), 203 (27, [M-Cl-N(CH3)2]+·). HRMS (EI+): berechnet: 282.092376, gefunden 282.094431. EA: berechnet: 72.21% C, 5.3,5% H; 9.91% N, gefunden: 72.43% C, 5.53% H; 10.00% N. Schmelzpunkt (nicht korrigiert): 99°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 8.9 Hz; H-9 ), 7.12 (s, 1H, H-6), 7.26-7.33 (m, 2H, H-2 + 3), 7.40-7.46 (m, 2H, H-1 + 4), 7.85 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8). MS (EI +): m / z (%) = 282 (100, M + ), 203 (27, [M-Cl-N (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 282.092376, found 282.094431. EA: calculated: 72.21% C, 5.3.5% H; 9.91% N, found: 72.43% C, 5.53% H; 10.00% N. Melting point (uncorrected): 99 ° C.
SCH139 (Z)-2-(4-Chlorphenyl)-3-[4-(dimethylamino)phenyl]acrylnitril (SCH139) SCH139 (Z) -2- (4-Chlorophenyl) -3- [4- (dimethylamino) phenyl] acrylonitrile (SCH139)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.74 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 7.35-7.38 (m, 3H; H2+4), 7.55 (psd, 2H; 3J + 5J = 8.7 Hz; H-1), 7.85 (psd, 2H; 3J + 5J = 8.9 Hz; H-6). MS (EI+): m/z, (%) = 282 (100, M+·), 203 (18, [M-Cl-N(CH3)2]+·). HRMS (EI+): berechnet: 282.092376, gefunden 282.093166. EA: berechnet: 72.21% C, 5.35% H; 9.91% N, gefunden: 72.06% C, 5.37% H; 9.85% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.74 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7 ), 7.35-7.38 (m, 3H, H2 + 4), 7.55 (psd, 2H, 3 J + 5 J = 8.7 Hz, H-1), 7.85 (psd, 2H, 3 J + 5 J = 8.9 Hz; H-6). MS (EI +): m / z, (%) = 282 (100, M + ), 203 (18, [M-Cl-N (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 282.092376, found 282.093166. EA: calculated: 72.21% C, 5.35% H; 9.91% N, found: 72.06% C, 5.37% H; 9.85% N.
SCH140 (Z)-3-[4-(Dimethylamino)phenyl]-2-(4-nitrophenyl)acrylnitril (SCH140) SCH140 (Z) -3- [4- (dimethylamino) phenyl] -2- (4-nitrophenyl) acrylonitrile (SCH140)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.10 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 7.54 (s, 1H; H-4), 7.77 (psd, 2H; 3J + 5J = 9.2 Hz; H-2), 7.91 (psd, 2H; 3J + 5J = 8.9 Hz; H-6), 8.25 (psd, 2H; 3J + 5J = 9.2 Hz; H-1). MS (EI+): m/z (%) = 293 (100, M+·, 263 (77, [M-(CH3)2]+·), 247 (29, [M-NO2]+·). HRMS (EI+): berechnet: 293.116427, gefunden 293.115855. EA: berechnet: 69.61% C, 5.15% H; 14.33% N, gefunden: 69.34% C, 5.24% H; 14.38% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.10 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7 ), 7:54 (s, 1H, H-4), 7.77 (psd, 2H, 3 J = 9.2 Hz + 5 J H-2), 7.91 (psd, 2H, 3 J = 8.9 Hz + 5 J; H- 6), 8.25 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-1). MS (EI +): m / z (%) = 293 (100, M + · , 263 (77, [M- (CH 3 ) 2 ] + · ), 247 (29, [M-NO 2 ] + · ) HRMS (EI +): calculated: 293.116427, found 293.115855 EA: calculated: 69.61% C, 5.15% H, 14.33% N, found: 69.34% C, 5.24% H, 14.38% N.
SCH141 (Z)-3-[4-(Dimethylamino)phenyl]-2-(4-methoxyphenyl)acrylnitril (SCH141) SCH141 (Z) -3- [4- (dimethylamino) phenyl] -2- (4-methoxyphenyl) acrylonitrile (SCH141)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.05 (s, 6H; NCH3), 3.84 (s, 3H; OCH3), 6.74 (psd, 2H; 3J + 5J = 7.3 Hz; H-7), 6.93 (psd, 2H; 3J + 5J = 8.9 Hz; H-1), 7.30 (s, 1H; H-4), 7.56 (psd, 2H; 3J + 5J = 8.9 Hz; H-2), 7.83 (psd, 2H; 3J + 5J = 8.9 Hz; H-6). MS (EI+): m/z (%)= 278 (100, M+·), 263 (27, [M-CH3]+·). HRMS (EI+): berechnet: 278.141913, gefunden 278.144148. EA: berechnet: 77.67% C, 6.52% H; 10.06% N, gefunden: 7716% C, 6.61% H; 10.05% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.05 (s, 6H, NCH 3 ), 3.84 (s, 3H, OCH 3 ), 6.74 (psd, 2H, 3 J + 5 J = 7.3 Hz, H-7), 6.93 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-1), 7.30 (s, 1H, H-4), 7.56 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-2), 7.83 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-6). MS (EI +): m / z (%) = 278 (100, M + * ), 263 (27, [M-CH 3 ] + · ). HRMS (EI +): calculated: 278.141913, found 278.144148. EA: calculated: 77.67% C, 6.52% H; 10.06% N, found: 7716% C, 6.61% H; 10.05% N.
SCH142 (Z)-2-(2,6-Dichlorphenyl)-3-[4-(dimethylamino)phenyl]acrylnitril (SCH142) SCH142 (Z) -2- (2,6-dichlorophenyl) -3- [4- (dimethylamino) phenyl] acrylonitrile (SCH142)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; CH3), 6.72 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 6.93 (s, 1H; H-4), 7.24 (dd, 1H; 3J = 8.7, 3J = 7.6 Hz; H-1), 7.39 (d, 2H; 3J = 7.6 Hz; H-2), 7.86 (psd, 2H; 3J + 5J = 8.9 Hz; H-6). MS (EI+): m/z (%) = 316 (100, M+·), 246 (24, [M-2Cl]+·), 203 (25, [M-2Cl-N(CH3)2]+·). HRMS (EI+): berechnet: 316.053404, gefunden 316.051077. Schmelzpunkt (nicht korrigiert): 146°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, CH 3 ), 6.72 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7 ), 6.93 (s, 1H, H-4), 7.24 (dd, 1H, 3 J = 8.7, 3 J = 7.6 Hz, H-1), 7.39 (d, 2H, 3 J = 7.6 Hz, H-2 ), 7.86 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-6). MS (EI +): m / z (%) = 316 (100, M + · ), 246 (24, [M-2Cl] + · ), 203 (25, [M-2Cl-N (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 316.053404, found 316.051077. Melting point (uncorrected): 146 ° C.
SCH143 (Z)-2-Phenyl-3-[4-(piperidin-1-yl)phenyl]acrylnitril (SCH143) SCH143 (Z) -2-Phenyl-3- [4- (piperidin-1-yl) phenyl] acrylonitrile (SCH143)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 1.6-1.76 (m, 6H; H-11+12), 3.31-3.37 (m, 4H; H-10), 6.92 (psd, 2H; 3J + 5J = 7.8 Hz; H-8), 7.30-7.35 (m, 1H; H-1), 7.38-7.44 (m, 3H; H-2+5), 7.61-7.66 (m, 2H; H-3), 7.84 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 288 (100, M+·). HRMS (EI+): berechnet: 288.162649, gefunden 288.164001. EA: berechnet: 83.30% C, 6.99% H; 9.71% N, gefunden: 83.23% C, 7.14% H; 9.81% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 1.6-1.76 (m, 6H, H-11 + 12), 3.31-3.37 (m, 4H, H-10), 6.92 (psd, 2H, 3 J = 7.8 Hz + 5 J H-8), 7:30 to 7:35 (m, 1H, H-1), 7:38 to 7:44 (m, 3H; H-2 + 5), 7.61- 7.66 (m, 2H, H-3), 7.84 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 288 (100, M + * ). HRMS (EI +): calculated: 288.162649, found 288.164001. EA: calculated: 83.30% C, 6.99% H; 9.71% N, found: 83.23% C, 7.14% H; 9.81% N.
SCH144 (Z)-2-Phenyl-3-[4-(pyrrolidin-1-yl)phenyl]acrylnitril (SCH144) SCH144 (Z) -2-phenyl-3- [4- (pyrrolidin-1-yl) phenyl] acrylonitrile (SCH144)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 2.01-2.07 (sm, 4H; H-10), 3.34-3.40 (sm, 4H; H-9), 6.58 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 7.28-7.33 (sm, 1H; H-1), 7.37-7.43 (m, 3H; H-2+5), 7.61-7.65 (m, 2H; H-3), 7.86 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 274 (100, M+·). HRMS (EI+): berechnet 274.146999, gefunden 274.144312. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 2.01-2.07 (sm, 4H, H-10), 3.34-3.40 (sm, 4H, H-9), 6.58 ( psd, 2H, 3 J = 8.9 Hz + 5 J H-8), 7:28 to 7:33 (sm, 1H; H-1), 7:37 to 7:43 (m, 3H; H-2 + 5), 7.61-7.65 ( m, 2H, H-3), 7.86 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 274 (100, M + * ). HRMS (EI +): calculated 274.146999, found 274.144312.
SCH145 (Z)-2-(2-Chlorphenyl)-3-[4-(piperidin-1-yl)phenyl]acrylnitril SCH145 (Z) -2- (2-Chlorophenyl) -3- [4- (piperidin-1-yl) phenyl] acrylonitrile
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 1.53-1.59 (m, 6H, H-12+13), 1.32-1.37 (m, 4H, H-11), 6.99 (psd, 2H, 3J + 5J = 9.2 Hz; H-9), 7.33 (s, 1H, H-6), 7.40-7.44 (m, 2H, H-2+3), 7.49-7.46 (m, 2H, H-1+4), 7.80 (psd, 2H, 3J + 5J = 8.9 Hz; H-8). MS (ESI+): m/z (%) = 323 (100, [M+H]+), 345 (19, [M+Na]+). 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 1.53-1.59 (m, 6H, H-12 + 13), 1.32-1.37 (m, 4H, H-11 ), 6.99 (psd, 2H, 3 J = 9.2 Hz + 5 J H-9), 7:33 (s, 1H, H-6), 7:40 to 7:44 (m, 2H, H-2 + 3), 7.49- 7.46 (m, 2H, H-1 + 4), 7.80 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8). MS (ESI +): m / z (%) = 323 (100, [M + H] + ), 345 (19, [M + Na] + ).
SCH148 (Z)-3-[4-(Dimethylamino)phenyl]-2-(2-methoxyphenyl)acrylnitril (SCH148) SCH148 (Z) -3- [4- (dimethylamino) phenyl] -2- (2-methoxyphenyl) acrylonitrile (SCH148)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.05 (s, 6H; NCH3), 3.91 (s, 3H; OCH3), 6.76 (psd, 2H; 3J + 5J = 7.1 Hz; H-9), 6.94 (dd, 1H; 3J = 8.2, 4J = 0.7 Hz; H-1), 6.99 (td, 1H; 3J = 7.6, 4J = 1.1 Hz; H-3), 7.28 (s, 1H; H-6), 7.32 (ddd, 1H; 3J = 8.2, 3J = 7.4, 4J = 1.6 Hz; H-2), 7.38 (dd, 1H; 3J = 7.6, 4J = 1.6 Hz; H-4), 7.84 (psd, 2H; 3J + 5J = 8.7 Hz; H-8). MS (EI+): m/z (%) = 278 (100, M+·), 248 (13, [M-OCH3-2CH3]+·), 235 (10, [M-3CH3]+·), 147 (38, [Ph(OCH3)CCN]+·). HRMS (EI+): berechnet: 278.141913, gefunden 278.140550. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.05 (s, 6H, NCH 3 ), 3.91 (s, 3H, OCH 3 ), 6.76 (psd, 2H, 3 J + 5 J = 7.1 Hz, H-9), 6.94 (dd, 1H, 3 J = 8.2, 4 J = 0.7 Hz, H-1), 6.99 (td, 1H, 3 J = 7.6, 4 J = 1.1 Hz ; H-3), 7.28 (s, 1H, H-6), 7:32 (ddd, 1H, 3 J = 8.2, 3 J = 7.4, 4 J = 1.6 Hz; H-2), 7:38 (dd, 1H; 3 J = 7.6, 4 J = 1.6 Hz, H-4), 7.84 (psd, 2H, 3 J + 5 J = 8.7 Hz, H-8). MS (EI +): m / z (%) = 278 (100, M + ), 248 (13, [M-OCH 3 -2CH 3 ] + · ), 235 (10, [M-3CH 3 ] + · ), 147 (38, [Ph (OCH 3 ) CCN] + · ). HRMS (EI +): calculated: 278.141913, found 278.140550.
SCH149 (Z)-2-(2-Bromphenyl)-3-[4-(dimethylamino)phenyl]acryinitril (SCH149) SCH149 (Z) -2- (2-Bromophenyl) -3- [4- (dimethylamino) phenyl] acryinitrile (SCH149)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.72 (psd, 2H; 3J + 5J = 9.2 Hz; H-9), 7.07 (s, 1H; H-6), 7.21 (ddd, 1H; 3J = 7.6, 4J = 1.8, 5J = 0.5 Hz; H-4), 7.35 (td, 1H; 3J = 7.6, 4J = 1.4 Hz; H-3), 7.41 (dd, 1H; 3J = 7.6, 4J = 1.8 Hz; H-2), 7.64 (dd, 1H; 3J = 8.0, 4J = 1.1 Hz; H-1), 7.85 (psd, 2H; 3J + 5J = 8.9 Hz; H-8). MS (EI+): m/z (%) = 326/328 (100, M+·), 203 (40, [M-Br-N(CH3)2]+·). HRMS (EI+): berechnet: 326.041860, gefunden 326.042488. EA: berechnet: 62.40% C, 4.62% H; 8.56% N, gefunden: 62.34% C, 4.79% H; 8.44% N. Schmelzpunkt (nicht korrigiert): 140°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.72 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-9 ), 7.07 (s, 1H, H-6), 7.21 (ddd, 1H, 3 J = 7.6, 4 J = 1.8, 5 J = 0.5 Hz, H-4), 7.35 (td, 1H, 3 J = 7.6 , 4 J = 1.4 Hz, H-3), 7.41 (dd, 1H, 3 J = 7.6, 4 J = 1.8 Hz, H-2), 7.64 (dd, 1H, 3 J = 8.0, 4 J = 1.1 Hz H-1), 7.85 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8). MS (EI +): m / z (%) = 326/328 (100, M + ), 203 (40, [M-Br-N (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 326.041860, found 326.042488. EA: calculated: 62.40% C, 4.62% H; 8.56% N, found: 62.34% C, 4.79% H; 8.44% N. Melting point (uncorrected): 140 ° C.
SCH150 (Z)-3-[4-(Dimethylamino)phenyl]-2-[2-(trifluormethyl)phenyl]acrylnitril (SCH150) SCH150 (Z) -3- [4- (dimethylamino) phenyl] -2- [2- (trifluoromethyl) phenyl] acrylonitrile (SCH150)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; CH3), 6.80 (psd, 2H; 3J + 5J = 8.2 Hz; H-9), 6.98 (s, 1H; H-6), 7.46-7.52 (m, 2H; H-2+4), 7.56-7.61 (m, 1H; H-3), 7.72-7.76 (m, 1H; H-1), 7.82 (psd, 2H; 3J + 5J = 8.9 Hz; H-8). MS (EI+): m/z (%) = 316 (100, M+·). HRMS (EI+): berechnet: 316.118733, gefunden 316.117731. Schmelzpunkt (nicht korrigiert): 110°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, CH 3 ), 6.80 (psd, 2H, 3 J + 5 J = 8.2 Hz, H-9 ), 6.98 (s, 1H, H-6), 7.46-7.52 (m, 2H, H-2 + 4), 7.56-7.61 (m, 1H, H-3), 7.72-7.76 (m, 1H, H -1), 7.82 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8). MS (EI +): m / z (%) = 316 (100, M + * ). HRMS (EI +): calculated: 316.118733, found 316.117731. Melting point (uncorrected): 110 ° C.
- SCH151 siehe obenSCH151 see above
SCH156 (E)-2-[4-(Dimethylamino)phenyl]-3-phenylacrylnitril (SCH156) SCH156 (E) -2- [4- (dimethylamino) phenyl] -3-phenylacrylonitrile (SCH156)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.03 (s, 6H; CH3), 7.76 (psd, 2H; 3J + 5J = 8.0 Hz; H-8), 7.35-7.47 (m, 4H; H-1+2+5), 7.57 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 7.82-7.86 (m, 2H; H-3). MS (EI+): m/z (%) = 248 (100, M+·), 204 (13, [M-N(CH3)2]+·). HRMS (EI+): berechnet: 248.131349, gefunden 248.131605. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.03 (s, 6H, CH 3 ), 7.76 (psd, 2H, 3 J + 5 J = 8.0 Hz; H-8 , 7.35-7.47 (m, 4H, H-1 + 2 + 5), 7.57 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7), 7.82-7.86 (m, 2H, H-3 ). MS (EI +): m / z (%) = 248 (100, M + ), 204 (13, [MN (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 248.131349, found 248.131605.
SCH158 (Z)-3-[4-(Dimethylamino)phenyl]-2-(2-fluorphenyl)acrylnitril (SCH158) SCH158 (Z) -3- [4- (dimethylamino) phenyl] -2- (2-fluorophenyl) acrylonitrile (SCH158)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.71 (pas, 2H; 3J + 5J = 9.2 Hz; H-9), 7.12 (ddd, 1H; 3JH,F = 11.2, 3J = 8.2, 4J = 1.1 Hz; H-1), 7.19 (td, 1H; 3J = 7.6, 4J = 1.1 Hz; H-3), 7.26-7.32 (sm, 1H; H-4), 7.42 (s, 1H; H-6), 7.54 (td, 1H; 3J = 7.8, 4J = 1.8 Hz; H-2), 7.86 (psd, 2H; 3J + 5J = 8.9 Hz; H-8). MS (EI+): m/z (%) = 266 (100, HRMS (EI+): berechnet: 266.121927, gefunden 266.123324. EA: berechnet: 76.67% C, 5.68% H; 10.52% N, gefunden: 76.57% C, 5.73% H; 10.50% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.71 (pas, 2H, 3 J + 5 J = 9.2 Hz, H-9 ), 7.12 (ddd, 1H, 3 J H, F = 11.2, 3 J = 8.2, 4 J = 1.1 Hz, H-1), 7.19 (td, 1H, 3 J = 7.6, 4 J = 1.1 Hz, H -3), 7.26-7.32 (sm, 1H, H-4), 7.42 (s, 1H, H-6), 7.54 (td, 1H, 3 J = 7.8, 4 J = 1.8 Hz, H-2), 7.86 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8). MS (EI +): m / z (%) = 266 (100, HRMS (EI +): calculated: 266.121927, found 266.123324 EA: calculated: 76.67% C, 5.68% H, 10.52% N, found: 76.57% C, 5.73% H; 10.50% N
SCH159 (Z)-2-(2-Chlor-6-fluorphenyl)-3-[4-(dimethylamino)phenyl]acrylnitril (SCH159) SCH159 (Z) -2- (2-chloro-6-fluorophenyl) -3- [4- (dimethylamino) phenyl] acrylonitrile (SCH159)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; CH3), 6.74 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.03 (s, 1H; H-5), 7.08 (sm, 1H; H-2), 7.25-7.29 (m, 2H; H-1+3), 7.87 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 300 (100, M+·), 221 (21, [M-N(CH3)2-Cl]+·). HRMS (EI+): berechnet: 300.082955, gefunden 300.081259. EA: berechnet: 67.89% C, 4.69% H; 9.31% N, gefunden: 67.70% C, 4.82% H; 9.33% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, CH 3 ), 6.74 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-8 ), 7:03 (s, 1H, H-5), 7:08 (sm, 1H; H-2), 7:25 to 7:29 (m, 2H; H-1 + 3), 7.87 (psd, 2H; J 3 + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 300 (100, M + ), 221 (21, [MN (CH 3 ) 2 -Cl] + · ). HRMS (EI +): calculated: 300.082955, found 300.081259. EA: calculated: 67.89% C, 4.69% H; 9.31% N, found: 67.70% C, 4.82% H; 9.33% N.
SCH166 (2Z,4E)-5-[4-(Dimethylamino)phenyl]-2-phenylpenta-2,4-diennitril (SCH166) SCH166 (2Z, 4E) -5- [4- (dimethylamino) phenyl] -2-phenylpenta-2,4-dienitrile (SCH166)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.03 (s, 6H; CH3), 6.70 (psd, 2H; 3J + 5J = 9.0 Hz; H-10), 6.94 (d, 1H; 3J = 15.1 Hz; H-7), 7.20 (dd, 1H; 3J = 15.1, 3J = 11.2 Hz; H-6), 7.28-7.34 (sm, 1H; H-1), 7.37-7.42 (m, 3H; H-2+5), 7.45 (psd, 2H; 3J + 5J = 8.7 Hz; H-9), 7.58-7.62 (m, 2H; H-3). MS (EI+): m/z (%) = 274 (100, M+·), 197 (31, [M-Ph]+·). HRMS (EI+): berechnet: 274.146999, gefunden 274.146448. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.03 (s, 6H, CH 3 ), 6.70 (psd, 2H, 3 J + 5 J = 9.0 Hz, H-10 ), 6.94 (d, 1H, 3 J = 15.1 Hz, H-7), 7.20 (dd, 1H, 3 J = 15.1, 3 J = 11.2 Hz, H-6), 7.28-7.34 (sm, 1H, H -1), 7:37 to 7:42 (m, 3H; H-2 + 5), 7:45 (psd, 2H, 3 J = 8.7 + 5J Hz; H-9), 7.58-7.62 (m, 2H; H-3) , MS (EI +): m / z (%) = 274 (100, M + * ), 197 (31, [M-Ph] + · ). HRMS (EI +): calculated: 274.146999, found 274.146448.
SCH167 (Z)-3-[4-(Dimethylamino)phenyl]-2-(pyridin-4-yl)acrylnitril (SCH167) SCH167 (Z) -3- [4- (dimethylamino) phenyl] -2- (pyridin-4-yl) acrylonitrile (SCH167)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.08 (s, 6H; CH3), 6.71 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 7.52 (dd, 2H; 3J = 6.4, 4J = 1.8 Hz; H-2), 7.58 (s, 1H; H-4), 7.90 (psd, 2H; 3J + 5J = 8.9 Hz; H-6), 8.59-8.62 (sm, 2H; H-1). MS (EI+): m/z (%) = 249 (100, M+·), 234 (19, [M-CH3]+·), 206 (16, [M-N(CH3)2]+·). HRMS (EI+): berechnet: 249.126598, gefunden 249.128587. EA: berechnet: 77.08% C, 6.06% H; 16.85% N, gefunden: 76.82% C, 6.15% H; 16.91% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.08 (s, 6H, CH 3 ), 6.71 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7 ), 7.52 (dd, 2H, 3 J = 6.4, 4 J = 1.8 Hz, H-2), 7.58 (s, 1H, H-4), 7.90 (psd, 2H, 3 J + 5 J = 8.9 Hz; H-6), 8.59-8.62 (sm, 2H, H-1). MS (EI +): m / z (%) = 249 (100, M + ), 234 (19, [M-CH 3 ] + · ), 206 (16, [MN (CH 3 ) 2 ] + · ) , HRMS (EI +): calculated: 249.126598, found 249.128587. EA: calculated: 77.08% C, 6.06% H; 16.85% N, found: 76.82% C, 6.15% H; 16.91% N.
SCH168 (Z)-3-[4-(Dimethylamino)phenyl]-2-(pyridin-3-yl)acrylnitril (SCH168) SCH168 (Z) -3- [4- (dimethylamino) phenyl] -2- (pyridin-3-yl) acrylonitrile (SCH168)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.08 (s, 6H, CH3), 6.72 (psd, 2H; 3J + 5J = 9.2 Hz; H-9), 7.37 (dd, 1H; 3J = 8.0, 3J = 4.8 Hz; H-2), 7.43 (s, 1H; H-6), 7.88 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.95 (ddd, 1H; 3J = 8.0, 4J = 2.3, 4J = 1.8 Hz; H-3), 8.54 (dd, 1H; 3J = 4.8, 4J = 1.4 Hz; H-1), 8.88 (d, 1H; 4J = 2.5 Hz; H-5). MS (EI+): m/z (%) = 249 (100, M+·), 234 (31, [M-CH3]+·), 206 (22, [M-N(CH3)2]+·). HRMS (EI+): berechnet: 249.126598, gefunden 249.123689. EA: berechnet: 77.08% C, 6.06% H; 16.85% N, gefunden: 76.93% C, 6.14% H; 16.75% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.08 (s, 6H, CH 3 ), 6.72 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-9 ), 7.37 (dd, 1H, 3 J = 8.0, 3 J = 4.8 Hz, H-2), 7.43 (s, 1H, H-6), 7.88 (psd, 2H, 3 J + 5 J = 9.2 Hz; H-8), 7.95 (ddd, 1H, 3 J = 8.0, 4 J = 2.3, 4 J = 1.8 Hz, H-3), 8.54 (dd, 1H, 3 J = 4.8, 4 J = 1.4 Hz, H -1), 8.88 (d, 1H, 4 J = 2.5 Hz, H-5). MS (EI +): m / z (%) = 249 (100, M + ), 234 (31, [M-CH 3 ] + · ), 206 (22, [MN (CH 3 ) 2 ] + · ) , HRMS (EI +): calculated: 249.126598, found 249.123689. EA: calculated: 77.08% C, 6.06% H; 16.85% N, found: 76.93% C, 6.14% H; 16.75% N.
SCH169 (Z)-2-Phenyl-3-[4-(piperazin-1-yl)phenyl]acrylnitril (SCH169) SCH169 (Z) -2-phenyl-3- [4- (piperazin-1-yl) phenyl] acrylonitrile (SCH169)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.77-2.81 (sm, 4H; H-11), 3.19-3.23 (sm, 4H; H-12), 6.99 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.31-7.37 (sm, 1H; H-1), 7.41-7.47 (m, 2H; H-2), 7.64-7.68 (m, 2H; H-3), 7.80 (s, 1H; H-5), 7.84 (psd, 2H; 3J + 5J = 9.2 Hz; H-7). MS (EI+): m/z (%) = 289 (38, M+·), 247 (100, [M-N(CH2)2]+·) HRMS (EI+): berechnet: 289.157898, gefunden 289.155945. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.77-2.81 (sm, 4H, H-11), 3.19-3.23 (sm, 4H, H-12), 6.99 (psd, 2H, 3 J = 9.2 Hz + 5 J H-8), 7:31 to 7:37 (sm, 1H; H-1); (, 7.64-7.68, 7:41 to 7:47 (H-2 m, 2H) m, 2H, H-3), 7.80 (s, 1H, H-5), 7.84 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-7). MS (EI +): m / z (%) = 289 (38, M + ), 247 (100, [MN (CH 2 ) 2 ] + · ) HRMS (EI +): Calcd: 289.157898, found 289.155945.
SCH171 (Z)-2-(2-Bromphenyl)-3-[4-(piperidin-1-yl)phenyl]acrylnitril (SCH171) SCH171 (Z) -2- (2-Bromophenyl) -3- [4- (piperidin-1-yl) phenyl] acrylonitrile (SCH171)
- 1H-NMR (d6-DMSO, 80°C, 400 MHz): δH (ppm) = 1.58-1.64 (sm, 2H; H-13), 1.65-1.71 (sm, 4H; H-12), 3.36-3.40 (sm, 4H; H-11), 7.18 (psd, 2H; 3J + 5J = 8.6 Hz; H-9), 7.30 (s, 1H; H-6), 7.34 (ddd, 1H; 3J = 8.0, 3J = 7.4, 4J = 1.7 Hz; H-2), 7.46 (td, 1H; 3J = 7.7, 4J = 1.1 Hz; H-3), 7.51 (dd, 1H; 3J = 7.7, 4J = 1.7 Hz; H-4), 7.71 (dd, 1H; 3J = 8.0, 4J = 1.1 Hz; H-1), 7.83 (psd, 2H; 3J + 5J = 7.2 Hz; H-8). MS (EI+): m/z(%) = 366/368 (100, M+·), 287 (11, [M-Br]+·], 203 (43, [M-N(CH2CH2)2CH2-Br]+·). HRMS (EI+): berechnet: 366.073160, gefunden 366.072095. EA: berechnet: 59.50% C, 4.99% H; 6.94% N, gefunden: 59.37% C, 5.17% H; 6.84% N. 1 H NMR (d 6 -DMSO, 80 ° C, 400 MHz): δ H (ppm) = 1.58-1.64 (sm, 2H, H-13), 1.65-1.71 (sm, 4H, H-12), 3:36 to 3:40 (sm, 4H; H-11), 7.18 (psd, 2H, 3 J = 8.6 Hz + 5 J H-9), 7.30 (s, 1H, H-6), 7:34 (ddd, 1H; 3 J = 8.0, 3 J = 7.4, 4 J = 1.7 Hz, H-2), 7.46 (td, 1H, 3 J = 7.7, 4 J = 1.1 Hz, H-3), 7.51 (dd, 1H, 3 J = 7.7, 4 J = 1.7 Hz, H-4), 7.71 (dd, 1H, 3 J = 8.0, 4 J = 1.1 Hz, H-1), 7.83 (psd, 2H, 3 J + 5 J = 7.2 Hz, H-8). MS (EI +): m / z (%) = 366/368 (100, M + ), 287 (11, [M-Br] + · ], 203 (43, [MN (CH 2 CH 2 ) 2 CH 2 -Br] + · ). HRMS (EI +): calculated: 366.073160, found 366.072095 EA: calculated: 59.50% C, 4.99% H, 6.94% N, found: 59.37% C, 5.17% H, 6.84% N.
SCH172 (Z)-2-(2-Bromphenyl)-3-[4-(4-methylpiperazin-1-yl)phenyl]acrylnitril (SCH172) (dihydrochlorid) SCH172 (Z) -2- (2-Bromophenyl) -3- [4- (4-methylpiperazin-1-yl) phenyl] acrylonitrile (SCH172) (dihydrochloride)
- 1H-NMR (d6-DMSO, 80°C, 500 MHz): δH (ppm) = 217 (s, 3H; CH3), 3.05-3.18 (m, 2H; H-12), 3.29-3.49 (m, 4H; H-11+12), 3.95-4.05 (m, 2H; H-11), 7.10 (psd, 2H; 3J + 5J = 8.9 Hz; H-9), 7.32 (s, 1H; H-6), 7.33-7.37 (sm, 1H; H-2), 7.45-7.48 (sm, 1H; H-3), 7.51 (dd, 1H; 3J = 7.7, 4J = 1.7 Hz; H-4), 7.71 (d, 1H; 3J = 8.0 Hz; H-1), 7.85 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 9.96 (bs, 1H; HCl), 11.46 (bs, 1H; HCl). MS (EI+): m/z (%) = 381/383 (100, M+·), 203 (72, [M-Br-N(CH2CH2)2NCH3]+·). HRMS (EI+): berechnet: 381.084059, gefunden 381.087401. EA: berechnet: 52.77% C, 4.87% H; 9.23% N, gefunden: 52.68% C, 4.97% H; 9.18% N. 1 H NMR (d 6 -DMSO, 80 ° C, 500 MHz): δ H (ppm) = 217 (s, 3H, CH 3 ), 3.05-3.18 (m, 2H, H-12), 3.29-3.49 (m, 4H; H-11 + 12), 3.95-4.05 (m, 2H; H-11), 7.10 (psd, 2H, 3 J = 8.9 Hz + 5 J H-9), 7:32 (s, 1H H-6), 7.33-7.37 (sm, 1H, H-2), 7.45-7.48 (sm, 1H, H-3), 7.51 (dd, 1H, 3 J = 7.7, 4 J = 1.7 Hz; H -4), 7.71 (d, 1H, 3 J = 8.0 Hz, H-1), 7.85 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8), 9.96 (bs, 1H, HCl), 11.46 (bs, 1H, HCl). MS (EI +): m / z (%) = 381/383 (100, M + ), 203 (72, [M-Br-N (CH 2 CH 2 ) 2 NCH 3 ] + · ). HRMS (EI +): calculated: 381.084059, found 381.087401. EA: calculated: 52.77% C, 4.87% H; 9.23% N, found: 52.68% C, 4.97% H; 9.18% N.
SCH174 (Z)-3-[4-(Cyclohexylamino)phenyl]-2-phenylacrylnitril (SCH174) SCH174 (Z) -3- [4- (Cyclohexylamino) phenyl] -2-phenylacrylonitrile (SCH174)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 1.10-1.21 (m, 3H; H-11+12), 1.27-1.39 (sm, 2H; H-11), 1.53-1.61 (sm, 1H; H-12), 1.65-1.74 (sm, 2H; H-10), 1.86-1.93 (sm, 2H; H-10), 3.23-3.33 (sm, 1H; H-9), 6.40 (d, 1H; 3J = 7.8 Hz; NH), 6.64 (psd, 2H; 3J + 5J = 8.7 Hz; H-8), 7.28-7.33 (sm, 1H; H-1), 7.39-7.45 (m, 2H; H-2), 7.60-7.64 (m, 2H; H-3), 7.69 (s, 1H; H-5), 7.74 (psd, 2H; 3J + 5J = 8.7 Hz; H-7). MS (EI+): m/z (%) = 302 (100, M+·), 259 (59, [M-CH2CH2CH2]+·). HRMS (EI+): berechnet: 302.178299, gefunden 302.178004. EA: berechnet: 83.40% C, 7.33% H; 9.26% N, gefunden: 83.27% C, 7.26% H; 9.10% N. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 1.10-1.21 (m, 3H, H-11 + 12), 1.27-1.39 (sm, 2H, H-11 ), 1.53-1.61 (sm, 1H, H-12), 1.65-1.74 (sm, 2H, H-10), 1.86-1.93 (sm, 2H, H-10), 3.23-3.33 (sm, 1H; H -9), 6.40 (d, 1H, 3 J = 7.8 Hz; NH), 6.64 (psd, 2H, 3 J = 8.7 Hz + 5 J H-8), 7:28 to 7:33 (sm, 1H; H-1 ), 7:39 to 7:45 (m, 2H; H-2), 7.60-7.64 (m, 2H; H-3), 7.69 (s, 1H, H-5), 7.74 (psd, 2H; J 3 + 5 J = 8.7 Hz, H-7). MS (EI +): m / z (%) = 302 (100, M + ), 259 (59, [M-CH 2 CH 2 CH 2 ] + · ). HRMS (EI +): calculated: 302.178299, found 302.178004. EA: calculated: 83.40% C, 7.33% H; 9.26% N, found: 83.27% C, 7.26% H; 9.10% N.
SCH175 (Z)-2-Phenyl-3-[4-(phenylamino)phenyl]acrylnitril (SCH175) SCH175 (Z) -2-phenyl-3- [4- (phenylamino) phenyl] acrylonitrile (SCH175)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 7.04-7.11 (m, 3H; H-8+12), 7.17-7.21 (m, 2H; H-11), 7.32-7.38 (m, 3H; H-1+10), 7.40-7.45 (m, 3H; H-2+5), 7.63-7.67 (m, 2H; H-3), 7.85 (psd, 2H; 3J + 5J = 8.7 Hz; H-7). MS (EI+): m/z (%) = 296 (100, HRMS (EI+): berechnet: 296.131349, gefunden 296.129489. EA: berechnet: 85.11% C, 5.44% H; 9.45% N, gefunden: 84.78% C, 5.66% H; 9.19% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 7.04-7.11 (m, 3H, H-8 + 12), 7.17-7.21 (m, 2H, H-11), 7.32-7.38 (m, 3H, H-1 + 10), 7.40-7.45 (m, 3H, H-2 + 5), 7.63-7.67 (m, 2H, H-3), 7.85 (psd, 2H, 3 J + 5 J = 8.7 Hz, H-7). MS (EI +): m / z (%) = 296 (100, HRMS (EI +): calculated: 296.131349, found 296.129489 EA: calculated: 85.11% C, 5.44% H, 9.45% N, found: 84.78% C, 5.66% H; 9.19% N.
SCH177 (Z)-2-{1-Cyano-2-[4-(dimethylamino)phenyl]vinyl}benzonitril (SCH177) SCH177 (Z) -2- {1-Cyano-2- [4- (dimethylamino) phenyl] vinyl} benzonitrile (SCH177)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.07 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 8.9 Hz; H-13), 7.41 (td, 1H; 3J = 7.6, 4J = 1.4 Hz; H-4), 7.48 (s, 1H; H-10), 7.60-7.69 (m, 2H; H-3+6), 7.73 (dd, 1H; 3J =7.7, 4J = 0.9 Hz; H-5), 7.89 (psd, 2H; 3J + 5J = 8.9 Hz; H-12). MS (EI+): m/z (%) = 273 (100, M+·). HRMS (EI+): berechnet: 273.126598, gefunden 273.126551. EA: berechnet: 79.10% C, 5.53% H; 15.37% N, gefunden: 79.17% C, 5.57% H; 15.38% N. Schmelzpunkt (nicht korrigiert): 160°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.07 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-13 ), 7.41 (td, 1H, 3 J = 7.6, 4 J = 1.4 Hz, H-4), 7.48 (s, 1H, H-10), 7.60-7.69 (m, 2H, H-3 + 6), 7.73 (dd, 1H, 3 J = 7.7, 4 J = 0.9 Hz; H-5), 7.89 (psd, 2H, 3 J = 8.9 Hz + 5 J H-12). MS (EI +): m / z (%) = 273 (100, M + · ). HRMS (EI +): calculated: 273.126598, found 273.126551. EA: calculated: 79.10% C, 5.53% H; 15.37% N, found: 79.17% C, 5.57% H; 15.38% N. Melting point (uncorrected): 160 ° C.
SCH178 (Z)-3-[4-(Azepan-1-yl)phenyl]-2-phenylacrylnitril (SCH178) SCH178 (Z) -3- [4- (azepan-1-yl) phenyl] -2-phenylacrylonitrile (SCH178)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 1.41-1.47 (sm, 4H; H-12), 1.67-1.74 (m, 4H; H-11), 3.49-3.54 (sm, 4H; H-10), 6.78 (psd, 2H; 3J + 5J = 9.2 Hz; H-8), 7.29-7.34 (sm, 1H; H-1), 7.40-7.45 (m, 2H; H-2), 7.62-7.66 (m, 2H; H-3), 7.74 (s, 1H; H-5), 7.83 (psd, 2H; 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 302 (100, M+·), 273 (55, [M(CH2)2]+·), 259 (28, [M-(CH2)3]+·), 231 (14, [M-(CH2)5]+·), 218 (16, [M(CH2)6]+·), 203 (26, [M-N(CH2CH2CH2)2]+·). HRMS (EI+): berechnet: 302.178299, gefunden 302.177334. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 1.41-1.47 (sm, 4H, H-12), 1.67-1.74 (m, 4H, H-11), 3.49-3.54 (sm, 4H, H-10), 6.78 (psd, 2H, 3 J + 5 J = 9.2Hz, H-8), 7.29-7.34 (sm, 1H, H-1), 7.40-7.45 ( m, 2H, H-2), 7.62-7.66 (m, 2H, H-3), 7.74 (s, 1H, H-5), 7.83 (psd, 2H, 3 J + 5 J = 8.9 Hz; H- 7). MS (EI +): m / z (%) = 302 (100, M + * ), 273 (55, [M (CH 2 ) 2 ] + · ), 259 (28, [M- (CH 2 ) 3 ] + · ), 231 (14, [M- (CH 2 ) 5 ] + · ), 218 (16, [M (CH 2 ) 6 ] + · ), 203 (26, [MN (CH 2 CH 2 CH 2 ) 2 ] + · ). HRMS (EI +): calculated: 302.178299, found 302.177334.
SCH179 (Z)-3-[4-(Dimethylamino)phenyl]-2-(2-iodphenyl)acrylnitril (SCH179) SCH179 (Z) -3- [4- (dimethylamino) phenyl] -2- (2-iodophenyl) acrylonitrile (SCH179)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 9.2 Hz; H-9), 6.99 (s, 1H; H-6), 7.04 (ddd, 1H; 3J = 7.7, 3J = 6.6, 4J = 2.5 Hz; H-3), 7.36-7.42 (m, 2H; H-2+4), 7.85 (psd, 2H; 3J + 5J = 8.9 Hz; H-8), 7.91-7.94 (m, 1H; H-1). MS (EI+): m/z (%) = 347 (100, M+·). HRMS (EI+): berechnet: 374.028001, gefunden 374.024834. Schmelzpunkt (nicht korrigiert): 134°C. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 9.2 Hz, H-9 ), 6.99 (s, 1H, H-6), 7.04 (ddd, 1H, 3 J = 7.7, 3 J = 6.6, 4 J = 2.5 Hz, H-3), 7.36-7.42 (m, 2H; H- 2 + 4), 7.85 (psd, 2H, 3 J = 8.9 Hz + 5 J H-8), 7.91-7.94 (m, 1H, H-1). MS (EI +): m / z (%) = 347 (100, M + * ). HRMS (EI +): calculated: 374.028001, found 374.024834. Melting point (uncorrected): 134 ° C.
SCH191 (Z)-3-[4-(4-Methylpiperazin-1-yl)phenyl]-2-[2-(trifluormethyl)phenyl]acrylnitril (SCH191) (dihydrochlorid) SCH191 (Z) -3- [4- (4-methylpiperazin-1-yl) phenyl] -2- [2- (trifluoromethyl) phenyl] acrylonitrile (SCH191) (dihydrochloride)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.75 (d, 3H; J = 4.6Hz; CH3), 3.03-3.14 (sm, 2H; H-12), 3.25-3.34 (sm, 2H; H-12), 3.40-3.47 (sm, 2H; H-11), 3.99-4.06 (sm, 2H; H-11), 7.11 (psd, 2H; 3J + 5J = 8.9 Hz; H-9), 7.30 (s, 1H; H-6), 7.60-7.68 (sm, 2H; H-3+4), 7.73-7.78 (sm 1H; H-2), 7.80-7.85 (m, 3H; H-1+8), 11.02 (bs, 1H; HCl), 11.52 (s, 1H; HCl). MS (EI+): m/z (%) = 371 (100, M+·). HRMS (EI+): berechnet: 371.160933, gefunden 371.157714. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.75 (d, 3H, J = 4.6Hz, CH 3 ), 3.03-3.14 (sm, 2H, H-12 ), 3:25 to 3:34 (sm, 2H; H-12), 3:40 to 3:47 (sm, 2H; H-11), 3.99-4.06 (sm, 2H; H-11), 7.11 (psd, 2H; J + 3 5 J = 8.9 Hz, H-9), 7.30 (s, 1H, H-6), 7.60-7.68 (sm, 2H, H-3 + 4), 7.73-7.78 (sm 1H, H-2), 7.80 -7.85 (m, 3H, H-1 + 8), 11.02 (bs, 1H, HCl), 11.52 (s, 1H, HCl). MS (EI +): m / z (%) = 371 (100, M + * ). HRMS (EI +): calculated: 371.160933, found 371.157714.
SCH193 (Z)-3-[4-(Dimethylamino)-3-methoxyphenyl]-2-phenylacrylnitril (SCH193) SCH193 (Z) -3- [4- (dimethylamino) -3-methoxyphenyl] -2-phenylacrylonitrile (SCH193)
- 1H-NMR (d6-DMSO, 30°C, 400 MHz): δH (ppm) = 2.81 (s, 6H; NCH3), 3.82 (s, 3H; OCH3), 6.90 (d, 1H; 3J = 8.2 Hz; H-8), 7.34-7.39 (sm, 1H; H-1), 7.43-7.51 (m, 3H; H-2+9), 7.62 (d, 1H; 4J = 1.8 Hz; H-7), 7.67-7.71 (m, 2H; H-3), 7.87 (s, 1H; H-5). MS (EI+): m/z (%) = 278 (100, M+·), 263 (41, [M-CH3]+·). HRMS (EI+): berechnet: 278.141913, gefunden 278.141310. EA: berechnet: 77.67% C, 6.52% H; 10.06% N, gefunden: 77.34% C, 6.46% H; 9.85% N. 1 H NMR (d 6 -DMSO, 30 ° C, 400 MHz): δ H (ppm) = 2.81 (s, 6H, NCH 3 ), 3.82 (s, 3H, OCH 3 ), 6.90 (d, 1H; 3 J = 8.2 Hz, H-8), 7.34-7.39 (sm, 1H, H-1), 7.43-7.51 (m, 3H, H-2 + 9), 7.62 (d, 1H, 4 J = 1.8 Hz H-7), 7.67-7.71 (m, 2H, H-3), 7.87 (s, 1H, H-5). MS (EI +): m / z (%) = 278 (100, M + · ), 263 (41, [M-CH 3 ] + · ). HRMS (EI +): calculated: 278.141913, found 278.141310. EA: calculated: 77.67% C, 6.52% H; 10.06% N, found: 77.34% C, 6.46% H; 9.85% N.
SCH199 (Z)-3-[4-(Dimethylamino)phenyl]-2-(4-fluorphenyl)acrylnitril (SCH199) SCH199 (Z) -3- [4- (dimethylamino) phenyl] -2- (4-fluorophenyl) acrylonitrile (SCH199)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H; CH3), 6.73 (psd, 2H; 3J + 5J = 8.9 Hz; H-7), 7.06-7.13 (sm, 2H; H-1), 7.32 (s, 1H; H-4), 7.56-7.61 (sm, 2H; H-2), 7.84 (psd, 2H; 3J + 5J = 8.7 Hz; H-6). MS (EI+): m/z (%) = 266 (100, M+·). HRMS (EI+): berechnet: 266.121927, gefunden 266.120746. EA: berechnet: 76.67% C, 5.68% H; 10.52% N, gefunden: 76.31% C, 5.75% H; 10.55% N. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7 ), 7:06 to 7:13 (sm, 2H; H-1), 7:32 (s, 1H, H-4), 7.56-7.61 (sm, 2H; H-2), 7.84 (psd, 2H; J 3 + 5 J = 8.7 Hz, H-6). MS (EI +): m / z (%) = 266 (100, M + * ). HRMS (EI +): calculated: 266.121927, found 266.120746. EA: calculated: 76.67% C, 5.68% H; 10.52% N, found: 76.31% C, 5.75% H; 10.55% N.
SCH200 (Z)-2-(2-Chlor-4-fluorphenyl)-3-[4-(dimethylamino)phenyl]acrylnitril (STI100) SCH200 (Z) -2- (2-chloro-4-fluorophenyl) -3- [4- (dimethylamino) phenyl] acrylonitrile (STI100)
- 1H-NMR (CDCl3, 21°C, 400 MHz): δH (ppm) = 3.06 (s, 6H, CH3), 6.73 (psd, 2H, 3J + 5J = 8.9 Hz; H-8), 7.02 (ddd, 1H, 3J = 8.5, 3JH,F = 7.8, 4J = 2.5 Hz; H-2), 7.07 (s, 1H, H-5), 7.19 (dd, 1H, 3JH,F = 8.5, 4J = 2.5 Hz; H-1), 7.39 (dd, 1H, 3J = 8.7, 4JH,F = 5.6 Hz; H-3), 7.84 (psd, 2H, 3J + 5J = 8.9 Hz; H-7). MS (EI+): m/z (%) = 300 (100, M+·), 265 (17,[M-Cl]+·), 221 (28, [M-Cl-N(CH3)2]+·). HRMS (EI+): berechnet: 300.082955, gefunden 300.081995. 1 H-NMR (CDCl 3 , 21 ° C, 400 MHz): δ H (ppm) = 3.06 (s, 6H, CH 3 ), 6.73 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-8 ), 7:02 (ddd, 1H, 3 J = 8.5, 3 J H, F = 7.8, 4 J = 2.5 Hz; H-2), 7:07 (s, 1H, H-5), 7.19 (dd, 1H, 3 J H, F = 8.5, 4 J = 2.5 Hz, H-1), 7.39 (dd, 1H, 3 J = 8.7, 4 J H, F = 5.6 Hz, H-3), 7.84 (psd, 2H, 3 J + 5 J = 8.9 Hz, H-7). MS (EI +): m / z (%) = 300 (100, M + · ), 265 (17, [M-Cl] + · ), 221 (28, [M-Cl-N (CH 3 ) 2 ] + · ). HRMS (EI +): calculated: 300.082955, found 300.081995.
ZITATE ENTHALTEN IN DER BESCHREIBUNG QUOTES INCLUDE IN THE DESCRIPTION
Diese Liste der vom Anmelder aufgeführten Dokumente wurde automatisiert erzeugt und ist ausschließlich zur besseren Information des Lesers aufgenommen. Die Liste ist nicht Bestandteil der deutschen Patent- bzw. Gebrauchsmusteranmeldung. Das DPMA übernimmt keinerlei Haftung für etwaige Fehler oder Auslassungen.This list of the documents listed by the applicant has been generated automatically and is included solely for the better information of the reader. The list is not part of the German patent or utility model application. The DPMA assumes no liability for any errors or omissions.
Zitierte PatentliteraturCited patent literature
- US 2004/0180892 [0008] US 2004/0180892 [0008]
- DE 60215145 T2 [0008] DE 60215145 T2 [0008]
- WO 2010/013071 A2 [0009] WO 2010/013071 A2 [0009]
Claims (10)
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE102011118606A DE102011118606A1 (en) | 2011-11-15 | 2011-11-15 | Stilbene compounds as PPAR beta / delta inhibitors for the treatment of PPAR beta / delta-mediated diseases |
PCT/EP2012/072655 WO2013072390A2 (en) | 2011-11-15 | 2012-11-14 | Stilbene compounds as ppar beta/delta inhibitors for treating ppar beta/delta transmitted illnesses |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE102011118606A DE102011118606A1 (en) | 2011-11-15 | 2011-11-15 | Stilbene compounds as PPAR beta / delta inhibitors for the treatment of PPAR beta / delta-mediated diseases |
Publications (1)
Publication Number | Publication Date |
---|---|
DE102011118606A1 true DE102011118606A1 (en) | 2013-05-16 |
Family
ID=47215544
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DE102011118606A Ceased DE102011118606A1 (en) | 2011-11-15 | 2011-11-15 | Stilbene compounds as PPAR beta / delta inhibitors for the treatment of PPAR beta / delta-mediated diseases |
Country Status (2)
Country | Link |
---|---|
DE (1) | DE102011118606A1 (en) |
WO (1) | WO2013072390A2 (en) |
Families Citing this family (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20170128483A1 (en) * | 2014-03-25 | 2017-05-11 | Ruprecht-Karls-Universitat Heidelberg | Host dependency factors as targets for antiviral therapy |
KR20180036522A (en) | 2016-09-30 | 2018-04-09 | (주)나노믹스 | Stilbene derivatives and preparation method thereof |
Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE69405497T2 (en) * | 1993-03-10 | 1998-03-05 | Celltech Therapeutics Ltd | STYRYL DERIVATIVES, THEIR PRODUCTION AND USE AS PDE-IV INHIBITORS |
DE69132961T2 (en) * | 1991-04-16 | 2002-09-19 | Rhone Poulenc Rorer Internat H | STYRYL-SUBSTITUTED HETEROARYL COMPOUNDS INHIBITING EGF RECEPTOR TYROSINE KINASE |
US20040180892A1 (en) | 2003-02-20 | 2004-09-16 | Encysive Pharmaceuticals Inc. | Phenylenediamine urotensin-II receptor antagonists and CCR-9 antagonists |
DE60215145T2 (en) | 2001-05-07 | 2007-08-23 | Smithkline Beecham Corp. | SULPHONAMIDES |
WO2010013071A2 (en) | 2008-08-01 | 2010-02-04 | University Court Of The University Of Dundee | Methods concerning ppar delta and antagonists thereof |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE1793261A1 (en) * | 1968-08-23 | 1971-07-01 | Bayer Ag | ss-phenyl-acrylic acid nitrile |
WO2009155657A1 (en) * | 2008-06-26 | 2009-12-30 | Commonwealth Scientific And Industrial Research Organisation | Conducting and semiconducting organic materials |
-
2011
- 2011-11-15 DE DE102011118606A patent/DE102011118606A1/en not_active Ceased
-
2012
- 2012-11-14 WO PCT/EP2012/072655 patent/WO2013072390A2/en active Application Filing
Patent Citations (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
DE69132961T2 (en) * | 1991-04-16 | 2002-09-19 | Rhone Poulenc Rorer Internat H | STYRYL-SUBSTITUTED HETEROARYL COMPOUNDS INHIBITING EGF RECEPTOR TYROSINE KINASE |
DE69405497T2 (en) * | 1993-03-10 | 1998-03-05 | Celltech Therapeutics Ltd | STYRYL DERIVATIVES, THEIR PRODUCTION AND USE AS PDE-IV INHIBITORS |
DE60215145T2 (en) | 2001-05-07 | 2007-08-23 | Smithkline Beecham Corp. | SULPHONAMIDES |
US20040180892A1 (en) | 2003-02-20 | 2004-09-16 | Encysive Pharmaceuticals Inc. | Phenylenediamine urotensin-II receptor antagonists and CCR-9 antagonists |
WO2010013071A2 (en) | 2008-08-01 | 2010-02-04 | University Court Of The University Of Dundee | Methods concerning ppar delta and antagonists thereof |
Non-Patent Citations (1)
Title |
---|
Stuart S. Kulp; Craig B. Caldwel: Reduction of alpha, beta-diarylacrylonitriles by sodium borohydride. In: The Journal of Organic Chemistry, 45, 1980, 1, 171-173. * |
Also Published As
Publication number | Publication date |
---|---|
WO2013072390A3 (en) | 2013-09-26 |
WO2013072390A2 (en) | 2013-05-23 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE69730345T2 (en) | TRIARYLETHANE DERIVATIVES AS PDE IV HEMMER | |
DE69532808T2 (en) | TRI-SUBSTITUTED PHENYL DERIVATIVES USE AS PDE IV HEMMER | |
DE69534164T2 (en) | TRI-SUBSTITUTED PHENYL DERIVATIVES USE AS PDE IV HEMMER | |
EP0934311B1 (en) | New heterocyclylmethyl-substituted pyrazol derivates | |
EP1280776B1 (en) | Substituted benzoic acid amides and use thereof for the inhibition of angiogenesis | |
DE69118388T2 (en) | SUBSTITUTED BIZYCLIC ARYL DERIVATIVES WITH SELECTIVE LEUKOTRIES B4 ANTAGONISTIC EFFECT | |
DE69830403T2 (en) | INHIBITORS OF FACTOR XA WITH A NEUTRAL GROUP OF P1 SPECIFICITY | |
DE602004012969T2 (en) | PHENYLACETAMIDES AND THEIR USE AS GLUCOCINASE MODULATORS | |
EP0707006B1 (en) | Aroyl-piperidine derivatives | |
DE69533589T2 (en) | TETRA-SUBSTITUTED PHENYL DERIVATIVES USE AS PDE IV HEMMER | |
EP2308848A1 (en) | Quinoline-derived amide modulators of vanilloid VR1 receptor | |
DE69721134T2 (en) | Process for the preparation of 4- (2- (2-pyridyl) ethoxy) benzaldehyde derivatives | |
WO2000027819A2 (en) | Antrhranilic acid amides and the use thereof as medicaments | |
DE19955794A1 (en) | Pyrrolidine derivatives-CCR-3 receptor antagonists | |
DE60309057T2 (en) | AZABICYCLODERIVATES AS ANTAGONISTS OF THE MUSCARIN RECEPTOR | |
US20110243844A1 (en) | Sulfonamide derivative metabotropic glutamate r4 ligands | |
DE60111498T2 (en) | CONDENSED IMIDAZOLE DERIVATIVES | |
JP2009538358A (en) | Oxazolyl piperidine modulator of fatty acid amide hydrolase | |
AT391694B (en) | METHOD FOR PRODUCING NEW ETHYLENE DIAMONOAMIDE DERIVATIVES | |
DE69432542T2 (en) | Tetradivatives, their production and use | |
US20160024009A1 (en) | Novel Sulfonamide TRPA1 Receptor Antagonists | |
EP0374756A2 (en) | Nitrogen-containing cyclic compounds | |
DE60112090T2 (en) | PROCESS FOR PREPARING ARYLACETYLAMINOTHIAZOLENE | |
US20090247550A1 (en) | 3-trifluoromethyl-pyrazine-2-carboxylic acid amide derivatives as hdl-cholesterol raising agents | |
US4792562A (en) | N-(pyrrol-1-yl)pyridinamines having memory enhancing activity |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
R012 | Request for examination validly filed | ||
R002 | Refusal decision in examination/registration proceedings | ||
R003 | Refusal decision now final | ||
R003 | Refusal decision now final |
Effective date: 20150217 |