DE10158283A1 - Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA - Google Patents

Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA

Info

Publication number
DE10158283A1
DE10158283A1 DE10158283A DE10158283A DE10158283A1 DE 10158283 A1 DE10158283 A1 DE 10158283A1 DE 10158283 A DE10158283 A DE 10158283A DE 10158283 A DE10158283 A DE 10158283A DE 10158283 A1 DE10158283 A1 DE 10158283A1
Authority
DE
Germany
Prior art keywords
dna
methylation
amplification
examined
dinucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
DE10158283A
Other languages
German (de)
Inventor
Kurt Berlin
Alexander Olek
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Epigenomics AG
Original Assignee
Epigenomics AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DE10112515A priority Critical patent/DE10112515B4/en
Application filed by Epigenomics AG filed Critical Epigenomics AG
Priority to DE10158283A priority patent/DE10158283A1/en
Priority to CA2435917A priority patent/CA2435917C/en
Priority to NZ527350A priority patent/NZ527350A/en
Priority to PCT/EP2002/002572 priority patent/WO2002072880A2/en
Priority to DE50210199T priority patent/DE50210199D1/en
Priority to JP2002571930A priority patent/JP4484431B2/en
Priority to NZ538608A priority patent/NZ538608A/en
Priority to DK02722194T priority patent/DK1370691T3/en
Priority to IL15708002A priority patent/IL157080A0/en
Priority to EP06077160A priority patent/EP1818414A3/en
Priority to AU2002253108A priority patent/AU2002253108B2/en
Priority to AT02722194T priority patent/ATE362995T1/en
Priority to KR1020037011825A priority patent/KR100839984B1/en
Priority to CNB028055071A priority patent/CN100347314C/en
Priority to RU2003126575/13A priority patent/RU2332462C2/en
Priority to EP02722194A priority patent/EP1370691B1/en
Priority to ES02722194T priority patent/ES2287269T3/en
Priority to PT02722194T priority patent/PT1370691E/en
Priority to US10/229,370 priority patent/US7229759B2/en
Publication of DE10158283A1 publication Critical patent/DE10158283A1/en
Priority to IS6887A priority patent/IS6887A/en
Priority to HK05102135A priority patent/HK1069604A1/en
Priority to US12/287,668 priority patent/US20120107807A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Detecting cytosine methylation in DNA samples by: (i) chemically treating a genomic sample to convert all non-methylated cytosines to uracil while leaving methylated cytosines unchanged; (ii) amplification with 2 primer oligonucleotides and a polymerase; and (iii) analysis of the amplicon and deducing the methylation status of test DNA. Detecting cytosine methylation in DNA samples by: (i) chemically treating a genomic sample to convert all non-methylated cytosines to uracil while leaving methylated cytosines unchanged; (ii) amplification with 2 primer oligonucleotides and a polymerase; and (iii) analysis of the amplicon and deducing the methylation status of test DNA from the presence of an amplicon and/or analysis of additional positions. The sample contains both test DNA and background DNA and step (ii) is designed for preferential amplification of test DNA. An Independent claim is also included for a kit containing a bisulfite reagent, primers, additional oligonucleotides that lack a 3'-hydroxy for preparation of an amplicon, and optionally instructions for performing an assay.

Description

Die vorliegende Erfindung betrifft ein Verfahren zum Nachweis von Cytosin-Methylierung in DNA-Proben. The present invention relates to a method for Detection of cytosine methylation in DNA samples.

Die nach den methodischen Entwicklungen der letzten Jahre in der Molekularbiologie gut studierten Beobachtungsebenen sind die Gene selbst, die Übersetzung dieser Gene in RNA und die daraus entstehenden Proteine. Wann im Laufe der Entwicklung eines Individuums welches Gen angeschaltet wird und wie Aktivieren und Inhibieren bestimmter Gene in bestimmten Zellen und Geweben gesteuert wird, ist mit Ausmaß und Charakter der Methylierung der Gene bzw. des Genoms korrelierbar. Insofern äußern sich pathogene Zustände in einem veränderten Methylierungsmuster einzelner Gene oder des Genoms. According to the methodological developments of the past few years studied well in molecular biology Levels of observation are the genes themselves, the translation of these genes in RNA and the resulting proteins. When in the course of an individual's development which one Gene is turned on and how to activate and inhibit certain genes in certain cells and tissues is controlled with the extent and character of the Methylation of genes or genome correlated. In this respect, pathogenic conditions express themselves in one changed methylation patterns of individual genes or the Genome.

5-Methylcytosin ist die häufigste kovalent modifizierte Base in der DNA eukaryotischer Zellen. Sie spielt beispielsweise eine Rolle in der Regulation der Transkription, beim genetischen Imprinting und in der Tumorgenese. Die Identifizierung von 5-Methylcytosin als Bestandteil genetischer Information ist daher von erheblichem Interesse. 5-Methylcytosin-Positionen können jedoch nicht durch Sequenzierung identifiziert werden, da 5-Methylcytosin das gleiche Basenpaarungsverhalten aufweist wie Cytosin. Darüber hinaus geht bei einer PCR- Amplifikation die epigenetische Information, welche die 5-Methylcytosine tragen, vollständig verloren. 5-methylcytosine is the most common covalently modified Base in the DNA of eukaryotic cells. she plays for example a role in the regulation of Transcription, in genetic imprinting and in Tumorigenesis. The identification of 5-methylcytosine as Part of genetic information is therefore from considerable interest. 5-methylcytosine positions can but cannot be identified by sequencing because 5-methylcytosine has the same base pairing behavior has like cytosine. In addition, a PCR Amplification the epigenetic information which the Wear 5-methylcytosine, completely lost.

Eine relativ neu und die mittlerweile am häufigsten angewandte Methode zur Untersuchung von DNA auf 5-Methylcytosin beruht auf der spezifischen Reaktion von Bisulfit mit Cytosin, das nach anschließender alkalischer Hydrolyse in Uracil umgewandelt wird, welches in seinem Basenpaarungsverhalten dem Thymidin entspricht. 5- Methylcytosin wird dagegen unter diesen Bedingungen nicht modifiziert. Damit wird die ursprüngliche DNA so umgewandelt, dass Methylcytosin, welches ursprünglich durch sein Hybridisierungsverhalten vom Cytosin nicht unterschieden werden kann, jetzt durch "normale" molekularbiologische Techniken als einzig verbliebenes Cytosin beispielsweise durch Amplifikation und Hybridisierung oder Sequenzierung nachgewiesen werden kann. Alle diese Techniken beruhen auf Basenpaarung, welche jetzt voll ausgenutzt wird. Der Stand der Technik, was die Empfindlichkeit betrifft, wird durch ein Verfahren definiert, welches die zu untersuchende DNA in einer Agarose-Matrix einschließt, dadurch die Diffusion und Renaturierung der DNA (Bisulfit reagiert nur an einzelsträngiger DNA) verhindert und alle Fällung- und Reinigungsschritte durch schnelle Dialyse ersetzt (Olek A, Oswald J, Walter J. A modified and improved method for bisulphate based cytosine methylation analysis. Nucleic Acids Res. 1996 DEC 15; 24(24): 5064-6). Mit dieser Methode können einzelne Zellen untersucht werden, was das Potential der Methode veranschaulicht. Allerdings werden bisher nur einzelne Regionen bis etwa 3000 Basenpaare Länge untersucht, eine globale Untersuchung von Zellen auf Tausenden von möglichen Methylierungsanalysen ist nicht möglich. Allerdings kann auch dieses Verfahren keine sehr kleinen Fragmente aus geringen Probenmengen zuverlässig analysieren. Diese gehen trotz Diffusionsschutz durch die Matrix verloren. A relatively new and the most common now method used to study DNA 5-methylcytosine is based on the specific reaction of bisulfite with cytosine, which after subsequent alkaline Hydrolysis is converted into uracil, which in its Base pairing behavior corresponds to the thymidine. 5 In contrast, methylcytosine is not used under these conditions modified. This is how the original DNA becomes converted that methylcytosine, which originally due to its hybridization behavior from cytosine can be distinguished now by "normal" molecular biological techniques as the only remaining Cytosine for example by amplification and Hybridization or sequencing can be demonstrated can. All of these techniques are based on base pairing, which is now being fully exploited. The state of the art, as far as sensitivity is concerned, a Method defines which the DNA to be examined in an agarose matrix, thereby diffusion and renaturation of the DNA (bisulfite only reacts single-stranded DNA) prevented and all precipitation and Cleaning steps replaced by rapid dialysis (Olek A, Oswald J, Walter J. A modified and improved method for bisulfate based cytosine methylation analysis. Nucleic Acids Res. 1996 DEC 15; 24 (24): 5064-6). With this method individual cells can be examined, what that The potential of the method is illustrated. However so far only single regions up to about 3000 base pairs Length examined, a global study of cells on thousands of possible methylation analyzes not possible. However, this procedure can also no very small fragments from small amounts of sample analyze reliably. These go despite Diffusion protection lost through the matrix.

Eine Übersicht über die weiteren bekannten Möglichkeiten, 5-Methylcytosine nachzuweisen, kann aus dem folgenden Übersichtsartikel entnommen werden: Rein T, DePamphilis ML, Zorbas H. Identifying 5-methylcytosine and related modifications in DNA genomes. Nucleic Acids Res. 1998 May 15; 26(10): 2255-64. An overview of the other known options Detect 5-methylcytosine from the following Review articles can be found: Rein T, DePamphilis ML, Zorbas H. Identifying 5-methylcytosine and related modifications in DNA genomes. Nucleic Acids Res. 1998 May 15; 26 (10): 2255-64.

Die Bisulfit-Technik wird bisher bis auf wenige Ausnahmen (z. B. Zeschnigk M, Lich C, Buiting K, Dörfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5(2): 94-8) nur in der Forschung angewendet. Immer aber werden kurze, spezifische Stücke eines bekannten Gens nach einer Bisulfit-Behandlung amplifiziert und entweder komplett sequenziert (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov.; 17(3): 275-6) oder einzelne Cytosin-Positionen durch eine "Primer- Extension-Reaktion" (Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15; 25(12): 2529-31, WO-Patent 9500669) oder einen Enzymschnitt (Xiong Z, Laird PW. COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun. 15; 25(12): 2532-4) nachgewiesen. Zudem ist auch der Nachweis durch Hybridisierung beschrieben worden (Olek et al., WO 99 28498). The bisulfite technique has so far been used with a few exceptions (e.g. Zeschnigk M, Lich C, Buiting K, Dörfler W, Horsthemke B. A single-tube PCR test for the diagnosis of Angelman and Prader-Willi syndrome based on allelic methylation differences at the SNRPN locus. Eur J Hum Genet. 1997 Mar-Apr; 5 (2): 94-8) only in research applied. But always short, specific pieces of a known gene after bisulfite treatment amplified and either completely sequenced (Olek A, Walter J. The pre-implantation ontogeny of the H19 methylation imprint. Nat Genet. 1997 Nov .; 17 (3): 275-6) or individual cytosine positions by a "primer Extension Response "(Gonzalgo ML, Jones PA. Rapid quantitation of methylation differences at specific sites using methylation-sensitive single nucleotide primer extension (Ms-SNuPE). Nucleic Acids Res. 1997 Jun. 15; 25 (12): 2529-31, WO patent 9500669) or one Enzyme cut (Xiong Z, Laird PW.COBRA: a sensitive and quantitative DNA methylation assay. Nucleic Acids Res. 1997 Jun. 15; 25 (12): 2532-4). It is also detection by hybridization has been described (Olek et al., WO 99 28498).

Harnstoff verbessert die Effizienz der Bisulfit- Behandlung vor der Sequenzierung von 5-Methylcytosin in genomischer DNA (Paulin R, Grigg GW, Davey MW, Piper AA. Urea improves efficiency of bisulphate-mediated sequencing of 5'-methylcytosine in genomic DNA. Nucleic Acids Res. 1998 Nov. 1; 26(21): 5009-10). Urea improves the efficiency of bisulfite Treatment before sequencing 5-methylcytosine in genomic DNA (Paulin R, Grigg GW, Davey MW, Piper AA. Urea improves efficiency of bisulphate-mediated sequencing of 5'-methylcytosine in genomic DNA. Nucleic Acids Res. 1998 Nov. 1; 26 (21): 5009-10).

Weitere Publikationen, die sich mit der Anwendung der Bisulfit-Technik zum Methylierungsnachweis bei einzelnen Genen befassen, sind:
Grigg G, Clark S. sequencing 5-methylcytosine residues in genomic DNA. Bioassays. 1994 Jun.; 16(6): 431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Dörfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader- Willi/Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar; 6(3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol fort bisulphate genomic sequencing. Nucleic Acids Res. 1994 Feb. 25; 22(4): 695-6; Martin V, Ribieras S. Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5' region of the pS2 gene andin its expression in human breast cancer cell lines. Gene. 1995 May 19; 157(1-2): 261-4; WO 97 46705, WO 95 15373 und WO 45560. Other publications dealing with the use of the bisulfite technique for methylation detection in individual genes are:
Grigg G, Clark S. sequencing 5-methylcytosine residues in genomic DNA. Bioassays. 1994 Jun .; 16 (6): 431-6, 431; Zeschnigk M, Schmitz B, Dittrich B, Buiting K, Horsthemke B, Dörfler W. Imprinted segments in the human genome: different DNA methylation patterns in the Prader- Willi / Angelman syndrome region as determined by the genomic sequencing method. Hum Mol Genet. 1997 Mar; 6 (3): 387-95; Feil R, Charlton J, Bird AP, Walter J, Reik W. Methylation analysis on individual chromosomes: improved protocol fort bisulphate genomic sequencing. Nucleic Acids Res. 1994 Feb. 25; 22 (4): 695-6; Martin V, Ribieras S. Song-Wang X, Rio MC, Dante R. Genomic sequencing indicates a correlation between DNA hypomethylation in the 5 'region of the pS2 gene andin its expression in human breast cancer cell lines. Genes. 1995 May 19; 157 (1-2): 261-4; WO 97 46705, WO 95 15373 and WO 45560.

Ein weiteres bekanntes Verfahren ist die sogenannte methylierungssensitive PCR (Herman JG, Graff JR, Myohanen S. Nelkin BD, Baylin SB. (1996), Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. Sep 3; 93(18): 9821-6). Für dieses Verfahren werden Primer verwendet, die entweder nur an eine Sequenz hybridisieren, die durch die Bisulfit-Behandlung einer an der betreffenden Position unmethylierten DNA entsteht, oder aber umgekehrt Primer, welche nur an eine Nukleinsäure bindet, die durch die Bisulfit-Behandlung einer an der betreffenden Position unmethylierten DNA entsteht. Mit diesen Primer können demnach Amplifikate erzeugt werden, deren Detektion wiederum Hinweise auf das Vorliegen einer methylierten oder unmethylierten Position in der Probe liefern, an welche die Primer binden. Another known method is the so-called methylation-sensitive PCR (Herman JG, Graff JR, Myohanen S. Nelkin BD, Baylin SB. (1996), Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. Sep 3; 93 (18): 9821-6). Primers are used for this method, the either hybridize only to a sequence which is characterized by the Bisulfite treatment at the position in question unmethylated DNA, or vice versa primer, which only binds to a nucleic acid that is Bisulfite treatment at the position in question unmethylated DNA is formed. With this primer you can accordingly amplicons are generated, their detection again indications of the presence of a methylated or unmethylated position in the sample which bind the primers.

Ein neueres Verfahren ist auch der Nachweis von Cytosin- Methylierung mittels einer Taqman PCR, das als Methyl Light bekannt geworden ist (WO 00/70090). Mit diesem Verfahren ist es möglich, den Methylierungsstatus einzelner oder weniger Positionen direkt im Verlauf der PCR nachzuweisen, so dass sich eine nachfolgende Analyse der Produkte erübrigt. A newer method is also the detection of cytosine Methylation using a Taqman PCR, which as Methyl Light has become known (WO 00/70090). With this It is possible to determine the methylation status individual or fewer positions directly in the course of Detect PCR so that a subsequent analysis of the products.

Eine Übersicht über den Stand der Technik in der Oligomer Array Herstellung lässt sich aus einer im Januar 1999 erschienenen Sonderausgabe von Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), der dort zitierten Literatur und dem US-Patent 5994065 über Methoden zur Herstellung von festen Trägern für Zielmoleküle wie Oligonucleotide bei vermindertem nichtspezifischen Hintergrundsignal entnehmen. An overview of the state of the art in oligomer Array manufacture can be found in January 1999 published special edition of Nature Genetics (Nature Genetics Supplement, Volume 21, January 1999), there cited literature and U.S. Patent 5,940,065 Methods of making solid supports for Target molecules such as oligonucleotides with reduced Take non-specific background signal.

Für die Abtastung eines immobilisierten DNA-Arrays sind vielfach fluoresziert markierte Sonden verwendet worden. Besonders geeignet für Fluoreszenzmarkierungen ist das einfache Anbringen von Cy3 und Cy5 Farbstoffen am 5'-OH der jeweiligen Sonde. Die Detektion der Fluoreszenz der hybridisierten Sonden erfolgt beispielsweise über ein Konfokalmikroskop. Die Farbstoffe Cy3 und Cy5 sind, neben vielen anderen, kommerziell erhältlich. For scanning an immobilized DNA array are probes marked with fluorescence have been used. This is particularly suitable for fluorescent labels simple attachment of Cy3 and Cy5 dyes to the 5'-OH the respective probe. The detection of the fluorescence of the Hybridized probes are, for example, via a Confocal microscope. The dyes Cy3 and Cy5 are, besides many others, commercially available.

Matrix-assistierte Laser Desorptions/Ionisations- Massenspektrometrie (MALDI-TOF) ist eine sehr leistungsfähige Entwicklung für die Analyse von Biomolekülen (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct. 15; 60(20): 2299-301). Ein Analyt wird in eine lichtabsorbierende Matrix eingebettet. Durch einen kurzen Laserpuls wird die Matrix verdampft und das Analytmolekül so unfragmentiert in die Gasphase befördert. Durch Stöße mit Matrixmolekülen wird die Ionisation des Analyten erreicht. Eine angelegte Spannung beschleunigt die Ionen in ein feldfreies Flugrohr. Auf Grund ihrer verschiedenen Massen werden Ionen unterschiedlich stark beschleunigt. Kleinere Ionen erreichen den Detektor früher als größere. Matrix-assisted laser desorption / ionization Mass spectrometry (MALDI-TOF) is a very powerful development for the analysis of Biomolecules (Karas M, Hillenkamp F. Laser desorption ionization of proteins with molecular masses exceeding 10,000 daltons. Anal Chem. 1988 Oct. 15; 60 (20): 2299-301). An analyte is placed in a light absorbing matrix embedded. The matrix is formed by a short laser pulse evaporates and the analyte molecule is so unfragmented in the Gas phase promoted. By collisions with matrix molecules ionization of the analyte is achieved. An created Voltage accelerates the ions into a field-free Flight tube. Because of their different masses Ions accelerated to different extents. Smaller ions reach the detector earlier than larger ones.

MALDI-TOF Spektroskopie eignet sich ausgezeichnet zur Analyse von Peptiden und Proteinen. Die Analyse von Nukleinsäuren ist etwas schwieriger (Gut, I. G. und Beck, S. (1995), DNA and Matrix Assisted Laser Desorption Ionization Mass Spectrometry. Molecular Biology: Current Innovations and Future Trends 1: 147-157.) Für Nukleinsäuren ist die Empfindlichkeit etwa 100 mal schlechter als für Peptide und nimmt mit zunehmender Fragmentgröße überproportional ab. Für Nukleinsäuren, die ein vielfach negativ geladenes Rückgrat haben, ist der Ionisationsprozeß durch die Matrix wesentlich ineffizienter. In der MALDI-TOF Spektroskopie spielt die Wahl der Matrix eine eminent wichtige Rolle. Für die Desorption von Peptiden sind einige sehr leistungsfähige Matrices gefunden worden, die eine sehr feine Kristallisation ergeben. Für DNA gibt es zwar mittlerweile einige ansprechende Matrices, jedoch wurde dadurch der Empfindlichkeitsunterschied nicht verringert. Der Empfindlichkeitsunterschied kann verringert werden, indem die DNA chemisch so modifiziert wird, dass sie einem Peptid ähnlicher wird. MALDI-TOF spectroscopy is ideal for Analysis of peptides and proteins. The analysis of Nucleic acids are a bit more difficult (Gut, I.G. and Beck, S. (1995), DNA and Matrix Assisted Laser Desorption Ionization mass spectrometry. Molecular Biology: Current Innovations and Future Trends 1: 147-157.) For The nucleic acid sensitivity is about 100 times worse than for peptides and decreases with increasing Fragment size disproportionately. For nucleic acids that have a backbone that is often negatively charged Ionization process through the matrix essential inefficient. It plays in MALDI-TOF spectroscopy Choice of the matrix plays an eminently important role. For the Desorption of peptides are some very powerful ones Matrices have been found that are very fine Result in crystallization. For DNA there is meanwhile some attractive matrices, however this does not reduce the difference in sensitivity. The difference in sensitivity can be reduced by chemically modifying the DNA so that it becomes more like a peptide.

Phosphorothioatnukleinsäuren, bei denen die gewöhnlichen Phosphate des Rückgrats durch Thiophosphate substituiert sind, lassen sich durch einfache Alkylierungschemie in eine ladungsneutrale DNA umwandeln (Gut, I. G. und Beck, S. (1995), A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 23: 1367-1373). Die Kopplung eines "charge tags" an diese modifizierte DNA resultiert in der Steigerung der Empfindlichkeit um den gleichen Betrag, wie er für Peptide gefunden wird. Ein weiterer Vorteil von "charge tagging" ist die erhöhte Stabilität der Analyse gegen Verunreinigungen, die den Nachweis unmodifizierter Substrate stark erschweren. Phosphorothioate nucleic acids, in which the usual Phosphates of the backbone substituted by thiophosphates are simple alkylation chemistry convert a charge-neutral DNA (Gut, I.G. and Beck, S. (1995), A procedure for selective DNA alkylation and detection by mass spectrometry. Nucleic Acids Res. 23: 1367-1373). The coupling of a "charge tag" to this modified DNA results in an increase in Sensitivity by the same amount as for Peptides is found. Another advantage of "charge tagging "is the increased stability of the analysis against Impurities, the detection of unmodified Make substrates very difficult.

Genomische DNA wird durch Standardmethoden aus DNA von Zell-, Gewebe- oder sonstigen Versuchsproben gewonnen. Diese Standardmethodik findet sich in Referenzen wie Fritsch und Maniatis, Molecular Cloning: A Laboratory Manual, 1989. Genomic DNA is extracted from DNA by standard methods Cell, tissue or other test samples obtained. This standard methodology can be found in references such as Fritsch and Maniatis, Molecular Cloning: A Laboratory Manual, 1989.

Es sind demnach bislang vielerlei Verfahren zur Methylierungsanalyse Stand der Technik. Die vorliegende Erfindung soll jedoch das Problem lösen, dass die gängigen Verfahren nicht in der Lage sind, eine in einer Körperflüssigkeit oder Serum befindliche zu untersuchende DNA gezielt zu amplifizieren, wenn zugleich andere, sequenzhomologe DNA-Abschnitte anderen Ursprungs zugegen sind. So far, there are many different methods for State of the art methylation analysis. The present However, the invention is intended to solve the problem that current procedures are unable to do one in one Body fluid or serum to be examined To amplify DNA in a targeted manner, if at the same time other sequence homologous DNA segments of other origin are.

Die zu untersuchende DNA sowie die ansonsten vorhandenen, im folgenden Hintergrund-DNA genannten Nukleinsäuren, werden in aller Regel gleichermaßen amplifiziert, da die verwendeten Primer auch nicht in der Lage sind, zwischen zu untersuchender DNA und Hintergrund-DNA zu unterscheiden. Eine Möglichkeit zur Unterscheidung dieser DNAs ergibt sich jedoch durch das unterschiedliche Methylierungsmuster. Ein gängiges Verfahren ist die methylierungssensitive PCR, kurz MSP (Herman JG, Graff JR, Myohanen S. Nelkin BD, Baylin SB. (1996), Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. Sep 3; 93(18): 9821-6). Dieses Verfahren besteht aus mehreren Teilschritten. Zunächst wird eine dem Stand der Technik entsprechende Bisulfit-Behandlung durchgeführt, welche wiederum dazu führt, dass alle Cytosinbasen in Uracil umgewandelt werden, während die methylierten Cytosinbasen (5-Methylcytosin) unverändert bleiben. Im nächsten Schritt verwendet man nun Primer, welche vollständig komplementär zu einer methylierten, mit Bisulfit umgewandelten DNA sind, nicht jedoch zu einer entsprechenden DNA welche ursprünglich nicht methyliert vorlag. Das führt bei der Durchführung einer PCR mit einem solchen Primer dazu, dass ausschließlich die ursprünglich methylierte DNA amplifiziert wird. Entsprechend ist es möglich, einen Primer zu verwenden, der im Gegenzug nur die unmethylierte DNA amplifiziert. Auf diese Art und Weise können, wenn zu analysierende DNA sowie Hintergrund DNA zugegen sind, ausschließlich die zu untersuchenden DNA Fragmente selektiv erzeugt werden, sofern sich diese hinsichtlich ihres Methylierungsstatus in einer CpG Position von der Hintergrund DNA unterscheiden. Stand der Technik ist es nun, aus dem Nachweis eines solchen zu untersuchenden DNA-Moleküls auf den Methylierungszustand oder das Vorliegen einer zu untersuchenden DNA rückzuschließen, was wiederum eine Diagnose beispielsweise einer Tumorerkrankung in Patienten prinzipiell erlaubt, da es bekannt ist, das beispielsweise die Serum DNA-Konzentration sich in Tumorpatienten zum Teil drastisch erhöht. Nur die von den Tumoren stammende DNA soll dann neben der Hintergrund-DNA nachgewiesen werden. Prinzipiell vergleichbar ist die Analyse von DNA in anderen Körperflüssigkeiten. The DNA to be examined as well as the other available in the following background DNA called nucleic acids, are usually amplified equally since the primers used are also unable to between DNA to be examined and background DNA differ. One way to differentiate this However, DNAs result from the different Methylation patterns. A common procedure is methylation-sensitive PCR, MSP for short (Herman JG, Graff JR, Myohanen S. Nelkin BD, Baylin SB. (1996), Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. Sep 3; 93 (18): 9821-6). This procedure consists of several steps. First, the state of the art Bisulfite treatment appropriate to the technology carried out, which in turn leads to all cytosine bases in Uracil can be converted while the methylated Cytosine bases (5-methylcytosine) remain unchanged. in the The next step is to use primers, which ones completely complementary to a methylated, with Bisulfite are converted DNA, but not to one corresponding DNA which is not originally methylated Template. This leads to the implementation of a PCR such a primer that only the originally methylated DNA is amplified. Accordingly, it is possible to use a primer which in turn only amplifies the unmethylated DNA. In this way, when analyzing DNA as well as background DNA are present, only those to selectively generating DNA fragments are generated, provided that these differ in terms of their methylation status in a CpG position from the background DNA differ. It is now state of the art from Detection of such a DNA molecule to be examined the methylation state or the presence of one investigate DNA, which in turn is a Diagnosis of, for example, a tumor in Patients allowed in principle, as it is known that for example the serum DNA concentration is in Tumor patients increased drastically in some cases. Only those of them DNA originating from tumors should then appear next to the background DNA be detected. In principle it is comparable Analysis of DNA in other body fluids.

Das hier geschilderte Verfahren, was als der nächstliegende Stand der Technik zu betrachten ist, hat jedoch einige Nachteile. Es ist beispielsweise nicht möglich, aus der Nachweisbarkeit eines amplifizierten Fragmentes zu untersuchender DNA auf die im Serum vorhandene Menge zu schließen. Schon geringste Mengen solcher DNA reichen aus, um ein positives Resultat zu erzielen, was zum einen ein Vorteil ist, sich aber auch sehr nachteilig auswirken kann, wenn man zum Beispiel den Effekt einer Tumorresektion auf die Serum DNA beurteilen will. Der größte Nachteil ist jedoch, dass es viele Methylierungspositionen gibt, in welchen sich zu untersuchende DNA und Hintergrund-DNA nur graduell unterscheiden. Es ist offensichtlich, dass das existierenden MSP Verfahren nur dann durchgeführt werden kann, wenn man weiß, dass sich die Hintergund-DNA von der zu untersuchenden DNA in der betreffenden CpG Position definitiv und zu 100% unterscheidet, will man nicht falsche positive Ergebnisse riskieren. Ist es dagegen in einem Tumorgewebe typisch, dass in z. B. 95% der Tumorzellen eine bestimmte Position methyliert vorliegt, in der ansonsten vorhandenen Hintergrund-DNA jedoch nur maximal 5% methyliert vorliegen, so ist es mit der MSP Methode nicht möglich, aussagekräftige Ergebnisse zu produzieren, da eine Quantifizierung der Templat-DNA mittels PCR prinzipiell nicht oder nur mit erhöhtem Aufwand möglich ist. Zudem liegt dieser Erfindung die Erkenntnis zugrunde, dass es oft Muster von Methylierungszuständen in einem DNA-Fragment sind, die typisch für einen bestimmten Typ von Zellen, zum Beispiel einer Tumorzelle, sind. The procedure described here, what as the closest state of the art has to be considered however some disadvantages. For example, it is not possible from the detectability of an amplified DNA fragment to be examined on the in the serum close existing quantity. Even the smallest amounts such DNA is enough to give a positive result achieve what is an advantage, but also itself can be very disadvantageous if, for example, the Assess the effect of tumor resection on serum DNA want. The main disadvantage, however, is that there are many There are methylation positions in which to investigating DNA and background DNA only gradually differ. It is obvious that that existing MSP procedures can only be carried out can, if you know that the background DNA is different from the DNA to be examined in the relevant CpG position definitely and 100% different, you don't want to risk false positive results. But it is in a tumor tissue typical that in z. B. 95% of Tumor cells are methylated in a certain position, in the otherwise existing background DNA, however, only A maximum of 5% is methylated, so it is with the MSP Method not possible to get meaningful results produce as a quantification of the template DNA in principle not by PCR or only with increased Effort is possible. In addition, this invention is the Understanding that there are often patterns of Methylation states in a DNA fragment are those typical of a certain type of cells, for example a tumor cell.

Stand der Technik ist wiederum ein von Epigenomics entwickeltes Verfahren, welches zu untersuchende DNA und Hintergrund-DNA nach Bisulfit-Behandlung gleichermaßen amplifiziert und dann die im Fragment enthaltenen ehemaligen CpG Positionen durch Hybridisierungstechniken untersucht, alternativ mittels Mini Sequenzierung oder anderen gängigen Verfahren. Dies hat den Vorteil, dass man ein quantitatives Bild bezüglich der untersuchten Methylierungspositionen erhält, d. h. es erfolgt die Bestimmung des Methylierungsgrades einer Vielzahl von Positionen, was z. B. bei soliden Tumoren eine sehr genau Klassifizierung ermöglicht. Der Nachteil dieser Methode ist jedoch, dass sie in den Fällen, in denen die Hintergrund-DNA stark überwiegt, keine genau Aussage liefern kann, da diese ja genau wie die zu untersuchende DNA amplifiziert wird und beide im Gemisch analysiert werden. Dieses Problem existiert nicht bei der Analyse von soliden Tumoren, wo man das zu untersuchende Material gezielt auswählen kann, es kann jedoch die Analyse von beispielsweise Serum-DNA erschweren. The state of the art is again one of Epigenomics developed method, which DNA and Background DNA after bisulfite treatment alike amplified and then those contained in the fragment former CpG positions through hybridization techniques investigated, alternatively using mini sequencing or other common procedures. This has the advantage that a quantitative picture regarding the examined Receives methylation positions, d. H. it takes place Determination of the degree of methylation of a large number of Positions what z. B. with solid tumors a very accurate Classification enables. The disadvantage of this method is, however, that in cases where the Background DNA predominates, no precise statement can deliver, since this is exactly like the one to be examined DNA is amplified and both analyzed in a mixture become. This problem does not exist in the analysis of solid tumors, where you have the material to be examined can select specifically, but it can analyze for example, complicate serum DNA.

Ziel der vorliegenden Erfindung ist es nun, die Nachteile des Standes der Technik zu überwinden und die Vorteile beider Verfahren für die Detektion von Körperflüssigkeiten und Serum zu kombinieren. The aim of the present invention is now to address the disadvantages state of the art and overcome the benefits both methods for the detection of Combine body fluids and serum.

Die Aufgabe wird dadurch gelöst, dass ein Verfahren zum Nachweis von Cytosin-Methylierung in DNA-Proben geschaffen wird bei dem dass man die folgenden Schritte ausführt:
man behandelt eine genomische DNA-Probe, welche zu untersuchende DNA und Hintergrund-DNA DNA umfasst, chemisch derart, dass alle nicht methylierten Cytosinbasen in Uracil umgewandelt werden, während die 5- Methylcytosinbasen unverändert bleiben,
man amplifiziert die chemisch behandelte DNA-Probe unter Verwendung von mindestens 2 Primeroligonukleotiden sowie einer Polymerase, wobei die zu untersuchende DNA gegenüber der Hintergrund-DNA als Templat bevorzugt wird und
man analysiert die Amplifikate und schließt aus dem Vorliegen eines Amplifikates und/oder aus der Analyse weiterer Positionen auf den Methylierungsstatus in der zu untersuchenden DNA. The object is achieved in that a method for the detection of cytosine methylation in DNA samples is created by carrying out the following steps:
a genomic DNA sample, which comprises the DNA to be examined and background DNA DNA, is chemically treated in such a way that all unmethylated cytosine bases are converted into uracil, while the 5-methylcytosine bases remain unchanged,
the chemically treated DNA sample is amplified using at least 2 primer oligonucleotides and a polymerase, the DNA to be examined being preferred over the background DNA as a template and
one analyzes the amplificates and concludes from the presence of an amplificate and / or from the analysis of further positions on the methylation status in the DNA to be examined.

Erfindungsgemäß bevorzugt ist es, dass man die Proben DNA aus Serum oder anderen Körperflüssigkeiten eines Individuums gewinnt. It is preferred according to the invention that the samples are DNA from serum or other body fluids Individual wins.

Es ist weiterhin erfindungsgemäß bevorzugt, dass man die Proben DNA aus Zellinien, Blut, Sputum, Stuhl, Urin, Serum, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin einbettetem Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologischen Objektträgern und allen möglichen Kombinationen hiervon gewinnt. It is further preferred according to the invention that the DNA samples from cell lines, blood, sputum, stool, urine, Serum, cerebrospinal fluid, in paraffin embedded tissue, for example tissue from eyes, Intestine, kidney, brain, heart, prostate, lung, chest or Liver, histological slides and all sorts Combinations of these wins.

Es ist ganz besonders erfindungsgemäß bevorzugt, dass man die chemische Behandlung mit einem Bisulfit (= Disulfit, Hydrogensulfit) durchführt. Bevorzugt ist es auch, dass die chemische Behandlung nach Einbetten der DNA in Agarose erfolgt. Es ist auch und weiterhin bevorzugt, dass bei der chemischen Behandlung ein die DNA-Duplex denaturierendes Reagenz und/oder ein Radikalfänger zugegen ist. It is particularly preferred according to the invention that chemical treatment with a bisulfite (= disulfite, Hydrogen sulfite) is carried out. It is also preferred that chemical treatment after embedding the DNA in Agarose occurs. It is also and still preferred that in chemical treatment a DNA duplex denaturing reagent and / or a radical scavenger is present.

Bevorzugt ist es, dass man die Amplifikation im zweiten Schritt in Gegenwart mindestens eines weiteren Oligonukleotids durchführt, welches an ein 5'-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5-CA- 3'-Dinukleotid bindet, wobei das weitere Oligonukleotid bevorzugt an die Hintergrund-DNA bindet und deren Amplifikation beeinträchtigt. It is preferred that the amplification in the second Step in the presence of at least one other Oligonucleotide, which is attached to a 5'-CG-3'- Dinucleotide or a 5'-TG-3'-dinucleotide or a 5-CA- 3'-dinucleotide binds, the further oligonucleotide binds preferentially to the background DNA and its Amplification affected.

Weiterhin ist es erfindungsgemäß bevorzugt, dass man die chemisch behandelte DNA-Probe im zweiten Schritt unter Verwendung von mindestens 2 Primeroligonukleotiden und einem weiteren Oligonukleotid, welches an ein 5-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5'-CA- 3'-Dinukleotid hybridisiert, und mindestens einem Reporteroligonukleotid, welches an ein 5'-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5'-CA- 3'-Dinukleotid hybridisiert, sowie einer Polymerase amplifiziert; wobei das weitere Oligonukleotid bevorzugt an die Hintergrund-DNA bindet und deren Amplifikation beeinträchtigt, und wobei das Reporteroligonukleotid bevorzugt an die zu untersuchende DNA bindet und deren Amplifikation anzeigt. Dabei ist es vorteilhaft, dass man zusätzlich zu dem Reporteroligonukleotid ein weiteres mit einem Fluoreszenzfarbstoff markiertes Oligomer verwendet, welches unmittelbar benachbart zu dem Reporteroligonukleotid hybridisiert und sich diese Hybridisierung mittels Fluoreszenz Resonanz Energietransfer nachweisen lässt. Weiterhin vorteilhaft ist es, dass ein Taqman-Assay durchgeführt wird. Bevorzugt ist es auch, dass ein Lightcycler Assay durchgeführt wird. Furthermore, it is preferred according to the invention that the chemically treated DNA sample in the second step below Use of at least 2 primer oligonucleotides and another oligonucleotide attached to a 5-CG-3'- Dinucleotide or a 5'-TG-3'-dinucleotide or a 5'-CA- 3'-dinucleotide hybridizes, and at least one Reporter oligonucleotide attached to a 5'-CG-3'- Dinucleotide or a 5'-TG-3'-dinucleotide or a 5'-CA- 3'-dinucleotide hybridized, and a polymerase amplified; the further oligonucleotide being preferred binds to the background DNA and its amplification impaired, and being the reporter oligonucleotide preferably binds to the DNA to be examined and their Indicates amplification. It is advantageous that one in addition to the reporter oligonucleotide uses an oligomer labeled with a fluorescent dye, which is immediately adjacent to the Reporter oligonucleotide hybridizes and this Hybridization using fluorescence resonance Evidence of energy transfer. Also advantageous is that a Taqman assay is being performed. It is also preferred that a light cycler assay is carried out.

Es ist ferner erfindungsgemäß bevorzugt, dass die zusätzlich zu den Primern verwendeten Oligonukleotide nicht über eine 3'-OH Funktion verfügen. Weiterhin ist bevorzugt, dass die Reporteroligonukleotide mindestens eine Fluoreszenzmarkierung tragen. Ferner ist auch bevorzugt, dass die Reportermoleküle die Amplifikation entweder durch eine Zunahme oder eine Abnahme der Fluoreszenz anzeigen. Dabei ist es besonders vorteilhaft, dass man die Zunahme oder Abnahme der Fluoreszenz auch direkt zur Analyse verwendet und aus dem Fluorenzenzsignal auf einen Methylierungszustand der zu analysierenden DNA schließt. It is further preferred according to the invention that the oligonucleotides used in addition to the primers do not have a 3'-OH function. Furthermore is preferred that the reporter oligonucleotides at least carry a fluorescent label. It is also preferred that the reporter molecules do the amplification either by an increase or a decrease in Show fluorescence. It is particularly advantageous that one can see the increase or decrease in fluorescence as well used directly for analysis and from the Fluorescence signal to a methylation state of the analyzing DNA closes.

Bevorzugt ist es erfindungsgemäß ferner, dass die Hintergrund-DNA in 100 facher Konzentration im Vergleich zur zu untersuchenden DNA vorliegt. Weiterhin ist bevorzugt, dass die Hintergrund-DNA in 1000 facher Konzentration im Vergleich zur zu untersuchenden DNA vorliegt. It is further preferred according to the invention that the Comparison of background DNA in 100-fold concentration for the DNA to be examined. Furthermore is preferred that the background DNA be 1000 fold Concentration compared to the DNA to be examined is present.

Bevorzugt ist es ferner, dass die Analyse, oder gegebenenfalls die weitere Analyse mittels Hybridisierung an Oligomer-Arrays erfolgt, wobei Oligomere Nukleinsäuren oder in ihren Hybridisierungseigenschaften ähnliche Moleküle wie PNAs sein können. It is further preferred that the analysis, or if necessary, further analysis using hybridization on oligomer arrays, oligomeric nucleic acids or similar in their hybridization properties Molecules can be like PNAs.

Vorteilhaft ist es erfindungsgemäß auch, dass die Oligomere über einen 12-22 Basen langen Abschnitt an die zu analysierende DNA hybridisieren und sie ein CG, TG oder CA Dinukleotid umfassen. It is also advantageous according to the invention that the Oligomers over a 12-22 base section to the Hybridize DNA to be analyzed and they a CG, TG or CA dinucleotide.

Es ist bevorzugt, dass der Methylierungsstatus von mehr als 20 Methylierungspositionen der zu analysierenden DNA in einem Experiment nachgewiesen wird. It is preferred that the methylation status be more than 20 methylation positions of the DNA to be analyzed is demonstrated in an experiment.

Weiterhin ist bevorzugt, dass der Methylierungsstatus von mehr als 60 Methylierungspositionen der zu analysierenden DNA in einem Experiment nachgewiesen wird. It is further preferred that the methylation status of more than 60 methylation positions of the ones to be analyzed DNA is detected in an experiment.

Auch ist es erfindungsgemäß bevorzugt, dass die Analyse, oder gegebenenfalls die weitere Analyse durch Längenmessung der amplifizierten zu untersuchenden DNA erfolgt, wobei Methoden zur Längenmessung Gelelektrophorese, Kapillargelelektrophorese, Chromatographie (z. B. HPLC), Massenspektrometrie und andere geeignete Methoden umfassen. Vorteilhaft ist es dabei auch, dass Methoden zur Sequenzierung die Sanger- Methode, Maxam-Gilbert-Methode und andere Methoden wie Sequencing by Hybridisation (SBH) umfassen. It is also preferred according to the invention that the analysis, or if necessary, the further analysis Length measurement of the amplified DNA to be examined takes place using methods for length measurement Gel electrophoresis, capillary gel electrophoresis, Chromatography (e.g. HPLC), mass spectrometry and include other suitable methods. It is advantageous also that methods for sequencing the singer Method, Maxam-Gilbert method and other methods such as Sequencing by Hybridization (SBH) include.

Erfindungsgemäß bevorzugt ist auch ein Verfahren, wobei man die Sequenzierung für jede oder eine kleine Gruppe von CpG Positionen mit jeweils einem separaten Primeroligonukleotid ausführt und die Verlängerung der Primer nur eine oder einige wenige Basen ausmacht, und man aus der Art der Primerverlängerung auf den Methylierungsstatus der betreffenden Positionen in der zu untersuchenden DNA schließt. A method according to the invention is also preferred, wherein one sequencing for each or a small group of CpG positions, each with a separate one Executes primer oligonucleotide and the extension of the Primer only makes up one or a few bases, and from the type of primer extension to the Methylation status of the positions in question examining DNA closes.

Weiterhin ist bevorzugt, dass man aus dem Methylierungsgrad an den verschiedenen untersuchten CpG Positionen auf das Vorliegen einer Erkankung oder eines anderen medizinischen Zustandes des Patienten schließt. Vorteilhaft ist es, dass die Amplifikate selbst für die Detektion mit einer nachweisbaren Markierung versehen sind. Weiterhin vorteilhaft ist es, dass die Markierungen Fluoreszenzmarkierungen sind, oder/und dass die Markierungen Radionuklide sind oder/und dass die Markierungen ablösbare Massenmarkierungen sind, die in einem Massenspektrometer nachgewiesen werden. It is further preferred that one from the Degree of methylation at the various CpG investigated Positions on the presence of a disease or one other medical condition of the patient. It is advantageous that the amplificates themselves for Provide detection with a detectable marking are. It is also advantageous that the markings Are fluorescent labels, and / or that the Labels are radionuclides or / and that the Markings are removable mass markings that are in be detected by a mass spectrometer.

Bevorzugt ist ferner, dass bei der Amplifikation einer der Primer an eine Festphase gebunden ist. It is further preferred that a the primer is bound to a solid phase.

Erfindungsgemäß ist es auch, dass die Amplifikate insgesamt im Massenspektrometer nachgewiesen werden und somit durch ihre Masse eindeutig charakterisiert sind. It is also according to the invention that the amplificates can be detected overall in the mass spectrometer and are clearly characterized by their mass.

Ein weiterer Gegenstand der vorliegenden Erfindung ist auch die Verwendung eines erfindungsgemäßen Verfahrens zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse mindestens einer der folgenden Kategorien angehören: unerwünschte Arzneimittelwirkungen; Krebserkrankungen; CNS-Fehlfunktionen, Schäden oder Krankheit; Aggressionssymptome oder Verhaltensstörungen; klinische, psychologische und soziale Konsequenzen von Gehirnschädigungen; psychotische Störungen und Persönlichkeitsstörungen; Demenz und/oder assoziierte Syndrome; kardiovaskuläre Krankheit, Fehlfunktion und Schädigung; Fehlfunktion, Schädigung oder Krankheit des gastrointestinalen Traktes; Fehlfunktion, Schädigung oder Krankheit des Atmungssystems; Verletzung, Entzündung, Infektion, Immunität und/oder Rekonvaleszenz; Fehlfunktion, Schädigung oder Krankheit des Körpers als Abweichung im Entwicklungsprozess; Fehlfunktion, Schädigung oder Krankheit der Haut, der Muskeln, des Bindegewebes oder der Knochen; endokrine und metabolische Fehlfunktion, Schädigung oder Krankheit; Kopfschmerzen oder sexuelle Fehlfunktion. Another object of the present invention is also the use of a method according to the invention for the diagnosis and / or prognosis of adverse events for patients or individuals, whereby these disadvantageous Events in at least one of the following categories include: adverse drug effects; Cancers; CNS malfunction, damage or Illness; Symptoms of aggression or behavioral disorders; clinical, psychological and social consequences of Brain damage; psychotic disorders and Personality disorders; Dementia and / or associated syndromes; cardiovascular disease, malfunction and Damage; Malfunction, damage or illness of the gastrointestinal tract; Malfunction, damage or Respiratory system disease; Injury, inflammation, Infection, immunity and / or convalescence; Malfunction, damage or illness of the body as Deviation in the development process; Malfunction Damage or disease to the skin, muscles, Connective tissue or the bone; endocrine and metabolic Malfunction, injury or illness; a headache or sexual malfunction.

Vorteilhaft ist dabei die Verwendung eines erfindungsgemäßen Verfahrens zur Unterscheidung von Zelltypen oder Geweben oder zur Untersuchung der Zelldifferenzierung. It is advantageous to use a inventive method for distinguishing Cell types or tissues or to study the Cell differentiation.

Gegenstand der vorliegenden Erfindung ist auch ein Kit, bestehend aus einem Bisulfit enthaltenen Reagenz, Primern und weiteren Oligonuleotiden ohne 3'-OH Funktion zur Herstellung der Amplifikate, sowie optional einer Anleitung zur Durchführung eines erfindungsgemäßen Assays. The present invention also relates to a kit, consisting of a reagent containing bisulfite, primers and other oligonucleotides without 3'-OH function for Production of the amplificates, and optionally one Instructions for performing an assay according to the invention.

Die vorliegende Erfindung beschreibt somit ein Verfahren zur Detektion des Methylierungszustandes genomischer DNA Proben. Im Gegensatz zu bislang bekannten Verfahren wird der Methylierungsgrad eines Satzes von CpG Positionen in einer ausgewählten Untergruppe von DNA-Fragmenten z. B. in Serum bestimmt, so dass eine Analyse auch in Gegenwart eines Überschusses an diagnostisch nicht relevanter Hintergrund-DNA möglich ist. The present invention thus describes a method for the detection of the methylation state of genomic DNA Rehearse. In contrast to previously known methods the degree of methylation of a set of CpG positions in a selected subset of DNA fragments e.g. B. determined in serum, so an analysis even in the presence an excess of not diagnostically relevant Background DNA is possible.

Dabei besteht das bevorzugte Verfahren wiederum aus mehreren Schritten, die sich wie folgt zusammenfassen lassen:
Zuerst werden dem Patienten Serum und/oder andere Körperflüssigkeiten entnommen und die darin befindliche DNA wenn erforderlich isoliert. Anschliessend wird im zweiten Schritt eine chemische Behandlung, bevorzugt mit einem Bisulfit (= Hydrogensulfit, Disulfit) durchgeführt, wobei beispielsweise alle nicht methylierten Cytosinbasen in Uracil umgewandelt werden, die methylierten Cytosinbasen (5-Methylcytosin) jedoch unverändert bleiben. Im dritten Verfahrensschritt wird nun eine Amplifikation durchgeführt, bei der bevorzugt die zu untersuchende DNA amplifiziert wird, nicht aber oder nur in geringerem Maße die Hintergrund-DNA. Im folgenden, vierten Schritt werden nun die amplifizierten Fragmente auf Ihre Methlylierungssignatur hin analysiert und der Methylierungsgrad mehrerer ehemaliger CpG Positionen in den Amplifikaten bestimmt. Im fünften Verfahrensschritt wird aus dem Methylierungsgrad an den verschiedenen untersuchten CpG Positionen auf das Vorliegen einer Erkankung oder eines anderen medizinischen Zustandes des Patienten geschlossen. The preferred method again consists of several steps, which can be summarized as follows:
First, serum and / or other body fluids are removed from the patient and the DNA contained therein is isolated if necessary. A chemical treatment, preferably with a bisulfite (= hydrogen sulfite, disulfite), is then carried out in the second step, for example all non-methylated cytosine bases being converted to uracil, but the methylated cytosine bases (5-methylcytosine) remaining unchanged. In the third method step, an amplification is now carried out, in which the DNA to be examined is preferably amplified, but not or only to a lesser extent the background DNA. In the following, fourth step, the amplified fragments are now analyzed for their methylation signature and the degree of methylation of several former CpG positions in the amplificates is determined. In the fifth process step, the degree of methylation at the various CpG positions examined indicates the presence of a disease or another medical condition of the patient.

Das Wesen der vorliegenden Erfindung ist es nun, dass zwei Arten von CpG Positionen eine Rolle spielen und gleichermaßen zur Analyse beitragen und die nachfolgend als "Qualifier"-Positionen und "Classifier"-Positionen benannt werden sollen. Die Qualifier-Positionen dienen dazu, in der Amplifikation die zu analysierende DNA von der Hintergrund-DNA zu unterscheiden. Dies kann technisch, wie im folgenden detailliert dargelegt, auf unterschiedliche Art und Weise erfolgen. Eigenschaft dieser Positionen ist es jedoch, dass ihr Methylierungsgrad in zu untersuchender DNA möglichst verschieden ist von dem in der Hintergrund-DNA und die zu einer Bevorzugung der zu untersuchenden DNA in der Amplifikation führt. Die Classifier-Positionen dienen im Gegensatz dazu, aus dem Amplifikat, erzeugt überwiegend aus der zu untersuchenden DNA, über den jeweiligen Methlierungsgrad die für die Diagnose bedeutende Information zu extrahieren. Es können bis zu einigen 100 solcher Classifier Positionen für eine Analyse verwendet werden, erfolgt die Analyse beipielsweise auf Oligomer- Arrays, auch wenn dies oftmals nicht erforderlich sein wird. Es ist jedoch in diesem Fall nicht das Entstehen eines bestimmten Amplifikates, das für das Untersuchungsergebnis von Bedeutung ist, sondern vielmehr die Analyse der CpG-Positionen in selbigem Amplifikat. In einigen Fällen ist es jedoch sicher möglich und sinnvoll, die aus dem Entstehen eines Amplifikates abzuleitende Information in die Analyse mit einzubeziehen, in diesem Fall sind einige Positionen dann zugleich Classifier und Qualifier. The essence of the present invention is that two types of CpG positions play a role and equally contribute to the analysis and the following as "qualifier" positions and "classifier" positions should be named. The qualifier positions serve to amplify the DNA of to distinguish the background DNA. This can technically, as detailed below different ways. property of these positions, however, is that you Degree of methylation in DNA to be examined if possible is different from that in the background DNA and that too a preference for the DNA to be examined in the Amplification leads. The classifier positions are used in In contrast, from the amplificate, generated predominantly from the DNA to be examined, over the respective Degree of methylation which is important for the diagnosis Extract information. Up to a few 100 such classifier positions are used for an analysis analysis is carried out, for example, for oligomer Arrays, even if this is often not necessary becomes. However, in this case it is not arising of a certain amplificate, which for the The result of the investigation is important, but rather the analysis of the CpG positions in the same amplificate. In In some cases, however, it is certainly possible and useful the one to be derived from the creation of an amplificate Include information in the analysis in this Some positions are then classifiers and Qualifier.

Der erste Schritt des Verfahrens, die Gewinnung von Proben, erfolgt bevorzugt durch Entnahme von Köperflüssigkeiten wie z. B. Sputum oder aber Serum, jedoch ist es offenkundig dass das Verfahren mit vielerlei Proben aus unterschiedlichen Quellen durchführbar ist, die hier ohne Anspruch auf Vollständigkeit aufgeführt sind. The first step of the process, the extraction of Samples are preferably taken by taking Body fluids such as B. sputum or serum, however, it is obvious that the procedure with many samples from different sources is feasible here without claim Completeness are listed.

Bevorzugt wird die in dem Verfahren eingesetzte genomische DNA aus einer DNA-Probe erhalten, wobei Quellen für DNA z. B. Zellinien, Blut, Sputum, Stuhl, Urin, Serum, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin eingebettetes Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologische Objektträger und alle möglichen Kombinationen hiervon umfassen. The one used in the process is preferred obtained genomic DNA from a DNA sample, where Sources of DNA e.g. B. cell lines, blood, sputum, stool, Urine, serum, brain spinal fluid, in paraffin embedded tissue, for example tissue from eyes, Intestine, kidney, brain, heart, prostate, lung, chest or Liver, histological slides and all sorts Combinations of these include.

Es erfolgt in einigen Fällen vor der Bisulfit-Behandlung eine Aufreinigung oder Aufkonzentration der DNA, um eine Störung der Bisulfit-Reaktion und/oder der nachfolgenden PCR durch ein zu hohes Maß an Verunreinigungen zu vermeiden. Es ist jedoch bekannt, dass beipielsweise eine PCR aus Gewebe nach Behandlung beispielsweise mit Proteinase K ohne weitere Aufreinigung erfolgen kann, und dies gilt sinngemäß auch für die Bisulfit-Behandlung und nachfolgende PCR. It is done in some cases before the bisulfite treatment a purification or concentration of the DNA to a Disruption of the bisulfite reaction and / or the subsequent one PCR due to excessive levels of contaminants avoid. However, it is known that, for example, a PCR from tissue after treatment with, for example Proteinase K can be done without further purification, and this applies mutatis mutandis to the bisulfite treatment and subsequent PCR.

Die chemische Behandlung wird bevorzugt durch Behandlung mit einem Bisulfit (= Hydrogensulft, Disulfit), wiederum bevorzugt Natriumbisulfit (weniger geeignet ist Ammoniumbisulfit) durchgeführt. Entweder erfolgt die Reaktion nach einer publizierten Variante, bevorzugt ist hier die Einbettung der DNA in Agarose, um die DNA während der Behandlung in einzelsträngigen Zustand zu halten, oder aber nach einer neuen Variante durch Behandlung in Gegenwart eines Radikalfängers und eines denaturierenden Reagenzes, bevorzugt ein Oligeothylenglykoldialkylether oder beipielsweise Dioxan. Vor der PCR Reaktion werden die Reagenzien entweder durch Waschen im Falle der Agarosemethode oder einem DNA- Aufreinigungsverfahren (Stand der Technik, Fällung oder Bindung an eine Festphase, Membran) entfernt oder aber einfach durch Verdünnung in einen Konzentrationsbereich gebracht, der die PCR nicht mehr signifikant beeinflusst. Chemical treatment is preferred by treatment with a bisulfite (= hydrogen sulfide, disulfite), again preferably sodium bisulfite (less suitable Ammonium bisulfite). Either that happens Reaction according to a published variant, is preferred here the embedding of the DNA in agarose to the DNA during treatment in single-stranded condition hold, or by a new variant Treatment in the presence of a radical scavenger and one denaturing reagent, preferably a Oligeothylene glycol dialkyl ether or, for example, dioxane. Before the PCR reaction, the reagents are either run through Washing in the case of the agarose method or a DNA Purification processes (state of the art, precipitation or Binding to a solid phase, membrane) removed or simply by dilution into a concentration range brought that no longer significantly affects the PCR.

Wesentlich für den dritten Schritt ist es nun, dass die Qualifier Positionen ausgewählt werden und eine geeignete Methode gewählt wird, die die selektive Amplifikation der zu untersuchenden DNA erlaubt. Die Auswahl der Positionen erfolgt nach der Prämisse, dass sie sich zwischen Hintergrund-DNA und zu untersuchender DNA hinsichtlich ihrer Methylierung so sehr wie möglich unterscheiden sollten. Dazu werden zunächst die Methylierungsprofile der jeweils in Frage kommenden Abschnitte eines Gens sowohl für die zu untersuchenden Tumore als auch für die Hintergrund-DNA aus gesunden Individuen bestimmt. Diejenigen Positionen, die die größten Unterschiede zwischen Tumor DNA und Hintergrund-DNA (beispielsweise im Serum) aufweisen, werden als Qualifier Positionen ausgewählt. Solche Positionen sind für eine Vielzahl von Genen bereits bekannt, beipielsweise für GSTpi, für HIC-1 und MGMT (von Wronski MA, Harris LC, Tano K, Mitra S. Bigner DD, Brent TP. (1992) Cytosine methylation and suppression of O6-methylguanine-DNA methyltransferase expression in human rhabdomyosarcoma cell lines and xenografts. Oncol Res.; 4(4-5): 167-74; Esteller M, Toyota M, Sanchez-Cespedes M, Capella G, Peinado MA, Watkins DN, Issa JP, Sidransky D, Baylin SB, Herman JG. (2000), Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis. Cancer Res. May 1; 60(9): 2368-71). Es gibt nun mehrere Methoden, die allesamt bevorzugt sind, mit denen man die zu untersuchende DNA unter Verwendung dieser Qualifier-Positionen bevorzugt amplifizieren kann. It is essential for the third step that the Qualifier positions are selected and an appropriate one Method is selected that the selective amplification of the DNA to be examined allowed. The selection of positions takes place on the premise that they are between Background DNA and DNA to be examined for distinguish their methylation as much as possible should. First, the methylation profiles the sections of a gene in question both for the tumors to be examined and for the Background DNA determined from healthy individuals. Those positions that have the biggest differences between tumor DNA and background DNA (e.g. in Serum) are considered qualifier positions selected. Such positions are for a variety of Genes already known, for example for GSTpi, for HIC-1 and MGMT (by Wronski MA, Harris LC, Tano K, Mitra S. Bigner DD, Brent TP. (1992) Cytosine methylation and suppression of O6-methylguanine-DNA methyltransferase expression in human rhabdomyosarcoma cell lines and xenografts. Oncol Res .; 4 (4-5): 167-74; Esteller M, Toyota M, Sanchez-Cespedes M, Capella G, Peinado MA, Watkins DN, Issa JP, Sidransky D, Baylin SB, Herman JG. (2000) Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis. Cancer Res. May 1; 60 (9): 2368-71). There are now several methods, all of which are preferred, with which one using the DNA to be examined of these qualifier positions can preferably amplify.

Zum einen ist es möglich, wiederum eine der MSP entsprechende Reaktion durchzuführen, indem man Primer verwendet, die vollständig an die Sequenz hybridisieren, die der zu untersuchenden DNA nach Bisulfit-Behandlung entspricht, nicht aber an die analog behandelte Hintergrund-DNA. Mit anderen Worten, die Primer hybridisieren an einen DNA-Abschnitt, in dem sich eine oder mehrere Qualifier Positionen befinden, und nur wenn deren Methylierungsstatus in der ursprünglichen DNA dem der für die zu untersuchende DNA charakteristischen entspricht, kann eine Amplifikation in signifikantem Ausmass stattfinden. Dies ist eine prinzipiell einfache Variante, die hat jedoch den Nachteil, dass die Qualifier-Positionen jeweils an einem oder an beiden Enden des DNA-Fragmentes liegen müssen, d. h. die Classifier-Positionen müssen zwischen den Qualifier- Positionen liegen (oder aber, bei nur einer Qualifier Position, darf diese nicht inmitten der Classifier- Positionen liegen). Auch wenn es erfindungsgemäß bevorzugt ist, eine solche MSP-Variante durchzuführen, ist daher davon auszugehen, dass sie nur in vergleichsweise wenigen Fällen zur Anwendung kommen kann, da die Verteilung von Qualifier und Classifier-Positionen nur in wenigen Fällen so ideal sein wird. Da prinzipiell jedoch einfach durchzuführen, ist sie hier dennoch als bevorzugt aufgeführt. For one, it is possible to turn one of the MSP perform appropriate reaction by using primers used that completely hybridize to the sequence, that of the DNA to be examined after bisulfite treatment corresponds, but not to the analog treated Background DNA. In other words, the primers hybridize to a DNA section in which a or more qualifier positions, and only if their methylation status in the original DNA the characteristic of the DNA to be examined corresponds to an amplification in significant Extent take place. This is a simple one in principle Variant, however, has the disadvantage that the Qualifier positions on one or both Ends of the DNA fragment must be d. H. the Classifier positions must be between the qualifier Positions are (or, if there is only one qualifier Position, it must not be in the middle of the classifier Positions). Even if it is according to the invention it is preferred to carry out such an MSP variant, it can therefore be assumed that they are only available in comparatively few cases can be used, because the distribution of qualifiers and classifier positions will only be so ideal in a few cases. In principle however, it is easy to do here preferably listed.

Besonders bevorzugt ist jedoch eine Variante, bei der die Primer nicht mit einer Qualifier-Position überlappen oder mit dieser hybridisieren, sondern die PCR-Amplifikation vielmehr durch mindestens ein weiteres Oligonukleotid, welches nicht als Primer fungieren kann und welches an eine Qualifier-Position bindet, beeinflusst wird. However, a variant is particularly preferred in which the Do not overlap or primer with a qualifier position hybridize with this, but the PCR amplification rather by at least one other oligonucleotide, which cannot act as a primer and which on binds a qualifier position, is influenced.

Das heißt, dass die chemisch behandelte DNA im Prinzip, wie es Stand der Technik ist, mittels zweier Primer amplifiziert wird. Innerhalb des von den beiden Primern eingegrenzten DNA-Abschnittes befinden sich eine oder mehrere Qualifier-Positionen. Es werden nun im Gegensatz zur normalen PCR weitere Oligonukleotide zugesetzt, welche an diese Qualifier-Positionen binden, und zwar selektiv dann, wenn diese vor der Bisulfit-Behandlung entweder methyliert oder nicht methyliert vorlagen. Die zu untersuchende DNA wird demnach bevorzugt dann amplifiziert, wenn die zugesetzten Oligonukleotide weniger effektiv an ihre Qualifier Positionen binden als bei der Hintergrund-DNA. Mit anderen Worten blockieren die zugesetzten Oligonukleotide selektiv die Amplifikation der Hintergrund-DNA. That means that the chemically treated DNA, in principle, as is state of the art, by means of two primers is amplified. Within that of the two primers delimited DNA section is one or multiple qualifier positions. It will now be in opposition further oligonucleotides added to normal PCR, which bind to these qualifier positions, namely selectively if this before the bisulfite treatment either methylated or unmethylated. The DNA to be examined is then preferred amplified when the added oligonucleotides less effective at tying them to their qualifier positions than in the background DNA. In other words, block the added oligonucleotides selectively Background DNA amplification.

Bevorzugt enthalten diese zugesezten Oligonukleotide entweder mindestens ein CG, ein TG oder ein CA Dinukleotid. Sie müssen weiterhin die Eigenschaft haben, dass sie von der in der PCR-Reaktion eingesetzten Polymerase nicht selbst verlängert werden können. Dies geschieht bevorzugt durch den Einsatz von 3'- Desoxyoligonukleotiden oder aber an der 3'-Position anderweitig funktionalisierten Oligonukleotiden, beipielsweise 3'-O-Acetyloligonukleotiden. Weiterhin muss der Abbau dieser Oligonukleotide durch die Polymerase verhindert werden. Dies erfolgt bevorzugt entweder durch die Verwendung einer Polymerase ohne Nukleaseaktivität oder bevorzugt durch Verwendung modifizierter Oligonukleotide, die beipielsweise am 5'-Ende Thioatbrücken aufweisen und daher gegen einen Abbau resistent sind. These preferably contain added oligonucleotides either at least a CG, a TG or a CA Dinucleotide. You must continue to have the property that they're from the one used in the PCR reaction Polymerase cannot be extended itself. This happens preferably through the use of 3'- Deoxyoligonucleotides or at the 3 'position otherwise functionalized oligonucleotides, for example 3'-O-acetyloligonucleotides. Furthermore must the degradation of these oligonucleotides by the polymerase be prevented. This is preferably done either by the use of a polymerase without nuclease activity or preferably by using modified ones Oligonucleotides, for example at the 5 'end Show thioate bridges and therefore against degradation are resistant.

Eine weitere besonders bevorzugte Variante ist die Verwendung von PNA (Peptide Nucleic Acid) Oligomeren, die sinngemäß wie die Oligonukleotide in diesem Experiment eingesetzt werden. Die PNA-Oligomere werden weder von der Polymerase abgebaut und noch können sie von dieser verlängert werden, so dass diese für diese Verfahrensvariante ideal geeignet sind. Verfahren zum Design und der Synthese von DNA-Oligomeren sind Stand der Technik. Another particularly preferred variant is the Use of PNA (Peptide Nucleic Acid) oligomers that analogous to the oligonucleotides in this experiment be used. The PNA oligomers are neither from the Polymerase degrades and you can still get from this be extended so this for this Process variants are ideally suited. Process for Design and synthesis of DNA oligomers are state of the art Technology.

Wie oben angesprochen, können mehrere Qualifier- Positionen und auch demnach mehrere, jeweils für einen in der Hintergrund-DNA vorliegenden Methylierungsstatus spezifische Oligonukeotide in einem solchen Verfahren verwendet werden. As mentioned above, multiple qualifiers Positions and therefore several, each for one in the background DNA present methylation status specific oligonucleotides in such a process be used.

Nach der selektiven Amplifikation der zu untersuchenden DNA können nun bevorzugt, nach an sich bekannten Verfahren, der Methylierungsstatus mehrerer Classifier- Positionen bestimmt werden. After the selective amplification of those to be examined DNA can now be preferred, according to known Procedure to determine the methylation status of several classifiers Positions can be determined.

Es ist jedoch offensichtlich, dass auch in diesem Fall das Entstehen eines PCR Fragmentes selbst im Einzelfall von hinreichender Aussagekraft sein kann, sofern man, wie auch bei der MSP, die Situation vorliegen hat, dass die Qualifier-Position praktisch zu 100% beispielsweise in der Hintergrund-DNA unmethyliert vorliegt, jedoch in der zu untersuchenden DNA aufmethyliert vorliegt. Verwendet man nun in der PCR ein Oligonukleotid, das bevorzugt an die Sequenz bindet, welche in der Bisulfit-Behandlung aus nicht methylierter Hintergrund-DNA entsteht, so entsteht in der PCR nur dann ein Produkt, wenn wenigstens eine geringe Menge an zu untersuchender DNA überhaupt vorhanden ist. Dies kann im Einzelfall bereits hinreichend für eine Diagnose sein, und es würde sich hierbei um ein Verfahren handeln, dass ähnliche Eigenschaften aufweist wie MSP. Obgleich eine solche Durchführung nicht direkt bevorzugt ist, ist ein solches Verfahren bislang nicht bekannt und wird demzufolge ebenfalls als zugehörig zum Gegenstand dieser Erfindung betrachtet. However, it is obvious that even in this case the emergence of a PCR fragment even in individual cases can be of sufficient informative value, provided that how Even at the MSP, the situation is that the Qualifier position practically 100% for example in the background DNA is unmethylated, but in the DNA to be examined is methylated. used an oligonucleotide, which is preferred to the sequence that binds out in the bisulfite treatment unmethylated background DNA arises, so arises a product in PCR only if at least one small amount of DNA to be examined at all is available. In individual cases this can already happen would be sufficient for a diagnosis, and it would this is a process that is similar Has properties like MSP. Although one Implementation is not directly preferred, it is one The method has not been known so far and will therefore become available also as belonging to the subject of this invention considered.

Bevorzugt ist es, dass in einer PCR-Reaktion mehrere Fragmente gleichzeitig erzeugt werden, d. h. dass eine Multiplex-PCR durchgeführt wird. Bei deren Design muss darauf geachtet werden, dass nicht nur die Primer, sondern auch die weiteren eingesetzten Oligonukleotide nicht zueinander komplementär sein dürfen, so dass eine hochgradige Multiplexierung in diesem Fall schwieriger ist als in üblich. Jedoch hat man bei bisulfitbehandelter DNA den Vorteil, dass aufgrund des unterschiedlichen G und C-Gehaltes der beiden DNA-Stränge ein Forward-Primer niemals auch als Reverse-Primer fungieren kann, was die Multiplexierung wiederum erleichtert und diesen Nachteil im wesentlichen ausgleicht. It is preferred that several in one PCR reaction Fragments are generated simultaneously, i. H. that a Multiplex PCR is performed. With their design must make sure that not only the primers, but also the other oligonucleotides used must not be complementary to each other, so that a high level multiplexing is more difficult in this case is more common than in. However, one has at bisulfite-treated DNA the advantage that due to the different G and C content of the two DNA strands a forward primer is never a reverse primer can act, which in turn multiplexing relieved and this disadvantage essentially balances.

Im einfachsten Fall werden nun wiederum die entstandenen Fragmente nachgewiesen. Dazu kommen alle möglichen bekannten molekularbiologischen Verfahren in Frage, wie Gelelektrophorese, Sequenzierung, Flüssigchromatographie oder Hybridisierungen, ohne dass dabei die Classifier Oligonukleotide analysiert werden. Dies wäre auch zur Qualitätskontrolle der vorangehenden Verfahrensschritte denkbar. Wie oben ausgeführt, ist jedoch die nachfolgende Analyse des Methlylierungsgrades der Classifier- Positionen besonders bevorzugt. In the simplest case, the resulting ones are again Fragments detected. In addition there are all sorts known molecular biological methods into question, such as Gel electrophoresis, sequencing, liquid chromatography or hybridizations without losing the classifier Oligonucleotides are analyzed. This would also be the case Quality control of the previous process steps conceivable. However, as stated above, the following is Analysis of the degree of methylation of the classifiers Positions particularly preferred.

Es gibt zahlreiche Möglichkeiten die bevorzugte Amplifikation der zu untersuchenden DNA mittels der oben beschriebenen Verfahren vorteilhaft mit Detektionstechniken für die Classifier-Oligonukleotide zu kombinieren. There are numerous options the preferred one Amplification of the DNA to be examined using the above described method advantageous with Detection techniques for the classifier oligonucleotides too combine.

Detektionstechniken, die sich besonders eignen, sind die Hybridisierung an Oligomerarrays und beispielsweise Primer-Extension (MiniSequenzierung) Reaktionen. Die Hybridisierung an Oligomerarrays kann ohne weitere Veränderung von Protokollen gegenüber dem nächstliegenden Stand der Technik verwendet werden (Olek A, Olek S. Walter J; WO-Patent 9928498). Jedoch ist es bevorzugt, die Amplifikate an einen Array von Oligomeren zu hybridisieren, der aus Paaren von an einer Festphase immobilisierten Oligonukleotiden besteht, von denen eines jeweils stark bevorzugt an einen ein ursprünglich unmethyliertes CpG (Classifier-Position) enthaltenden DNA-Abschnitt hybridisiert und das andere wiederum stark bevorzugt an den entsprechenden Abschnitt, in dem ursprünglich ein methyliertes CpG enthalten war, jeweils vor der Bisulfit-Behandlung und Amplifikation. Besonders bevorzugt ist in diesem Fall das Amplifikat oder die Amplifikate fluoreszent oder radioaktiv oder mit ablösbaren Massentags markiert, so dass sich nach der Hybridisierung die an die beiden Oligonukleotide eines Paares gebundenen Fragmente anhand dieser Markierung nachweisen und Quantifizieren lassen. Man erhält ein Intensitätsverhältnis, aus dem man beispielsweise nach Eichung des Experimentes mit vollständig methylierter und unmethylierter DNA den Methylierungsgrad an der jeweiligen Classifier-Position bestimmen kann. Auf einem solchen Oligomer-Array (Fig. 1) lassen sich eine Vielzahl von Fragmenten und Classifier-Positionen gleichzeitig nachweisen. Es ist sinnvoll und bevorzugt, dass der Array auch Qualifier-Positionen detektierende Oligomere zur Kontrolle des Experimentes enthält, da so das Verhältnis der in die Analyse eingehenden zu untersuchenden DNA zur Hintergrund-DNA bestimmt werden kann. Detection techniques that are particularly suitable are hybridization to oligomer arrays and, for example, primer extension (mini-sequencing) reactions. Hybridization to oligomer arrays can be used without further modification of protocols compared to the closest prior art (Olek A, Olek S. Walter J; WO patent 9928498). However, it is preferred to hybridize the amplificates to an array of oligomers, which consists of pairs of oligonucleotides immobilized on a solid phase, one of which in each case very preferably hybridizes to a DNA section containing an originally unmethylated CpG (classifier position) and that others in turn highly preferred to the corresponding section, in which a methylated CpG was originally contained, in each case before the bisulfite treatment and amplification. In this case, the amplificate or the amplificates are particularly preferably fluorescent or radioactive or labeled with removable mass tags, so that after the hybridization, the fragments bound to the two oligonucleotides of a pair can be detected and quantified using this label. An intensity ratio is obtained, from which the degree of methylation at the respective classifier position can be determined, for example after calibration of the experiment with fully methylated and unmethylated DNA. A large number of fragments and classifier positions can be detected simultaneously on such an oligomer array ( FIG. 1). It is sensible and preferred that the array also contains qualifier position-detecting oligomers to control the experiment, since in this way the ratio of the DNA to be examined to the background DNA to be examined can be determined.

Primerextensionsreaktionen können ebenfalls an auf einer Festphase immobilisierten Oligonukleotide ausgeführt werden. Obgleich nicht zwingend erforderlich, ist die Immobilisierung dieser Primer bevorzugt, da in der Regel eine Vielzahl von Classifier-Positionen aus mehreren Amplifikaten untersucht werden soll und dies auf einer Festphase, also an einem Oligomerarrays, bedeutend leichter und in einem Experiment durchführbar ist. Es ist besonders bevorzugt, dass die Primer sich unmittelbar neben einer Classifier-Position befinden und dass die Verlängerung nur um ein Nukleotid erfolgt. Es ist besonders bevorzugt, dass lediglich Didesoxythymidin und Didesoxycytidin als Nukleotide zugesetzt werden und dass diese jeweils mit einem unterschiedlichen Fluoreszenzfarbstoff markiert sind, wobei allerdings auch andere, unterscheidbare Markierungen wie Massentags denkbar und bevorzugt sind. Nach einer Bisulfit- Behandlung und Amplifikation liegen ehemalige methylierte CG als CG und nicht methylierte CG nunmehr als TG vor. Die Primerextensionsreaktion führt daher entweder zum Einbau eines Didesoxycytidins oder Didesoxythymidins. Aus dem Verhältnis der für diese beiden Terminatoren jeweils detektierten Fluoreszenzmarkierungen lässt sich auf den Methylierungsgrad der jeweiligen Position schließen. Es ist auch möglich und bevorzugt, in diesem Fall die Primerextension mit Desoxycytidin und Desoxythymidin durchzuführen, wenn man kein Guaninderivat zugibt und demzufolge bei einer TG oder CG Sequenz bereits nach einer Base die Primerextension ohnehin endet. Zudem ist es ebenfalls bevorzugt, die Analyse auf dem Gegenstrang durch Unterscheidung von CA und CG analog durchzuführen, dann entsprechend mit Didesoxy-ATP und Didesoxy-GTP oder deren Derivaten. Primer extension reactions can also be carried out on a Solid phase immobilized oligonucleotides performed become. Although not mandatory, the Immobilization of these primers is preferred, as a rule a large number of classifier positions Amplificates should be examined and this on a Solid phase, i.e. on an oligomer array, significant easier and feasible in an experiment. It is particularly preferred that the primers immediately next to a classifier position and that the Extension only by one nucleotide. It is particularly preferred that only dideoxythymidine and Dideoxycytidine can be added as nucleotides and that each with a different Fluorescent dye are marked, although also other distinguishable markings such as mass tags are conceivable and preferred. After a bisulfite Treatment and amplification are formerly methylated CG as CG and unmethylated CG now as TG. The primer extension reaction therefore either leads to Incorporation of a dideoxycytidine or dideoxythymidine. Out the ratio of each for these two terminators detected fluorescent labels can be on the Close degree of methylation of the respective position. It is also possible and preferred, in this case the Primer extension with deoxycytidine and deoxythymidine to be carried out if no guanine derivative is added and therefore already after a TG or CG sequence of a base the primer extension ends anyway. In addition is it also preferred to do the analysis on the opposite strand to be carried out analogously by differentiating between CA and CG, then accordingly with dideoxy-ATP and dideoxy-GTP or their derivatives.

Eine besonders bevorzugte Variante des Verfahrens ist jedoch die gleichzeitige Detektion von Qualifier- Positionen und Classifier-Positionen in einem Experiment, was sich durch Verwendung von Taqman oder Lightcycler- Technologievarianten erzielen lässt. Dabei werden zusätzlich zu den Oligonukleotiden, die für eine bevorzugte Amplifikation der zu untersuchenden DNA sorgen, weitere fluoreszenzmarkierte Oligonukleotide zugesetzt, und die Änderung der Fluoreszenz während der PCR-Reaktion gemessen. Dabei erhält man überwiegend, weil ja hauptsächlich die zu untersuchende DNA amplifiziert wird, auch aus dieser Fluoreszenzänderung unmittelbar Information über den Methylierungsstatus verschiedener Classifier CpG Positionen. Da verschiedene Oligonukleotide bevorzugt jeweils mit unterschiedlichen Fluoreszenzfarbstoffen versehen werden, ist auch eine Unterscheidung der Fluoreszenzänderung während der PCR getrennt für verschiedene Positionen möglich. A particularly preferred variant of the method is however, the simultaneous detection of qualifier Positions and classifier positions in an experiment, which can be achieved by using Taqman or Lightcycler Technology variants can be achieved. In doing so in addition to the oligonucleotides required for a preferred amplification of the DNA to be examined worry, more fluorescence-labeled oligonucleotides added, and the change in fluorescence during the PCR reaction measured. You get mostly because yes mainly amplifies the DNA to be examined is also immediately derived from this change in fluorescence Information about the methylation status of various Classifier CpG positions. Because different Oligonucleotides preferably with different ones Fluorescent dyes are also one Distinguish the change in fluorescence during PCR possible separately for different positions.

Diese vom Methylierungsstatus abhängige Fluoreszenzänderung kann durch zahlreiche Methoden erzielt werden, von denen hier beispielhaft zwei aufgeführt werden sollen. This depends on the methylation status Fluorescence change can be done by numerous methods can be achieved, of which two are exemplary should be listed.

Zum einen können Oligonukleotid Sonden verwendet werden, die spezifisch entweder an eine Sequenz binden, die durch chemische Behandlung aus einer an der entsprechenden Position unmethylierten DNA hervorgegangen ist, oder aber entsprechend an einer Sequenz, die durch chemische Behandlung aus einer an der entsprechenden Position methylierten DNA hervorgegangen ist. Diese Sonden sind besonders bevorzugt mit zwei Fluoreszenzfarbstoffen versehen, einem Quencherfarbstoff und einem als Marker dienenden Fluoreszenzfarbstoff. Beide sind mit der gleichen Oligonukleotidsonde verknüpft. Findet nun eine PCR-Reaktion mit der zu untersuchenden DNA als Templat statt, so wird die PCR Reaktion diesmal durch die fluoreszent markierte Oligomersonde blockiert. Da diese jedoch nicht gegen die Nukleaseaktivität der Polymerase resistent ist, findet ein Abbau der an die Templat-DNA gebundenen Sonde während der PCR-Reaktion statt, der mit der Bindungseffizienz der Sonde an das Templat korreliert, da die nicht gebundene Sonde von der Polymerase nicht abgebaut wird. Der Abbau der Sonde wird nun dadurch, dass dabei der Quencherfarbstoff und der als Marker dienende Fluoreszenzfarbstoff voneinander getrennt werden, durch eine Zunahme der Fluoreszenz des Markerfarbstoffs unmittelbar sichtbar. Im Prinzip handelt es sich hierbei um eine Variante des sogenannten Taqman Assays. On the one hand, oligonucleotide probes can be used that specifically bind to a sequence that is by chemical treatment from one to the corresponding Position unmethylated DNA has emerged, or else corresponding to a sequence by chemical Treatment from one at the appropriate position methylated DNA has emerged. These probes are particularly preferably with two fluorescent dyes provided, a quencher dye and one as a marker serving fluorescent dye. Both are with the same oligonucleotide probe linked. Now find one PCR reaction with the DNA to be examined as a template instead, the PCR reaction will be fluorescent labeled oligomer probe blocked. This one but not against the nuclease activity of the polymerase is resistant, there is a degradation of the template DNA bound probe instead of during the PCR reaction the binding efficiency of the probe to the template correlates because the unbound probe is from the Polymerase is not degraded. The probe is dismantled now that the quencher dye and the as Marker fluorescent dye separated from each other by an increase in the fluorescence of the Marker dye immediately visible. Acting in principle it is a variant of the so-called Taqman Assays.

Was man demnach misst, ist das Entstehen eines PCR Produktes aus der zu untersuchenden DNA, jedoch nur dann wenn die untersuchte Classifier-Position auch in dem Methylierungszustand vorliegt, den die Sonde durch Hybridisieren an die chemisch behandelte DNA detektieren kann. Eine Gegenprobe mit einer Sonde, die entsprechend an die Classifier Position im anderen Methylierungszustand binden würde, ist daher zweckmäßig und bevorzugt. So what you measure is the emergence of a PCR Product from the DNA to be examined, but only then if the investigated classifier position also in the Methylation state that the probe passes through Detect hybridization to the chemically treated DNA can. A cross-check with a probe made accordingly to the classifier position in the other Would bind methylation state is therefore appropriate and preferred.

Bevorzugt werden verschiedene Fluoreszenzfarbstoffe mit unterschiedlichen Emissionswellenlängen an mehreren Sonden zusammen mit dem Quencher eingesetzt, um eine Unterscheidbarkeit der Sonden und damit eine Multiplexierung zu erreichen. Different fluorescent dyes are preferred different emission wavelengths at several Probes used with the Quencher to make one Distinctness of the probes and therefore one To achieve multiplexing.

Auch bei einem solchen Assay werden an die Qualifier Position bindende Oligonukleotide eingesetzt, die eine signifikante Amplifikation der Hintergrund-DNA verhindern. Die Amplifikation der zu untersuchenden DNA kann auch derart analysiert werden, dass man die gleiche Position auch mit einer Sonde wie oben beschrieben untersucht und die Amplifikation demnach durch eine an eine Qualifier-Position bindende Sonde nachweist. In diesem Fall ist es besonders bevorzugt, dass das nicht abbaubare Oligonukleotid selektiv an die Hintergrund-DNA bindet, während die fluoreszenzmarkierte Sonde an die zu untersuchende DNA bindet. In einer besonders bevorzugten Variante des Verfahrens weisen dabei die Sonde und das nicht abbaubare Oligonukleotid bis auf bevorzugt eine, nicht aber mehr als zwei Nukleobasen die gleiche Sequenz auf. Even with such an assay, the qualifiers are passed on Position-binding oligonucleotides are used that a significant amplification of the background DNA prevent. The amplification of the DNA to be examined can also be analyzed in such a way that the same Position also with a probe as described above examined and the amplification accordingly by an a probe that binds a qualifier. In In this case, it is particularly preferred that it not degradable oligonucleotide selectively attached to the background DNA binds to the while the fluorescently labeled probe investigating DNA binds. In a particularly preferred Variant of the method show the probe and that non-degradable oligonucleotide except for one, but not more than two nucleobases of the same sequence on.

Besonders bevorzugt ist zudem eine Variante, bei der mehrere methylierbare Positionen als Qualifier-Positionen definiert werden und für diese Positionen je mindestens ein, an die Hintergrund-DNA bevorzugt bindendes Oligonukeotid sowie eine Sonde verwendet werden. Da die Amplifikation der Hintergrund-DNA in diesem Falle durch mehrere Oligonukleotide unterdrückt wird, eignet sich dieses Verfahren besonders in Fällen, in denen der Überschuss an Hintergrund-DNA gegenüber der zu untersuchenden DNA besonders groß ist. In vielen Fällen wird sich bei dieser Variante und dem Vorliegen mehrerer Qualifier-Positionen in einem Fragment die weitere Untersuchung von Classifier-Positionen erübrigen, da mit den heute verfügbaren Geräten auch nicht beliebig viele unterschiedliche Farbstoffe (meistens sind es 4-5) gleichzeitig detektiert werden können. Die Untersuchung weiterer Classifier-Positionen wird dann bevorzugt mit einer der anderen, oben erwähnten Detektionstechniken durchgeführt. A variant in which several methylable positions as qualifier positions be defined and at least for each of these positions a which preferably binds to the background DNA Oligonucleotide and a probe can be used. Since the Amplification of the background DNA in this case by suppressing several oligonucleotides is suitable this procedure especially in cases where the Excess background DNA over that too investigating DNA is particularly large. In many cases will look at this variant and the presence of several Qualifier positions in one fragment the next Examination of classifier positions is unnecessary, since with not an unlimited number of devices available today different dyes (usually 4-5) can be detected at the same time. The investigation further classifier positions are then preferred with one of the other detection techniques mentioned above carried out.

Bevorzugt ist es auch, dass mit einer Sonde mehrere Positionen gleichzeitig auf ihren Methylierungsgrad untersucht werden können. It is also preferred that several with one probe Positions simultaneously on their degree of methylation can be examined.

Ist eine genauere Quantifizierung des Methylierungsgrades der Classifier-Positionen wünschenswert, so können bevorzugt auch zwei mit einander konkurrierende Sonden mit unterschiedlichen Farbstoffen eingesetzt werden, wobei eine wiederum im Fall einer unmethylierten Position in der zu untersuchenden DNA, die andere umgekehrt im Falle einer methylierten Position bevorzugt bindet. Aus dem Verhältnis der Fluoreszenzzunahmen für die beiden Farbstoffe lässt sich dann wiederum auf den Methylierungsgrad der untersuchten Position schließen. Is a more precise quantification of the degree of methylation of the classifier positions desirable, so can preferably also two competing probes with different dyes, one again in the case of an unmethylated position in the DNA to be examined, the other vice versa in In the case of a methylated position, preferably binds. Out the ratio of the fluorescence increases for the two Dyes can then in turn on the Close the degree of methylation of the investigated position.

Ein grundsätzlich anderes Verfahren, bei dem jedoch auch während der PCR eine Fluoreszenzänderung erfolgt, ist gegenwärtig als LightCyclertm Technologie bekannt. Dabei wird ausgenutzt, das ein Fluoreszenz Resonanz Energietransfer (FRET) zwischen zwei Farbstoffen nur erfolgen kann, wenn diese sich in unmmittelbarer Nähe, das heißt 1-5 Nukleotide voneinander entfernt befinden. A fundamentally different process, but also there is a change in fluorescence during the PCR currently known as LightCyclertm technology. there is exploited which has a fluorescence resonance Energy transfer (FRET) between two dyes only can take place if this is in the immediate vicinity, that is 1-5 nucleotides apart.

Nur dann kann der zweite Farbstoff von der Emission des ersten Farbstoffes angeregt werden und dann seinerseits Licht einer anderen Wellenlänge emittieren, das dann detektiert wird. Only then can the second dye from the emission of the first dye and then in turn Then emit light of a different wavelength is detected.

Im vorliegenden Fall der Methylierungsanalyse erfolgt eine Hybridisierung einer fluoreszenzmarkierten Sonde an die betreffende chemisch behandelte DNA an einer Classifier-Position, und die Bindung dieser Sonde hängt wiederum davon ab, ob die zu untersuchende DNA an dieser Position methyliert oder unmethyliert vorlag. Unmittelbar benachbart zu dieser Sonde bindet eine weitere Sonde mit einem anderen Fluoreszenzfarbstoff. Diese Bindung erfolgt bevorzugt wiederum methylierungsabhängig, wenn in dem betreffenden Sequenzabschnitt eine weitere methylierbare Position vorliegt. Während der Amplifikation wird nun die DNA vermehrt, weshalb immer mehr fluoreszenzmarkierte Sonden benachbart an die betreffende Position binden, sofern diese den dafür erforderlichen Methylierungszustand aufwies, und daher sich ein zunehmender FRET gemessen wird. In the present case the methylation analysis is done hybridization of a fluorescence-labeled probe the relevant chemically treated DNA on a Classifier position, and the binding of this probe hangs again depends on whether the DNA to be examined on this Position was methylated or unmethylated. Right away another probe binds adjacent to this probe another fluorescent dye. This binding takes place preferred again depending on methylation if in the relevant sequence section a further methylatable Position exists. During the amplification, the DNA increased, which is why more and more fluorescent labels Bind probes adjacent to the relevant position, if this is the necessary Showed methylation state, and therefore one increasing FRET is measured.

Auch bei diesem Verfahren erfolgt bevorzugt eine Multiplexierung mit mehreren verschieden fluoreszenzmarkierten Sonden. In this method, too, there is preferably a Multiplexing with several different ones fluorescent labeled probes.

Auch hier ist es wiederum möglich und bevorzugt, dass eine Qualifier Position gemessen wird. Angenommen, dass die Hintergrund-DNA an der betreffenden Position unmethyliert vorliegt und nach chemischer Behandlung und Amplifikation ein TG Dinukleotid an dieser Position ergibt, und dass im Gegensatz die methylierte zu untersuchende DNA ein CG Dinukleotid ergibt, würde eine fluoreszenzmarkierte Sonde an die ein CG enthaltende Sequenz binden, während ein konkurrierendes Oligomer, welches nicht markiert ist, an die entsprechende TG Sequenz der Hintergund-DNA bindet. Dabei ist es wichtig, dass das unmethylierte Oligonukleotid die Amplifikation aufgrund seiner deutlich höheren Schmelztemperatur im Gegensatz zu den kürzeren Sondenolignukleotiden hemmt. Again, it is possible and preferred that a qualifier position is measured. Assume that the background DNA at that position is unmethylated and after chemical treatment and Amplification of a TG dinucleotide at this position results, and that in contrast the methylated to DNA to be examined would produce a CG dinucleotide fluorescence-labeled probe to the one containing a CG Bind sequence while a competing oligomer, which is not marked, to the corresponding TG Sequence of the background DNA binds. It is important that the unmethylated oligonucleotide is the amplification due to its significantly higher melting temperature in the In contrast to the shorter probe oligonucleotides inhibits.

Insofern sind in diesem Fall Sonden und an die chemisch behandelte Hintergrund-DNA bindende Oligomere nicht bis auf wenige Basen identisch, sondern sie sind wesentlich (um 5-15 Basen) länger. Auch ist es wiederum möglich und bevorzugt, modifizierte Oligonukeotide und/oder PNAs einzusetzen. Auch in diesem Fall sind alle Sonden und Oligonukleotide bis auf die Primer an ihrem 3'-Ende blockiert, um eine Verlängerung in der PCR zu vermeiden. Dies kann beispielsweise mit einer Phosphatgruppe erfolgen. In this respect, probes are chemical in this case treated background DNA binding oligomers not until identical on a few bases, but they are essential (by 5-15 bases) longer. Again, it is also possible and preferred, modified oligonucleotides and / or PNAs use. In this case too, all probes and Oligonucleotides except for the primers at their 3 'end blocked to avoid extension in the PCR. This can be done, for example, with a phosphate group respectively.

Beide Verfahren unterscheiden sich im Ergebnis hauptsächlich darin, dass in einem Fall eine Abnahme, im anderen Fall eine Zunahme der Fluoreszenz gemessen wird. In beiden Fällen können sowohl Qualifier- als auch Classifier-Positionen gemessen werden. The result of both methods differs mainly in that in one case a decrease in otherwise an increase in fluorescence is measured. In both cases, both qualifiers and Classifier positions can be measured.

Zusammenfassend ist ein Verfahren zum Nachweis von Cytosin-Methylierung in DNA-Proben besonders bevorzugt, bei welchem die folgenden Schritte ausgeführt werden:
Zurst wird eine genomische DNA-Probe, welche zu untersuchende DNA und Hintergrund-DNA DNA umfasst, chemisch derart behandelt, dass alle nicht methylierten Cytosinbasen in Uracil umgewandelt werden, während die 5- Methylcytosinbasen unverändert bleiben, dann wird die chemisch behandelte DNA-Probe unter Verwendung von mindestens 2 Primeroligonukleotiden sowie einer Polymerase amplifiziert, wobei die zu untersuchende DNA gegenüber der Hintergrund-DNA als Templat bevorzugt wird und im nächsten Schritt werden die Amplifikate analysiert und aus dem Vorliegen eines Amplifikates und/oder aus der Analyse weiterer Positionen auf den Methylierungsstatus in der zu untersuchenden DNA geschlossen. In summary, a method for the detection of cytosine methylation in DNA samples is particularly preferred, in which the following steps are carried out:
First, a genomic DNA sample, which comprises the DNA to be examined and background DNA DNA, is chemically treated in such a way that all unmethylated cytosine bases are converted to uracil, while the 5-methylcytosine bases remain unchanged, then the chemically treated DNA sample is removed Use of at least 2 primer oligonucleotides and a polymerase amplified, the DNA to be examined being preferred over the background DNA as a template and in the next step the amplificates are analyzed and the presence of an amplificate and / or the analysis of further positions for the methylation status in of the DNA to be examined closed.

In einer besonders bevorzugten Verfahrensvariante wird die Proben-DNA aus Serum oder anderen Körperflüssigkeiten eines Individuums gewonnen. Ebenfalls bevorzugt ist es, dass die Proben-DNA aus Zellinien, Blut, Sputum, Stuhl, Urin, Serum, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin einbettetem Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologischen Objektträgern und allen möglichen Kombinationen hiervon gewonnen wird. In a particularly preferred variant of the method the sample DNA from serum or other body fluids of an individual won. It is also preferred that the sample DNA from cell lines, blood, sputum, stool, Urine, serum, brain spinal fluid, in paraffin embedded tissue, for example tissue from eyes, Intestine, kidney, brain, heart, prostate, lung, chest or Liver, histological slides and all sorts Combinations of these are won.

In einer besonders bevorzugten Variante des Verfahrens wird die chemische Behandlung mit einem Bisulfit (= Disulfit, Hydrogensulfit) durchgeführt. Bevorzugt ist es, die chemische Behandlung nach Einbetten der DNA in Agarose durchzuführen. Auch ist es bevorzugt, dass bei der chemischen Behandlung ein die DNA-Duplex denaturierendes Reagenz und/oder ein Radikalfänger zugegen ist. In a particularly preferred variant of the method is the chemical treatment with a bisulfite (= Disulfite, hydrogen sulfite) performed. Is preferred it, the chemical treatment after embedding the DNA in Perform agarose. It is also preferred that at chemical treatment a DNA duplex denaturing reagent and / or a radical scavenger is present.

In einer besonders bevorzugten Verfahrensvariante wird die Amplifikation im zweiten Schritt in Gegenwart mindestens eines weiteren Oligonukleotids durchgeführt, welches an ein 5'-CG-3'-Dinukleotid oder ein 5'-TG-3'- Dinukleotid oder ein 5'-CA-3'-Dinukleotid bindet, wobei das weitere Oligonukleotid bevorzugt an die Hintergrund- DNA bindet und deren Amplifikation beeinträchtigt. In a particularly preferred variant of the method the amplification in the second step in the presence carried out at least one further oligonucleotide, which is attached to a 5'-CG-3'-dinucleotide or a 5'-TG-3'- Dinucleotide or a 5'-CA-3 'dinucleotide binds, wherein the further oligonucleotide preferably to the background DNA binds and affects their amplification.

Besonders bevorzugt ist es zudem, dass man die chemisch behandelte DNA-Probe im zweiten Schritt unter Verwendung von mindestens 2 Primeroligonukleotiden und einem weiteren Oligonukleotid, welches an ein 5'-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5-CA- 3'-Dinukleotid hybridisiert, und mindestens einem Reporteroligonukleotid, welches an ein 5'-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5'-CA- 3'-Dinukleotid hybridisiert, sowie einer Polymerase amplifiziert; wobei das weitere Oligonukleotid bevorzugt an die Hintergrund-DNA bindet und deren Amplifikation beeinträchtigt und wobei das Reporteroligonukleotid bevorzugt an die zu untersuchende DNA bindet und deren Amplifikation anzeigt. It is also particularly preferred that the chemical treated DNA sample in the second step using of at least 2 primer oligonucleotides and one further oligonucleotide, which is attached to a 5'-CG-3'- Dinucleotide or a 5'-TG-3'-dinucleotide or a 5-CA- 3'-dinucleotide hybridizes, and at least one Reporter oligonucleotide attached to a 5'-CG-3'- Dinucleotide or a 5'-TG-3'-dinucleotide or a 5'-CA- 3'-dinucleotide hybridized, and a polymerase amplified; the further oligonucleotide being preferred binds to the background DNA and its amplification impaired and being the reporter oligonucleotide preferably binds to the DNA to be examined and their Indicates amplification.

Es ist auch bevorzugt, dass zusätzlich zu dem Reporteroligonukleotid ein weiteres mit einem Fluoreszenzfarbstoff markiertes Oligomer verwendet wird, welches unmittelbar benachbart zu dem Reporteroligonukleotid hybridisiert und sich diese Hybridisierung mittels Fluoreszenz Resonanz Energietransfer (FRET) nachweisen lässt. It is also preferred that in addition to that Reporter oligonucleotide another one Fluorescent dye labeled oligomer is used which is immediately adjacent to the Reporter oligonucleotide hybridizes and this Hybridization using fluorescence resonance Evidence of energy transfer (FRET).

Besonders bevorzugt wird für die Analyse ein Taqman-Assay durchgeführt. Ebenso ist es bevorzugt, einen LightCycler Assay (wie oben beschrieben) durchzuführen. A Taqman assay is particularly preferred for the analysis carried out. It is also preferred to use a LightCycler Perform assay (as described above).

Besonders bevorzugt verfügen die zusätzlich zu den Primern verwendeten Oligonukleotide nicht über eine 3'-OH Funktion. Zudem tragen die Reporteroligonukleotide besonders bevorzugt mindestens eine Fluoreszenzmarkierung. They particularly preferably have in addition to Primers did not use oligonucleotides through a 3'-OH Function. The reporter oligonucleotides also carry particularly preferably at least one Fluorescent label.

Es ist besonders bevorzugt, dass die Reportermoleküle die Amplifikation entweder durch eine Zunahme oder eine Abnahme der Fluoreszenz anzeigen und dass die Zunahme oder Abnahme der Fluoreszenz auch direkt zur Analyse verwendet wird und aus dem Fluorenzenzsignal auf einen Methylierungszustand der zu analysierenden DNA geschlossen wird. It is particularly preferred that the reporter molecules Amplification by either an increase or a Show decrease in fluorescence and that increase or decrease in fluorescence directly for analysis is used and from the fluorescence signal to one Methylation state of the DNA to be analyzed is closed.

In einer besonders bevorzugten Verfahrensvariante erfolgt die Analyse oder die weitere Analyse mittels Hybridisierung an Oligomer-Arrays, wobei Oligomere Nukleinsäuren oder in ihren Hybridisierungseigenschaften ähnliche Moleküle wie PNAs sein können. Bevorzugt hybridisieren die Oligomere über einen 12-22 Basen langen Abschnitt an die zu analysierende DNA und umfassen ein CG, TG oder CA Dinukleotid. Mit dieser Methode wird bevorzugt der Methylierungsstatus von mehr als 20 Methylierungspositionen der zu untersuchenden DNA in einem Experiment nachgewiesen, besonders bevorzugt sind es mehr als 60 Methylierungspositionen. In a particularly preferred variant of the method the analysis or further analysis by means of Hybridization to oligomer arrays, using oligomers Nucleic acids or in their hybridization properties molecules similar to PNAs. Prefers hybridize the oligomers over a 12-22 base long Section to the DNA to be analyzed and include a CG, TG or CA dinucleotide. With this method preferably the methylation status of more than 20 Methylation positions of the DNA to be examined in demonstrated in an experiment, are particularly preferred there are more than 60 methylation positions.

Besonders bevorzugt ist auch ein Verfahren, bei dem die weitere Analyse durch Längenmessung der amplifizierten zu untersuchenden DNA erfolgt, wobei Methoden zur Längenmessung Gelelektrophorese, Kapillargelelektrophorese, Chromatographie (z. B. HPLC), Massenspektrometrie und andere geeignete Methoden umfassen. A method in which the further analysis by measuring the length of the amplified investigating DNA takes place, using methods for Length measurement gel electrophoresis, Capillary gel electrophoresis, chromatography (e.g. HPLC), Mass spectrometry and other suitable methods include.

Besonders bevorzugt ist auch ein Verfahren, bei dem die weitere Analyse durch Sequenzierung erfolgt, wobei Methoden zur Sequenzierung die Sanger-Methode, Maxam- Gilbert-Methode und andere Methoden wie Sequencing by Hybridisation (SBH) umfassen. Wiederum bevorzugt ist ein Verfahren, wobei die Sequenzierung (nach Sanger) für jede oder eine kleine Gruppe von CpG Positionen mit jeweils einem separaten Primeroligonukleotid ausgeführt wird und die Verlängerung der Primer nur eine oder einige wenige Basen ausmacht, und aus der Art der Primerverlängerung auf den Methylierungsstatus der betreffenden Positionen in der zu untersuchenden DNA geschlossen wird. A method in which the further analysis is done by sequencing, whereby Methods for sequencing the Sanger method, Maxam- Gilbert method and other methods such as sequencing by Hybridization (SBH) include. Again, a is preferred Procedure whereby sequencing (according to Sanger) for each or a small group of CpG positions with each a separate primer oligonucleotide is carried out and extending the primer only one or a few Bases, and from the type of primer extension on the methylation status of the positions in question the DNA to be examined is closed.

In einer besonders bevorzugten Verfahrensvariante wird aus dem Methylierungsgrad an den verschiedenen untersuchten CpG Positionen auf das Vorliegen einer Erkankung oder eines anderen medizinischen Zustandes des Patienten geschlossen. In a particularly preferred variant of the method from the degree of methylation at the various examined CpG positions for the existence of a Disease or other medical condition of the Patient closed.

Besonders bevorzugt sind auch die Amplifikate selbst für die Detektion mit einer nachweisbaren Markierung versehen. Bei diesen Markierungen handelt es sich bevorzugt um Fluoreszenzmarkierungen, Radionuklide oder ablösbare Massenmarkierungen, die in einem Massenspektrometer nachgewiesen werden. The amplificates themselves are also particularly preferred for detection with a detectable label Mistake. These marks are preferably around fluorescent labels, radionuclides or removable mass markings in one Mass spectrometer can be detected.

Weiterhin ist ein Verfahren bevorzugt, bei dem bei der Amplifikation einer der Primer an eine Festphase gebunden ist. Furthermore, a method is preferred in which Amplification of one of the primers bound to a solid phase is.

Auch bevorzugt ist eine Verfahrensvariante, wobei die Amplifikate insgesamt im Massenspektrometer nachgewiesen werden und somit durch ihre Masse eindeutig charakterisiert sind. A method variant is also preferred, wherein the Total amplificates detected in the mass spectrometer become clear and therefore unique by their mass are characterized.

Ein weiterer Gegenstand der vorliegenden Erfindung ist die Verwendung eines der beschriebenen Verfahren zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse mindestens einer der folgenden Kategorien angehören: unerwünschte Arzneimittelwirkungen; Krebserkrankungen; CNS-Fehlfunktionen, Schäden oder Krankheit; Aggressionssymptome oder Verhaltensstörungen; klinische, psychologische und soziale Konsequenzen von Gehirnschädigungen; psychotische Störungen und Persönlichkeitsstörungen; Demenz und/oder assoziierte Syndrome; kardiovaskuläre Krankheit, Fehlfunktion und Schädigung; Fehlfunktion, Schädigung oder Krankheit des gastrointestinalen Traktes; Fehlfunktion, Schädigung oder Krankheit des Atmungssystems; Verletzung, Entzündung, Infektion, Immunität und/oder Rekonvaleszenz; Fehlfunktion, Schädigung oder Krankheit des Körpers als Abweichung im Entwicklungsprozess; Fehlfunktion, Schädigung oder Krankheit der Haut, der Muskeln, des Bindegewebes oder der Knochen; endokrine und metabolische Fehlfunktion, Schädigung oder Krankheit; Kopfschmerzen oder sexuelle Fehlfunktion. Another object of the present invention is the use of one of the methods described for Diagnosing and / or predicting adverse events for Patients or individuals, whereby these are disadvantageous Events in at least one of the following categories include: adverse drug effects; Cancers; CNS malfunction, damage or Illness; Symptoms of aggression or behavioral disorders; clinical, psychological and social consequences of Brain damage; psychotic disorders and Personality disorders; Dementia and / or associated syndromes; cardiovascular disease, malfunction and Damage; Malfunction, damage or illness of the gastrointestinal tract; Malfunction, damage or Respiratory system disease; Injury, inflammation, Infection, immunity and / or convalescence; Malfunction, damage or illness of the body as Deviation in the development process; Malfunction Damage or disease to the skin, muscles, Connective tissue or the bone; endocrine and metabolic Malfunction, injury or illness; a headache or sexual malfunction.

Zudem bevorzugt ist die Verwendung eines der beschriebenen Verfahren zur Unterscheidung von Zelltypen oder Geweben oder zur Untersuchung der Zelldifferenzierung. It is also preferred to use one of the described method for differentiating cell types or tissues or to examine the Cell differentiation.

Ein weiterer Gegenstand der vorliegenden Erfindung ist ein Kit, bestehend aus einem Bisulfit enthaltenen Reagenz, Primern und weiteren Oligonuleotiden ohne 3'-OH Funktion zur Herstellung der Amplifikate, sowie optional einer Anleitung zur Durchführung zumindest einer der beschriebenen Verfahrensvarianten. Another object of the present invention is a kit consisting of a bisulfite contained Reagent, primers and other oligonucleotides without 3'-OH Function for producing the amplificates, as well as optional a guide to performing at least one of the described process variants.

Die folgenden Beispiele erläutern die Erfindung: The following examples illustrate the invention:

Beispiel 1example 1 Methylierungssensitive Amplifikation des MDR1 Gens unter Verwendung von PNA blocking probes (PCR clamping) im MDR-1 GenMethylation sensitive amplification of MDR1 Gene using PNA blocking probes (PCR clamping) in the MDR-1 gene a) Methylierungsspezifische PCR mit PNA Sonden (PNA blocking probes), deren Bindungsstellen nicht mit denen der Primer überlappena) Methylation-specific PCR with PNA probes (PNA blocking probes) whose binding sites do not match those of the Overlap primers

Zunächst wurden PCR-Bedingungen für Bisulfit-behandelte DNA definiert, unter denen ein allelspezifischer Einfluss der PNA blocking probe auf die PCR erkennbar ist. In diesem ersten Experiment überlappen die Bindungsstellen zwischen PNA und den Primern nicht. First, PCR conditions for bisulfite-treated ones DNA defines, among which an allele-specific influence the PNA blocking probe is recognizable on the PCR. In in this first experiment, the binding sites overlap not between PNA and the primers.

Zunächst wurde in einem Experiment der Einfluss einer 11mer PNA der Sequenz AAAATGTGTT in einer PCR mit den Primern TAAGTATGTTGAAGAAAGATTATTGTAG und TAAAAACTATCCCATAATAACTCCCAAC getestet. Ein Einfluss der PNA auf die PCR Reaktion ist unter PCR- Standardbedingungen bei einer Aneealingtemperatur von 55°C nicht messbar. Das für die Amplifikation des MDR1- Fragmentes verwendete Standard-Cyclerprogramm verwendet folgende Programmschritte:
Schritt 1: T = 96°C; 20 min
Schritt 2: T = 96°C; 30 s
Schritt 3: T = 56°C; 1,15 min
Schritt 4: T = 72°C; 2,00 min
Die Schritte 2 bis 4 werden als Zyklus 40 mal durchlaufen.
Schritt 5: T = 72°C; 15 min
Schritt 6: auf 4°C abkühlen und Temperatur halten First, the influence of an 11mer PNA of the sequence AAAATGTGTT was tested in a PCR using the primers TAAGTATGTTGAAGAAAGATTATTGTAG and TAAAAACTATCCCATAATAACTCCCAAC. The influence of the PNA on the PCR reaction cannot be measured under standard PCR conditions at an anealing temperature of 55 ° C. The standard cycler program used for the amplification of the MDR1 fragment uses the following program steps:
Step 1: T = 96 ° C; 20 min
Step 2: T = 96 ° C; 30 s
Step 3: T = 56 ° C; 1.15 min
Step 4: T = 72 ° C; 2.00 min
Steps 2 to 4 are run 40 times as a cycle.
Step 5: T = 72 ° C; 15 minutes
Step 6: cool to 4 ° C and keep temperature

Demzufolge müssen die Primerlänge, die Annealingtemperatur und die PNA-Probelänge optimal angepasst werden, um eine allelspezifische Unterdrückung der Amplifikation zu erreichen. Accordingly, the primer length, the Annealing temperature and the PNA sample length optimal be adjusted to allele-specific suppression to achieve the amplification.

Um den Primern und der PNA ein optimales Annealing zu ermöglichen, wurden in einer PCR Reaktion kürzere 21mer Primer TAAGTATGTTGAAGAAAGATT und AATCCCCATAAACTTACCAAA mit einer längeren 13mer PNA AAAGACGTGTTAT getestet. Weitere Versuche wurden mit 18, 19 und 20mer Primern durchgeführt, welche sich von den obigen Sequenzen nur dadurch unterscheiden, dass Basen am 3'-Ende weggelassen wurden. Die 21mer Primer wurden mit einem Gradienten der Annealingtemperatur getestet. In einem Parallelansatz wurden die 13mer PNA AAAGACGTGTTAT respektive die für eine aus einem nicht methylierten Allel hervorgegangene Sequenz passende PNA AAAGATGTGTTAT in verschiedenen Konzentrationen von 20-100 pmol/µl zugegeben. For optimal annealing of the primers and the PNA allow shorter 21mer in a PCR reaction Primers TAAGTATGTTGAAGAAAGATT and AATCCCCATAAACTTACCAAA tested with a longer 13mer PNA AAAGACGTGTTAT. Further attempts were made with 18, 19 and 20mer primers performed, which differ from the above sequences only differ in that bases at the 3 'end are omitted were. The 21mer primers were made using a gradient of Annealing temperature tested. In a parallel approach the 13mer PNA AAAGACGTGTTAT or the for one derived from a non-methylated allele Sequence matching PNA AAAGATGTGTTAT in different Concentrations of 20-100 pmol / µl added.

Ein deutlicher Einfluss auf die PCR wurde bei Annealingtemperaturen von 49,4°C und 46,7°C bei Zugabe der PNA in einer Konzentration von 70 und 100 pmol/µl beobachtet. Der Effekt war bei der Verwendung eines 18mer Primers am deutlichsten. A significant influence on the PCR was found in Annealing temperatures of 49.4 ° C and 46.7 ° C when added the PNA in a concentration of 70 and 100 pmol / µl observed. The effect was when using an 18mer Primers most clearly.

Untersucht wurde nun, inwieweit sich eine niedrigere Extensiontemperatur von 54°C auf den hemmenden Einfluss der PNAs auswirkt. It was now examined to what extent a lower one Extension temperature of 54 ° C on the inhibitory influence that affects PNAs.

Hierfür wurden zu einem PCR-Ansatz jeweils die oben genannten 13mer PNAs bzw. beide 13mer PNAs zusammen in einer Konzentration von 50 und 70 pmol/µl gegeben. Zu beobachten war eine deutliche Unterdrückung der PCR im Vergleich zur positiven Kontrolle ohne PNAs (Fig. 2, Agarose-Gelelektrophorese, Konzentrationen der PNAs für die verwendeten 13mer PNA Sonden; Annotation: MDR1-5FM: 13mer PNA AAAGACGTGTTAT; MDR1-5FU: 13mer PNA AAAGATGTGTTAT). Die Versuche legen nahe, dass die in den Versuchen verwendete DNA an den betreffenden Positionen überwiegend unmethyliert vorlag, was durch Bisulfit- Sequenzierung bestätigt werden konnte. Es kann also in diesem Experiment bereits eine deutliche Allelspezifität der PNA blocking probe gezeigt werden, die zu einer bevorzugten Amplifikation der nicht methylierten Fragmente führt. For this, the above-mentioned 13mer PNAs or both 13mer PNAs were added together to a PCR mixture in a concentration of 50 and 70 pmol / µl. A clear suppression of the PCR was observed in comparison to the positive control without PNAs ( FIG. 2, agarose gel electrophoresis, concentrations of the PNAs for the 13-mer PNA probes used; annotation: MDR1-5FM: 13-mer PNA AAAGACGTGTTAT; MDR1-5FU: 13-mer PNA AAAGATGTGTTAT). The experiments suggest that the DNA used in the experiments was predominantly unmethylated at the positions in question, which could be confirmed by bisulfite sequencing. A clear allele specificity of the PNA blocking probe can thus already be shown in this experiment, which leads to a preferred amplification of the unmethylated fragments.

b) Methylierungsspezifische PCR mit PNA Sonden (PNA blocking probes), deren Bindungsstellen mit denen der Primer überlappen ("primer exclusion")b) Methylation-specific PCR with PNA probes (PNA blocking probes), their binding sites with those of the Overlap primers ("primer exclusion")

In obigen Experimenten waren die Primer so gewählt, dass die PNA-Zielsequenz ungefähr in der Mitte des zu amplifizierenden Bereichs lag. Als sensitiver wurde die Anordnung beschrieben, wenn Primer- und PNA-Sequenz aneinander angrenzen bzw. sich überlappen. Bei einer sequenzspezifischen Bindung der PNA müsste bei dieser Anordnung ein Effekt der PNA schon bei geringeren PNA- Konzentrationen zu beobachten sein. In the above experiments, the primers were chosen so that the PNA target sequence approximately in the middle of the amplifying region was. The became more sensitive Arrangement described when primer and PNA sequence adjoin or overlap. At a sequence-specific binding of the PNA would have to Arrangement an effect of PNA even at lower PNA Concentrations can be observed.

Für dieses Experiment wurde ein Primer mit der Sequenz TTATGTGAATTTTGAAAG so gewählt, dass er sich mit der PNA- Sequenz überlappt (primer exclusion). In einen Reaktionsansatz wurden beide 13mer PNAs AAAGACGTGTTAT und AAAGATGTGTTAT in 3 verschiedenen Konzentrationen zugegeben. For this experiment, a primer with the sequence TTATGTGAATTTTGAAAG chosen so that it deals with the PNA Sequence overlaps (primer exclusion). In a Both 13mer PNAs and AAAGACGTGTTAT were reacted AAAGATGTGTTAT in 3 different concentrations added.

Eine vollständige Unterdrückung der PCR Reaktion wurde schon mit einer Konzentration von 25 pmol/µl erzielt. Im vorangegangenen Experiment war eine vollständige Unterdrückung der PCR bei Zugabe beider PNAs erst in einer Konzentration von 70 pmol/µl erkennbar. A complete suppression of the PCR reaction was found already achieved with a concentration of 25 pmol / µl. in the previous experiment was a complete one Suppression of the PCR when adding both PNAs only in a concentration of 70 pmol / µl can be seen.

c) primer exclusion mit nicht methylierter DNA entsprechenden Fragmentenc) primer exclusion with unmethylated DNA corresponding fragments

Für den Nachweis einer sequenzspezifischen Bindung wurde in weiteren Experimenten die Wirkung der PNAs auf hinsichtlich des Methylierungsstatus gut charakterisierten Templaten untersucht. Die für dieses Experiment verwendete Templat DNA entsprach einer bisulfitbehandelten vollständig unmethylierten DNA. Diese wurde als Templat in eine PCR eingesetzt. Dafür wurden die folgenden Programmschritte eingesetzt:
Schritt 1: T = 96°C; 20 min
Schritt 2: T = 96°C; 30 s
Schritt 3: T = 49°C; 1,15 min
Schritt 4: T = 54°C; 2,00 min
Die Schritte 2 bis 4 werden als Zyklus 36 mal durchlaufen.
Schritt 5: T = 72°C; 15 min
Schritt 6: auf 4°C abkühlen und Temperatur halten For the detection of a sequence-specific binding, the effect of the PNAs on templates well characterized with regard to the methylation status was investigated in further experiments. The template DNA used for this experiment corresponded to a bisulfite-treated, completely unmethylated DNA. This was used as a template in a PCR. The following program steps were used for this:
Step 1: T = 96 ° C; 20 min
Step 2: T = 96 ° C; 30 s
Step 3: T = 49 ° C; 1.15 min
Step 4: T = 54 ° C; 2.00 min
Steps 2 to 4 are run 36 times as a cycle.
Step 5: T = 72 ° C; 15 minutes
Step 6: cool to 4 ° C and keep temperature

Zum Reaktionsansatz wurden die 13mer wie oben beschrieben in 3 verschiedenen Konzentrationen zugegeben. In diesem Fall des unmethylierten Templates würde man erwarten, dass die für dieses Templat passende PNA MDR1- 5-FU (3) einen deutlich stärkeren Einfluss als MDR1-5-FM (3) hat. In Fig. 3 (Annotation siehe Fig. 2) ist dargstellt, dass dies auch bei vergleichsweise niedrigen PNA Konzentrationen der Fall ist. The 13mer was added to the reaction mixture in 3 different concentrations as described above. In this case of the unmethylated template, one would expect that the PNA MDR1-5-FU (3) suitable for this template would have a significantly stronger influence than MDR1-5-FM (3). FIG. 3 (annotation see FIG. 2) shows that this is also the case with comparatively low PNA concentrations.

Diese Ergebnisse zeigen, dass die Unterdrückung der PCR Reaktion durch spezifisch bindende PNAs methylierungsspezifische Amplifikationen ermöglicht. In Kontrollexperimenten mit nicht zu MDR-1 komplementären PNAs konnte gezeigt werden, dass diese keinen nennenswerten Einfluss auf die PCR bei den in Frage kommenden Konzentrationen ausüben (nicht gezeigt). These results show that the suppression of the PCR Response by specifically binding PNAs enables methylation-specific amplifications. In Control experiments with MDR-1 not complementary PNAs could be shown to have none significant impact on the PCR in question exert upcoming concentrations (not shown).

Beispiel 2Example 2 Methylierungssensitive Amplifikation eines Fragments des GSTpi GensMethylation sensitive amplification of a Fragments of the GSTpi gene

Bestimmte CpG-Positionen des GSTPi-Genes wurden als Tumormarker für Prostatakrebs identifiziert. Certain CpG positions of the GSTPi gene were identified as Tumor markers identified for prostate cancer.

Bei dem für die Experimente ausgewählten Primerpaar GGAAAGAGGGAAAGGTTTT und TACTAAAAACTCTAAACCCCAT ist ein Primer so lokalisiert, das er genau an die PNA-Sequenz CCCCGAAAACGCG (bzw. CCCTGAAAATGTG) angrenzt. Die PNA- Sequenz umfasst im Unterschied zu den für das MDR1 Fragment verwendeten PNAs nun drei relevante CpG Positionen. With the primer pair selected for the experiments GGAAAGAGGGAAAGGTTTT and TACTAAAAACTCTAAACCCCAT is a Primer localized so that it exactly matches the PNA sequence CCCCGAAAACGCG (or CCCTGAAAATGTG) adjacent. The PNA Sequence differs from that for the MDR1 PNAs now used three relevant CpG fragments Positions.

Die zu untersuchenden relevanten CpGs des GSTPi Fragmentes liegen in "normaler", d. h. nicht von Tumorpatienten stammender DNA nicht methyliert vor. Die zum Reaktionsansatz gegebene PNA "GSTP-down" der Sequenz CCCTGAAAATGTG sollte daher einen erkennbaren Einfluss auf die PCR-Reaktion haben, jedoch nicht die entsprechende PNA "GSTP-up" CCCCGAAAACGCG. The relevant CpGs of the GSTPi to be examined Fragmentes are in "normal", i.e. H. not from DNA from tumor patients is not methylated. The PNA "GSTP-down" of the sequence given for the reaction mixture CCCTGAAAATGTG should therefore have a noticeable impact on have the PCR reaction, but not the corresponding one PNA "GSTP-up" CCCCGAAAACGCG.

Zum Versuchsansatz wurde die PNA "GSTP-down" in drei verschiedenen Konzentrationen zugegeben. Getestet wurde ein Gradient der Annealingtemperatur. Die Ergebnisse des Experimentes sind in Fig. 4 dargestellt. Die stärkste Unterdrückung der PCR durch Zugabe der PNA (GSTP-down) ist bei einer Annealingtemperatur von 55°C feststellbar. Im Vergleich mit der positiven Kontrolle (ohne Zugabe von PNA) ist erkennbar, dass die PCR Reaktion schon durch die Zugabe der PNA in einer Konzentration von 20 mol/µl signifikant unterdrückt werden konnte. The PNA "GSTP-down" was added to the test batch in three different concentrations. A gradient of the annealing temperature was tested. The results of the experiment are shown in Fig. 4. The strongest suppression of the PCR by adding the PNA (GSTP-down) can be determined at an annealing temperature of 55 ° C. In comparison with the positive control (without adding PNA), it can be seen that the PCR reaction could be significantly suppressed even by adding the PNA in a concentration of 20 mol / µl.

Nachfolgend wurde, um eine sequenzspezifische (und damit letztlich methylierungsensitive) Bindung nachzuweisen, der Einfluss der PNAs "GSTP-up" und "GSTP-down" auf die Amplifikationen einer in der ursprünglichen Probe unmethylierten DNA und einer aus einem Prostatatumorgewebe stammenden methylierten DNA als Templat gegenübergestellt. Subsequently, a sequence-specific (and thus ultimately to detect methylation-sensitive binding, the influence of the PNAs "GSTP-up" and "GSTP-down" on the Amplifications of one in the original sample unmethylated DNA and one out of one Prostate tumor tissue-derived methylated DNA as Juxtaposed template.

Die unmethylierte DNA und die Prostata DNA wurden als Templat in eine PCR eingesetzt. Zum Reaktionsansatz wurden die PNAs "GSTP-up" bzw. "GSTP-down" in drei verschiedenen Konzentrationen zugegeben. The unmethylated DNA and the prostate DNA were identified as Template used in a PCR. To the reaction approach the PNAs were "GSTP-up" and "GSTP-down" in three different concentrations added.

Die Zugabe der PNA "GSTP-down" hat auf dem downmethyliertem Templat einen sichtbaren Einfluss: die PCR ist bei Zugabe der PNA in einer Konzentration von 70 pmol/µl vollständig unterdrückt. Bei Zugabe der PNA "GSTP-up" ist dagegen nur ein schwacher, hemmender Einfluss der PNA auf die PCR erkennbar. The addition of the PNA "GSTP-down" has on the downmethylated template a visible influence: the PCR is added at a concentration of 70 pmol / µl completely suppressed. When adding the PNA In contrast, "GSTP-up" is only a weak, inhibitory Influence of the PNA on the PCR can be seen.

Die Zugabe der PNA "GSTP-up" zur Test-DNA aus Prostatagewebe hat einen erheblich hemmenden Einfluss auf die PCR (Fig. 5). Die Zugabe der PNA in einer Konzentration von 20 µmol/µl unterdrückt die PCR schon deutlich. Eine vollständige Unterdrückung der PCR ist bei einer Zugabe der PNA in einer Konzentration von 50 pmol/µl feststellbar. Im Gegensatz dazu hat die Zugabe der PNA "GSTP-down" zur Prostata DNA einen deutlich geringer Einfluss. Auch eine Zugabe der PNA in einer Konzentration von 70 pmol/µl unterdrückt die PCR nicht vollständig. The addition of the PNA "GSTP-up" to the test DNA from prostate tissue has a considerable inhibitory influence on the PCR ( FIG. 5). The addition of the PNA in a concentration of 20 µmol / µl clearly suppresses the PCR. Complete suppression of the PCR can be determined when the PNA is added in a concentration of 50 pmol / µl. In contrast, the addition of the PNA "GSTP-down" to the prostate DNA has a significantly smaller influence. Even adding the PNA in a concentration of 70 pmol / µl does not completely suppress the PCR.

Die Experimente zeigen, dass es möglich ist, mittels blockierender Oligomersonden selektiv die Amplifikation von an definierten Positionen methylierten oder unmethylierten Allelen zu unterdrücken. Im Sinne dieser Erfindung würden die betreffenden Positionen als Qualifier-Positionen dienen, d. h. man würde selektiv die Amplifikation unerwünscht methylierter Template der Hintergrund DNA unterdrücken. The experiments show that it is possible to use blocking oligomer probes selectively amplification of methylated or at defined positions to suppress unmethylated alleles. In the spirit of this Invention would consider the items in question as Qualifier positions serve, d. H. one would selectively Amplification of undesirably methylated templates of the Suppress background DNA.

Beispiel 3Example 3 Verschiedene Möglichkeiten des Einsatzes von methylierungsspezifisch die PCR unterdrückenden Sonden am Beispiel des GSTPi GensDifferent ways of using Methylation-specific probes that suppress PCR on Example of the GSTPi gene

In Fig. 6 sind mehrere Möglichkeiten dargestellt, wie bei einer gegebenen Templatsequenz Primer im Sinne einer methylierungsensitiven Amplifikation anzuordnen sind. Zur Erläuterung zeigt Fig. 6a die nach der Bisulfitbehandlung vorliegenden Template, DNA 1 entsprechend einer ursprünglich methylierten DNA-Probe, DNA 2 entsprechend einer ursprünglich unmethylierten DNA- Probe. In FIG. 6, several options are shown to be arranged as in a given template sequence primer in the sense of a methylation sensitive amplification are. To illustrate, FIG. 6a, the present after the bisulfite treatment template DNA 1 in accordance with an originally methylated DNA sample, DNA 2 corresponding to an originally unmethylated DNA sample.

Fig. 6b zeigt die Anordnung eines der Primer im Sinne einer Allelspezifischen PCR bzw. einer Methylierungsspezifischen PCR (MSP). In diesem Fall würde nur die Amplifikation der methylierten DNA 1 unter Verwendung des gezeigten Primes stattfinden können. Fig. 6b shows the arrangement of one of the primers in the sense of allele-specific PCR and methylation-specific PCR (MSP). In this case only the amplification of the methylated DNA 1 could take place using the prime shown.

Fig. 6c und 6d zeigen, wie entsprechend nicht methylierungsspezifische Primer eingesetzt werden können, entweder durch Verwendung degenerierter Positionen (6c) oder aber universeller Basen (hier Inosin) in Fig. 6d. Fig. 6c and 6d show how methylation specific primers can not be used accordingly, either by use of degenerate positions (6c) or universal bases (here inosine) in Fig. 6d.

In Fig. 7 sind mehrere Möglichkeiten dargestellt, wie bei einer gegebenen Templatsequenz Primer und Sonden ("Blocker") im Sinne einer methylierungsensitiven Amplifikation anzuordnen sind. In diesen Beispielen sind die verwendeten Primer nicht selbst methylierungsspezifisch, Sonden die Methylierungsspezifität wird allein durch die Sonden ("Blocker") erreicht. Für DNA 1 und DNA 2 werden jeweils spezifische Sonden als Blocker eingesetzt. Are shown in Fig. 7 are shown a number of ways, such as at a given template sequence primers and probes ( "blockers") to be arranged in the sense of a methylation sensitive amplification. In these examples, the primers used are not themselves methylation-specific, probes the methylation specificity is achieved solely by the probes (“blockers”). Specific probes are used as blockers for DNA 1 and DNA 2.

In Fig. 7a überlappen Primer und Sonde nicht, sondern die Sonde schliesst sich unmittelbar an das 3'-Ende des Primers an. Die dargestellte Sonde ist ein am 3'-Ende modifiziertes Oligonukleotid, das in der Amplifikation nicht selbst verlängert werden kann. Analog können auch PNAs verwendet werden, die in diesem Beispiel jedoch entsprechend ihrer Schmelztemperatur kürzer sein müssten. In Fig. 7b wird der gleiche Primer eingesetzt, jedoch überlappt hier die DNA-Sonde mit dem Primer (Primer Exclusion). In Fig. 7a, primer and probe do not overlap, but the probe immediately adjoins the 3 'end of the primer. The probe shown is an oligonucleotide modified at the 3 'end, which cannot be extended in the amplification itself. Analogously, PNAs can also be used, which in this example, however, would have to be shorter according to their melting temperature. The same primer is used in FIG. 7b, but here the DNA probe overlaps with the primer (primer exclusion).

In Fig. 7c und 7d überlappen ein mit degenerierten Positionen versehener Primer und die methylierungsspezifische Sonde. Analog sind auch universelle Basen in den Primern einsetzbar. In Figures 7c and 7d, a degenerate position primer and the methylation specific probe overlap. Analogously, universal bases can also be used in the primers.

In Fig. 8 ist analog ein Beispiel mit Foward und Reverse-Primer dargestellt, in dem eine Sonde verwendet wird, die mit keinem der Primer überlappt. In FIG. 8, an example using foward and reverse primers is analogous shown, is used in which a probe that overlaps with any of the primers.

Diese Beispiele sollen die zahlreichen Möglichkeiten veranschaulichen, wie Oligomersonden zur methylierungsspezifischen Amplifikation eingesetzt werden können, um Hintergrund DNA gegenüber der zu analysierenden DNA zu unterdrücken. Der Umfang der Erfindung soll sich jedoch nicht auf die hier beispielhaft angeführten Ausführungen beschränken. These examples are intended to illustrate the numerous possibilities illustrate how oligomer probes are used methylation-specific amplification can be used can to DNA against the background too to suppress analyzing DNA. The scope of the Invention, however, is not intended to be exemplary here restrict the statements made.

Beispiel 4Example 4 Herstellung von nicht- und aufmethylierter DNA und Bisulphit-BehandlungProduction of non-methylated and methylated DNA and bisulphite treatment

Für die Herstellung aufmethylierter DNA wurden humane genomische DNA mit S-Adenosylmethion und der CpG Methylase (SssI, New England Biolabs) nach Angaben des Herstellers behandelt. Für die Herstellung nichtmethylierter DNA wurde das Genfragment ELK-1 mit den Primern GCTCTATGGTCTTGTCTAACCGTA (SEQ-ID: 1) und AGGTGGTGGTGGCGGTGG (SEQ-ID: 2) ausgehend von humaner genomischer DNA, mittels PCR amplifiziert. Die so hergestellte nicht- und aufmethylierte DNA, wie auch humane genomische DNA, wurde unter Verwendung von Bisulphit (Hydrogensulfit, Disulfit) derart behandelt, dass alle nicht an der 5-Position der Base methylierten Cytosine so verändert werden, dass eine hinsichtlich dem Basenpaarungsverhalten unterschiedliche Base entsteht, während die in 5-Position methylierten Cytosine unverändert bleiben. Wird für die Reaktion Bisulfit im Konzentrationsbereich zwischen 0.1 Mol und 6 Mol verwendet, so findet an den nicht methylierten Cytosinbasen eine Addition statt. Zudem müssen ein denaturierendes Reagenz oder Lösungsmittel sowie ein Radikalfänger zugegen sein. Eine anschließende alkalische Hydrolyse führt dann zur Umwandlung von nicht methylierten Cytosin-Nukleobasen in Uracil. Diese umgewandelte DNA dient dazu, methylierte Cytosine nachzuweisen. Human beings were used for the production of methylated DNA genomic DNA with S-adenosylmethion and the CpG Methylase (SssI, New England Biolabs) according to the Manufacturer treats. For the production the non-methylated DNA gene fragment ELK-1 with the Primers GCTCTATGGTCTTGTCTAACCGTA (SEQ ID: 1) and AGGTGGTGGTGGCGGTGG (SEQ ID: 2) starting from human genomic DNA, amplified by PCR. The so produced unmethylated and methylated DNA as well human genomic DNA, was made using Bisulfite (hydrogen sulfite, disulfite) treated in such a way that all were not methylated at the 5-position of the base Cytosine be changed so that one with regard to Base pairing behavior different base arises, while the 5-position methylated cytosines remain unchanged. For the reaction bisulfite in Concentration range between 0.1 mol and 6 mol used, takes place on the unmethylated Cytosine bases an addition instead. In addition, a denaturing reagent or solvent and a Radical scavengers are present. A subsequent alkaline Hydrolysis then does not lead to the conversion of methylated cytosine nucleobases in uracil. This converted DNA serves to methylated cytosines demonstrated.

Beispiel 5Example 5 Herstellung der Cy5-markierten GensondenProduction of the Cy5-labeled gene probes

Ausgehend von den Bisulphit behandelten DNA Proben wird je ein definiertes Fragment der Länge 595 bp aus der Promotorregion des ELK-1 Gens amplifiziert. Die Amplifikation wird mit den Primeroligonukleotiden ATGGTTTTGTTTAATYGTAGAGTTGTTT (SEQ-ID: 3) und TAAACCCRAAAAAAAAAAACCCAATAT (SEQ-ID: 4) durchgeführt. Durch Verwenden von Primeroligonukleotiden, die mit dem Fluoreszenfarbstoff Cy5 markiert sind, wird das Fragment direkt bei der PCR markiert. Als Matrix DNA wird Bisulphit (Hydrogensulfit, Disulfit) behandelte (1) nichtmethylierte, (2) aufmethylierte und (3) humane genomische DNA verwendet. Anschließend werden diese drei unterschiedlichen DNA-Fragmente in getrennten Hybridisierungen auf ihren Methylierungsgrad an einer spezifischen CpG Position untersucht. Starting from the bisulphite treated DNA samples each a defined fragment of length 595 bp from the Promoter region of the ELK-1 gene amplified. The Amplification is done with the primer oligonucleotides ATGGTTTTGTTTAATYGTAGAGTTGTTT (SEQ ID: 3) and TAAACCCRAAAAAAAAAAACCCAATAT (SEQ ID: 4). By using primer oligonucleotides that match the Fluorescent dye Cy5 are labeled, the fragment marked directly at the PCR. As matrix is DNA Bisulfite (hydrogen sulfite, disulfite) treated (1) unmethylated, (2) methylated and (3) human genomic DNA used. Then these three different DNA fragments in separate Hybridizations on their degree of methylation on one specific CpG position examined.

Beispiel 6Example 6

Durchführung der Hybridisierung und Auswertung eines hybridisierten DNA-"Chip"Implementation of hybridization and Evaluation of a hybridized DNA "chip"

Die in Beispiel 5 hergestellten Gensonden werden auf einem DNA Chip hybridisiert. Auf dem Chip sind zuvor Oligonukleotide immobilisiert worden. Die Oligonukleotidesequenzen leiten sich von dem in Beispiel 2 genannten amplifizierten Fragment des Gens ELK-1 ab, und repräsentierten die CG Dinukleotide, die unmittelbare Umgebung einschließend. Die Länge der Oligonukleotide beträgt 14-22 Nukleotide, die Position des CG Dinukleotides innerhalb der Oligonukleotide ist variabel. Nach der Hybridisierung wird der DNA Chip gescannt (siehe Fig. 1) und die Hybridisierungssignale numerisch ausgewertet (Daten nicht gezeigt). Das Ergebnis der Hybridisierung für die Oligonukleotide CTACTCAACGAAAACAAA (SEQ-ID: 5) und CTACTCAACAAAAACAAA (SEQ-ID: 6) wird in Fig. 1 gezeigt. Hierbei hybridisiert CTACTCAACGAAAACAAA (SEQ-ID: 5) bevorzugt, wenn das zu Cytosin des ELK-1 Fragments, welches sich an Position 103 des Amplifikates befindet, methyliert ist, CTACTCAACAAAAACAAA (SEQ-ID: 6) wenn dieses Cytosin nicht methyliert ist. The gene probes produced in Example 5 are hybridized on a DNA chip. Oligonucleotides have previously been immobilized on the chip. The oligonucleotide sequences are derived from the amplified fragment of the ELK-1 gene mentioned in Example 2 and represent the CG dinucleotides, including the immediate surroundings. The length of the oligonucleotides is 14-22 nucleotides, the position of the CG dinucleotide within the oligonucleotides is variable. After the hybridization, the DNA chip is scanned (see FIG. 1) and the hybridization signals are evaluated numerically (data not shown). The result of the hybridization for the oligonucleotides CTACTCAACGAAAACAAA (SEQ-ID: 5) and CTACTCAACAAAAACAAA (SEQ-ID: 6) is shown in FIG. 1. Here, CTACTCAACGAAAACAAA (SEQ-ID: 5) hybridizes preferentially if that is methylated to cytosine of the ELK-1 fragment, which is located at position 103 of the amplified product, CTACTCAACAAAAACAAA (SEQ-ID: 6) if this cytosine is not methylated.

In Fig. 1 ist ein DNA Chip nach Hybridisierung mit dem Promotor Fragment dargestellt. Dargestellt ist das Falschfarben-Bild wie es nach dem Scannen erzeugt wird. Entgegen der hier dargestellten schwarzweiß Abbildung wird von dem Scanner ein farbiges Bild erzeugt. Die Intensität der verschiedenen Farben repräsentiert den Grad der Hybridisierung, wobei der Hybridisierungsgrad von rot (in Fig. 1 als helle Spots zu erkennen) nach blau (in Fig. 1 als dunkle Spots zu erkennen) abnimmt. SEQUENZPROTOKOLL





In Fig. 1, a DNA chip after hybridization is shown with the promoter fragment. The false color image is shown as it is generated after scanning. Contrary to the black and white image shown here, the scanner creates a color image. The intensity of the different colors represents the degree of hybridization, the degree of hybridization decreasing from red (in FIG. 1 as bright spots) to blue (in FIG. 1 as dark spots). SEQUENCE LISTING





Claims (34)

1. Verfahren zum Nachweis von Cytosin-Methylierung in DNA-Proben, dadurch gekennzeichnet, dass man die folgenden Schritte ausführt:
man behandelt eine genomische DNA-Probe, welche zu untersuchende DNA und Hintergrund-DNA DNA umfasst, chemisch derart, dass alle nicht methylierten Cytosinbasen in Uracil umgewandelt werden, während die 5-Methylcytosinbasen unverändert bleiben,
man amplifiziert die chemisch behandelte DNA-Probe unter Verwendung von mindestens 2 Primeroligonukleotiden sowie einer Polymerase, wobei die zu untersuchende DNA gegenüber der Hintergrund- DNA als Templat bevorzugt wird und
man analysiert die Amplifikate und schließt aus dem Vorliegen eines Amplifikates und/oder aus der Analyse weiterer Positionen auf den Methylierungsstatus in der zu untersuchenden DNA. 1. A method for the detection of cytosine methylation in DNA samples, characterized in that the following steps are carried out:
a genomic DNA sample, which comprises the DNA to be examined and background DNA DNA, is chemically treated in such a way that all unmethylated cytosine bases are converted into uracil, while the 5-methylcytosine bases remain unchanged,
the chemically treated DNA sample is amplified using at least 2 primer oligonucleotides and a polymerase, the DNA to be examined being preferred over the background DNA as a template and
one analyzes the amplificates and concludes from the presence of an amplificate and / or from the analysis of further positions on the methylation status in the DNA to be examined. 2. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man die Proben DNA aus Serum oder anderen Körperflüssigkeiten eines Individuums gewinnt. 2. The method according to claim 1, characterized in that that you can sample DNA from serum or other An individual's body fluids wins. 3. Verfahren nach Anspruch 1, dadurch gekennzeichnet, dass man die Proben DNA aus Zellinien, Blut, Sputum, Stuhl, Urin, Serum, Gehirn-Rückenmarks-Flüssigkeit, in Paraffin einbettetem Gewebe, beispielsweise Gewebe von Augen, Darm, Niere, Hirn, Herz, Prostata, Lunge, Brust oder Leber, histologischen Objektträgern und allen möglichen Kombinationen hiervon gewinnt. 3. The method according to claim 1, characterized in that the DNA samples from cell lines, blood, sputum, Stool, urine, serum, brain spinal fluid, tissue embedded in paraffin, for example tissue of eyes, intestines, kidneys, brain, heart, prostate, lungs, Breast or liver, histological slides and all possible combinations of these wins. 4. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass man die chemische Behandlung mit einem Bisulfit (= Disulfit, Hydrogensulfit) durchführt. 4. The method according to any one of the preceding claims, characterized in that the chemical Treatment with a bisulfite (= disulfite, Hydrogen sulfite) is carried out. 5. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass die chemische Behandlung nach Einbetten der DNA in Agarose erfolgt. 5. The method according to claim 4, characterized in that chemical treatment after embedding the DNA done in agarose. 6. Verfahren nach Anspruch 4, dadurch gekennzeichnet, dass bei der chemischen Behandlung ein die DNA-Duplex denaturierendes Reagenz und/oder ein Radikalfänger zugegen ist. 6. The method according to claim 4, characterized in that in chemical treatment a DNA duplex denaturing reagent and / or a radical scavenger is present. 7. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass man die Amplifikation im zweiten Schritt in Gegenwart mindestens eines weiteren Oligonukleotids oder eines PNA-Oligomers durchführt, welches an ein 5'-CG-3'-Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5'-CA-3'- Dinukleotid bindet, wobei das weitere Oligonukleotid oder PNA-Oligomer bevorzugt an die Hintergrund-DNA bindet und deren Amplifikation beeinträchtigt. 7. The method according to any one of the preceding claims, characterized in that the amplification in second step in the presence of at least one further oligonucleotide or a PNA oligomer which is attached to a 5'-CG-3'-dinucleotide or a 5'-TG-3'-dinucleotide or a 5'-CA-3'- Dinucleotide binds, with the further oligonucleotide or PNA oligomer preferably to the background DNA binds and affects their amplification. 8. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass man die chemisch behandelte DNA-Probe im zweiten Schritt unter Verwendung von mindestens 2 Primeroligonukleotiden und einem weiteren Oligonukleotid oder PNA-Oligomer, welches an ein 5'-CG-3'-Dinukleotid oder ein 5'-TG- 3'-Dinukleotid oder ein 5'-CA-3'-Dinukleotid hybridisiert, und mindestens einem Reporteroligonukleotid, welches an ein 5'-CG-3'- Dinukleotid oder ein 5'-TG-3'-Dinukleotid oder ein 5'-CA-3'-Dinukleotid hybridisiert, sowie einer Polymerase amplifiziert; wobei das weitere Oligonukleotid oder PNA-Oligomer bevorzugt an die Hintergrund-DNA bindet und deren Amplifikation beeinträchtigt, und wobei das Reporteroligonukleotid bevorzugt an die zu untersuchende DNA bindet und deren Amplifikation anzeigt. 8. The method according to any one of the preceding claims, characterized in that the chemically treated DNA sample in the second step below Use of at least 2 primer oligonucleotides and another oligonucleotide or PNA oligomer, which is attached to a 5'-CG-3'-dinucleotide or a 5'-TG- 3'-dinucleotide or a 5'-CA-3'-dinucleotide hybridizes, and at least one Reporter oligonucleotide attached to a 5'-CG-3'- Dinucleotide or a 5'-TG-3 'dinucleotide or a 5'-CA-3 'dinucleotide hybridized, as well as one Amplified polymerase; being the further Oligonucleotide or PNA oligomer preferred to the Background DNA binds and their amplification impaired, and being the reporter oligonucleotide binds preferentially to the DNA to be examined and indicates their amplification. 9. Verfahren nach Anspruch 8, dadurch gekennzeichnet, dass man zusätzlich zu dem Reporteroligonukleotid ein weiteres mit einem Fluoreszenzfarbstoff markiertes Oligomer verwendet, welches unmittelbar benachbart zu dem Reporteroligonukleotid hybridisiert und sich diese Hybridisierung mittels Fluoreszenz Resonanz Energietransfer nachweisen lässt. 9. The method according to claim 8, characterized in that one in addition to the reporter oligonucleotide another marked with a fluorescent dye Oligomer used, which is immediately adjacent to hybridizes to the reporter oligonucleotide and itself this hybridization using fluorescence resonance Evidence of energy transfer. 10. Verfahren nach einem der Ansprüche 8 oder 9, dadurch gekennzeichnet, dass ein Taqman-Assay durchgeführt wird. 10. The method according to any one of claims 8 or 9, characterized characterized that a Taqman assay was performed becomes. 11. Verfahren nach einem der Ansprüche 8 oder 9, dadurch gekennzeichnet, dass ein Lightcycler Assay durchgeführt wird. 11. The method according to any one of claims 8 or 9, characterized characterized that a lightcycler assay is carried out. 12. Verfahren nach einem der Ansprüche 7 bis 11, dadurch gekennzeichnet, dass die zusätzlich zu den Primern verwendeten Oligonukleotide nicht über eine 3'-OH Funktion verfügen. 12. The method according to any one of claims 7 to 11, characterized characterized that in addition to the primers oligonucleotides did not have a 3'-OH Function. 13. Verfahren nach einem der Ansprüche 8 bis 12, dadurch gekennzeichnet, dass die Reporteroligonukleotide mindestens eine Fluoreszenzmarkierung tragen. 13. The method according to any one of claims 8 to 12, characterized characterized that the reporter oligonucleotides wear at least one fluorescent label. 14. Verfahren nach einem der Ansprüche 8 bis 13, dadurch gekennzeichnet, dass die Reportermoleküle die Amplifikation entweder durch eine Zunahme oder eine Abnahme der Fluoreszenz anzeigen. 14. The method according to any one of claims 8 to 13, characterized characterized that the reporter molecules the Amplification by either an increase or a Show decrease in fluorescence. 15. Verfahren nach Anspruch 14, dadurch gekennzeichnet, dass man die Zunahme oder Abnahme der Fluoreszenz auch direkt zur Analyse verwendet und aus dem Fluorenzenzsignal auf einen Methylierungszustand der zu analysierenden DNA schließt. 15. The method according to claim 14, characterized in that one can see the increase or decrease in fluorescence also used directly for analysis and from the Fluorescence signal to a methylation state of DNA to be analyzed includes. 16. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Hintergrund-DNA in 100 facher Konzentration im Vergleich zur zu untersuchenden DNA vorliegt. 16. The method according to any one of the preceding claims, characterized in that the background DNA in 100 times the concentration compared to the investigating DNA is present. 17. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Hintergrund-DNA in 1000 facher Konzentration im Vergleich zur zu untersuchenden DNA vorliegt. 17. The method according to any one of the preceding claims, characterized in that the background DNA in 1000 times the concentration compared to the investigating DNA is present. 18. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Analyse, oder im Falle eines Verfahrens nach einem der Ansprüche 6 bis 11, die weitere Analyse mittels Hybridisierung an Oligomer-Arrays erfolgt, wobei Oligomere Nukleinsäuren oder in ihren Hybridisierungseigenschaften ähnliche Moleküle wie PNAs sein können. 18. The method according to any one of the preceding claims, characterized in that the analysis, or in In the case of a method according to one of claims 6 to 11, further analysis using hybridization Oligomer arrays are made using oligomers Nucleic acids or in their Hybridization properties similar molecules as Can be PNAs. 19. Verfahren nach Anspruch 18, dadurch gekennzeichnet, dass die Oligomere über einen 12-22 Basen langen Abschnitt an die zu analysierende DNA hybridisieren und sie ein CG, TG oder CA Dinukleotid umfassen. 19. The method according to claim 18, characterized in that the oligomers are 12-22 bases long Hybridize section to the DNA to be analyzed and they comprise a CG, TG or CA dinucleotide. 20. Verfahren nach einem der Ansprüche 18 oder 19, dadurch gekennzeichnet, dass der Methylierungsstatus von mehr als 20 Methylierungspositionen der zu analysierenden DNA in einem Experiment nachgewiesen wird. 20. The method according to any one of claims 18 or 19, characterized in that the methylation status of more than 20 methylation positions analyzing DNA detected in an experiment becomes. 21. Verfahren nach einem der Ansprüche 18 oder 19, dadurch gekennzeichnet, dass der Methylierungsstatus von mehr als 60 Methylierungspositionen der zu analysierenden DNA in einem Experiment nachgewiesen wird. 21. The method according to any one of claims 18 or 19, characterized in that the methylation status of more than 60 methylation positions analyzing DNA detected in an experiment becomes. 22. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekennzeichnet, dass die Analyse, oder im Falle der Ansprüche 8 bis 12, die weitere Analyse durch Längenmessung der amplifizierten zu untersuchenden DNA erfolgt, wobei Methoden zur Längenmessung Gelelektrophorese, Kapillargelelektrophorese, Chromatographie (z. B. HPLC), Massenspektrometrie und andere geeignete Methoden umfassen. 22. The method according to any one of claims 1 to 17, characterized characterized that the analysis, or in the case of Claims 8 to 12, further analysis by Length measurement of the amplified to be examined DNA is done using methods of length measurement Gel electrophoresis, capillary gel electrophoresis, Chromatography (e.g. HPLC), mass spectrometry and include other suitable methods. 23. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekennzeichnet, dass die Analyse, oder im Falle der Ansprüche 8 bis 12, die weitere Analyse durch Seguenzierung erfolgt, wobei Methoden zur Seguenzierung die Sanger-Methode, Maxam-Gilbert- Methode und andere Methoden wie Sequencing by Hybridisation (SBH) umfassen. 23. The method according to any one of claims 1 to 17, characterized characterized that the analysis, or in the case of Claims 8 to 12, further analysis by Segregation takes place using methods for Segregation of the Sanger Method, Maxam-Gilbert- Method and other methods like sequencing by Hybridization (SBH) include. 24. Verfahren nach Anspruch 23, dadurch gekennzeichnet, dass man die Sequenzierung für jede oder eine kleine Gruppe von CpG Positionen mit jeweils einem separaten Primeroligonukleotid ausführt und die Verlängerung der Primer nur eine oder einige wenige Basen ausmacht, und man aus der Art der Primerverlängerung auf den Methylierungsstatus der betreffenden Positionen in der zu untersuchenden DNA schließt. 24. The method according to claim 23, characterized in that you can do sequencing for everyone or a small one Group of CpG positions, each with a separate one Primer oligonucleotide executes and the extension the primer only one or a few bases matters, and you from the type of primer extension on the methylation status of those concerned Positions in the DNA to be examined closes. 25. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass man aus dem Methylierungsgrad an den verschiedenen untersuchten CpG Positionen auf das Vorliegen einer Erkankung oder eines anderen medizinischen Zustandes des Patienten schließt. 25. The method according to any one of the preceding claims, characterized in that from the Degree of methylation in the various investigated CpG positions on the presence of a disease or of another medical condition of the patient closes. 26. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass die Amplifikate selbst für die Detektion mit einer nachweisbaren Markierung versehen sind. 26. The method according to any one of the preceding claims, characterized in that the amplificates themselves for detection with a detectable label are provided. 27. Verfahren nach Anspruch 26, dadurch gekennzeichnet, dass die Markierungen Fluoreszenzmarkierungen sind. 27. The method according to claim 26, characterized in that that the labels are fluorescent labels. 28. Verfahren nach Anspruch 26, dadurch gekennzeichnet, dass die Markierungen Radionuklide sind. 28. The method according to claim 26, characterized in that that the labels are radionuclides. 29. Verfahren nach Anspruch 26, dadurch gekennzeichnet, dass die Markierungen ablösbare Massenmarkierungen sind, die in einem Massenspektrometer nachgewiesen werden. 29. The method according to claim 26, characterized in that that the markings removable mass markings are detected in a mass spectrometer become. 30. Verfahren nach einem der voranstehenden Ansprüche, dadurch gekennzeichnet, dass bei der Amplifikation einer der Primer an eine Festphase gebunden ist. 30. The method according to one of the preceding claims, characterized in that in the amplification one of the primers is bound to a solid phase. 31. Verfahren nach einem der Ansprüche 1 bis 17, dadurch gekennzeichnet, dass die Amplifikate insgesamt im Massenspektrometer nachgewiesen werden und somit durch ihre Masse eindeutig charakterisiert sind. 31. The method according to any one of claims 1 to 17, characterized characterized that the amplificates in total Mass spectrometer can be detected and thus are clearly characterized by their mass. 32. Verwendung eines Verfahrens nach einem der voranstehenden Ansprüche zur Diagnose und/oder Prognose nachteiliger Ereignisse für Patienten oder Individuen, wobei diese nachteiligen Ereignisse mindestens einer der folgenden Kategorien angehören:
unerwünschte Arzneimittelwirkungen; Krebserkrankungen; CNS-Fehlfunktionen, Schäden oder Krankheit; Aggressionssymptome oder Verhaltensstörungen; klinische, psychologische und soziale Konsequenzen von Gehirnschädigungen; psychotische Störungen und Persönlichkeitsstörungen; Demenz und/oder assoziierte Syndrome; kardiovaskuläre Krankheit, Fehlfunktion und Schädigung; Fehlfunktion, Schädigung oder Krankheit des gastrointestinalen Traktes; Fehlfunktion, Schädigung oder Krankheit des Atmungssystems; Verletzung, Entzündung, Infektion, Immunität und/oder Rekonvaleszenz; Fehlfunktion, Schädigung oder Krankheit des Körpers als Abweichung im Entwicklungsprozess; Fehlfunktion, Schädigung oder Krankheit der Haut, der Muskeln, des Bindegewebes oder der Knochen; endokrine und metabolische Fehlfunktion, Schädigung oder Krankheit; Kopfschmerzen oder sexuelle Fehlfunktion. 32. Use of a method according to one of the preceding claims for the diagnosis and / or prognosis of adverse events for patients or individuals, wherein these adverse events belong to at least one of the following categories:
adverse drug effects; Cancers; CNS malfunction, damage or illness; Symptoms of aggression or behavioral disorders; clinical, psychological and social consequences of brain damage; psychotic disorders and personality disorders; Dementia and / or associated syndromes; cardiovascular disease, malfunction and damage; Malfunction, damage or disease of the gastrointestinal tract; Malfunction, damage or disease of the respiratory system; Injury, inflammation, infection, immunity and / or convalescence; Malfunction, damage or illness of the body as a deviation in the development process; Malfunction, damage or disease of the skin, muscles, connective tissue or bones; endocrine and metabolic dysfunction, injury or illness; Headache or sexual malfunction. 33. Verwendung eines Verfahrens nach einem der voranstehenden Ansprüche zur Unterscheidung von Zelltypen oder Geweben oder zur Untersuchung der Zelldifferenzierung. 33. Use of a method according to one of the preceding claims to distinguish from Cell types or tissues or to study the Cell differentiation. 34. Kit, bestehend aus einem Bisulfit enthaltenen Reagenz, Primern und weiteren Oligonuleotiden ohne 3'-OH Funktion zur Herstellung der Amplifikate, sowie optional einer Anleitung zur Durchführung eines Assays nach einem der Ansprüche 1-31. 34. Kit consisting of a bisulfite contained Reagent, primers and other oligonucleotides without 3'-OH function for the production of the amplificates, and optional instructions for performing a Assays according to any one of claims 1-31.
DE10158283A 2001-03-09 2001-11-19 Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA Withdrawn DE10158283A1 (en)

Priority Applications (23)

Application Number Priority Date Filing Date Title
DE10112515A DE10112515B4 (en) 2001-03-09 2001-03-09 Method for the detection of cytosine methylation patterns with high sensitivity
DE10158283A DE10158283A1 (en) 2001-11-19 2001-11-19 Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA
AU2002253108A AU2002253108B2 (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
KR1020037011825A KR100839984B1 (en) 2001-03-09 2002-03-08 Highly sensitive method for the detection of cytosine methylation patterns
PCT/EP2002/002572 WO2002072880A2 (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
DE50210199T DE50210199D1 (en) 2001-03-09 2002-03-08 PROCESS FOR DETECTING CYTOSINE METHYLATION PATTERNS WITH HIGH SENSITIVITY
JP2002571930A JP4484431B2 (en) 2001-03-09 2002-03-08 Sensitive detection of cytosine methylation
NZ538608A NZ538608A (en) 2001-03-09 2002-03-08 Detecting cytosine methylation in genomic DNA samples in which all unmethylated cytosine bases are converted to uracil and the 5-methylcytosine bases remain unchanged
DK02722194T DK1370691T3 (en) 2001-03-09 2002-03-08 Method for detecting high sensitivity cytosine methylation patterns
IL15708002A IL157080A0 (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
EP06077160A EP1818414A3 (en) 2001-03-09 2002-03-08 Method for detecting cytosine-methylation patterns with high sensitivity
CA2435917A CA2435917C (en) 2001-03-09 2002-03-08 Highly sensitive method for the detection of cytosine methylation patterns
AT02722194T ATE362995T1 (en) 2001-03-09 2002-03-08 METHOD FOR DETECTING CYTOSINE METHYLATION PATTERNS WITH HIGH SENSITIVITY
NZ527350A NZ527350A (en) 2001-03-09 2002-03-08 Detecting cytosine methylation in genomic DNA samples in which all unmethylated cytosine bases are converted to uracil and the 5-methylcytosine bases remain unchanged
CNB028055071A CN100347314C (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
RU2003126575/13A RU2332462C2 (en) 2001-03-09 2002-03-08 Method of cytosine methylation detection in dna samples
EP02722194A EP1370691B1 (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
ES02722194T ES2287269T3 (en) 2001-03-09 2002-03-08 PROCEDURE FOR THE DETECTION OF METHODS OF METHYLATION OF CITOSINE, WITH HIGH SENSITIVITY.
PT02722194T PT1370691E (en) 2001-03-09 2002-03-08 Method for detecting cytosine methylation patterns having high sensitivity
US10/229,370 US7229759B2 (en) 2001-03-09 2002-08-27 Highly sensitive method for the detection of cytosine methylation patterns
IS6887A IS6887A (en) 2001-03-09 2003-07-24 A method for detecting cytosine methylation patterns that are highly sensitive
HK05102135A HK1069604A1 (en) 2001-03-09 2005-03-11 Method for detecting cytosine methylation patternshaving high sensitivity
US12/287,668 US20120107807A1 (en) 2001-03-09 2007-06-11 Highly sensitive method for the detection of cytosine methylation patterns

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
DE10158283A DE10158283A1 (en) 2001-11-19 2001-11-19 Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA

Publications (1)

Publication Number Publication Date
DE10158283A1 true DE10158283A1 (en) 2003-05-28

Family

ID=7707207

Family Applications (1)

Application Number Title Priority Date Filing Date
DE10158283A Withdrawn DE10158283A1 (en) 2001-03-09 2001-11-19 Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA

Country Status (1)

Country Link
DE (1) DE10158283A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10329240A1 (en) * 2003-06-24 2005-01-20 Epigenomics Ag Method for analyzing the cytosine methylation status of cancer testis antigens for individualized immunotherapy

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE10329240A1 (en) * 2003-06-24 2005-01-20 Epigenomics Ag Method for analyzing the cytosine methylation status of cancer testis antigens for individualized immunotherapy

Similar Documents

Publication Publication Date Title
DE10112515B4 (en) Method for the detection of cytosine methylation patterns with high sensitivity
EP1423533B1 (en) Method for high sensitivity detection of cytosine-methylation
EP1423528B1 (en) Method for determining the degree of methylation of defined cytosines in genomic dna in the sequence context 5'-cpg-3'
DE10201138A1 (en) Method for the detection of cytosine methylation patterns by exponential ligation of hybridized probe oligonucleotides
DE60305150T2 (en) QUANTITATIVE DETECTION OF METHYLATION IN DNA SAMPLES
DE10151055B4 (en) Method for detecting cytosine methylation in CpG islands
DE60029323T3 (en) METHOD FOR ANALYZING DNA METHYLATION AT HIGH RATE OF PURCHASE
EP1654388B1 (en) Method for the detection of cytosine methylations in dna
DE10154317B4 (en) Method for the detection of cytosine methylations in immobilized DNA samples
DE10132212B4 (en) Method for the detection of cytosine methylation by comparative analysis of the single strands of amplicons
DE10128508A1 (en) Methods and nucleic acids for the differentiation of prostate tumors
EP1853724B1 (en) Method for investigating cytosine methylations in dna
DE10304219B3 (en) Method for the detection of cytosine methylation patterns with high sensitivity
EP1339873B1 (en) Diagnosis of diseases associated with the human c-mos gene
EP1711628B1 (en) Method for the calibration and verification of methylation analysis methods with the aid of non-methylated dna
DE10132211A1 (en) Detection of specific dinucleotides in DNA samples by fluorescence resonance energy transfer (FRET)
DE10158283A1 (en) Detecting methylation status of test DNA in a mixture, useful for diagnosis and prognosis of disease, comprises bisulfite treatment then selective amplification of test DNA
EP1432827B1 (en) Method for detecting dna methylation using labelled s-adenosylmethionine analogs
DE10044543C2 (en) Method for determining the degree of methylation of certain cytosines in genomic DNA in the context of 5'-CpG-3 '
DE10164501A1 (en) Methods and nucleic acids for the analysis of a lymphoid cell division disorder
DE10255104A1 (en) Methods and nucleic acids for the analysis of proliferative diseases of breast cells
DE10065814A1 (en) Methods for the simultaneous amplification of many sequences in a PCR reaction and their labeling

Legal Events

Date Code Title Description
8139 Disposal/non-payment of the annual fee