DE102005028077A1 - Alkynyl-substituted thiophenes - Google Patents

Abstract

The invention relates to alkynyl-substituted thiophenes and processes for their preparation, their use for the treatment and / or prophylaxis of diseases and their use for the preparation of medicaments for the treatment and / or prophylaxis of diseases, in particular for use as antiviral agents, especially against hepatitis C. viruses.

Description

The This invention relates to alkynyl-substituted thiophenes and methods for their preparation, their use for treatment and / or prophylaxis of diseases as well as their use for the production of medicines for the treatment and / or prophylaxis of diseases, in particular for use as antiviral agents, in particular against hepatitis C viruses.

infections with the hepatitis C virus (HCV) are the leading cause of non-A / non-B worldwide Hepatitis disease. By estimates About 170 million people worldwide are infected with the virus. In a high percentage of virus carriers this leads to a chronic Hepatitis C disease. For this group of infected people is at increased risk, subsequently life-threatening liver diseases such as cirrhosis, hepatocellular carcinoma or terminal liver failure. Hepatitis C infection is one of the most common Reasons for a liver transplant. Not yet fully understood are the mechanisms, such as it to persist the virus infection and high rate of it resulting in serious liver disease. It is unknown how the virus interacts with the human immune system and overcomes the immune system. The role of the cellular as the humoral immune responses to protection against HCV infection is not understood yet. It has been reported that immunoglobulins for prophylactic protection against transfusion-induced viral hepatitis were used; however, the use of immunoglobulins For this Purpose present Not recommended by the Center for Disease Control. The lack of an efficient Immune response is so far the establishment of a vaccine in the Ways, as well as a prophylaxis, after contact with the virus could be used. In the nearer Therefore, the future will be mainly antiviral principles play a role in the fight against the hepatitis C virus play.

In Various clinical trials have been targeting substances examined HCV infections in patients with chronic hepatitis to treat effectively. In these studies came interferon-alpha (IFN-α), in its sole use or in combination with other antiviral agents. These studies have shown that a significant number to patients on this therapy does not respond, and that a large part those in which interferon-alpha has an effect after Discontinuation of the substance to relapse.

To Recently, treatment with interferon (IFN) was the only form of therapy with clinically proven efficacy in chronic hepatitis C disease. The proportion of patients with sustainable therapeutic success but it is low. Interferon therapy is consistently serious Side effects (e.g., leukopenia, thrombocytopenia, retinopathy, thyroiditis, acute pancreatitis, depression) that affects the quality of life of patients considerably restrict.

Recently, the combination of interferon with ribavirin was approved. This combination therapy results in improved efficacy, but does not improve the side-effect profile associated with IFN; moreover, side effects (eg haemolytic anemia) are also associated with ribavirin. Through the use of pegylated forms of IFN, such as PEG-Intron ^® and Pegasys ^® can be at least partially mitigated these undesirable side effects. Nonetheless, there is a great need for oral antiviral drugs that can overcome the limitations of previously established therapies (S.L.Tan et al., Nature Rev. Drug Discov., 2002, 1, 867-881).

Hepatitis C virus (HCV) is the only member of the genus Hepacivirus within the family Flaviviridae. There are at least 6 genotypes and a variety of subtypes. The virus is surrounded by a shell and has as a genome a positive single strand of viral RNA. The length of the viral RNA genome is approximately 9500 nucleotides. Propagation of the viral genome and translation into protein is accomplished by means of RNA structures located at the beginning and end of the genome (5 'untranslated region, 3' untranslated region). The genome has a single reading frame (ORF) encoding a polyprotein (about 3000 amino acids). From this, structural and non-structural (NS) proteins are cleaved in an infected cell by viral or host cell enzymes. HCV encodes a capsid protein (c) and two envelope proteins (E1 and E2). A small protein (p7) could be a so-called viroporin, which is essential for the infectivity of the mature virus particle. The mature NS proteins include the NS2, NS3, NS4A, NS4B, NS5A and NS5B proteins. For their cleavage from the polyprotein two viral proteases are responsible. The enzyme, designated as NS2 / 3 protease, cleaves at the NS2-NS3 site in a manner that is as yet only slightly characterized. The second protease (NS3 protease) is a serine protease contained in the N-terminal part of the NS3 protein. It catalyses all downs of NS3 existing cleavages of the poly proteins, ie NS3 NS4A proteolysis as well as the NS4A NS4B, NS4B NS5A, NS5A NS5B sites.

The NS4A protein probably has multiple functions, such as as a cofactor of the NS3 protease and possibly in membrane localization of NS3 and other NS proteins. Complex formation between NS3 and NS4A is probably a prerequisite for the Protein processing and increased the proteolytic activities related to all interfaces. The NS3 protein also has activity as an NTPase and helicase. NS5B is an RNA-dependent RNA polymerase, which is critically involved in HCV replication. About the Functions of the NS4B and NS5A proteins is very little known. For NS5A will an involvement in clinical resistance to interferon discussed.

the Hepatitis C closely related viruses such as the GBV B virus, which infects New World monkeys, or the BVDV (Bovine Viral Diarrhea Virus) become common used as model viruses to certain aspects of the virus life cycle to investigate.

A Object of the present invention is therefore to provide new compounds with equal or improved antiviral effect for treatment and / or prophylaxis of viral infectious diseases in humans and animals, especially hepatitis C and its consequences put.

Structurally similar Compounds are described for example in WO 02/100851, WO 04/052879 and WO 04/052885 for the treatment and / or prophylaxis of flavivirus infections, such as. Hepatitis C, in WO 00/027823 as gastrin and / or cholecystokinin Receptors for the treatment of cancer and diseases of the central Nervous system, in WO 92/010094 in combination with aryloxyacetic acid derivatives as herbicides and described in EP-A 423 523 as herbicides.

Laval Chan, et al., Bioorg. Med. Chem. Lett. 2004, 14, 793-796 and Laval Chan, et al., Bioorg. Med. Chem. Lett. 2004, 14, 797-800 substituted 5-phenyl-thiophene-2-carboxylic acids as potent HCV inhibitors.

Surprisingly was found to be those described in the present invention Substituted thiophenes are highly effective antiviral.

in welcher
R¹ für (C₁-C₆)-Alkyl, (C₃-C₇)-Cycloalkyl, 5- bis 7-gliedriges Heterocyclyl, 5- bis 7-gliedriges Heteroaryl oder Phenyl steht,
wobei Alkyl, Cycloalkyl, Heterocyclyl, Heteroaryl und Phenyl substituiert sein können mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkoxy, (C₁- C₆)-Alkylamino, (C₃-C₇)-Cycloalkyl, Phenyl, 5- bis 7-gliedrigem Heterocyclyl, 5- bis 7-gliedrigem Heteroaryl, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkylsulfoxyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl, (C₁-C₆)-Alkylcarbonylamino, (C₁-C₆)-Alkylsulfonylamino und (C₆-C₁₀)-Arylsulfonylamino,
worin Arylsulfonylamino seinerseits substituiert sein kann mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, (C₁-C₆)-Alkyl und (C₁-C₆)-Alkoxy,
R² für (C₁-C₆)-Alkyl, (C₃-C₇)-Cycloalkyl, 5- bis 7-gliedriges Heterocyclyl oder Benzyl steht,
wobei Alkyl, Cycloalkyl, Heterocyclyl und Benzyl substituiert sein können mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkoxy, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkylsulfoxyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl, (C₁-C₆)-Alkylcarbonylamino, 5- bis 7-gliedrigem Heterocyclyl, gegebenenfalls Alkyl substituiertem (C₃-C₇)-Cycloalkylaminocarbonyl und gegebenenfalls Alkyl substituiertem 5- bis 7-gliedrigem Heterocyclylcarbonyl,
worin Alkyl substituiert sein kann mit 1 bis 2 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Hydroxy, Amino, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylsulfoxyl und (C₁-C₆)-Alkoxycarbonyl,
R³ für (C₃-C₇)-Cycloalkyl, 5- bis 7-gliedriges Heterocyclyl, (C₆-C₁₀)-Aryl, 5- bis 7-gliedriges Heteroaryl, -CH₂-R⁴ oder -CH₂-CH₂-R⁵ steht,
wobei Cycloalkyl, Heterocyclyl, Aryl und Heteroaryl substituiert sein können mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkoxycarbonyl, (C₆-C₁₀)-Aryloxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl, (C₁-C₆)-Alkylcarbonylamino, -OR⁶ und -NR⁷R⁸,
worin Alkyl substituiert sein kann mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Hydroxy, Amino, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkoxy, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylthio, Phenyl, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl und (C₁-C₆)-Alkylcarbonylamino,
worin Phenyl seinerseits substituiert sein kann mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkoxy, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl und (C₁-C₆)-Alkylcarbonylamino,
wobei
R⁶ und R⁷ unabhängig voneinander für (C₁-C₆)-Alkyl, (C₃-C₇)-Cycloalkyl, 5- bis 7-gliedriges Heterocyclyl, Benzyl, (C₆-C₁₀)-Aryl oder 5- oder 6-gliedriges Heteroaryl stehen,
wobei Alkyl, Cycloalkyl, Heterocyclyl, Benzyl, Aryl und Heteroaryl substituiert sein können mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkoxy, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl und (C₁-C₆)-Alkylcarbonylamino,
R⁸ für Wasserstoff, (C₁-C₆)-Alkyl oder (C₃-C₇)-Cycloalkyl steht,
oder
R⁷ und R⁸ mit dem Stickstoffatom an das sie gebunden sind einen 5- bis 7-gliedrigen Heterocyclus bilden,
R⁴ und R⁵ unabhängig voneinander für (C₃-C₇)-Cycloalkyl, 5- bis 7-gliedriges Heterocyclyl, (C₆-C₁₀)-Aryl oder 5- bis 7-gliedriges Heteroaryl stehen,
wobei Cycloalkyl, Heterocyclyl, Aryl und Heteroaryl substituiert sein können mit 1 bis 3 Substituenten, wobei die Substituenten unabhängig voneinander ausgewählt werden aus der Gruppe, bestehend aus Halogen, Cyano, Hydroxy, Amino, Nitro, Trifluormethyl, Trifluormethoxy, Hydroxycarbonyl, Aminocarbonyl, (C₁-C₆)-Alkyl, (C₁-C₆)-Alkoxy, (C₁-C₆)-Alkylamino, (C₁-C₆)-Alkylthio, (C₁-C₆)-Alkylcarbonyl, (C₁-C₆)-Alkylsulfonyl, (C₁-C₆)-Alkoxycarbonyl, (C₁-C₆)-Alkylaminocarbonyl und (C₁-C₆)-Alkylcarbonylamino,
und ihre Salze, ihre Solvate und die Solvate ihrer Salze.The invention relates to compounds of the formula

in which
R ^{1 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl or phenyl,
wherein alkyl, cycloalkyl, heterocyclyl, heteroaryl and phenyl may be substituted with 1 to 3 substituents, the substituents being independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆₎ alkyl, (C ₁ -C ₆₎ alkoxy, (C ₁ - C ₆₎ alkylamino, (C ₃ -C ₇₎ cycloalkyl, phenyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, (C ₁ -C ₆ ) -alkylsulfonylamino and (C ₆ -C ₁₀ ) -arylsulfonylamino,
in which arylsulfonylamino may in turn be substituted by 1 to 3 substituents, where the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, (C ₁ -C ₆ ) -alkyl and ( C ₁ -C ₆ ) -alkoxy,
R ² is (C ₁ -C ₆₎ alkyl, (C ₃ -C ₇₎ -cycloalkyl, 5- to 7-membered heterocyclyl or benzyl,
wherein alkyl, cycloalkyl, heterocyclyl and benzyl may be substituted with 1 to 3 substituents, wherein the Substituents independently of one another are selected from the group consisting of halogen, cyano, hydroxyl, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, ( C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, ( C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, 5- to 7-membered heterocyclyl, optionally alkyl-substituted (C ₃ -C ₇ ) -cycloalkylaminocarbonyl and optionally alkyl-substituted 5- to 7-membered heterocyclylcarbonyl,
wherein alkyl may be substituted with 1 to 2 substituents wherein the substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, (C ₁ -C ₆ ) alkylsulfoxyl and (C ₁ -C ₆ ) alkoxycarbonyl,
R ^{3 is} (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, (C ₆ -C ₁₀ ) -aryl, 5- to 7-membered heteroaryl, -CH ₂ -R ⁴ or -CH ₂ - CH ₂ -R ⁵ is
wherein cycloalkyl, heterocyclyl, aryl and heteroaryl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C C ₁ -C ₆ ) -alkyl, C ₁ -C ₆ -alkylthio, C ₁ -C ₆ -alkylcarbonyl, C ₁ -C ₆ -alkylsulfonyl, C ₁ -C ₆ -alkoxycarbonyl, (C ₆ -C ₁₀ ) -aryloxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, -OR ⁶ and -NR ⁷ R ⁸ ,
wherein alkyl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, hydroxy, amino, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) alkoxy, (C ₁ -C ₆ ) -Alkylamino, (C ₁ -C ₆ ) -alkylthio, phenyl, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -) C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino,
in which phenyl in turn may be substituted by 1 to 3 substituents, the substituents being independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) Alkyl, C ₁ -C ₆ alkoxy, C ₁ -C ₆ alkylamino, C ₁ -C ₆ alkylthio, C ₁ -C ₆ alkylcarbonyl, C ₁ -C ₆ Alkylsulfonyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino,
in which
R ⁶ and R ⁷ independently of one another are (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, benzyl, (C ₆ -C ₁₀ ) -aryl or 5- or 6-membered heteroaryl,
where alkyl, cycloalkyl, heterocyclyl, benzyl, aryl and heteroaryl may be substituted by 1 to 3 substituents, the substituents being independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, Aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) - Alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulphonyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino,
R ⁸ is hydrogen, (C ₁ -C ₆₎ alkyl or (C ₃ -C ₇₎ is cycloalkyl,
or
R ⁷ and R ⁸ with the nitrogen atom to which they are attached form a 5- to 7-membered heterocycle,
R ⁴ and R ⁵ independently of one another are (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, (C ₆ -C ₁₀ ) -aryl or 5- to 7-membered heteroaryl,
wherein cycloalkyl, heterocyclyl, aryl and heteroaryl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) alkyl, (C ₁ -C ₆ ) alkoxy, (C ₁ -C ₆ ) alkylamino, (C ₁ -C ₆ ) alkylthio, (C ₁ -C ₆ ) alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino,
and their salts, their solvates, and the solvates of their salts.

Compounds of the invention are the compounds of formula (I) and their salts, solvates and solvates the salts, below as embodiment (e) mentioned compounds and their salts, solvates and solvates of Salts, as far as those of formula (I), hereinafter not already mentioned salts, solvates and solvates salts.

The Compounds of the invention can dependent on of their structure in stereoisomeric forms (enantiomers, diastereomers) exist. The invention therefore relates to the enantiomers or Diastereomers and their respective mixtures. From such mixtures enantiomers and / or diastereomers can be the stereoisomer isolate uniform components in a known manner.

Provided the compounds of the invention can occur in tautomeric forms, For example, the present invention encompasses all tautomeric forms.

Salts used in the context of the present invention are physiologically acceptable salts of the compounds according to the invention. Also included are salts which are suitable for pharmaceutical applications conditions are not suitable but can be used for example for the isolation or purification of the compounds of the invention.

physiological Safe salts of the compounds of the invention include acid addition salts of mineral acids, carboxylic acids and sulfonic acids, e.g. Salts of hydrochloric acid, hydrobromic, Sulfuric acid, Phosphoric acid, methane, ethanesulfonic, toluene sulfonic acid, benzenesulfonic, naphthalenedisulfonic, Acetic acid, trifluoroacetic, propionic acid, Lactic acid, Tartaric acid, malic acid, citric acid, fumaric acid, maleic acid and Benzoic acid.

physiological acceptable salts of the compounds of the invention also include Salts more usual Bases, such as by way of example and preferably alkali metal salts (e.g. Sodium and potassium salts), alkaline earth salts (e.g., calcium and magnesium salts) and ammonium salts derived from ammonia or organic amines with 1 to 16 carbon atoms, such as by way of example and preferably ethylamine, Diethylamine, triethylamine, ethyldiisopropylamine, monoethanolamine, Diethanolamine, triethanolamine, dicyclohexylamine, dimethylaminoethanol, Prokain, dibenzylamine, N-methylmorpholine, arginine, lysine, ethylenediamine and N-methylpiperidine.

When In the context of the invention, solvates are those forms of the compounds according to the invention, which in solid or liquid Condition by coordination with solvent molecules a complex form. Hydraie are a special form of solvates in which the coordination with water takes place.

Unless otherwise specified, in the context of the present invention, the substituents have the following meaning:
Alkyl per se and "Alk" and "alkyl" in alkoxy, alkylthio, alkylamino, alkylcarbonyl, alkoxycarbonyl, alkylaminocarbonyl, alkylcarbonylamino, alkylsulfonyl, alkylsulfoxyl and alkylsulfonylamino stand for a linear or branched alkyl radical with generally 1 to 6 ("C ₁ - C ₆ alkyl "), preferably 1 to 4, particularly preferably 1 to 3 carbon atoms, by way of example and preferably methyl, ethyl, n-propyl, isopropyl, tert-butyl, n-pentyl and n-hexyl.

alkoxy is exemplary and preferably methoxy, ethoxy, n-propoxy, Isopropoxy, tert-butoxy, n-pentoxy and n-hexoxy.

alkylthio is exemplary and preferably methylthio, ethylthio, n-propylthio, Isopropylthio, tert-butylthio, n-pentylthio and n-hexylthio.

alkylcarbonyl is exemplary and preferably acetyl and propanoyl.

Alkylamino represents an alkylamino radical having one or two (independently selected) alkyl substituents, by way of example and by way of preference methylamino, ethylamino, n-propylamino, isopropylamino, tert-butylamino, n-pentylamino, n-hexylamino, N, N-dimethylamino, N , N-diethylamino, N-ethyl-N-methylamino, N-methyl-Nn-propylamino, N-isopropyl-Nn-propylamino, Nt-butyl-N-methylamino, N-ethyl-Nn-pentylamino and Nn-hexyl-N methylamino. C ₁ -C ₃ -alkylamino is, for example, a monoalkylamino radical having 1 to 3 carbon atoms or a dialkylamino radical having in each case 1 to 3 carbon atoms per alkyl substituent.

alkoxycarbonyl is exemplary and preferably methoxycarbonyl, ethoxycarbonyl, n-propoxycarbonyl, Isopropoxycarbonyl, tert-butoxycarbonyl, n-pentoxycarbonyl and n-hexoxycarbonyl.

Alkylaminocarbonyl represents an alkylaminocarbonyl radical having one or two (independently selected) alkyl substituents, by way of example and preferably methylaminocarbonyl, ethylaminocarbonyl, n-propylaminocarbonyl, isopropylaminocarbonyl, tert-butylaminocarbonyl, n-pentylaminocarbonyl, n-hexylaminocarbonyl, N, N-dimethylamino-carbonyl , N, N-diethylaminocarbonyl, N-ethyl-N-methylaminocarbonyl, N-methyl-Nn-propylaminocarbonyl, N-isopropyl-Nn-propylaminocarbonyl, Nt-butyl-N-methylaminocarbonyl, N-ethyl-Nn-pentylaminocarbonyl and Nn-hexyl -N-methylaminocarbonyl. C ₁ -C ₃ -alkylamino-carbonyl is, for example, a monoalkylaminocarbonyl radical having 1 to 3 carbon atoms or a dialkylaminocarbonyl radical having in each case 1 to 3 carbon atoms per alkyl substituent.

alkylcarbonylamino is exemplary and preferably acetylamino and propanoylamino.

Alkylsulfonylamino is by way of example and preferably methylsulfonylamino, ethylsulfonylamino, n-propylsulfonylamino, isopropylsulfonylamino, tert-butylsulfonylamino, n-pentylsulfonylamino and n-hexyl sulfonylamino.

alkylsulfonyl is exemplary and preferably methylsulfonyl, ethylsulfonyl, n-propylsulfonyl, isopropylsulfonyl, tert -butylsulfonyl, n -pentylsulfonyl and n-hexylsulfonyl.

alkylsulfoxyl is exemplary and preferably methylsulfoxyl, ethylsulfoxyl, n-propylsulfoxyl, isopropylsulfoxyl, tert-butylsulfoxyl, n-pentylsulfoxyl and n-hexylsulfoxyl.

cycloalkyl stands for a cycloalkyl group having usually 3 to 7, preferably 5 to 6 carbon atoms, by way of example and preferably for cyclopropyl, Cyclobutyl, cyclopentyl, cyclohexyl and cycloheptyl.

aryl stands for a mono- or bicyclic aromatic, carbocyclic radical with usually 6 to 10 carbon atoms; by way of example and preferably for phenyl and naphthyl.

aryloxycarbonyl is exemplary and preferably phenyloxycarbonyl and Naphthyloxycarbonyl.

Arysulfonylamino is exemplary and preferably phenylsulfonylamino and naphthylsulfonylamino.

5 to 7-membered heterocyclyl and 5- to 7-membered heterocycle are within the scope of the invention a monocyclic, saturated or partially unsaturated Heterocycle containing up to three heteroatoms from the series N, O and / or S, over a ring carbon atom or a nitrogen atom of the heterocycle is linked and optionally substituted oxo. Exemplary and preferably may be mentioned: tetrahydrofuryl, dihydrofuryl, imidazolidinyl, thiolanyl, Dioxolanyl, pyrrolidinyl, pyrrolinyl, tetrahydro-2H-pyranyl, dihydropyranyl, Piperidinyl, piperazinyl, morpholinyl, thiomorpholinyl, tetrahydro-2H-thiopyranyl, Oxidotetrahydro-2H-thiopyranyl, 1,1-Dioxotetrahydro-2H-thiopyranyl, tetrahydrothienyl and 1,4-diazepanyl.

5 to 7-membered heteroaryl is in the context of the invention in general for one aromatic, monocyclic radical having 5 to 7 ring atoms and up to 4 heteroatoms from the series S, O and / or N. Preferred 5- to 6-membered heteroaryls containing up to 4 heteroatoms. The heteroaryl radical can over be bound to a carbon or heteroatom. For example and Preferred are: thienyl, furyl, pyrrolyl, thiazolyl, Oxazolyl, imidazolyl, pyridyl, pyrimidyl and pyridazinyl.

halogen stands for Fluorine, chlorine, bromine and iodine.

Preferred in the context of the present invention are compounds of the formula (I) in which
R ^{1 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl or phenyl,
wherein alkyl, cycloalkyl, heterocyclyl, heteroaryl and phenyl may be substituted with 1 to 3 substituents, the substituents being independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₃ -C ₇ ) -cycloalkyl, phenyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, (C ₁ -C ₆ ) -alkylsulfonylamino and (C ₆ -C ₁₀ ) -arylsulfonylamino,
in which arylsulfonylamino may in turn be substituted by 1 to 3 substituents, where the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, (C ₁ -C ₆ ) -alkyl and ( C ₁ -C ₆ ) -alkoxy,
R ^{2 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl or benzyl,
wherein alkyl, cycloalkyl, heterocyclyl and benzyl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆₎ alkyl, (C ₁ -C ₆₎ alkoxy, (C ₁ -C ₆₎ alkylamino, (C ₁ -C ₆₎ alkylthio, (C ₁ -C ₆₎ alkylcarbonyl, (C ₁ -C ₆₎ alkylsulfonyl, (C ₁ -C ₆₎ - alkylsulfoxyl, (C ₁ -C ₆₎ -alkoxycarbonyl, (C ₁ -C ₆₎ alkylaminocarbonyl, (C ₁ -C ₆₎ alkylcarbonylamino, 5- to 7-membered heterocyclyl, optionally alkyl-substituted (C ₃ -C ₇ ) -cycloalkylaminocarbonyl and optionally alkyl-substituted 5- to 7-membered heterocyclylcarbonyl,
wherein alkyl may be substituted with 1 to 2 substituents wherein the substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, (C ₁ -C ₆ ) alkylsulfoxyl and (C ₁ -C ₆ ) alkoxycarbonyl,
R ^{3 is} cyclohexyl,
wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and (C ₁ -C ₃ ) -alkyl,
and their salts, their solvates, and the solvates of their salts.

Also preferred in the context of the present invention are compounds of the formula (I) in which
R ^{1 is} (C ₁ -C ₆ ) -alkyl or (C ₃ -C ₆ ) -cycloalkyl,
wherein alkyl and cycloalkyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, 5- to 7-membered heterocyclyl and phenylsulfonylamino,
wherein phenylsulfonylamino in turn may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of fluoro, chloro, hydroxy, amino, trifluoromethyl, trifluoromethoxy, methyl and methoxy,
R ^{2 is} branched (C ₃ -C ₅ ) -alkyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydrofuranyl, pyrrolidinyl, tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro-2H-thiopyranyl or 1,1-dioxotetrahydro- 2H-thiopyranyl stands,
wherein alkyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of amino, methoxy, (C ₁ -C ₆ ) -alkylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl,
R ^{3 is} cyclohexyl,
wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and (C ₁ -C ₃ ) -alkyl,
and their salts, their solvates, and the solvates of their salts.

Also preferred in the context of the present invention are compounds of the formula (I) in which
R ^{1 is} isopropyl, tert-butyl, cyclopropyl, cyclopentyl or cyclohexyl,
wherein isopropyl, tert-butyl, cyclopropyl, cyclopentyl and cyclohexyl may be substituted with a substituent, wherein the substituent is selected from the group consisting of hydroxy and amino,
R ^{2 is} branched (C ₃ -C ₅ ) alkyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro-2H-thiopyranyl or 1,1-dioxotetrahydro-2H-thiopyranyl .
wherein alkyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of methoxy, dimethylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl,
R ^{3 is} cyclohexyl,
wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and methyl,
and their salts, their solvates, and the solvates of their salts.

Also preferred in the context of the present invention are compounds of the formula (I) in which
R ^{1 is} isopropyl, tert-butyl, cyclopropyl, cyclopentyl or cyclohexyl,
wherein isopropyl, cyclopropyl, cyclopentyl and cyclohexyl may be substituted with a substituent, wherein the substituent is selected from the group consisting of hydroxy and amino,
R ^{2 is} branched (C ₃ -C ₅ ) alkyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro-2H-thiopyranyl or 1,1-dioxotetrahydro-2H-thiopyranyl .
wherein alkyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of methoxy, dimethylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl,
R ^{3 is} cyclohexyl,
wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and methyl,
and their salts, their solvates, and the solvates of their salts.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{1 is} isopropyl, tert-butyl, cyclopropyl, cyclopentyl or cyclohexyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{1 is} (C ₃ -C ₄ ) -alkyl or (C ₃ -C ₆ ) -cycloalkyl, where alkyl and cycloalkyl may be substituted by one Substituents, wherein the substituent is selected from the group consisting of hydroxy, amino or (C ₁ -C ₆ ) alkylamino.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{1 is} 1-hydroxy-1-methyleth-1-yl or 1-hydroxycyclopent-1-yl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{1 is} 2-hydroxy-1,1-dimethyl-eth-1-yl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} (C ₃ -C ₇ ) -cycloalkyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} cyclobutyl, cyclopentyl or cyclohexyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} (C ₁ -C ₆ ) -alkyl, where alkyl may be substituted by 1 to 3 substituents, where the substituents are selected independently of one another the group consisting of hydroxy, amino, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) Alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl and (C ₁ -C ₆ ) -alkylcarbonylamino.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} (C ₃ -C ₅ ) -alkyl, where alkyl may be substituted by 1 to 2 substituents, where the substituents are selected independently of one another the group consisting of methoxy, dimethylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} a (C ₃ -C ₅ ) -alkyl bonded to the nitrogen via a secondary carbon atom, where alkyl may be substituted by 1 to 2 substituents wherein the substituents are independently selected from the group consisting of methoxy, dimethylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} 1-dimethylaminopropan-2-yl, 1-methoxypropan-2-yl, 1-methylsulfonylpropan-2-yl or 1-methylsulfoxylpropan-2 yl stands.

Preferred in the context of the present invention are also compounds of the formula (I) in which R ^{2 is} isopropyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} 5- to 7-membered heterocyclyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} tetrahydrofuranyl, pyrrolidinyl, tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro-2H-thiopyranyl or 1,1-dioxotetrahydro- 2H-thiopyranyl stands.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{2 is} tetrahydrofuranyl or tetrahydro-2H-pyranyl.

Preferred in the context of the present invention are also compounds of the formula (I) in which R ^{3 is} cyclohexyl, where cyclohexyl may be substituted by 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and Methyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{3 is} trans-4-methylcyclohexyl.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{3 is} trans-4-methylcyclohexyl which is substituted in the 2-position by a hydroxyl group.

Also preferred in the context of the present invention are compounds of the formula (I) in which R ^{3 is} trans-4-methylcyclohexyl which is substituted in the 2-position by a hydroxyl group and this hydroxyl group and the carbonyl group in cis position to each other.

in welcher
R¹, R² und R³ die oben angegebene Bedeutung haben, und
R⁹ für Alkyl, bevorzugt Methyl, Ethyl oder tert.-Butyl, steht,
mit Basen oder Säuren umgesetzt werden.The invention further provides a process for the preparation of the compounds of the formula (I), where compounds of the formula

in which
R ¹ , R ² and R ^{3 have} the abovementioned meaning, and
R ^{9 is} alkyl, preferably methyl, ethyl or tert-butyl,
be reacted with bases or acids.

In the case where R ^{9 is} methyl or ethyl, the reaction is generally carried out with a base in inert solvents, preferably in a temperature range from room temperature to reflux of the solvents under normal pressure.

bases For example, alkali hydroxides such as sodium, lithium or Potassium hydroxide, or alkali metal carbonates such as cesium carbonate, sodium or Potassium carbonate, optionally in aqueous solution, is preferably lithium hydroxide in water.

inert solvent are, for example, ethers, such as 1,2-dimethoxyethane, dioxane, tetrahydrofuran, Glycol dimethyl ether or diethylene glycol dimethyl ether, or alcohols such as methanol, ethanol, n-propanol, iso-propanol, n-butanol or tert-butanol, or mixtures of solvents, preferred is dioxane or tetrahydrofuran.

In the case that R ^{9 is} tert-butyl, the reaction is generally carried out with an acid in inert solvents, preferably in a temperature range from room temperature to the reflux of the solvent at atmospheric pressure.

Prefers is the reaction with trifluoroacetic acid in methylene chloride, with Hydrogen chloride in dioxane or with hydrochloric acid in dioxane.

If the radicals R ³ contain functional groups such as, for example, hydroxyl or amino, these groups are provided with suitable protective groups known from the literature, for example acetyl, benzyl, benzyloxycarbonyl or tert-butyloxycarbonyl, which are cleaved off after the reaction to give compounds of the formula (I) ( Lit: PJ Kocienski: Protecting Groups, Georg Thieme Verlag, Stuttgart, New York, 1994, ISBN 3-13-135601-4).

in welcher
R², R³ und R⁹ die oben angegebene Bedeutung haben,
mit Verbindungen der Formel

in welcher
R¹ die oben angegebene Bedeutung hat,
umgesetzt werden.The compounds of the formula (II) are known or can be prepared by reacting compounds of the formula

in which
R ² , R ³ and R ^{9 have} the abovementioned meaning,
with compounds of the formula

in which
R ^{1 has} the meaning given above,
be implemented.

The Reaction is generally carried out under Sonogashira reaction conditions under argon in inert and degassed solvents, in the presence a catalyst, optionally in the presence of an additional reagent, in the presence of a base and triphenylphosphine, preferably in one Temperature range from room temperature to the reflux of the solvent at normal pressure (R. R. Tykwinski, Angew Chem, Int Ed 2003, 42, 1566-1568, K. Sonogashira in Handbook of organopailadium chemistry for organic synthesis (Ed E.I. Negishi), 1133-1178 Wiley-Interscience, New York (2002)).

catalysts are for example Sonogashira reaction conditions conventional palladium catalysts, preferred For example, catalysts such as e.g. Tri (dibenzylideneacetone) dipalladium, Dichlorobis (triphenylphosphine) palladium, tetrakistriphenylphosphine palladium (0), Palladium (II) acetate, 1,1'-bis [(diphenylphosphino) ferrocene] palladium II chloride (1: 1) complex with dichloromethane.

additional reagents are, for example, copper (I) iodide and triphenylphosphine.

bases For example, amine bases such as triethylamine.

inert solvent For example, ethers such as dioxane, tetrahydrofuran or 1,2-dimethoxyethane, hydrocarbons such as benzene, xylene or toluene, or other solvents such as nitrobenzene, dimethylformamide, dimethylacetamide, Dimethylsulfoxide or N-methylpyrrolidone, preferred are solvents such as. Dimethylformamide, dimethylacetamide, dimethyl sulfoxide or 1,2-dimethoxyethane.

The Compounds of formula (IV) are known or can be after synthesize known methods from the corresponding starting materials.

in welcher
R², R³ und R⁹ die oben angegebene Bedeutung haben,
mit N-Bromsuccinimid in Halogenkohlenwaserstoffen wie Dichlormethan, Chloroform oder Tetrachlorkohlenstoff sowie deren Gemischen umgesetzt werden, bevorzugt ist eine Mischung aus Chloroform und Tetrachlorkohlenstoff.The compounds of the formula (III) are known or can be prepared by reacting compounds of the formula

in which
R ² , R ³ and R ^{9 have} the abovementioned meaning,
are reacted with N-bromosuccinimide in halocarbon such as dichloromethane, chloroform or carbon tetrachloride and mixtures thereof, preferred is a mixture of chloroform and carbon tetrachloride.

in welcher
R² und R⁹ die oben angegebene Bedeutung haben,
mit Verbindungen der Formel

in welcher
R³ die oben angegebene Bedeutung hat, und
X¹ für Halogen, bevorzugt Chlor oder Brom, steht,
umgesetzt werden.The compounds of the formula (V) are known or can be prepared by reacting compounds of the formula

in which
R ² and R ^{9 have} the abovementioned meaning,
with compounds of the formula

in which
R ^{3 has} the meaning given above, and
X ^{1 is} halogen, preferably chlorine or bromine,
be implemented.

The Reaction is carried out in inert solvents or without solvents with the acylating reagent, if appropriate in the presence of a base, preferably in a temperature range from 0 ° C to 120 ° C at atmospheric pressure.

inert solvent are, for example, halogenated hydrocarbons, such as methylene chloride, Trichloromethane, tetrachloromethane, trichloroethane, tetrachloroethane, 1,2-dichloroethane or trichlorethylene, ethers, such as diethyl ether, methyl tert-butyl ether, Dioxane, tetrahydrofuran, 1,2-dimethoxyethane, glycol dimethyl ether or diethylene glycol dimethyl ether, hydrocarbons such as benzene, Xylene, toluene, hexane, cyclohexane or petroleum fractions, or carboxylic acid amides such as N, N-dimethylformamide or N, N-dimethylacetamide, alkylnitriles such as acetonitrile, or heteroaromatics such as pyridine, or ethyl acetate, preferred is pyridine or acetonitrile.

bases For example, alkali metal carbonates such as cesium carbonate, sodium or Potassium carbonate, alkali acetates such as sodium acetate or other bases such as triethylamine, diisopropylethylamine or pyridine, preferably diisopropylethylamine, Triethylamine or pyridine.

The Compounds of formula (VII) are known or can be after synthesize known methods from the corresponding starting materials.

in welcher
R⁹ die oben angegebene Bedeutung hat,
mit Aldehyden, Ketonen, Orthoestern oder Enolethern, die den Rest R² beinhalten,
unter den Bedingungen einer reduktiven Aminierung umgesetzt werden.The compounds of the formula (VI) are known or can be prepared by reacting compounds of the formula

in which
R ^{9 has} the meaning given above,
with aldehydes, ketones, orthoesters or enol ethers containing the radical R ² ,
be reacted under the conditions of a reductive amination.

The Reaction is generally carried out in inert solvents, in the presence a reducing agent and acetic acid, preferably in a temperature range from room temperature to reflux of the solvent at normal pressure.

inert solvent For example, halogenated hydrocarbons such as methylene chloride or 1,2-dichloroethane, ethers, such as dioxane or tetrahydrofuran, alcohols such as methanol or ethanol, or N, N-dimethylformamide are methylene chloride or 1,2-dichloroethane.

reducing agent For example, sodium borohydride, sodium cyanoborohydride, sodium trisacetoxyborohydride or tetrabutylammonium borohydride, preferred is sodium trisacetoxyborohydride.

The If appropriate, reaction takes place in the presence of Lewis acids such as For example, titanium tetrachloride (analogous to J.F. Parlow, M. S. South, Tetrahedron 2003, 59, 7695-7701).

The Compounds of formula (VIII) are known or can be after synthesize known processes from the corresponding starting materials, e.g. by Gewald synthesis (K. Gewald et al., Chem. Ber. 1966, 94-100).

Aldehydes, ketones, orthoesters and enol ethers containing the radical R ² are known or are allowed be synthesized by known methods from the corresponding starting materials.

in welcher
R³ und R⁹ die oben angegebene Bedeutung haben,
mit Verbindungen der Formel R²-X² (X),in welcher
R² die oben angegebene Bedeutung hat, und
X² für Halogen, bevorzugt Iod oder Brom, oder Sulfonsäureester steht,
umgesetzt werden.In an alternative method, the compounds of formula (V) can be prepared by reacting compounds of formula

in which
R ³ and R ^{9 have} the abovementioned meaning,
with compounds of the formula R ² -X ² (X), in which
R ^{2 has} the meaning given above, and
X ^{2 is} halogen, preferably iodine or bromine, or sulfonic acid ester,
be implemented.

The Reaction is generally carried out in inert solvents, in the presence a base, preferably in a temperature range of room temperature until the reflux of the solvent at normal pressure.

bases For example, alkali metal carbonates such as cesium carbonate, sodium or Potassium carbonate, or sodium or potassium methoxide, or sodium or potassium ethoxide or potassium tert-butoxide, or amides such as sodium amide, Lithium bis (trimethylsilyl) amide or lithium diisopropylamide, or organometallic compounds such as butyllithium or phenyllithium, or other bases such as sodium hydride, DBU, preferably potassium tert-butoxide, cesium carbonate, DBU, sodium hydride, potassium carbonate or sodium carbonate.

inert solvent are, for example, halogenated hydrocarbons, such as methylene chloride, Trichloromethane or 1,2-dichloroethane, ethers, such as dioxane, tetrahydrofuran or 1,2-dimethoxyethane, or other solvents such as acetone, dimethylformamide, Dimethylacetamide, 2-butanone or acetonitrile, preferably tetrahydrofuran, Methylene chloride, acetone, 2-butanone, acetonitrile, dimethylformamide or 1,2-dimethoxyethane.

The Compounds of the formula (X) are known or can be prepared by known processes Synthesize process from the corresponding starting materials.

The Compounds of formula (IX) are known or can be prepared by: Compounds of the formula (VIII) with compounds of the formula (VII) under the for the reaction of compounds of the formula (VI) with compounds of the formula (VII) reaction conditions are reacted.

The Preparation of the compounds of the invention can be illustrated by the following synthesis scheme.

Synthesis scheme:

The Compounds of the invention show an unpredictable, valuable spectrum of action. they show antiviral effect Representatives of the family Flaviviridae, especially against hepatitis C virus.

Another The present invention is the use of the compounds of the invention for the treatment and / or prophylaxis of diseases, especially of Infections with viruses, in particular the viruses mentioned above, and the infectious diseases caused thereby. Under one Viral infection will subsequently both an infection with a Virus as well as one caused by an infection with a virus Illness understood.

• 1. Behandlung von akuten und chronischen Hepatitis C-Infektionen und die Vermeidung, Linderung oder Eliminierung der Begleiterscheinungen und Folgeschäden wie beispielsweise Leberfibrose, Leberzirrhose, Leberkrebs (hepatozelluläres Karzinom) und/oder die Verminderung der Anzahl der viralen Genomkopien in einem Patienten;
• 2. Behandlung und Prophylaxe bei Organtransplantationspatienten, insbesondere bei einer Hepatitis C-Infektion des Organspenders oder Organempfängers;
• 3. Behandlung von HCV-Infektionen bei AIDS-Patienten und Patienten, welche mit HIV (humanes Immunodefizienz-Virus) infiziert sind (eine Co-Infektion von HIV mit Hepatitis C führt zu einer raschen Verschlechterung des Krankheitsbildes);
• 4. Behandlung von HCV-Infektionen bei Patienten, welche mit HBV (Hepatitis B-Virus) oder anderen hepatotrophen Viren (beispielsweise Hepatitis A-Virus, Hepatitis G-Virus) infiziert sind;
• 5. Behandlung von Erkrankungen mit Viren, welche mit HCV verwandt sind, wie z.B. Gelbfieber-Virus, Dengue-Virus, West Nil-Virus, Frühsommermeningoenzephalitis-Virus, Japanisches Enzephalitis-Virus;
• 6. Behandlung von Säugetieren mit verwandten animalen Viren wie beispielsweise Pestiviren;
• 7. Behandlung von Materialien oder biologischen Agentien, um eine Übertragung von Hepatitis C zu vermeiden oder eine solche Gefahr zu verringern (z.B. bei Blut und Blutprodukten, Blutspende-Utensilien oder chirurgischen Instrumenten).

As indication areas can be mentioned for example:

• 1. Treatment of acute and chronic hepatitis C infections and prevention, alleviation or elimination of concomitant and sequelae such as liver fibrosis, cirrhosis of the liver, liver cancer (hepatocellular carcinoma) and / or reduction of the number of viral genome copies in a patient;
• 2. Treatment and prophylaxis in organ transplant patients, in particular in hepatitis C infection of the organ donor or organ recipient;
• 3. Treatment of HCV infections in AIDS patients and patients who are infected with HIV (human immunodeficiency virus) (a co-infection of HIV with hepatitis C leads to a rapid deterioration of the clinical picture);
• 4. treatment of HCV infections in patients infected with HBV (hepatitis B virus) or other hepatotrophic viruses (for example hepatitis A virus, hepatitis G virus);
• 5. Treatment of diseases with HCV-related viruses, such as yellow fever virus, dengue virus, West Nile virus, early-summer meningoencephalitis virus, Japanese encephalitis virus;
• 6. Treatment of mammals with related animal viruses, such as pestiviruses;
• 7. Treatment of materials or biological agents to prevent or reduce the transmission of hepatitis C (eg blood and blood products, blood donation items or surgical instruments).

Another object of the present invention is the use of the compounds of the invention for the manufacture of a medicament for the treatment and / or prophylaxis of diseases, esp especially the aforementioned diseases.

Prefers be the compounds of the invention used for the preparation of medicines for prophylaxis and / or treatment of infections with hepatitis C virus or others Members of the family Flaviviridae are suitable.

Another The present invention is the use of the compounds of the invention alone or in combination with other agents for treatment and / or prophylaxis of diseases, in particular those mentioned above Diseases.

Another The present invention relates to medicaments which are at least a compound of the invention, preferably together with interferon (pegylated or non-pegylated) or with ribavirin or with one or more anti-HCV agents or with a combination thereof, as well as their use for the purposes mentioned above.

Another The subject of the present invention is a method of treatment and / or prophylaxis of diseases, in particular those mentioned above Diseases using an antivirally effective amount of Compounds of the invention.

Another The subject of the present invention is a method of treatment a HCV infection by administering an effective amount of at least one of the compounds according to the invention, a pharmacologically acceptable salt, solvate or solvate a salt thereof or a drug as described above, alone or together with interferon (pegylated or non-pegylated) or with immunomodulators (for example ribavirin or viramidine) or with one or more anti-HCV agents or with a combination hereof, which can be administered together or separately.

Another The present invention is a method for prophylaxis a HCV infection by Administration of an effective amount of at least one of the compounds according to the invention, a pharmacologically acceptable salt, solvate or solvate a salt thereof or a drug as described above, alone or together with interferon (pegylated or non-pegylated) or with immunomodulators (for example ribavirin or viramidine) or with one or more anti-HCV agents or with a combination hereof, which can be administered together or separately.

drug of the present invention one or more additional ones containing active agents, preferably selected from the group antiviral Agents, immunomodulatory agents, HCV protease inhibitors, HCV polymerase inhibitors, inhibitors of another target in the HCV life cycle, HIV inhibitors, HAV inhibitors and HBV inhibitors. Examples of such agents are listed below and explained.

preferred Examples of some of these agents are ribavirin and amantadine (antiviral Agents), class I interferons, class II interferons and pegylated Interferons (immunomodulatory agents), inhibitors of HCV NS5B polymerase, HCV NS3 helicase, HCV protease or IRES (inhibitors another target in the HCV life cycle), nucleoside inhibitors, non-nucleoside Inhibitors, protease inhibitors, fusion inhibitors and integrase inhibitors of HIV (HIV inhibitors) or agents containing the HBV DNA polymerase inhibit, or hepatitis B vaccines (HBV inhibitors).

object The present invention is therefore also a combination therapy, in the at least one of the compounds of the invention or a pharmacological harmless salt, solvate or solvate of a salt thereof with at least one additional Agent, selected from the group antiviral agents, immunomodulatory agents, HCV protease inhibitors, HCV polymerase inhibitors, inhibitors of another target in the HCV life cycle, HIV inhibitors, HAV inhibitors and HBV inhibitors, be administered. The additional Agents can with the compounds of the invention into a single pharmaceutical dosage form. Alternatively you can these extra Agents are administered separately. Such additional agents may while or after administration of a compound of the invention or pharmacologically harmless salt, solvates or solvates of a salt thereof be administered.

definitions:

The term "anti-viral agent" means an agent that inhibits the formation and / or replication of a virus biert. This includes agents that interfere with host or virus mechanisms necessary for the formation and / or replication of a virus. Anti-viral agents include Ribavirin, Amantadine, VX-497 (Merimepodib, Vertex Pharmaceuticals), Viramidine, Ceplene (Maxamine), XTL-001 and XTL-002 (XTL-Biopharmaceuticals).

Of the Term "anti-HCV agent" means an agent, reduces or prevents hepatitis C-related disease symptoms. Such an agent may be an anti-viral agent, an immunomodulatory Agent, an HCV protease inhibitor, an HCV polymerase inhibitor or an inhibitor of another target in the HCV life cycle.

Of the Term "immunomodulatory Agent, "says one Agent that enhances the immune response or harmful immune reactions restrains. Immunomodulatory agents are e.g. Class I interferons (such as alpha, beta, delta and omega interferons, tau interferons, consensus interferons and asialo interferons), class II interferons (such as gamma interferons) and pegylated interferons as well as substances such as levovirin.

Of the Term "HCV protease inhibitor" means an agent, the function of HCV NS2 / 3 metalloprotease or NS3 / 4A serine protease inhibited. HCV NS3 / 4A serine protease inhibitors are e.g. BILN 2061 (Boehringer Ingelheim), or VX-950 / LY-570310 (Vertex / Eli Lilly).

The term "HCV polymerase inhibitor" means an agent that inhibits the function of HCV polymerase. This includes, for example, inhibitors of HCV NS5B polymerase. HCV polymerase inhibitors include non-nucleosides, for example compounds described in WO 02/100846 and WO 02/100851 (Shire), WO 01/85172 and WO 02/098424 (GSK), WO 00/06529 and WO 02 / 06246 (Merck), WO 01/47883 and WO 03/000254 (Japan Tobacco) and EP 1 256 628 (Agouron). In addition, HCV polymerase inhibitors include nucleoside analogs, for example, compounds described in WO 01/90121 (Idenix), WO 02/069903 (Biochryst Pharmaceuticals), WO 02/057287 and WO 02/057425 (Merck / Isis). Further examples of HCV polymerase inhibitors are JTK-002, JTK-003 and JTK-109 (Japan Tobacco).

Of the Term "inhibitor of another target in the HCV life cycle "means an agent that controls the formation and / or Replication of HCV other than by inhibition of HCV Function of a HCV protease or HCV polymerase inhibited. The includes Agents that interfere with mechanisms of the host or HCV, the for the formation and / or replication of HCV are necessary. inhibitors another target in the HCV life cycle includes agents, for example inhibit a helicase or an IRES as a target. A specific one example for an inhibitor of another target in the HCV life cycle is ISIS-14803 (ISIS Pharmaceuticals).

Of the Term "HIV inhibitor" means an agent, which inhibits the formation and / or replication of HIV. That includes agents One who intervene in mechanisms of the host or HIV responsible for education and / or replication of HIV are necessary. HIV inhibitors include e.g. nucleoside inhibitors, non-nucleoside inhibitors, protease inhibitors, Fusion inhibitors and integrase inhibitors.

The term "HAV inhibitor" means an agent that inhibits the formation and / or replication of HAV. This includes agents that interfere with mechanisms of the host or HAV necessary for the formation and / or replication of HAV. HAV inhibitors include Hepatitis A vaccines, for example, [for example, Havrix ^® (GSK), VAQTA ^® (Merck), Avaxim ^® (Aventis Pasteur)] a.

The term "HBV inhibitor" means an agent that inhibits the formation and / or replication of HBV. This includes agents that interfere with host or HBV mechanisms necessary for the formation and / or replication of HBV. For example, HBV inhibitors include agents that inhibit HBV DNA polymerase, or hepatitis B vaccines. Specific examples of HBV inhibitors include Lamivudine (Epivir-HBV ^®), Adefovir Dipivoxil, Entecavir, FTC (Coviracil ^®), DAPD (DXG), L-FMAU (Clevudine ^®), AM365 (Amrad), Ldt (Telbivudine), monoval-LdC (valtorcitabine), BAY 41-4109 (Bayer), ACH-126.443 (L-Fd4C) (Achillion), MCC ₄ 78 (Eli Lilly), Racivir (RCV), fluoro-L and D nucleosides, Robustaflavone , ICN2001-3 (ICN), Bam 205 (Novelos), XTL-001 (XTL), imino-sugar (Nony-DNJ) (Synergy), HepBzyme, and immunomodulatory products such as Interferon alpha-2b, HE2000 (Hollis-Eden ), Theradigm (Epimmune), EHT899 (Enzo Biochem), thymosin alpha-1 (Zadaxin ^®), HBV DNA vaccine (PowderJect), HBV DNA vaccine (Jefferon Center), HBV antigen (oragen), BayHep B ^® (Bayer), Nabi- ^HB® (Nabi) and anti-hepatitis B (Cangene), as well as HBV vaccines such as Engerix B, Recombivax HB, GenHevac B, Hepacare, Bio-Hep B, TwinRix, Comvax, Hexavac.

Of the Term "Class I interferons" means an interferon selected from a group of interferons, all to the receptor type I tie. That concludes natural and synthetically prepared class I interferons. Examples of class I interferons are alpha, beta and omega interferons, tau interferons, consensus interferons and asialo interferons.

Of the Term "class II interferons" means an interferon selected from a group of interferons, all to the receptor type II bind. Examples of class II interferons are gamma interferons.

Of the Term "treatment" means the administration of a drug according to the present invention to alleviate or eliminate the disease symptoms of hepatitis C. and / or to reduce the amount of virus.

Of the Term "Prophylaxis" means the administration of a medicament according to the present invention the infection with HCV, but before the onset of disease symptoms and / or before the detection of HCV in the blood.

The Compounds of the invention can act systemically and / or locally. For this purpose they can be applied in a suitable manner, e.g. oral, parenteral, pulmonary, nasal, sublingual, lingual, buccal, rectal, dermal, transdermal, conjunctival, otic or as an implant or stent.

For this Application routes can the compounds of the invention be administered in suitable administration forms.

For the oral Application are functioning according to the prior art rapidly and / or modifies the compounds according to the invention donating Application forms containing the compounds of the invention in crystalline and / or amorphized and / or dissolved form, e.g. Tablets (uncoated or coated Tablets, for example, with enteric or delayed dissolving or insoluble coatings that control the release of the compound of the invention), in the oral cavity rapidly disintegrating tablets or films / wafers, films / lyophilisates, Capsules (for example hard or soft gelatine capsules), dragees, Granules, pellets, powders, emulsions, suspensions, aerosols or Solutions.

The Parenteral administration can bypass a resorption step happen (e.g., intravenously, intraarterial, intracardiac, intraspinal or intralumbar) or involving absorption (e.g., intramuscular, subcutaneous, intracutaneous, percutaneous or intraperitoneal). For parenteral administration are suitable as application forms u.a. Injection and infusion preparations in the form of solutions, Suspensions, emulsions, lyophilisates or sterile powders.

For the others Application routes are suitable, e.g. Inhalation medicines (i.a. Powder inhalers, nebulizers), nasal drops, solutions, sprays; lingual, sublingual or buccally applied tablets, films / wafers or capsules, Suppositories, ear or eye preparations, vaginal capsules, aqueous suspensions (Lotions, shake mixes), lipophilic suspensions, ointments, creams, transdermal therapeutic systems, Milk, pastes, foams, Scattering powders, implants or stents.

The Compounds of the invention can in the cited Application forms are transferred. This can be done in a conventional manner by mixing with inert, Non-toxic, pharmaceutically suitable excipients happen. Among these adjuvants include et al excipients (for example, microcrystalline cellulose, lactose, mannitol), solvent (e.g., liquid Polyethylene glycols), emulsifiers and dispersing or wetting agents (For example, sodium dodecyl sulfate, Polyoxysorbitanoleat), binder (For example, polyvinylpyrrolidone), synthetic and natural polymers (for example, albumin), stabilizers (e.g., antioxidants such as for example ascorbic acid), Dyes (e.g., inorganic pigments such as iron oxides) and flavor and / or scent remedies.

Another The present invention relates to medicaments which are at least a compound of the invention, usually together with one or more inert, non-toxic, pharmaceutical contain suitable excipients, as well as their use to the previously mentioned purposes.

In general, it has proven to be advantageous to administer amounts of about 0.001 to 20 mg / kg, preferably about 0.01 to 5 mg / kg of body weight to achieve effective results when administered intravenously, and for oral administration, the dosage is about 0.01 to 50 mg / kg, preferably 0.1 to 10 mg / kg body weight.

Nevertheless it may be necessary, if necessary, of the quantities mentioned to deviate, depending on of body weight, Route of administration, individual behavior towards the active substance, type of Preparation and time or interval to which the application he follows. So it can in some cases be sufficient, with less than the aforementioned minimum quantity to get along while in other cases exceeded the mentioned upper limit must become. In case of application of larger quantities it may be recommended be to distribute these in several single doses throughout the day.

The Percentages in the following tests and examples are provided not stated otherwise, weight percentages; Parts are parts by weight. Solvent ratios, dilution ratios and concentration data of liquid refer to liquid solutions each on the volume.

A. Examples

Used abbreviations:

• BINAP

  2,2'-bis (diphenylphosphino) -1,1'-binaphthyl

  CDCl ₃

  deuterochloroform

  CD ₃ CN

  deuteroacetonitrile

  DC

  TLC

  DCI

  direct chemical Ionization (in MS)

  DCM

  dichloromethane

  DIEA

  N, N-diisopropylethylamine (Hünig Base)

  DMAP

  4-N, N-dimethylaminopyridine

  DMSO

  dimethyl sulfoxide

  DMF

  N, N'-dimethylformamide

  theory

  the theory

  EE

  Ethyl acetate (ethyl acetate)

  EGG

  Electron impact ionization (in MS)

  IT I

  Electrospray ionization (in MS)

  Mp.

  melting point

  ges.

  saturated

  H

  hour

  HPLC

  High pressure, high performance liquid chromatography

  conc.

  concentrated

  LC-MS

  Liquid chromatography-coupled mass spectroscopy

  LDA

  Lithium diisopropylamide

  LiOH

  lithium hydroxide

  MS

  mass spectroscopy

  NMR

  Nuclear Magnetic Resonance Spectroscopy

  proc.

  percent

  RP-HPLC

  Reverse phase HPLC

  RT

  room temperature

  R _t

  Retention time (at HPLC)

  THF

  tetrahydrofuran

General LCMS and HPLC methods:

Method 1 (HPLC): Instrument: HP 1100 with DAD detection; Column: Kromasil RP-18, 60 mm × 2 mm, 3.5 μm; Eluent A: 5 ml HClO ₄ / l water, eluent B: acetonitrile; Gradient: 0 min 2% B, 0.5 min 2% B, 4.5 min 90% B, 6.5 min 90% B; Flow: 0.75 ml / min; Oven: 30 ° C; UV detection: 210 nm.

method 2 (HPLC, preparative Separation): column: CromSil C18, 250 mm × 30 mm; Eluent A: water, eluent B: acetonitrile; Gradient: 3 min 10% B → 31 min 90% B → 34 min 90% B → 34.01 min 10% B; Running time: 38 min; Flow: 50 ml / min; UV detection: 210 nm.

Method 3 (HPLC): Instrument: HP 1100 with DAD detection; Column: Kromasil RP-18, 60 mm × 2 mm, 3.5 μm; Eluent A: 5 ml HClO ₄ / l water, eluent B: acetonitrile; Gradient: 0 min 2% B, 0.5 min 2% B, 4.5 min 90% B, 9 min 90% B; Flow: 0.75 ml / min; Oven: 30 ° C; UV detection: 210 nm.

method 4 (LC-MS): Device type MS: Micromass ZQ; device type HPLC: HP 1100 Series; UV DAD; Pillar: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm × 4 mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 liter acetonitrile + 0.5 ml 50% formic acid; Gradient: 0.0 min 90% A → 2.5 min 30% A → 3.0 min 5% A → 4.5 min 5% A; River; 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min 2 ml / min; Oven: 50 ° C; UV detection: 210 nm.

method 5 (LC-MS): Instrument: Micromass Quattro LCZ with HPLC Agilent series 1100; Pillar: Phenomenex Synergi 2μ Hydro-RP Mercury 20 mm × 4 mm; Eluent A: 1 l of water + 0.5 ml of 50% formic acid, eluent B: 1 liter acetonitrile + 0.5 ml 50% formic acid; Gradient: 0.0 min 90% A → 2.5 min 30% A → 3.0 min 5% A → 4.5 min 5% A; Flow: 0.0 min 1 ml / min, 2.5 min / 3.0 min / 4.5 min 2 ml / min; Oven: 50 ° C; UV detection: 208 - 400 nm.

starting compounds

Example 1A

2-aminothiophene-3-carbonsäuremethylester

In analogy to J. Med. Chem. 1999, 42, 5437-5447, 65.1 g (656.9 mmol) of methyl cyanoacetate and 50.0 g (328.4 mmol) of 2,5-dihydroxy-1,4-dithiane in 400 ml of DMF are initially charged While cooling with ice, 45.8 ml (328.4 mmol) of triethylamine are added dropwise. The reaction mixture is stirred for 2 h at RT and then diluted with 1.2 leiner 0.4M acetic acid. The aqueous phase is extracted four times with 150 ml each of tert-butyl methyl ether. The combined organic phases are washed twice with 150 ml of water and dried with sodium sulfate. The solvent is removed under reduced pressure and gentle heating on a rotary evaporator. The residue is purified by washing twice with cold cyclohexane to give 35.3 g (68% of theory) of product.
HPLC (Method 1): R _t = 3.63 min
Ms (DCI (NH ₃ )): m / z = 158 (M + H) ⁺ .
¹ H-NMR (400MHz, CDCl _3): δ = 6.96 (d, 1H), 6.18 (d, 1H), 5.94 (br. S, 2H), 3.81 (s, 3H).

Example 2A

2- (isopropylamino) thiophene-3-carbonsäuremethylester

27.5 g (175.0 mmol) of 2-amino-thiophene-3-carboxylic acid methyl ester are initially charged under argon in 533 ml of dichloromethane and 50.5 g (700 mmol) of 2-methoxypropene, 42.0 g of glacial acetic acid (700 mmol) and 74.2 g (350 mmol) sodium triacetoxyborohydride. The reaction mixture is stirred for 2 h at RT and then neutralized with an aqueous 2N sodium hydroxide solution. After separation of the phases, the aqueous phase is extracted three times with dichloromethane. The combined organic phases are dried with sodium sulfate and the solvent is stripped off under reduced pressure and gentle heating on a rotary evaporator. The residue is purified by flash chromatography (mobile phase gradient: 0% ethyl acetate in petroleum ether to 3% ethyl acetate in petroleum ether) and obtained 24.9 g (72% of theory) of product.
HPLC (Method 1): R _t = 4.88 min
MS (DCI (NH ₃ )): m / z = 200 (M + H) ⁺ .
¹ H-NMR (400MHz, CDCl _3): δ = 7.36 (d, 1H) 7.00 (d, 1H), 6.14 (d, 1H), 3.78 (s, 3H), 3:45 to 3:55 (m, 1H), 1.31 (d, 6H).

Example 3A

2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

30.0 g (211.0 mmol) of trans-4-methyl-cyclohexanecarboxylic acid are dissolved under argon in 150.6 g (1.27 mol) of thionyl chloride and boiled under reflux for 1 h. After cooling, the excess thionyl chloride is removed in vacuo with gentle heating and the residue is coevaporated three times with dry toluene. 33.9 g (211.0 mmol) of trans-4-methylcyclohexanecarboxylic acid chloride and 25.9 g (200.5 mmol) of dry diisopropylethylamine are added under argon to 21.0 g (105.5 mmol) of methyl 2-isopropylamino-thiophene-3-carboxylate. It is heated with stirring to 80 ° C overnight. The mixture is then diluted with dichloromethane and carefully added aqueous saturated sodium carbonate solution. The phases are separated, the aqueous phase is extracted three times with dichloromethane, the combined organic phases are dried over sodium sulfate, filtered and concentrated. After column chromatography on silica gel 60 (eluent: ethyl acetate: cyclohexane 1: 5), 32.5 g (49% of theory) of product are obtained.
HPLC (Method 1): R _t = 5.20 min
MS (ESI +): m / z = 324 (M + H) ^+
1 H-NMR (400MHz, CDCl _3): δ = 7.44 (d, 1H), 7.19 (d, 1H), 4.94 (m, 1H), 3.79 (s, 3H), 1.93-2.09 (m, 1H), 1.56-1.78 (m, 5H), 1.19-1.43 (m, 2H), 1.16 (d, 3H), 0.88 (d, 3H), 0.77 (d, 3H), 0.54-0.74 (m, 2H).

Example 4A

5-bromo-2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

15.4 g (47.1 mmol) of 2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid methyl ester are initially charged in 308 ml of a 1: 1 mixture of chloroform: carbon tetrachloride and 21.2 g (119.0 mmol) of N are added Bromosuccinimide added. The mixture is stirred under reflux for 2.5 h. After cooling, the solvent is removed in vacuo with gentle heating. The residue is purified by flash chromatography on silica gel 60 (solvent: ethyl acetate: cyclohexane 1: 5) to give 13.8 g (72% of theory) of product
HPLC (Method 3): R _t = 5.88 min
MS (ESI +): m / z = 402 (M + H) ⁺ .
¹ H-NMR (400MHz, CDCl _3): δ = 7.42 (s, 1H), 4.91 (m, 1H), 3.78 (s, 3H), 2:02 to 2:16 (m, 1H), 1.55-1.74 (m, 5H ), 1.22-1.49 (m, 2H), 1.14 (d, 3H), 0.90 (d, 3H), 0.79 (d, 3H), 0.61-0.78 (m, 2H).

Example 5A

2- (tetrahydro-2H-pyran-4-yl) aminothiophene-3-carbonsäuremethylester

2.0 g (12.7 mmol) of 2-aminothiophene-3-carboxylic acid methyl ester are initially charged in 10 ml of 1,2-dichloroethane, 1.27 g (12.7 mmol) of tetrahydropyran-4-one are added and the mixture is stirred at room temperature overnight. Subsequently, 5.39 g (25.4 mmol) of sodium trisacetoxyborohydride and 3.06 g (50.9 mmol) of acetic acid are added and the mixture is stirred at 40 ° C. overnight. Thereafter, the batch is poured onto saturated sodium bicarbonate solution, the organic phase separated, the aqueous phase extracted three times with dichloromethane, the organic phases combined, dried over sodium sulfate, filtered and the solvent removed in vacuo. The product is purified by chromatography on silica gel with dichloromethane. Yield: 835 mg (26% of theory).
HPLC (Method 1): R _t = 4.33 min
MS (ESI-pos): m / z = 242 (M + H) ⁺

Example 6A

2 - [[(trans-4-methylcyclohexyl) carbonyl] (tetrahydro-2H-pyran-4-yl) amino] thiophene-3-carbonsäuremethylester

474 mg (1.96 mmol) of the amine from Example 5A and 1.5 ml of trans-4-methylcyclohexylcarboxylic acid chloride are combined and the mixture is stirred at 90 ° C. overnight. The cooled mixture is taken up in ethyl acetate and extracted four times with saturated sodium bicarbonate solution. The product is purified by preparative HPLC (Method 2). Yield: 261 mg (36% of theory).
HPLC (Method 1): R _t = 4.92 min
MS (ESI-pos): m / z = 366 (M + H) ⁺

Example 7A

5-bromo-2 - [[(trans-4-methylcyclohexyl) carbonyl] (tetrahydro-2H-pyran-4-yl) amino] thiophene-3-carbonsäuremethylester

338 mg (0.93 mmol) of the thiophene from Example 6A are initially charged in 14 ml of a 1: 1 mixture of carbon tetrachloride and chloroform, 823 mg (4.62 mmol) of N-bromosuccinimide are added and the mixture is stirred under reflux for 5 hours. The reaction is diluted with dichloromethane and added to saturated thiosulphate solution. The organic phase is separated, the aqueous phase extracted with dichloromethane, the combined organic phase washed with saturated sodium chloride solution, dried over sodium sulfate, filtered, the solvent removed in vacuo and the product purified by preparative HPLC (Method 2). Yield: 356 mg (87% of theory).
HPLC (Method 3): R _t = 5.52 min
MS (DCI pos): m / z = 446 (M + H) ⁺

Example 8A

5- (3,3-dimethylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

500.0 mg (1.24 mmol) of methyl 5-bromo-2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylate, 439.0 mg (5.34 mmol, 4.3 equiv) of 3,3-dimethyl-1-butyne , 892.8 mg (8.82 mmol, 7.1 equiv) of triethylamine, 32.6 mg (0.12 mmol, 0.1 equiv) of triphenylphosphine, 4.7 mg (0.02 mmol, 0.02 equiv) of copper (I) iodide are initially charged in 5 ml of N, N'-dimethylformamide and argon is passed through the reaction mixture for 1 h. Then add 79.7 mg (0.09 mmol, 0.07 equiv) of tris (dibenzyl) acetal and the reaction mixture is stirred overnight at 60 ° C in a closed reaction vessel. The contents of the flask are filtered through kieselguhr and purified by preparative HPLC. 350.0 mg (70% of theory) of product are obtained
HPLC (Method 3): R _t = 6.77 min
MS (DCI): m / z = 404 (M + H) ⁺ .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 7.42 (s, 1H), 4.69-4.80 (m, 1H), 3.72 (s, 3H), 1.97-2.08 (m, 1H), 1.41-1.66 (m, 5H), 1.17-1.35 (m, 11H), 1.08 (d, 3H), 0.82 (d, 3H), 0.77 (d, 3H), 0.57-0.74 (m, 2H).

Example 9A

5- (cyclopropylethynyl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

500.0 mg (1.24 mmol) of methyl 5-bromo-2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylate, 353.2 mg (5.34 mmol, 4.3 equiv) of ethynylcyclopropane, 892.8 mg (8.82 mmol, 7.1 equiv) triethylamine, 32.6 mg (0.12 mmol, 0.1 equiv) of triphenylphosphine, 4.7 mg (0.02 mmol, 0.02 equiv) of copper (I) iodide are initially charged in 5 ml of N, N'-dimethylformamide and the reaction mixture is stirred for 1 h Passed through argon. Subsequently, 79.7 mg (0.09 mmol, 0.07 equiv) of tris (dibenzylideneacetone) dipalladium are added and the reaction mixture is stirred overnight at 60.degree. The contents of the flask are filtered through kieselguhr and purified by preparative HPLC. This gives 263.0 mg (55% of theory) of product
HPLC (Method 3): R _t = 6.14 min
MS (DCI): m / z = 388 (M + H) ⁺ .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 7.41 (s, 1H), 4.66-4.80 (m, 1H), 3.72 (s, 3H), 1.94-2.05 (m, 1H), 1.39-1.65 (m, 6H), 1.17-1.35 (m, 2H), 1.08 (d, 3H), 0.86-0.07 (m, 2H), 0.72-0.85 (m, 8H), 0.50-0.72 (m, 2H).

General working instructions [A]: Sonogashira coupling of bromo-thiophenes with alkynes

Under Argon becomes 0.25 mmol (1.0 equivalent) of bromothiophene, 1.07 mmol (4.3 equivalents) of alkyne, 1.76 mmol (7.1 equivalents) Triethylamine, 0.02 mmol (0.1 equiv.) Triphenylphosphine and 0.005 mmol (0.02 equivalents) of copper (I) iodide in 1 ml of N, N'-dimethylformamide solved. The mixture is passed through the reaction mixture at RT argon for 1 h and then tri (dibenzylideneacetone) dipalladium is added added. The reaction mixture is over Night at 60 ° C stirred in a closed reaction vessel. After cooling, it is filtered one over kieselguhr and cleans by preparative HPLC (RP-18 column, Eluent acetonitrile-water gradient).

The Examples 10A to 18A are analogously to the general Working instruction [A] from the corresponding starting compounds produced.

Example 19A

5- (3,3-dimethylbut-1-yn-1-yl) -2 - [[(trans-4-methylcyclohexyl) carbonyl] (tetrahydro-2H-pyran-4-yl) amino] thiophene-3-carbonsäuremethylester

100 mg (0.23 mmol) of the bromide from Example 7A, 79 mg (0.97 mmol) of 3,3-dimethyl-1-butyne, 162 mg (1.60 mmol) of triethylamine, 5.9 mg (0.02 mmol) of triphenylphosphine and 0.9 mg (0.005 mmol) Copper (I) iodide are introduced into 1 ml of N, N'-dimethylformamide, the solution is heated to 60 ° C. and argon is passed through the warm solution for 1 hour. Subsequently, 14 mg (0.016 mmol) of tris (dibenzylideneacetone) dipalladium are added and the mixture is stirred overnight at 60 ° C. under argon. The cooled mixture is filtered through kieselguhr, the diatomaceous earth is washed with acetonitrile and the product is purified by preparative HPLC (method 2). Yield: 54 mg (54% of theory).
HPLC (Method 3): R _t = 6.17 min
MS (ESIpos): m / z = 446 (M + H) ⁺

Example 20A

2 - {(2-methoxy-1-methylethylamino} -thiophene-3-carbonsäuremethylester

2.0 g (12.72 mmol) of methyl 2-aminothiophene-3-carboxylate are introduced into 1,2-dichloroethane, 1.12 g (12.72 mmol) of methoxyacetone are added and the mixture is stirred at room temperature overnight. Subsequently, 5.39 g (25.45 mmol) of sodium triacetoxyborohydride and 3.06 g (50.89 mmol) of acetic acid are added and the mixture is stirred overnight at 40.degree. Then the mixture is cooled, cautiously treated with saturated sodium bicarbonate solution and the organic phase separated. The aqueous phase is extracted three times with dichloromethane, all organic phase are combined, dried over sodium sulfate, filtered and the solvent mixture is removed in vacuo. The product is purified by chromatography on silica gel (mobile phase dichloromethane) and preparative HPLC (Method 2). Yield: 254 mg (9% of theory).
HPLC (Method 1): R _t = 4.53 min
MS (ESI-pos): m / z = 230 (M + H) ⁺

Example 21A

2 - {(2-methoxy-1-methylethyl) [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

277 mg (1.21 mmol) of the aminothiophene from Example 20A are mixed with 0.3 ml of trans-4-methylcyclohexane-1-carboxylic acid chloride and the mixture is stirred overnight at 90 ° C bath temperature. Then another 0.3 ml of the acid chloride are added and stirred for 11 h at 90 ° C. The reaction mixture is taken up in ethyl acetate, extracted three times with saturated sodium bicarbonate solution, the organic phase is separated off and dried over sodium sulfate, filtered and the solvent is removed in vacuo. The product is purified by preparative HPLC (Method 2). Yield: 108 mg (25% of theory).
HPLC (Method 3): R _t = 4.58 min
MS (ESI-pos): m / z = 354 (M + H) ⁺

Example 22A

5-bromo-2 - {(2-methoxy-1-methylethyl) [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

105 mg (0.30 mmol) of the thiophene from Example 21A are initially charged in 4 ml of a 1: 1 mixture of carbon tetrachloride and chloroform, 132 mg (0.74 mmol) of N-bromosuccinimide are added and the mixture is refluxed for 3 h and then overnight at room temperature touched. The batch is diluted with dichloromethane and the product is purified by chromatography on silica gel (gradient: dichloromethane to dichloromethane / methanol 100: 1 v / v). Yield: 141 mg (95% of theory).
HPLC (Method 4): R _t = 3.24 min
MS (ESI-pos): m / z = 433 (M + H) ⁺

General working procedure [B]: Alternative method of Sonogashira coupling of 5-bromothiophenes with alkynes

To a 0.1 M solution of 1.0 equivalents of bromothiophene in DMF become 7.1 equivalents of triethylamine, 0.1 equiv Triphenlyphosphine and 0.02 equivalents Copper (I) iodide given. Argon is passed through this solution for 15 minutes, then 4.3 equiv Alkyne and 0.07 equivalents Added tris (dibenzylidene) dipalladium and the reaction mixture overnight at 65 ° C touched. Subsequently, will the mixture over Diatomaceous earth filtered and by preparative HPLC (method 2) cleaned.

The following examples are produced according to the general procedure [B]:

Example 29A

5- [3- (acetylamino) -3-methylbut-1-yn-1-yl] -2 - [[(trans-4-methylcyclohexyl) carbonyl] - (tetrahydro-2H-pyran-4-yl) amino] thiophene -3-carbonsäuremethylester

50 mg (0.11 mmol) of the amine from Example 7A and 16 mg (0.12 mmol) Hunig base are initially charged in 5 ml of tetrahydrofuran, admixed with 13 mg (0.12 mmol) of acetic anhydride and the mixture is stirred overnight at room temperature. The volatiles are then removed in vacuo and the product is purified by preparative HPLC (method 2). Yield: 38 mg (66% of theory).
HPLC (Method 3): R _t = 4.63 min
MS (ESIpos): m / z = 489 (M + H) ⁺

Example 30A

2 - [[(trans-4-methylcyclohexyl) carbonyl] (tetrahydro-2H-pyran-4-yl) amino] -5- {3-methyl-3 - [(methylsulfonyl) amino] but-1-yn-1- yl} thiophene-3-carbonsäuremethylester

25 mg (0.06 mmol) of the amine from Example 7A and 17 mg (0.17 mmol) of triethylamine are dissolved in 2 ml Submitted to dichloromethane, treated with 16 mg (0.14 mmol) of methanesulfonyl chloride and the mixture was stirred for 2 h at room temperature. The volatiles are then removed in vacuo and the product is purified by preparative HPLC (method 2). Yield: 16 mg (52% of theory).
HPLC (method 5): R _t = 2.60 min
MS (ESIpos): m / z = 525 (M + H) ⁺

Example 31A

2 - ({[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} amino) thiophene-3-carbonsäuremethylester

(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexanecarboxylic acid is synthesized in analogy to WO 2004/052885. 9.00 g (44.9 mmol) of (1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexanecarboxylic acid are dissolved in 50 ml of thionyl chloride and stirred at room temperature for 2 h. The reaction mixture is evaporated to dryness in vacuo, taken up in 90 ml of dioxane and admixed with 6.54 g (41.6 mmol) of methyl 2-amino-5-phenylthiophene-3-carboxylate. The solution is stirred at 90 ° C for 30 minutes. The cooled reaction mixture is partitioned between ethyl acetate and saturated sodium bicarbonate solution. The combined organic phases are dried over magnesium sulfate and evaporated in vacuo. After purification over silica gel 60 by MPLC (mobile phase: cyclohexane / ethyl acetate 5/1), the residue gives 5.66 g (39% of theory) of product.
HPLC (Method 1): R _t = 4.76 min
MS (DCI (NH ₃ )): m / z = 357 (M + NH ₄ ) ^+
1 H-NMR (300MHz, DMSO-d ₆ ): δ = 11.03 (s, 1H), 7.16 (d, 1H), 7.01 (d, 1H), 5.36-5.30 (m, 1H), 3.85 (s, 3H ), 2.90-2.80 (m, 1H), 1.95-1.56 (m, 8H, where: 1.93 (s, 3H)), 1.33-.20 (m, 1H), 1.12-0.95 (m, 1H), 0.96 ( d, 3H)

Example 32A

2 - [{[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} (isopropyl) amino] thiophene-3-carbonsäuremethylester

5.66 g (16.7 mmol) of the compound from Example 31A, 13.22 g (50.0 mmol) of 18-crown-6 and 46.1 g (333 mmol) of potassium carbonate are initially charged in 60 ml of N, N-dimethylformamide and then treated with 33.2 ml (333 ml mmol) of 2-iodopropane. The reaction mixture is stirred overnight at 40 ° C in a closed reaction vessel. The cooled reaction mixture is partitioned between ethyl acetate and 2N hydrochloric acid, the organic phase is washed with water, dried over magnesium sulfate and the solvent evaporated in vacuo. This crude product is again implemented analogously to the previous work instructions. After the second reaction, the residue is purified over silica gel 60 using MPLC (eluent: cyclohexane / ethyl acetate 8/1 → 5/1) and a clean and a contaminated fraction are isolated. The separation of the mixed fraction on the preparative RP-HPLC with a water / acetonitrile gradient results in another clean product fraction. After combining the purified fractions, 1.68 g (26% of theory) of product are obtained.
HPLC (Method 3): R _t = 4.85 min
MS (DCI (NH ₃ )): m / z = 399 (M + NH ₄ ) ^+
1 H-NMR (400MHz, DMSO-d ₆ ): δ = 7.56 (s, 1H), 7.41 (s, 1H), 5.09-5.03 (m, 1H), 4.75-4.62 (m, 1H), 3.75 (s , 3H), 2.35 (br d, 1H), 1.98-1.79 (m, 4H, therein: 1.95 (s, 3H)), 1.70-1.55 (m, 3H), 1.47-1.40 (m, 1H), 1.05 ( d, 3H), 0.85-0.72 (m, 8H).

Example 33A

2 - [{[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} (isopropyl) amino] -5-bromothiophene-3-carbonsäuremethylester

1.68 g (4.4 mmol) of the compound from Example 32A and 1.96 g (11.0 mmol) of N-bromosuccinimide are stirred in 30 ml of a mixture of chloroform / carbon tetrachloride 1/1 under reflux overnight. The solvent is evaporated in vacuo and the residue is purified on silica gel 60 using MPLC (eluent: cyclohexane / ethyl acetate 5: 1). 1.7 g (83% of theory) of product are obtained.
HPLC (Method 3): R _t = 5.39 min
MS (DCI (NH ₃ )): m / z = 477/479 (M + NH ₄ ) ^+
1 H-NMR (300MHz, DMSO-d _6): δ = 7.55 (s, 1H), 5:18 to 5:08 (m, 1H), 4.75-4.60 (m, 1H), 3.75 (s, 3H), 2.00-1.80 (m, 4H, therein 1.95 (s, 3H)), 1.70-1.52 (m, 3H), 1.48-1.35 (m, 1H), 1.10-0.70 (m, 11H, therein 1.03 (d, 3H)).

Example 34A

2 - [{[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} (isopropyl) amino] -5- (3-methylbut-1-yn-1-yl) thiophene-3- carbonsäuremethylester

60.0 mg (130 μmol) of the compound from Example 33A, 129 μl (0.93 mmol) triethylamine, 3.4 mg (13.0 μmol) triphenylphosphine, 0.5 mg (2.6 μmol) copper (I) iodide and 8.4 mg (9.1 μmol) tris (dibenzylideneacetone) Dipalladium be presented in 1 ml of N, N-dimethylformamide under argon, 38.7 mg (560 .mu.mol) of 3-methyl-1-butyne are added and stirred in a closed reaction vessel at 60 ° C overnight. Ethyl acetate is added to the cooled reaction, washed several times with water and once with saturated sodium chloride solution, the organic phase is filtered through silica gel 60 / magnesium sulfate and the solvent is evaporated in vacuo. The residue is prepurified on silica gel 60 using MPLC (mobile phase: cyclohexane / ethyl acetate 8/1 → 5/1) and, after repeated separation via preparative RP-HPLC (water / acetonitrile gradient), 41.7 mg (71% of theory) of th. ) Product received.
HPLC (Method 3): R _t = 5.61 min
MS (ESI +): m / z = 448 (M + H) ^+
1 H-NMR (300MHz, DMSO-d ₆ ): δ = 7.44 (s, 1H), 5.18-5.08 (m, 1H), 4.78-4.63 (m, 1H), 3.73 (s, 3H), 2.94-2.80 (m, 1H), 2.50-2.38 (m, 1H), 1.80-2.02 (m, 4H, therein: 1.94 (s, 3H)), 1.52-1.70 (m, 3H), 1.47-1.36 (m, 1H) , 1.22 (d, 6H), 1.04 (d, 3H), 0.97-0.68 (m, 8H).

Example 35A

2 - [{[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} (isopropyl) amino] -5- (cyclopropylethynyl) thiophen-3-carbonsäuremethylester

The compound is obtained analogously to the procedure of Example 34A from 60.0 mg (130 μmol) of the compound from Example 33A and 37.0 mg (560 μmol) of ethynylcyclopropane with 37.2 mg (64% of theory).
HPLC (Method 1): R _t = 5.40 min
MS (ESI +): m / z = 446 (M + H) ^+
1 H-NMR (300MHz, DMSO-d ₆ ): δ = 7.44 (s, 1H), 5.20-5.05 (m, 1H), 4.76-4.62 (m, 1H), 3.72 (s, 3H), 2.48-2.37 (m, 1H), 2.01-1.79 (m, 4H, therein: 1.95 (s, 3H)), 1.78-1.52 (m, 4H), 1.46-1.34 (m, 1H), 1.04 (d, 3H), 0.98 -0.68 (m, 11H).

Example 36A

2 - [{[(1R, 2S, 4R) -2- (acetyloxy) -4-methylcyclohexyl] carbonyl} (isopropyl) amino] -5- (4-hydroxy-3,3-dimethylbut-1-yn-1- yl) thiophen-3-carbonsäuremethylester

100 mg (217 μmol) of the compound from Example 33A, 5.7 mg (22.0 μmol) of triphenylphosphine, 0.8 mg (4 μmol) of copper (I) iodide and 4.0 mg (4 μmol) of tris (dibenzylideneacetone) dipalladium are dissolved in 1 ml of N, N Dimethylformamide under argon, 214 μl (1.54 mmol) of triethylamine and 42.6 mg (0.434 mmol) of 2,2-dimethylpent-3-yn-1-ol (X. Creary, J. Am. Chem. Soc. 1977, 99, 7632-7639) are added and stirred in a closed reaction vessel at 75 ° C for 4 h. The reaction mixture is partitioned between tert-butyl methyl ether and 2N hydrochloric acid, the organic phase is dried over sodium chloride, decanted and evaporated to dryness. The residue is purified on silica gel 60 by means of vacuum flash chromatography (eluent: cyclohexane / ethyl acetate 85/15 - 66:33). There are obtained 103 mg (99% of theory) of product.
HPLC (Method 3): R _t = 4.91 min
MS (ESI +): m / z = 478 (M + H) ^+
1 H-NMR (300MHz, DMSO-d ₆ ): δ = 7.42 (s, 1H), 5.18-5.15 (m, 1H), 5.08 (t, 1H), 4.78-4.67 (m, 1H), 3.73 (s , 3H), 3.38-3.28 (m, 2H), 2.43 (br d, 1H), 2.03-1.83 (m, 4H, therein 1.94 (s, 3H)), 1.70-1.53 (m, 3H), 1.48-1.38 (m, 1H), 1.25-0.70 (m, 17H, 1.20 (s, 6H), 1.03 (d, 3H), 0.77 / 0.75 (rotamers, 2 d, 3H)).

Example 37A

5- (4-hydroxy-3,3-dimethylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carbonsäuremethylester

100 mg (249 μmol) of the compound from Example 4A, 6.5 mg (25 μmol) of triphenylphosphine, 0.95 mg (5 μmol) of copper (I) iodide and 4.5 mg (5 μmol) of tris (dibenzylideneacetone) dipalladium are dissolved in 1 ml of N, N Dimethylformamide presented under argon, 245 .mu.l (1.76 mmol) of triethylamine and 36.5 mg (0.373 mmol) of 2,2-dimethylpent-3-in-1-ol are added and stirred in a closed reaction vessel at 90 ° C for 6 h. The reaction mixture is partitioned between tert-butyl methyl ether and 2N hydrochloric acid, the organic phase is dried over sodium chloride, decanted and evaporated to dryness. The residue is purified on silica gel 60 by means of vacuum flash chromatography (eluent: petroleum ether / ethyl acetate 85/15 - 70:30). It will be 50 mg (43% of theory) product.
HPLC (Method 3): R _t = 5.24 min
MS (DCI): m / z = 420 (M + H) ^+
1 H-NMR (400MHz, DMSO-d ₆ ): δ = 7.42 (s, 1H), 5.05 (t, 1H), 4.80-4.70 (m, 1H), 3.71 (s, 3H), 3.40-3.27 (m , 2H), 2.10-1.95 (m, 1H), 1.65-0.60 (m, 24H, 1.20 (s, 6H), 0.81 (d, 3H), 0.77 (d, 3H)).

General working instructions [C]: Sonogashira coupling of the compound of Example 33A with alkynes

130 μmol (1.0 equivalent) the compound of Example 33A, 925 μmol (7.1 equivalents) of triethylamine, 13.0 μmol (0.1 equivalent) Triphenylphosphine, 2.6 μmol (0.02 equivalents) Copper (I) iodide and 9.1 μmol (0.07 equivalents) Tris (dibenzylideneacetone) dipalladium are dissolved in 1 ml of N, N-dimethylformamide submitted under argon, 560 .mu.mol (4.3 equivalents) Alkyne are added and in a closed reaction vessel at 60 ° C overnight stirred. To the cooled Reaction is added ethyl acetate, several times with water and once with saturated Sodium chloride solution washed, the organic phase over Diatomaceous earth filtered and the solvent is evaporated in vacuo. The residue will over the preparative RP-HPLC (water / acetonitrile gradient) cleaned.

The following examples are prepared according to General Procedure [C]:

embodiments

example 1

5- (3,3-Dimethylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

70.0 mg (0.17 mmol) of 5- (3,3-dimethylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid methyl ester are dissolved in 1 ml of dioxane solved. 1 ml of an aqueous 1N lithium hydroxide solution is added and the mixture is stirred at RT for 2 h. The reaction mixture is acidified and the dioxane is stripped off in vacuo with gentle heating. The residual volume is diluted with acetonitrile and dimethyl sulfoxide and purified by means of preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). This gives 31 mg (46% of theory) of product.
HPLC (Method 3): R _t = 5.89 min
MS (ESIpos): m / z = 390 (M + H) ^+.
1 H-NMR (400MHz, DMSO-d ₆ ): δ = 13.17 (br s, 1H), 7.37 (s, 1H), 4.66-4.83 (m, 1H), 1.96-2.12 (m, 1H), 1.39- 1.69 (m, 5H), 1.16-1.34 (m, 11H), 1.09 (d, 3H), 0.85 (d, 3H), 0.77 (d, 3H), 0.53-0.73 (m, 2H).

Example 2

5- (cyclopropylethynyl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

70.0 mg (0.18 mmol) of methyl 5- (cyclopropylethynyl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylate are dissolved in 1 ml of dioxane. 1 ml of an aqueous 1N lithium hydroxide solution is added and the mixture is stirred at RT for 2 h. The reaction mixture is acidified and the dioxane is stripped off in vacuo with gentle heating. The residual volume is diluted with acetonitrile and dimethyl sulfoxide and purified by means of preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 40 mg (59% of theory) of product are obtained.
HPLC (Method 3): R _t = 5.45 min
MS (ESIpos): m / z = 374 (M + H) ⁺ .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 13.17 (br s, 1H), 7.39 (s, 1H), 4.63-4.83 (m, 1H), 1.94-2.11 (m, 1H), 1.36- 1.67 (m, 6H), 1.15-1.34 (m, 2H), 1.08 (d, 3H), 0.89-0.97 (m, 2H), 0.85 (d, 3H), 0.74-0.82 (m, 5H), 0.52- 0.73 (m, 2H).

Example 3

5- (cyclohexylethynyl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

70 mg (0.16 mmol) of the compound from Example 10A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 2 h at RT and then worked up as described in Example 1. After preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95), 10.0 mg (12% of theory) of product are obtained.
HPLC (Method 3): R _t = 6.38 min
MS (ESIpos): m / z = 416.1 (M + H) ⁺ .
¹ H-NMR (400 MHz, CD ₃ OD): δ = 7.38 (s, 1H), 2.60-2.72 (m, 1H), 2.09-2.22 (m, 1H), 1.24-1.96 (m, 18H), 1.18 ( d, 3H), 0.96 (d, 3H), 0.82 (d, 3H), 0.62-0.79 (m, 2H).

Example 4

2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} -5- (3-methylbut-1-yn-1-yl) thiophene-3-carboxylic acid

The 51 mg (0.13 mmol) of the compound from Example 11A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 42 mg (85% of theory) of product are obtained.
HPLC (Method 1): R _t = 5.64 min
MS (ES): m / z = 374.0 (M-H) ^- .
¹ H-NMR (400 MHz, DMSO-d ₆ ): δ = 13.2 (br.s, 1H), 7.39 (s, 1H), 4.67-4.82 (m, 1H), 2.77-2.92 (m, 1H), 1.96 -2.11 (m, 1H), 1.35-1.68 (m, 5H), 1.14-1.32 (m, 8H), 1.09 (d, 3H), 0.85 (d, 3H), 0.77 (d, 3H), 0.55-0.73 (m, 2H).

Example 5

5- (3-hydroxy-3-methylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

95 mg (0.23 mmol) of the compound from Example 12A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 67 mg (73% of theory) of product are obtained.
HPLC (Method 1): R _t = 4.62 min
MS (ES): m / z = 390.0 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 13.2 (br s, 1H), 7.42 (s, 1H), 5.58 (nr s, 1H), 4.67-4.83 (m, 1H), 1.96-2.11 (m, 1H), 1.53-1.69 (m, 4H), 1.37-1.53 (m, 7H), 1.17-1.33 (m, 2H), 1.09 (d, 3H), 0.86 (d, 3H), 0.77 (i.e. , 3H), 0.55-0.73 (m, 2H).

Example 6

5- (3-amino-3-methylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

93 mg (0.23 mmol) of the compound from Example 13A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 37 mg (41% of theory) of product are obtained.
HPLC (Method 1): R _t = 4.00 min
MS (ES): m / z = 389.1 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 8.16 (s, 2H), 7.39 (s, 1H), 4.67-4.78 (m, 1H), 2.02-2.13 (m, 1H), 1.16-1.72 (m, 13H), 1.08 (d, 3H), 0.87 (d, 3H), 0.77 (d, 3H), 0.52-0.72 (m, 2H).

Example 7

5 - [(1-hydroxycyclopentyl) ethynyl] -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

87 mg (0.20 mmol) of the compound from Example 14A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 63 mg (74% of theory) of product are obtained.
HPLC (Method 1): R _t = 4.94 min
MS (ES-): m / z = 416.1 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 13.23 (br s, 1H), 7.43 (s, 1H), 5.44 (br s, 1H), 4.67-4.84 (m, 1H), 1.97-2.11 (m, 1H), 1.36-1.97 (m, 13H), 1.16-1.34 (m, 2H), 1.09 (d, 3H), 0.86 (d, 3H), 0.77 (d, 3H), 0.54-0.73 (m , 2H).

Example 8

5- [3- (dimethylamino) prop-1-in-1-yl] -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

18 mg (0.044 mmol) of the compound from Example 15A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 13 mg (75% of theory) of product are obtained.
MS (ES): m / z = 389.0 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 12.88 (br s, 1H), 7.48 (s, 1H), 4.67-4.83 (m, 1H), 3.52 (s, 2H), 2.24 (s, 6H), 1.99-2.12 (m, 1H), 1.53-1.69 (m, 4H), 1.37-1.53 (m, 1H), 1.17-1.33 (m, 2H), 1.09 (d, 3H), 0.87 (d, 3H), 0.77 (d, 3H), 0.55-0.73 (m, 2H).

Example 9

2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} -5- (3-methylhex-1-yn-1-yl) thiophene-3-carboxylic acid

9.0 mg (0.022 mmol) of the compound from Example 16A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 6 mg (69% of theory) of product are obtained.
HPLC (Method 1): R _t = 6.16 min
¹ H-NMR (400MHz, CDCl _3): δ = 7.46 (s, 1H), 4.86-5.04 (m, 1H), 2.61-2.76 (m, 1H), 2:03 to 2:19 (m, 1H), 1.11-1.75 (m, 17H), 0.86-1.10 (m, 6H), 0.61-0.84 (m, 5H).

Example 10

5- (3 - {[(2-chlorophenyl) sulfonyl] amino} -3-methylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3- carboxylic acid

72 mg (0.12 mmol) of the compound from Example 17A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). This gives 61 mg (87% of theory) of product.
HPLC (Method 3): R _t = 5.05 min
MS (ES): m / z = 562.9 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 13.22 (br s, 1H), 8.41 (s, 1H), 7.99-8.08 (m, 1H), 7.54-7.60 (m, 1H), 7.38- 7.52 (m, 2H), 7.12 (s, 1H), 4.65-4.83 (m, 1H), 1.90-2.04 (m, 1H), 1.16-1.70 (m, 13H), 1.08 (d, 3H), 0.84 ( d, 3H), 0.78 (d, 3H), 0.55-0.75 (m, 2H).

Example 11

5- (3,3-Dimethylpent-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

50 mg (0.12 mmol) of the compound from Example 18A are dissolved in 1.0 ml of dioxane and admixed with 1.0 ml of an aqueous 1N lithium hydroxide solution. The reaction mixture is stirred for 18 h at RT and then purified by preparative HPLC (RP-18 column, eluent: acetonitrile-water gradient 95: 5 → 5:95). 48 mg (99% of theory) of product are obtained.
HPLC (Method 3): R _t = 6.01 min
MS (ES): m / z = 402.0 (M-H) ^- .
¹ H-NMR (400MHz, DMSO-d ₆ ): δ = 7.17 (s, 1H), 4.56-4.70 (m, 1H), 2.13-2.30 (m, 1H), 1.78-1.91 (m, 1H), 1.10 -1.63 (m, 14H), 1.03 (d, 3H), 0.98 (t, 3H), 0.89 (d, 3H), 0.76 (d, 3H), 0.50-0.71 (m, 2H).

Example 12

5- (3,3-dimethylbut-1-yn-1-yl) -2 - [[(trans-4-methylcyclohexyl) carbonyl] (tetrahydro-2H-pyran-4-yl) amino] thiophene-3-carboxylic acid

52 mg (0.12 mmol) of the methyl ester from Example 19A are initially charged in 3 ml of dioxane and 0.3 ml of water, 4 mg (0.53 mmol) of lithium hydroxide are added and the mixture is stirred under reflux for 3.5 h. The mixture is then neutralized with 1N hydrochloric acid, the solvent removed in vacuo and the product purified by preparative HPLC (Method 2). Yield: 39 mg (78% of theory).
HPLC (Method 3): R _t = 5.57 min
MS (ESI-pos): m / z = 432 (M + H) ^+
1 H-NMR (400 MHz, CDCl _3): δ [ppm] = 7.44 (s, 1H), 4.82-4.73 (m, 1H), 4.02-3.87 (m, 2H), 3:54 to 3:39 (m, 2H) , 2.17-2.05 (m, 1H), 1.82-1.59 (m, 8H), 1.42-1.25 (m, 3H), 1.33 (s, 9H, 0.80 (d, 3H), 0.77-0.63 (m, 2H).

General working instructions [D]: saponification of thiophene-3-carboxylic acid esters

In a dioxane / water mixture (5: 1 v / v) is placed 1.0 equivalent of the ester (about 0.01-0.1 M solution), treated with 4-5 equivalents of lithium hydroxide and the mixture stirred under reflux. The turnover is monitored by means of HPLC. As soon as the ester has reacted, the mixture is acidified with 1N hydrochloric acid, the solvent mixture is removed in vacuo and the product is purified by preparative HPLC (method 2). If the product contains a basic nitrogen, it will become the hydrochloride after purification transferred. For this purpose, the purified product is taken up in a mixture of 1N hydrochloric acid and methanol and this mixture is removed in vacuo.

The following examples are produced according to the general procedure [D]:

Example 20

2 - [{[(1R, 2S, 4R) -2-hydroxy-4-methylcyclohexyl] carbonyl} (isopropyl) amino] -5- (3-methylbut-1-yn-1-yl) thiophene-3-carboxylic acid

38.0 mg (8.5 .mu.mol) of the compound from Example 34A are dissolved in 1.5 ml of a mixture of dioxane / water (2 / l), then 212 .mu.l (424.4 .mu.mol) 2N lithium hydroxide solution and the reaction is overnight at room temperature touched. The solvent is evaporated in vacuo, the residue is combined with ethyl acetate and 2N hydrochloric acid and the aqueous phase is extracted once more with ethyl acetate. After drying the combined organic phases over magnesium sulfate, the solvent is evaporated in vacuo. The resulting crude product is purified by preparative RP-HPLC with a water-acetonitrile gradient. There are obtained 28.6 mg (86% of theory) of product.
HPLC (Method 3): R _t = 4.85 min
MS (ESI +): m / z = 392 (M + H) ^+
1 H-NMR (300 MHz, DMSO-d ₆ , 1: 1 mixture of rotamers): δ = 13.25 (br. S, 1H), 7.43-7.35 (2s, 1H), 4.87-4.72 (m, 1.5H ), 4.24 (d, 0.5H), 4.00-3.94 (m, 0.5H), 3.87-3.80 (m, 0.5H), 2.94-2.78 (m, 1H), 2.10-2.30 (m, 1H), 1.95- 1.28 (m, 5H), 1.22 (d, 6H), 1.16-1.05 (2d, 3H), 0.91-0.80 (2d, 3H), 0.78-0.52 (m, 5H, therein: 0.73 (d, 3H)).

Example 21

5- (cyclopropylethynyl) -2 - [{[(1R, 2S, 4R) -2-hydroxy-4-methylcyclohexyl] carbonyl} (isopropyl) amino) thiophene-3-carboxylic acid

The compound is obtained analogously to the procedure of Example 20 from 32.0 mg (7.2 μmol) of the compound from Example 35A and 179 μl (359 μmol) of 2M lithium hydroxide solution with 25.4 mg (91% of theory).
HPLC (Method 3): R _t = 4.38 min
MS (ESI +): m / z = 390 (M + H) ^+
1 H-NMR (300 MHz, DMSO-d ₆ , 1: 1 mixture of rotamers): δ = 13.25 (br s, 1H), 7.40 / 7.38 (2 s, ¹ H), 4.68-4.89 (m, 1.5H) , 4.25 (d, 0.5H), 4.00-3.92 (m, 0.5H), 3.87-3.78 (m, 0.5H), 2.312.08 (m, 1H), 1.96-1.26 (m, 6H), 1.20-0.47 (m, 12H).

Example 22

5- (4-hydroxy-3,3-dimethylbut-1-yn-1-yl) -2 - [{[(1R, 2S, 4R) -2-hydroxy-4-methylcyclohexyl] carbonyl} (isopropyl) amino] thiophene-3-carboxylic acid

80.0 mg (167 μmol) of the compound from Example 36A are stirred in a mixture of 3 ml of methanol and 418 μl (837 μmol) of 2N aqueous lithium hydroxide solution overnight at room temperature. The reaction mixture is partitioned between tert-butyl methyl ether and 2N hydrochloric acid, the combined organic phases are dried over sodium chloride, decanted and evaporated to dryness. The crude mixture is purified by preparative RP-HPLC with a water / acetonitrile gradient. 48 mg (68% of theory) of product are obtained.
HPLC (Method 3): R _t = 4.42 min
MS (ESI +): m / z = 422 (M + H) ^+
1 H-NMR (300 MHz, DMSO-d ₆ , mixture of rotamers): δ = 13.25 (brs, 1H), 7.38 / 7.35 (2s, 1H), 5.12-5.02 (m, 1H), 4.90-4.70 ( m, 1.5H), 4.22 (d, 0.5 H), 3.98 / 3.83 (2m, 1H), about 3.32 (s, 2H, in CDCl ₃ spectrum at 3.52), 2.26 / 2.18 (2 d, 1H), 1.95 -0.55 (m, 22H, where 1.20 (s, 6H), 1.11 (t, 3H), 0.85 (t, 3H), 0.72 (d, 3H)).

Example 23

5- (4-hydroxy-3,3-dimethylbut-1-yn-1-yl) -2- {isopropyl [(trans-4-methylcyclohexyl) carbonyl] amino} thiophene-3-carboxylic acid

45.0 mg (107 μmol) of the compound from Example 37A are stirred in a mixture of 1.35 ml of methanol and 161 μl (322 μmol) of 2N aqueous lithium hydroxide solution overnight at room temperature. The reaction mixture is partitioned between tert-butyl methyl ether and 2N hydrochloric acid, the combined organic phases are dried over sodium chloride, decanted and evaporated to dryness. The crude mixture is purified by preparative RP-HPLC with a water / acetonitrile gradient. There are obtained 32 mg (73% of theory) of product.
HPLC (Method 3): R _t = 4.75 min
MS (ESI): m / z = 404 (M-H) ^-
1 H-NMR (300 MHz, DMSO-d ₆ ): δ = 13.25 (brs, 1H), 7.38 (s, 1H), 5.11-5.02 (m, 1H), 4.82-4.68 (m, 1H), 2.10 -2.00 (m, 1H), 1.70-0.55 (m, 24H, 1.20 (s, 6H), 1.10 (d, 3H), 0.85 (d, 3H), 0.77 (d, 3H)).

General working instructions [E]: Alternative method of saponification of Sonogashira products

1 equivalent of the thiophenecarboxylic acid ester is stirred in a mixture of dioxane / water (2 / l) and 5 or 10 equivalents of 2M lithium hydroxide solution for 3 hours at room temperature or for 1 hour at 50 ° C. The solvent is completely evaporated, the residue with ethyl acetate and 2N hydrochloric acid ver and the aqueous phase is extracted again with ethyl acetate. After drying the combined organic phases over magnesium sulfate, the solvent is evaporated in vacuo and the product is obtained after purification via preparative RP-HPLC (water-acetonitrile gradient).

The following examples are produced according to the general procedure [E]:

B. Assessment of physiological effectiveness

Abbreviations:

• DMSO

  dimethyl sulfoxide

  DMEM

  Dulbecco's Modified Earle's Medium

  FKS

  Fetal calf serum

  G418

  geneticin

  EC ₅₀

  Effective concentration 50

  IC ₅₀

  Inhibitory concentration 50

  CC ₅₀

  Cytotoxic concentration 50

  Pen

  penicillin

  Strep

  streptomycin

  minute

  minutes

  NEAA

  Nonessential amino acids

  PBS

  Phosphate buffered saline (phosphate buffer)

  H

  hours

  sec

  seconds

  RT

  room temperature

Used products:

The In vitro activity of the compounds of the invention can be seen in the following Assays are shown:

1. Measurement of the substance activity in one cellular HCV RNA Replication Assay ("Replicon System")

Hepatitis C can not be replicated reproducibly with high titers in cell culture until now. Therefore, the substance activity is detected in the so-called replicon system. These are genome parts of HCV or entire genomes of HCV, which are transported to cell lines (here HuH-7 cells) of human origin. By inserting a selection marker, it is possible to obtain stable cell lines which under selection pressure multiply genomic or subgenomic RNA from HCV [Lohmann et al., Science 285, 110-113 (1999); Blight et al., Science 290, 1972-1974 (2000)]. The HuH5-2 cells used here harbor a selectable, luciferase-bearing, cell culture-adapted replicon as in EP 1 043 399 described. The cells are grown in Dulbecco's Modified Earle's Medium (DMEM) with 10% fetal calf serum (FCS), 1% Pen / Strep, 1% NEAA, 1% L-glutamine and 250 μg / ml Geneticin (G418) fourth. For carrying out the assays described below, the cells are first trypsinized and resuspended with the DMEM medium described above without G418. Depending on the test, the cells are sown in 24-well or 384-well plates. Depending on the reading or assay method used, transparent or white test plates coated for cell culture are used.

a) Preparation of the test substances:

The test compounds are prepared as a 50 mM stock solution in DMSO. For the determination of the EC ₅₀ values, the substances are then diluted serially in DMEM in two stages. The dilutions are transferred as duplets to the cell culture plates. This is followed by the addition of the trypsinized, resuspended in medium cells. The final concentrations of the test substances in the cell culture cavities is, for example, 300 μM to 0.0001 μM. Interferon alpha serves as a reference in concentrations from 60 IU / ml to 1 IU / ml. Antimycin-alpha serves as a cytotoxicity control in concentrations from 2 μM to 0.03 μM. Untreated cells are for reference. The plates are then incubated at 37 ° C under 5% CO ₂ for 4-5 days. This is followed by the different measurements or the quantification of the HCV replicon RNA.

b) Cytotoxicity test (visual):

For the rating cytotoxicity of the test substances on HUH5-2 cells, the above test becomes transparent Attached to cell culture plate. The qualitative evaluation is done visually Under the microscope.

c) Alamar Blue test (quantitative Cytotoxicity):

Alamar Blue is a water-soluble redox indicator, which is reduced depending on the metabolic activity of the cells to be examined. The Alamar Blue test is used as a quantitative cytotoxicity assay. For this purpose, the cells are seeded with the appropriate test substances (see above) in white 384-well cell culture plates and incubated at 37 ° C under 5% CO ₂ for 4 days. 4 to 6 hours before the actual measurement, add 5 μl Alamar Blue per well. Subsequently, the fluorescence is measured at an emission wavelength of 544 nm and at an extinction wavelength of 590 nm. If, following this test, the chemiluminescence measurement (see below) is carried out on the same plate, the dye solution is aspirated from the cells and then washed once with PBS. The PBS is also aspirated from the cells again.

d) Measurement of the amount of HCV RNA by determining the activity a reporter gene:

In the HCV replicon HuH5-2, a reporter gene is inserted, here the gene for the enzyme luciferase of Photinus pyralis. After addition of the luciferase reagent (20 mM Tris / HCl, 20 mM Tricine, 2.67 mM MgSO ₄ , 0.1 mM EDTA, 33.3 mM DTT, 0.27 mM Coenzyme A, 0.47 mM luciferin, 0.53 mM ATP, pH 7.8) to the cells the chemiluminescence measurement in a luminometer. Usually, the photons are measured in a period of 10 seconds to 60 seconds.

CC₅₀

= Substanzkonzentration in μM, bei der die Alamar Blue-Fluoreszenz im Vergleich zur unbehandelten Kontrolle um 50% abnimmt;

EC₅₀

= Substanzkonzentration, bei der die Luciferaseaktivität im Vergleich zur unbehandelten Replikonkontrolle um 50% abnimmt;

SI(Selektivitätsindex)

= CC₅₀/EC₅₀.

The following data can be determined from the test plates:

CC ₅₀

= Substance concentration in μM at which the Alamar Blue fluorescence decreases by 50% compared to the untreated control;

EC ₅₀

= Substance concentration at which luciferase activity decreases by 50% compared to untreated replicon control;

SI (selectivity index)

= CC ₅₀ / EC ₅₀ .

e) Measurement of the substance activity by means of direct measurement of HCV genome:

Cells which amplify subgenomic HCV RNA are propagated as described above in 96 well or 24 well cell culture plates in DMEM / 10% FCS without addition of geniticin. If the cells are in the logarithmic growth phase, the substance is mixed in a suitable dilution in the medium. The final concentrations are, for example, 100 μM and 30 μM and dilutions thereof. After 4 to 5 days of incubation, the medium is discarded. The cells are detached from the cell culture plate using trypsin and taken up in 100 μl of phosphate buffer (PBS). When the assay is carried out in 24 well cell culture plates, the cells are split, one part is assayed for their content of HCV RNA by quantitative PCR, the other part of the cells is assayed for luciferase activity (Bright Glow Kit, Fa. Promega, implementation according to the manufacturer). If the test is carried out in 96 well cell culture plates, samples are taken in parallel. As described above, one duplicate is assayed for luciferase activity, RNA is recovered from the other duplicate and assayed for HCV RNA content by quantitative PCR. Values obtained are evaluated by curve analysis (variable curve sigmoidal dose-response curves, GraphPad Prism version 3.02 for Windows, GraphPad Software Inc.) and the effective concentration at which 50% inhibition is achieved (EC ₅₀ ) is determined. For comparison, untreated cells are used. From the remaining cells to be examined, whole cell RNA is isolated according to the manufacturer's instructions using the Rneasy Mini Kit (Qiagen, order No. 74104). Elution is carried out in 30-50 μl of Rnase-free water. The RNA is stored at -80 ° C. Using TaqMan ^® assays (Fa. Applied Biosystems) determining the amount of HCV RNA contained. The primer and gene probes used bind to the conserved 5'-untranslated region of the viral genome (primer for coding DNA strand: aatgcctggagatttgggc; primer in the opposite direction: tttcgcgacccaacactactc; probe: 6-carboxyfluorescin-tgcccccgcgagactgcatagc-N, N, N ', N'- tetramethyl-6-carboxyrhodamine). To standardize the sample used, the expression of a cell-specific gene is determined (TagMan Ribosomal RNA Control Reagents, Applied Biosystems P / N 4308329). For the reaction, the kit Platinum ^® Quantitative RT-PCR Thermoscript ^TM one step system is of the company. Invitrogen (Cat. 12267-019) is used. The reaction takes place in a final volume of 25 μM with 1 μl sample volume. The reaction conditions are: incubation at 50 ° C for 30 min, then incubation at 95 ° C for 5 min. After this step, the actual amplification phase follows with 40 repeats of the following steps: 15 sec incubation at 95 ° C followed by 1 min incubation at 60 ° C. The measurement and evaluation took place in an Applied Biosystems Abi Prism 7700 Sequence Detection device. Using the obtained CT values from the reactions for the target gene (here: HCV) and the cellular reference gene (here: 18s RNA), the relative expression is calculated as described under: Abi Prism 7700 Sequence Detection System User Bulletin # 2: Relative Quantification of gene expression (P / N 4303859).

Table A (HCV RNA Replication Assay)

2. Activity determination of the RNA-dependent RNA polymerase (NS5B) of hepatitis C virus in the presence and absence of test substances

Starting from the plasmid pBacSB-Chis (Lohmann V, Koerner F, Herian U and Bartenschlager R, J. Virol 71 (1997) 8461-8428), which shows the complete DNA sequence of a recombinant NS5B gene from the hepatitis C virus genotype 1b, a DNA sequence is amplified by polymerase chain reaction (PCR) (Sambrock J and Russel DW, Cold Spring Harbor Press, New York (2001)), which encodes a NS5B protein truncated by 21 amino acids at the carboxyl terminus , By using the PCR primers 5B21AAUPI (5'-AATTGCTAGCATGTCCTACACATGGACAGGCGCCCTGA-3 ') and 5B21AAD1 (5'-TATACTCGAGGCGGGGTCGGGCACGAGACAGGCT-3'), the PCR product can be introduced into the T7 expression vector pET21b (Novagen) via the recognition cleavage sites for the restriction endonucleases NheI and XhoI are cloned. The thus-constructed plasmid pET21NS5Bt expresses an NS5B protein carrying amino acids 2420 to 2989 of the HCV precursor polyprotein and a poly-histidine fusion at the carboxyl terminus. The expression and purification of such a recombinant NS5B variant in the heterologous host Escherichia coli BL21 (DE3) (Novagen) has already been described several times (Ferrari E, Wright-Minogue J, Fang JWS, Baroudy BM, Lau JYN and Hong Z, J. Virol Tomei L, Vitale RL, Incitti I, Serafini S, Altamura S, Vitelli A and DeFrancesco R, J. Gen. Virol 81 (2000) 759-767). BL21 (DE3) cells transformed with the plasmid pET21NS5Bt are shaken to an optical density OD (600 nm) = 0.6 at 37 ° C in LB medium (plus 100 μg / ml ampicillin) and then at 0, 5 mM IPTG (isopropyl-beta-D-thiogalactopyranoside) induced. To prevent cell inclusion bodies, expression is carried out at 20 ° C to 25 ° C for 4 hours. The cell pellets recovered by centrifugation (20 min, 5000 x g, 4 ° C) are assayed for OD (600 nm) = 50 to 500 in cell disruption buffer (50 mM NaH ₂ PO ₄ ; 5 mM Tris-HCl (Tris - (hydroxymethyl) -aminomethane) pH 8.0; 25 mM imidazole; 10 mM MgCl ₂ ; 500 mM NaCl; 0.1% (v / v) β-mer capto-ethanol; 1 mM EDTA (ethylenediamine-N, N, N ', N'-tetraacetate); 10% (v / v) glycerol; 1 tablet / 50 ml Complete (Roche); 10 μg / ml DNase I) and then disrupted with ultrasound (10 × 30 s, 200 W, 0 ° C.). The soluble protein fraction, which is separated from the insoluble protein fraction by centrifugation (20 min; 10000 x g; 4 ° C), is sterile filtered (<0.45 μm) and loaded onto a Ni-NTA column (nickel nitrilotriacetic acid, Qiagen ) applied. After sample loading, a 10 column volume cell disruption buffer wash followed by 20 column volumes of wash buffer (50 mM NaH ₂ PO ₄ ; 5 mM Tris-HCl pH 8.0; 25 mM imidazole; 10 mM MgCl ₂ ; 500 mM NaCl; 0.1 % (v / v) β-mercaptoethanol; 1mM EDTA; 10% (v / v) glycerol). The protein elution is carried out with an imidazole step gradient (wash buffer supplemented with 50 mM, 100 mM, 250 mM and 500 mM imidazole) with 5 column volumes per imidazole step. During elution, fractions of 1 to 2 ml volume are collected and analyzed in SDS-PAGE. The NS5B-containing fractions are pooled and purified using a PD10 column (Amersham) according to the manufacturer in storage buffer (25 mM Tris-HCl pH 7.5, 0.3 M NaCl, 10 mM MgCl ₂ , 5 mM DTT (dithiothreitol 1mM EDTA, 0.1% n-dodecyl maltoside, 30% glycerol) and stored at -80 ° C. The mock control procedure is analogous to a protein extract obtained from Escherichia coli BL21 (DE3) cells transformed with the empty vector pET21b.

To detect NS5B activity, an RNA polymerase catalyzed primer elongation reaction is performed as previously described (Ferrari et al., 1999; Tomei et al., 2000). Here, a single-stranded, homopolymeric RNA template (poly (rA) (Amersham)) with the aid of RNA primers (oligo (rU) ₁₂ (Eurogentec)) and the substrate UTP is converted to a double-stranded RNA duplex. When using radioactively labeled UTP eg [ ³² P] -UTP, the incorporation of the substrate can be quantified. In contrast to the majority of published assay formats, tritiated UTP ([ ³ H] -UTP ([5,6 ³ H] -uridine-5'-triphosphate), Perkin Elmer) is used instead of [ ³² P] -UTP, such as it has already been described by Uchiyama et al. (Uchiyama Y, Huang Y, Kanamori H, Uchida M, Doi T, Takamizawa A, Hamakubo T and Kodama T, Hepatol. Res. 23 (2002) 90-97). A reaction mixture contains 6 μg / ml poly (rA), 90 nM oligo (rU) ₁₂ , 5 μM UTP and 16 μCi / ml [ ³ H] -UTP and in 90 μl reaction buffer (20 mM Tris-HCl pH 7.5; 25 mM KCl; 5 mM MgCl ₂ ; 1 mM EDTA; 1 mM DTT; 0.01% (w / v) BSA; 0.5 (v / v) DMSO; 100 U / ml RNasin (Promega)). If the effect of substances on the polymerase activity is to be tested, the substance to be tested in the desired concentration is added to the reaction mixture before the addition of template, primer and substrate. The reaction is started by the addition of 12.5 nM NS5B protein and incubated at 30 ° C. After an incubation period of 120 min, the reaction is stopped with 1 volume of ice-cold stop buffer 1 (0.2 M EDTA; 100 μg / ml calf thymus DNA) and dissolved in 4 volumes of stop solution 2 (10% (w / v) tri-chloro-acetic acid; 0.5% (w / v) sodium pyrophosphate is precipitated on ice for 30 min The precipitate is transferred to GF / C filters in 96 well microtiter plate format (Millipore) and washed 3 times with wash solution 1 (1% w / w). v) Tri-chloroacetic acid, 0.1% (w / v) sodium pyrophosphate) and twice with 95% (v / v) ethanol The dried filters are washed with scintillation liquid (Ultima Gold XR Liquid Scintillation Cocktails, Packard Instruments ), incubated for a further 30 minutes and then read using a Microbeta Counter (1450 Microbeta Plus, Wallac) according to the manufacturer The built-in amount [ ³ H] -UTP or the measured CPM (counts per minute) are a measure of the Activity of the NS5B Polymerase To determine the IC ₅₀ values, the relative egg is determined in a dose-response curve Construction of [ ³ H] -UTP against the concentration of the test substance used applied. The IC ₅₀ values are determined using the GraphPad Prism 3.02 analysis software (GraphPad Software, INC) using the Sigmoid Variable-Dose-Response Curve function. The reference is the relative incorporation of [ ³ H] -UTP without the addition of a Test substance used.

C. Embodiments for pharmaceutical compositions

The Compounds of the invention can as follows be converted into pharmaceutical preparations:

Tablet:

Composition: 100 mg of the compound of Example 1, 50 mg lactose (monohydrate), 50 mg of corn starch (natively), 10 mg polyvinylpyrolidone (PVP 25) (BASF, Ludwigshafen, Germany) and 2 mg magnesium stearate.

tablet weight 212 mg. Diameter 8 mm, radius of curvature 12 mm.

Preparation: The mixture of active ingredient, lactose and starch is granulated with a 5% solution (m / m) of the PVP in water. The granules, after drying with the magnesium stearate for 5 min. mixed. This mixture is compressed with a conventional tablet press (for the tablet format see above). As a guideline for the compression, a pressing force of 15 kN is used.

Orally administrable suspension:

Composition: 1000 mg of the compound of Example 1, 1000 mg of ethanol (96%), 400 mg Rhodigel (xanthan gum from FMC, Pennsylvania, USA) and 99 g of water.

one Single dose of 100 mg of the compound of the invention correspond 10 ml oral suspension.

production: The rhodigel is suspended in ethanol, the active ingredient is the Added suspension. Under stir the addition of the water takes place. Until the completion of the swelling of the Rhodigels is stirred for about 6 h.

Orally administrable solution:

Composition: 500 mg of the compound according to the invention, 2.5 g polysorbate and 97 g polyethylene glycol 400. A single dose of 100 mg of the compound of the invention correspond to 20 g of oral solution.

production: The compound of the invention is in the mixture of polyethylene glycol and polysorbate under stir suspended. The stirring process will be up to the full resolution the compound of the invention continued.

iv solution:

The inventive compound becomes in a concentration below the saturation solubility in a physiological acceptable solvent (e.g., isotonic saline, glucose solution 5% and / or PEG 400 solution 30%) solved. The solution is sterile filtered and placed in sterile and pyrogen-free injection containers bottled.

Claims (13)

Compound of the formula

in which R ^{1 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl or phenyl, where alkyl, cycloalkyl, heterocyclyl , Heteroaryl and phenyl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -Alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₃ -C ₇ ) -cycloalkyl, phenyl, 5- to 7-membered heterocyclyl, 5- to 7-membered Heteroaryl, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, (C ₁ -C ₆ ) - Alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, (C ₁ -C ₆ ) -alkylsulfonylamino and (C ₆ -C ₁₀ ) -arylsulfonylamino, in which arylsulfonylamino in turn may be substituted by 1 to 3 substituents, where the substituents unab are selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, (C ₁ -C ₆ ) -alkyl and (C ₁ -C ₆ ) -alkoxy, R ² for (C ₁ -C ₆ ) alkyl, (C ₃ -C ₇ ) cycloalkyl, 5- to 7-membered heterocyclyl or benzyl, wherein alkyl, cycloalkyl, heterocyclyl and benzyl may be substituted with 1 to 3 substituents, wherein the substituents independently are selected from the group consisting of halogen, cyano, Hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -Alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -Alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, 5- to 7-membered heterocyclyl, optionally alkyl-substituted (C ₃ -C ₇ ) -cycloalkylaminocarbonyl, and optionally alkyl-substituted 5- to 7-membered heterocyclylcarbonyl, wherein alkyl may be substituted may be substituted with 1 to 2 substituents wherein the substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, (C ₁ -C ₆ ) alkylsulfoxyl and (C ₁ -C ₆ ) Alkoxycarbonyl, R ^{3 is} (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, (C ₆ -C ₁₀ ) -aryl, 5- to 7-membered heteroaryl, -CH ₂ -R ⁴ or -CH ₂ -CH ₂ -R ⁵ , wherein cycloalkyl, heterocyclyl, aryl and heteroary l may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) alkyl , (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₆ -C ₁₀ ) -aryloxycarbonyl , (C ₁ -C ₆ ) -alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, -OR ⁶ and -NR ⁷ R ⁸ , wherein alkyl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected the group consisting of halogen, hydroxy, amino, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -alkylthio, phenyl, (C ₁ -C ₆ ) alkylcarbonyl, (C ₁ -C ₆ ) alkylsulfonyl, (C ₁ -C ₆ ) alkoxycarbonyl, (C ₁ -C ₆ ) alkylaminocarbonyl and (C ₁ -C ₆ ) alkylcarbonylamino, in which phenyl in turn may be substituted with 1 to 3 subs substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) Alkoxy, C ₁ -C ₆ alkylamino, C ₁ -C ₆ alkylthio, C ₁ -C ₆ alkylcarbonyl, C ₁ -C ₆ alkylsulfonyl, C ₁ -C ₆ Alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino, where R ⁶ and R ⁷ independently of one another represent (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) - Cycloalkyl, 5- to 7-membered heterocyclyl, benzyl, (C ₆ -C ₁₀ ) -aryl or 5- or 6-membered heteroaryl, wherein alkyl, cycloalkyl, heterocyclyl, benzyl, aryl and heteroaryl may be substituted with 1 to 3 Substituents wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) alkoxy , (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkoxycarbonyl , (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino, R ^{8 is} hydrogen, (C ₁ -C ₆ ) -alkyl or (C ₃ -C ₇ ) -cycloalkyl, or R ⁷ and R ⁸ with the nitrogen atom to which they are attached form a 5- to 7-membered heterocycle, R ⁴ and R ⁵ independently of one another represent (C ₃ -C ₇ ) -cycloalkyl, 5-7-membered heterocyclyl, (C ₆ C ₁₀ ) aryl or 5- to 7-membered heteroaryl, wherein cycloalkyl, heterocyclyl, aryl and heteroaryl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, Hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -Alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) alkoxycarbonyl, (C ₁ -C ₆ ) -alkylaminocarbonyl and (C ₁ -C ₆ ) -alkylcarbonylamino, or one of their salts, their solvates or the solvates of their salts. A compound according to claim 1, characterized in that R ^{1 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl, 5- to 7-membered heteroaryl or phenyl wherein alkyl, cycloalkyl, heterocyclyl, heteroaryl and phenyl may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl , (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₃ -C ₇ ) -cycloalkyl, phenyl, 5- to 7-membered heterocyclyl , 5- to 7-membered heteroaryl, (C ₁ -C ₆ ) -alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, ( C ₁ -C ₆ ) alkoxycarbonyl, (C ₁ -C ₆ ) alkylaminocarbonyl, (C ₁ -C ₆ ) alkylcarbonylamino, (C ₁ -C ₆ ) alkylsulfonylamino and (C ₆ -C ₁₀ ) arylsulfonylamino wherein Arylsulfonylamino in turn may be substituted with 1 to 3 substituents, wherein the substituents are independently selected from the group consisting of halogen, cyano, hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, (C ₁ -C ₆ ) -alkyl and (C ₁ -C ₆ ) -alkoxy, R ^{2 is} (C ₁ -C ₆ ) -alkyl, (C ₃ -C ₇ ) -cycloalkyl, 5- to 7-membered heterocyclyl or benzyl, wherein alkyl, cycloalkyl, heterocyclyl and benzyl may be substituted with 1 to 3 substituents wherein the substituents are independently selected from the group consisting of halogen, cyano, Hydroxy, amino, nitro, trifluoromethyl, trifluoromethoxy, hydroxycarbonyl, aminocarbonyl, (C ₁ -C ₆ ) -alkyl, (C ₁ -C ₆ ) -alkoxy, (C ₁ -C ₆ ) -alkylamino, (C ₁ -C ₆ ) -Alkylthio, (C ₁ -C ₆ ) -alkylcarbonyl, (C ₁ -C ₆ ) -alkylsulfonyl, (C ₁ -C ₆ ) -alkylsulfoxyl, (C ₁ -C ₆ ) -alkoxycarbonyl, (C ₁ -C ₆ ) -Alkylaminocarbonyl, (C ₁ -C ₆ ) -alkylcarbonylamino, 5- to 7-membered heterocyclyl, optionally alkyl-substituted (C ₃ -C ₇ ) -cycloalkylaminocarbonyl, and optionally alkyl-substituted 5- to 7-membered heterocyclylcarbonyl, wherein alkyl may be substituted may be substituted with 1 to 2 substituents wherein the substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, (C ₁ -C ₆ ) alkylsulfoxyl and (C ₁ -C ₆ ) Alkoxycarbonyl, R ^{3 is} cyclohexyl, wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and (C ₁ -C ₃ ) alkyl. A compound according to claim 1 or 2, characterized in that R ^{1 is} (C ₁ -C ₆ ) -alkyl or (C ₃ -C ₆ ) -cycloalkyl, wherein alkyl and cycloalkyl may be substituted by 1 to 2 substituents, wherein the Substituents are independently selected from the group consisting of hydroxy, amino, (C ₁ -C ₆ ) alkylamino, 5- to 7-membered heterocyclyl and phenylsulfonylamino, wherein phenylsulfonylamino in turn may be substituted with 1 to 3 substituents, wherein the substituents independently of one another are selected from the group consisting of fluorine, chlorine, hydroxyl, amino, trifluoromethyl, trifluoromethoxy, methyl and methoxy, R ^{2 is} branched (C ₃ -C ₅ ) -alkyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydrofuranyl, pyrrolidinyl, Tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro-2H-thiopyranyl or 1,1-dioxotetrahydro-2H-thiopyranyl, wherein alkyl may be substituted with 1 to 2 substituents wherein the substituents are independently selected from the group consisting of amino, methoxy, (C ₁ -C ₆ ) -alkylamino, methylthio, methylsulfonyl, methylsulfoxyl or methoxycarbonyl, R ^{3 is} cyclohexyl, where cyclohexyl may be substituted by 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of hydroxy and (C ₁ -C ₃ ) alkyl. A compound according to any one of claims 1 to 3, characterized in that R ^{1 is} isopropyl, tert-butyl, cyclopropyl, cyclopentyl or cyclohexyl, wherein isopropyl, tert-butyl, cyclopropyl, cyclopentyl and cyclohexyl may be substituted with a substituent, wherein the substituent is selected from the group consisting of hydroxy and amino, R ^{2 is} branched (C ₃ -C ₅ ) alkyl, cyclobutyl, cyclopentyl, cyclohexyl, tetrahydro-2H-pyranyl, piperidinyl, tetrahydro-2H-thiopyranyl, oxidotetrahydro 2H-thiopyranyl or 1,1-dioxotetrahydro-2H-thiopyranyl, wherein alkyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from the group consisting of methoxy, dimethylamino, methylthio, methylsulfonyl, methylsulfoxyl or Methoxycarbonyl, R ^{3 is} cyclohexyl, wherein cyclohexyl may be substituted with 1 to 2 substituents, wherein the substituents are independently selected from de r group consisting of hydroxy and methyl. Process for the preparation of a compound of formula (I) according to claim 1, characterized in that a compound of formula

in which R ¹ , R ² and R ^{3 have} the meaning given in claim 1, and R ^{9 is} alkyl, preferably methyl, ethyl or tert-butyl, is reacted with a base or an acid. A compound according to any one of claims 1 to 4 for the treatment and / or prophylaxis of diseases. Use of a compound according to any one of claims 1 to 4 for the manufacture of a medicament for the treatment and / or prophylaxis of diseases. Use of a compound according to any one of claims 1 to 4 for the manufacture of a medicament for the treatment and / or prophylaxis of virus infections. Use according to claim 8, characterized that the viral infection is an infection with the hepatitis C virus or another member of the group of Flaviviridae. Medicaments containing a compound as in one of the claims 1 to 4, in combination with another active ingredient. Medicament containing a compound after one the claims 1 to 4 in combination with an inert, non-toxic, pharmaceutical suitable excipient. Medicament according to claim 11 for the treatment and / or Prophylaxis of viral infections. Method of combating viral infections in humans and animals by administration of an antiviral effective Amount of at least one compound according to any one of claims 1 to 4, a medicament according to claim 10 or 11 or one according to one of the claims 7 or 9 received drug.