DE10155841A1 - MCH receptor interacting zinc finger protein - Google Patents

Abstract

The invention concerns a novel multifunctional human protein which interacts with the melanin-concentrating hormone receptor (MCH-R), as well as derivatives, homologues and fragments of said protein. The invention also concerns a polynucleotide encoding said protein or said polypeptide.

Description

The present invention relates to a new, human, multifunctional protein that works with the melanin-concentrating hormone Receptor (MCH-R) interacts, including derivatives, homologs and fragments of the same. The invention further relates to a Polynucleotide for the aforementioned protein or polypeptide coded.

A number of peptide hormones, such as, for example, are involved in the regulation of energy balance and appetite behavior. B. leptin, neuropeptide Y (NPY) or α-MSH with different functions involved (see. Fig. 1). So z. B. Lack of energy to decrease the expression of the saturation signal leptin in adipose tissue (see Ref. 1-3). Less leptin reaches the hypothalamic nucleus via the bloodstream and the blood-brain barrier. In response, the expression rate of the orexigenic (orexis = appetizing) NPY increases in the nucleus arcuatus, while that of the anorexigenic (anorexis = appetite-reducing) α-MSH decreases. Projections of the NPY and α-MSH expressing neurons reach MCH expressing neurons in the lateral hypothalamic area. NPY has a stimulating effect there, while α-MSH inhibits the expression rate of the orexigenic neuropeptide MCH. The decrease in leptin thus leads to an increase in the expression rate of MCH via the increase in NPY and decrease in α-MSH. MCH-expressing neurons project into many areas of the brain (cortex, hippocampus, olfactory areas, cerebellum, etc.) and use the MCH-R to activate various behavior patterns that lead to an increase in food intake.

After sufficient food intake, the Leptin concentration and thus the α-MSH expression - at the same time NPY expression off; thereby less MCH is expressed, what in turn signals the body to stop eating reduce (see Ref. 1-3). Starving rats or obese, Leptin-deficient mice (ob / ob) (Ref. 4, 7) therefore have one increased MCH expression. The same was done for the MCH-R observed its expression in starving and Leptin-deficient mice are greatly increased (Ref. 5); the underlying Mechanism of leptin-dependent regulation of MCH-R expression is so far unknown, as is MCH-R's received signal intracellularly and at what level Signal chain could be modulated. A lack of MCH, as in the Mouse through an experimentally generated zero mutation of the MCH gene generated leads to an anorexia-like phenotype (Ref. 6). Conversely, an increased concentration of MCH, e.g. B. by intracerebroventricular injection of the peptide in rats or by overexpression in transgenic mice to increase of eating behavior and a obesity-like phenotype (Ref. 7-9).

Because on the one hand the MCH / MCH-R system is of significant importance in the regulation of appetite behavior and thus endogenous Energy budget, but little about the other MCH-mediated signal transduction chain is known Object of the present invention in the identification of Interaction partners of the MCH-R. The identification of such Proteins and its possible regulation represents considerable pharmacological interest to develop new approaches to Track influencing appetite behavior.

According to the invention, the object is achieved by a new, humane, multifunctional protein dissolved, which is an MCH receptor interacting zinc finger protein.

The isolated human cDNA sequence consists of 1.377 kb, the one has an open reading frame of 227 amino acids (cf. SEQ ID NO: 1; "SEQ ID NO" corresponds to the sequence code "400" according to WIPO Standard ST.25.). The human MIZIP protein has at the C-terminus a MYND-type zinc finger domain consisting of 44 amino acids (Myeloid, Nevy, DEAF) (cit. 13, 14 + 21), a conserved Protein-protein interaction motif found in proteins from yeast to Human occurs; otherwise there are no structural ones Similarities to other known proteins. With the help of EST The murine MIZIP (MIZIP1; see. SEQ ID NO: 3) and a splice variant MIZIP2 (MIZIP2; cf. SEQ ID NO: 4). The nucleotide sequence of the murine MIZIP1 is 90% identical to the predicted protein 100% with the humane MIZIP. The murine splice variant MIZIP2 is on N-terminus is 39 amino acids shorter than murine MIZIP1, otherwise it is identical to MIZIP1 in the amino acid sequence.

The human MIZIP gene is located on chromosome 9q34.3, the murine MZIP gene on chromosome 2. The human and murine MIZIP gene consist of 6 exons and 5 introns, which are highly conserved. In the murine MIZIP splice form, the first exon is through one another, further downstream exon that replaces the 5'- encoded untranslated region. A humane splice variant could have not yet been identified. Orthologic genes are included Xenopus and zebrafish, on the other hand, only distantly related genes with Drosophila or the yeast.

• - Steuerung des Energiehaushaltes und Appetitverhaltens:
  Humanes MIZIP wird in Gehirnregionen wie Thalamus, Substantia Nigra, Hippokampus, Corpus Callosum, Amygdala, aber auch in peripheren Organen wie Leber, Magen, Niere, Skelettmuskel, Haut, Herz, Speicheldrüse, Schilddrüse, Testis oder Placenta exprimiert. Im Hippokampus und Cerebellum liegen MIZIP und MCH-R co-exprimiert vor. In verschiedenen Geweben, vor allem in Testis und Gehirn, Leptin-defizienter Fettsucht-Mäuse (B6.V-Lep^ob, Jackson Laboratory, Bar Harbor, USA) konnte durch Northern-Hybridisierungsexperimente eine erhöhte MIZIP-mRNA-Expression nachgewiesen werden. Dies zeigt, dass MIZIP ebenso wie MCH und MCH-R als Marker für Fettsucht, zumindest für durch Leptin-Fehlfunktionen verursachte Fettsucht, eingesetzt werden kann. Humanes MIZIP interagiert mit dem C-Terminus vom MCH-R im Hefe-Interaktionstest, im "overlay assay" und im "pull-down assay". In mit MIZIP transfizierten HEK293-Zellen (menschliche embryonale Nierenzellen) ist MIZIP cytoplasmatisch lokalisiert; in transfizierten COS7-Zellen auch im Zellkern. Co- Transfektion von MIZIP und MCH-R in HEK293-Zellen führt zur Co-Lokalisation der beiden Proteine an der Zellmembran. Auch nach Zugabe des Agonisten MCH verbleiben beide Proteine an der Zellmembran co-lokalisiert. Danach moduliert MIZIP die Internalisierung bzw. das Recycling von MCH-R. MIZIP kommt damit eine wichtige Rolle bei der Regulation des Energiehaushaltes und Appetitverhaltens zu.
• - Entwicklung des Cerebellums:
  Das auf Chromosom 9q34.3 kartierte MIZIP liegt in unmittelbarer Nachbarschaft zu dem autosomal rezessiv vererbten Joubert Syndrom (Cerebelloparenchymale Erkrankung (CPDIV), OMIM 213300), für das noch kein molekulares Korrelat bekannt ist. Patienten mit Joubert Syndrom sind psychomotorisch gestört und mental retardiert. Aufgrund seiner genomischen Lokalisation ist MIZIP ein Kandidatengen für das Joubert Syndrom.
• - Regulation der Gen-Replikation und -Expression:
  Das Vorkommen von MIZIP in zahlreichen Geweben sowie die immuncytochemische Lokalisation im Zellkern von COS7-Zellen zeigen, daß MIZIP weitere Funktionen z. B. bei Transkriptionsvorgängen haben kann.
• - MIZIP-Expression im Pankreas:
  insulinotropher Effekt - Auswirkungen beim Kohlenhydratstoffwechsel bzw. Diabetes mellitus: Dot-Blot Analysen zeigen, dass MIZIP auch im Pankreas exprimiert wird. Da MCH- R ebenfalls in pankreatischen Zellen exprimiert wird, ferner MCH-Zugabe die Insulinsekretion stimuliert, ist MIZIP als eine Komponente bei der Insulinsekretion im Kohlenhydratstoffwechsel bzw. beim Diabetes mellitus anzusehen.
• - Reproduktionsprozesse:
  Northern Blot- bzw. Dot-Blot-Analysen zeigen starke Expression in humanem Testis- bzw. Placentagewebe, was auf eine Beteiligung von MIZIP bei Reproduktionsvorgängen hinweist.
• - Tumor-/Leukämieentstehung:
  Dot-Blot-Analysen ergeben eine signifikante MIZIP-Expression in Tumor- und Leukämie-Zellen des Menschen. Die Bedeutung von MIZIP kann vielschichtig sein. So kann das Protein z. B. an der Leukämie-Entstehung beteiligt sein, wodurch es als früher Leukämiemarker dienen könnte.

As determined in the context of the present invention, MIZIP is a multifunctional gene product which is expressed in many organs by humans, mice and other vertebrates. MIZIP is involved in the following functions and regulatory processes:

• - Control of energy balance and appetite behavior:
  Human MIZIP is expressed in brain regions such as the thalamus, substantia nigra, hippocampus, corpus callosum, amygdala, but also in peripheral organs such as the liver, stomach, kidney, skeletal muscle, skin, heart, salivary gland, thyroid, testis or placenta. MIZIP and MCH-R are co-expressed in the hippocampus and cerebellum. In various tissues, especially in testis and brain, leptin-deficient obesity mice (B6.V-Lep ^ob , Jackson Laboratory, Bar Harbor, USA), an increased MIZIP-mRNA expression was detected by Northern hybridization experiments. This shows that MIZIP, like MCH and MCH-R, can be used as a marker for obesity, at least for obesity caused by leptin malfunctions. Human MIZIP interacts with the C-terminus of the MCH-R in the yeast interaction test, in the "overlay assay" and in the "pull-down assay". MIZIP is cytoplasmic localized in HEK293 cells (human embryonic kidney cells) transfected with MIZIP; in transfected COS7 cells also in the cell nucleus. Co-transfection of MIZIP and MCH-R in HEK293 cells leads to the co-localization of the two proteins on the cell membrane. Even after adding the agonist MCH, both proteins remain co-localized on the cell membrane. Then MIZIP modulates the internalization or recycling of MCH-R. MIZIP thus plays an important role in regulating energy balance and appetite behavior.
• - Development of the cerebellum:
  MIZIP mapped to chromosome 9q34.3 is in the immediate vicinity of the autosomal recessive inherited Joubert syndrome (cerebelloparenchymal disease (CPDIV), OMIM 213300), for which no molecular correlate is known yet. Patients with Joubert syndrome are psychomotor impaired and mentally retarded. Because of its genomic location, MIZIP is a candidate gene for Joubert syndrome.
• - Regulation of gene replication and expression:
  The presence of MIZIP in numerous tissues and the immunocytochemical localization in the cell nucleus of COS7 cells show that MIZIP has other functions, e.g. B. may have in transcription processes.
• - MIZIP expression in the pancreas:
  Insulinotrophic effect - effects of carbohydrate metabolism or diabetes mellitus: Dot blot analyzes show that MIZIP is also expressed in the pancreas. Since MCH-R is also expressed in pancreatic cells and the addition of MCH stimulates insulin secretion, MIZIP can be seen as a component in insulin secretion in carbohydrate metabolism or in diabetes mellitus.
• - Reproduction processes:
  Northern blot and dot blot analyzes show strong expression in human testis and placenta tissue, which indicates MIZIP's involvement in reproductive processes.
• - Tumor / leukemia development:
  Dot blot analyzes reveal significant MIZIP expression in human tumor and leukemia cells. The meaning of MIZIP can be complex. So the protein z. B. be involved in the development of leukemia, which could serve as an early leukemia marker.

• a) ein Polynukleotid ist, das ein mit dem MCH-R interagierendes Protein mit der in SEQ ID NO: 2 gezeigten Aminosäuresequenz oder mit einer Aminosäuresequenz, die mindestens etwa 90% zu der in SEQ ID NO: 2 gezeigten Aminosäuresequenz identisch ist, kodiert,
• b) ein Polynukleotid mit der in SEQ ID NO: 1, 3 oder 4 gezeigten Sequenz ist,
• c) ein Polynukleotid ist, das unter stringenten Bedingungen (Puffer mit 5 × SSC/50% Formamid bei 60°C) mit einem in (a) oder (b) genannten Polynukleotid hybridisiert,
• d) ein Polynukleotid mit einer Sequenz ist, die von den in (a) bis (c) genannten Polynukleotidsequenzen aufgrund der Degeneration des genetischen Codes abweicht, oder
• e) ein Polynukleotid ist, das ein Fragment, ein Derivat oder eine allelische Variation eines in (a) bis (d) genannten Polynukleotids ist.

The present invention therefore relates to an isolated polynucleotide which encodes a protein which interacts with the melanin-concentrating hormone receptor (MCH-R)

• a) is a polynucleotide which encodes a protein interacting with the MCH-R with the amino acid sequence shown in SEQ ID NO: 2 or with an amino acid sequence which is at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 2,
• b) is a polynucleotide with the sequence shown in SEQ ID NO: 1, 3 or 4,
• c) is a polynucleotide which hybridizes under stringent conditions (buffer with 5 × SSC / 50% formamide at 60 ° C.) with a polynucleotide mentioned in (a) or (b),
• d) is a polynucleotide with a sequence which differs from the polynucleotide sequences mentioned in (a) to (c) due to the degeneration of the genetic code, or
• e) is a polynucleotide which is a fragment, a derivative or an allelic variation of a polynucleotide mentioned in (a) to (d).

According to a special embodiment, the polynucleotide is a Polynucleotide, the regulatory genomic sequences (promoter) of the human or murine MIZIP gene or a polypeptide, that under stringent conditions specifically between the murines Splice variants MIZIP1 and MIZIP2 can differentiate.

In the present case, a fragment contains nucleic acid sequences 19 to 1000 bases, preferably 20 to 250 bases understood. The The term derivative includes variants in which individual Nucleic acid building blocks by modified, known to those skilled in the art Nucleotides are replaced.

• a) ein cDNA-Fragment des murinen MIZIP1 bestehend aus den Nukleotiden 1-205 der cDNA des murinen MIZIP1 zur spezifischen Detektion von MIZIP1 (vgl. Abb. 5).
• b) ein c-DNA-Fragment des murinen MIZIP2 bestehend aus den Nukleotiden 1-263 der cDNA des murinen MIZIP2 zur spezifischen Detektion von MIZIP2 (vgl. Abb. 5).

According to the invention, the following cDNA fragments come into question, which are used in particular for the specific detection of the mRNA of the splice variants of the murine MIZIP:

• a) a cDNA fragment of the murine MIZIP1 consisting of nucleotides 1-205 of the cDNA of the murine MIZIP1 for the specific detection of MIZIP1 (see Fig. 5).
• b) a c-DNA fragment of the murine MIZIP2 consisting of nucleotides 1-263 of the cDNA of the murine MIZIP2 for the specific detection of MIZIP2 (cf. Fig. 5).

Genomic DNA fragments of the human and murine MIZIP gene

• a) Regulatory genomic sequences (promoter regions) of the human and murine MIZIP, in particular 702 nucleotides 5 ' the transcription start point of the human MIZIP (gi: 15297410, bases 41408-40706 (reverse); SEQ ID NO: 17), and 717 nucleotides 5 'of the translation start point of the murine MIZIP-1 (Whitehead mouse assembly contig 514358, Nucleotides 3-719; SEQ ID NO: 18) for isolation more specific Transcription regulators of human and murine MIZIP, especially for isolation more specific Transskriptionsinhibitoren.
• b) the genomic sequence of the murine MIZIP (generated from the Whitehead mouse assembly database entries contig_514358 (Exon 1-2), contig_408870 (Exon 3, 4), contig_384443 (Exon 6) and the Sanger center mouse assembly contig RPCI-23-407013.F (Exon 5)) for genetic engineering Generation of mutations, in particular Deletion mutations, in mice by homologous recombination or Insertions.

The invention further relates to an expression vector which a contains the aforementioned polynucleotide and a host cell which contains such an expression vector.

The invention also relates to one of the aforementioned polynucleotides encoded protein, in particular a Protein that interacts with the MCH-R and that in SEQ ID NO: 2 amino acid sequence shown. It is also a protein included which is a homologue or a fragment of the is the aforementioned protein, the amino acid sequence of which Degree of homology of at least 85% to the corresponding section of the in SEQ ID NO: 2 sequence shown and essentially the same biological activity, physiological effectiveness and / or has immunogenicity.

According to a particular embodiment, the MYND domain (nucleotides 735-866 or amino acids 169-212. See FIG. 2) is of particular importance as a protein-protein interaction domain for the function of the protein. The localization of the highly conserved amino acids of the MYND domain, such as the distances between the cysteine residues (cf. FIG. 3), is particularly important here. The free C-terminus of the MIZIP, in particular the amino acids 211-227, is of great importance for the generation of specific antibodies.

• a) die oben genannte Wirtszelle unter Bedingungen kultiviert, die für die Expression des Proteins geeignet sind und man
• b) das Protein aus der Wirtszellkultur isoliert.

The invention further relates to a method for producing a protein interacting with MCH-R, in which

• a) the above-mentioned host cell is cultivated under conditions which are suitable for the expression of the protein and man
• b) the protein is isolated from the host cell culture.

• a) ein oben genanntes Polynukleotid mit einem Nukleinsäurematerial einer biologischen Probe unter Bildung eines Hybridisierungskomplexes hybridisiert und man
• b) den Hybridisierungskomplex nachweist.

To examine the tissue-specific expression, a method for detecting a polynucleotide, which codes for a protein interacting with the MCH-R, is used in a biological sample, preferably a human biological sample, in which

• a) an above-mentioned polynucleotide is hybridized with a nucleic acid material of a biological sample to form a hybridization complex and one
• b) detects the hybridization complex.

The detection of the hybridization complex can be verified by previous appropriate labeling of the polynucleotide, e.g. B. with dyes or radioactive markings.

In order to quantify the expression, however, the detection of the Expression product, d. H. of the protein as such, preferred. For this purpose it is recommended to use antibodies detect and / or quantify the expressed protein. The present invention therefore further relates to a method for Production of polyclonal and monoclonal antibodies against the aforesaid protein, including antibodies against it Homologous or its fragment in which one is non-human Mammals with a protein, homologue or fragment of the immunized above protein or polypeptide and one the Antibodies from a biological sample of the non-human Mammal isolated. According to a preferred embodiment of the Invention is the non-human mammal Guinea pigs or rabbits. The subject of the invention are also polyclonal and monoclonal antibodies, which by a the aforementioned and well known to the person skilled in the art Immunization procedures are available.

• a) Die Peptidsequenz C-KRPFQHELEPER (Cystein + Aminosäuren 216-227 des MIZIP).
• b) Fragmente des MIZIP, insbesondere die Aminosäuren 1-168 zur Generierung des Antiserum GST-N-MIZIP und spezifischer monoklonaler Antikörper (N-MIZIP) bzw. die Aminosäuren 154-227 zur Generierung des Antiserum GST-MYND-MIZIP und spezifischer monoklonaler Antikörper (C-MIZIP).

The following fragments are particularly suitable for the production of specific antisera:

• a) The peptide sequence C-KRPFQHELEPER (cysteine + amino acids 216-227 of the MIZIP).
• b) Fragments of the MIZIP, in particular the amino acids 1-168 for generating the antiserum GST-N-MIZIP and specific monoclonal antibodies (N-MIZIP) or the amino acids 154-227 for generating the antiserum GST-MYND-MIZIP and specific monoclonal antibodies (C-MIZIP).

The antibodies are according to an embodiment of the invention for in vitro investigation of the expression of the invention Proteins used in which a human biological sample with the antibodies to bind the antibody to the protein suitable conditions and the binding of the Detects antibodies to the protein.

For those skilled in the art, considering the foregoing Comments, of course, that the invention is also a Method for the detection of a polynucleotide or one protein of the invention, including its homologues and Fragments, comprising a biological sample, preferably a human biological sample in contact with a reagent that is specific to the polynucleotide or protein, interacts with the homologue or fragment. The one with the Protein, homologue or fragment interacting reagent it is preferably an aforementioned antibody.

Of course, the invention further relates to a diagnostic kit to carry out the polynucleotide protein or polypeptide Detection method, the appropriate reagents for the preparation of the biological sample and to carry out the detection contains the necessary reagents. According to a special embodiment the invention contains the diagnostic kit aforementioned antibodies.

Due to the fact that within the scope of the present invention isolates the protein interacting with the MCH-R and was characterized, it is now possible to be therapeutically effective Identify substances that affect the activity of the MCH-R regulate interacting protein, in particular increase or Reduce. The invention therefore also relates to methods for Screening for substances that inhibit the activity of one with the MCH-R reduce interacting protein by using one to be tested Connection to a through a polynucleotide mentioned above encoded protein in contact and the binding of the Detects testing compound to the protein, where one Compound that binds to the protein as possible therapeutic agent for reducing the activity of the protein identified.

A method of screening for is also included Substances that interfere with the activity of an MCH-R Regulate proteins by using a compound to be tested with a protein encoded by a polynucleotide according to the invention and the activity of the protein with which MCH-R demonstrates how to interact, being a connection that the activity of the protein to interact with the MCH-R, increased, as a possible therapeutic agent for increasing the Activity of interaction of MCH-R and proteins identified, and being a compound that affects the activity of the protein, interacting with the MCH-R diminishes as possible therapeutic agent for reducing the activity of the Interaction of MCH-R and proteins identified.

Finally, a method for screening for substances Provided the activity of a protein with which MCH-R to interact, diminish, where one has to be tested A compound in contact with a polynucleotide according to claim 1 and the binding of the connection to be tested to the Detects polynucleotide, where a compound attached to the Polynucleotide binds as a possible therapeutic agent for Decrease in the activity of the protein, with the MCH-R too interact, identified.

Furthermore, the use of the above is according to the invention regulatory genomic sequences of human or murine MIZIP for screening for substances that inhibit the transcription of the Reduce or increase MIZIP, included.

For further investigation of the physiological relationships regulating appetite behavior and energy metabolism also becomes a transgenic non-human mammal provided that the protein with the amino acid sequence according to SEQ ID NO: 2 (murine MIZIP) not functionally expressed. This can can be achieved by selecting the gene that is associated with the Melanin Concentrating Hormone Receptor (MCH-R) interacting Protein encoded, completely or partially deleted or one Fragment of the gene responsible for the melanin-concentrating- Hormone receptor (MCH-R) encoding interacting protein LacZ gene and a neomycin resistance gene replaced or by Insertion mutations changed. According to a special one Embodiment of the invention expresses the transgenic non- human mammals use a fusion protein instead of the murine MIZIP from the 44 amino acid long N-terminal fragment and β- Galactosidase. It is understood by the person skilled in the art that the Production of various non-human mammals is possible insofar as this is homologous to the murine or human MIZIP Express protein. In the transgenic non-human mammal it is preferably a rodent, in particular is a mouse (so-called knock-out mouse; ko-mouse). The production of a transgenic co-animal is known to those skilled in the art Methods feasible.

The invention further relates to a method for generating a transgenic non-human mammal, in which the gene that for the melanin-concentrating hormone receptor (MCH-R) interacting protein encoded, completely or partially deleted or a fragment of the gene that is for the one with the Melanin Concentrating Hormone Receptor (MCH-R) interacting protein encoded by a LacZ gene and a neomycin resistance gene exchanges. The fragment mentioned is preferably around part of exon 2, exon 3 and exon 4.

According to the invention, the non-human mammal is suitable for Research and development of diagnostic markers for detection of disorders in the regulation of appetite behavior or of Active ingredients for regulating appetite behavior.

The invention is described below using examples, figures and a sequence listing explained.

Examples 1. Yeast interaction cloning

A PCR reaction with the primers slc-1-f1n (NcoI; CGGCCATGGGCTTGGGCTATGCTAACAG) and slc-1-rs (BamHI; GCGGATCCT-CAGGTGCCTTTGCTTTCT) and the cloned rat cDNA of the MCH-R (cDNA) was used as a template (11) Fragment (bases 915-1085; coding for the 55 C-terminal amino acids of the rat MCH-R including the last 17 amino acids of the TM-7; see FIG. 2) and amplified into the vector pAS2 via the NcoI / BamHI cleavage sites ( Clontech, Heidelberg) cloned.

After transformation of this bait plasmid into the yeast reporter strain CG1945 (His ^- , Trp ^- , Leu ^- ; Clontech) (lithium acetate / single-stranded carrier DNA / PEG method according to Gietz et al., Ref. 10), a human brain cDNA library was developed in the Vector pACT2 (Matchmaker, Clontech, Heidelberg) searched for interaction partners according to the yeast two-hybrid protocol (Ref. 10; Clontech, Heidelberg). (4 parallel batches, each 1 × 10 ⁹ cells with 50 µg cDNA library; plated on 5 SD agar plates (His ^- , Trp ^- , Leu ^- , 30 mM 3AT)). A total of 2.7 × 10 ⁶ transformants were examined and 33 colonies of SD agar plates (His ^- , Trp ^- , Leu ^- , 30 mM 3AT) were isolated. After checking the interaction by X-Gal staining and cycloheximide selection, 20 positive clones remained, whose cDNA were isolated and sequenced according to standard protocols (ref. 11; see Table 1). A.

B.

C.

Table 1 Yeast interaction cloning with the C-terminus of Rat MCH-R using a human Brain cDNA library

• A) The C-terminal amino acid and nucleotide sequence of the MCH-R the rat. The nucleotide sequence in bold served as Bait; the only amino acid exchange between rat and Human is marked by a T (threonine, bold).
• B) Summary of the yeast interaction cloning with the C-terminus of the MCH-R.
  Bait: Rat SLC-1 C terminus in pAS2 (Trp ⁺ ); cDNA library: Matchmaker human brain in pACT2 (Leu ⁺ ); co-transfected in CG-1945 yeast (His ^- / Trp ^- / Leu ^- , cyh ^r ); Selection with His ^- / Trp ^- / Leu ^- plates with 30 mM 3-AT, X-Gal: LacZ reporter assay (strong interaction = blue colony); cyh: Selection for pACT2 plasmid, colonies should become X-Gal negative (others false positive).
  3-AT, 3-amino-1,2,4-triazole; cyh, cycloheximide; X-Gal, 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (see Matchmaker Gal4 two-hybrid user manual (Clontech)).
• C) Result of the sequencing. X, Y, no closer characterized proteins. 5 other clones contained sequences in the wrong reading frame or genomic DNA fragments.

2. In vitro interaction studies

For the in vitro interaction studies, MIZIP was produced as a GST fusion protein (53 kDA), the C-terminus of the MCH-R as a 6 × HIS-DHFR fusion protein (30 kDa). For this purpose, a cDNA fragment coding for the entire human MIZIP was cloned into the vector pGEX-4T2 (Amersham Pharmacia Biotech, Freiburg), and a cDNA fragment coding for the 56 C-terminal amino acids of the rat MCH-R into the vector pQE40 (Qiagen, Hilden) cloned. The cloning was carried out using the PCR as follows:
MIZIP from clone L9 with the primers L9-FAgex (BamHI; CAG-GATCCGCCATGACCGACTTCAAATTG) and L9-RSgex (XhoI; CCCTCGAGCGT-CATCGCTCTGGCTCAAGC) after digestion with BamHI / XhoI cloned in BamHI / XhoI; MCH-R from rats SLC-1 with the primers SLC-pQEF1 (BamHI; CGGGATCCAGCTTGGGCTATGCTAACAG) and SLCpQERl (HinDIII; CTAAGCTTTCAGGTGCCTTTGCTTTCT) after digestion with BamHI / HinDIII in BamHI / HinDD.

The fusion proteins were expressed in E. coli BL21, the GST- Fusion proteins using glutathione Sepharose 4B (Amersham Pharmacia Biotech, Freiburg), as well as the 6 × HIS fusion proteins using Ni-NTA agarose (Qiagen) according to the manufacturer's instructions isolated. The GST fusion proteins were native (STE- Buffer), the 6 × HIS fusion proteins, however, denaturing with a urea buffer (6 M). For renaturation the 6 × HIS fusion proteins were dialyzed overnight against PBS. The isolated fusion proteins were stored at 4 ° C.

2.1. Overlay assay

2 µg of GST control protein and MIZIP-GST fusion protein were separated using SDS-PAGE and blotted onto nitrocellulose membrane. As a loading control, the membrane was stained with 1% Ponceau-S for 10 min, briefly watered and documented. After decolorization, the membrane for the overlay assay was blocked for 3 h at 4 ° C. in 10% skim milk powder in TBS-T and overnight at 4 ° C. with 2 μg / ml 6 × HIS-MCH-R fusion protein in TBS-T, 5% skimmed milk powder incubated. The membrane was washed 5 × for 5 min at room temperature with TBS-T and incubated overnight at 4 ° C. with Anti-MCH-R 1: 1000 in TBS-T, 5% skim milk powder. After washing (5 × for 5 min at room temperature with TBS-T), the membrane was incubated with an alkaline phosphatase-linked anti-rabbit antibody (1: 3000 in TBS-T, 5% skimmed milk powder) for 2 h at 4 ° C. and washed (5 × for 5 min at room temperature with TBS-T). The detection was carried out with AP substrate solution (0.4 mM NBT; 0.38 mM BCIP in 100 mM Tris / HCl, pH 9.5; 100 mM NaCl; 50 mM MgCl ₂ ) for 10 min.

2.2. GST pulldown assay

10-20 µg GST control or GST-MIZIP fusion protein were obtained coupled to glutathione agarose, 2 × 5 min each at 4 ° C on the Shaker with buffer 1 (50 mM Tris / HCl pH 7.5; 0.1% Triton X100; Proteinase inhibitor cocktail) and after Centrifuge (for 2 min at 4 ° C and 1000 × g) with approx. 2 µg 6 × HIS MCH-R fusion protein in 1 ml buffer 1 for 3 h at 4 ° C below Shake incubated. The mixture was then washed 5 × with buffer 1 (see above). The pellet after the last wash and an aliquot the supernatant was taken up in Lämmli buffer and the therein contained proteins separated by SDS-PAGE and on Blotted nitrocellulose membrane. Precipitated by GST-MIZIP 6 × HIS MCH-R fusion protein was immunoblotted with a murine anti-HIS antibodies (1: 5000 in TBS-T, 5% milk powder) and subsequent incubation with peroxidase-coupled anti-mouse Antibody and ECL detection (Amersham Pharmacia Biotech, Freiburg) demonstrated.

3. Isolation of the mouse MIZIP

Comparison of the cDNA sequence of the human MIZIP with the murine EST database (NCBI-BLAST) revealed several murine ESTs (GI110434, AL362430, AA536891, AV205600) with overlapping sequences the majority of the human MIZIP cDNA, including the complete coding region. Of these sequences starting from this, PCR primers were constructed and thus the cDNA of the murine MIZIP1 from murine embryonic cDNA (13.5 dpc total Mouse embryo, 19.5 dpc mouse embryo head). In addition, two murine ESTs with partially homologous sequence (AI56418, AA54553) in the murine EST database. Based on these EST An additional forward primer was constructed and sequences thus the splice variant MIZIP2 by PCR from murine embryonic cDNA cloned.

4. Northern and dot blot hybridization

Northern blots (human 12-lane MTN blot, human brain MTN blot IV, mouse brain MTN blot) and the multiple tissue array dot blot human MTE from Clontech, Heidelberg, were used for 1 according to the manufacturer (Clontech, Heidelberg) h at 65 ° C with 10 ml ExpressHyb solution prehybridized in the hybridization oven and then with freshly denatured probes (50 ng cDNA probes from human or murine MIZIP (entire coding region cloned into pTOPO, insert isolated after EcoRI digestion and gel separation by Ultrafree- DA DNA extraction columns (Millipore) labeled with α- ³² P-dCTP using Prime-It II random prime labeling kit, Stratagene (specific activity> 1 × 10 ⁹ dpm / µg DNA) in 5 ml ExpressHyb solution (Clontech) at 68 Incubated in the hybridization oven for 2 h (the human MTE overnight at 65 ° C.) After 3 × 10 min, wash at room temperature (the human MTE at 65 ° C.) in 2 × SSC, 0.05% SDS and 4 × The blots were placed in plastic film for 10 min at 50 ° C. in 0.1 × SSC, 0.1% SDS packed and exposed on X-ray film with intensifying screens for 1-3 (the human MTE 7) days at -70 ° C.

5. Genomic mapping and elucidation of the exon-intron structure

The exon-intron structure of the human MIZIP was developed by the Comparison of the isolated cDNA of the human MIZIP with the human Genome database through the program human genome BLAST (NCBI) elucidated. Since the oriented genomic DNA sequence of the mouse is not yet publicly available, the murine cDNA Sequence of both splice variants against the TRACE database of non-aligned (non-aligned) raw data of the murine Genome project using the SSAHA server (Ensembl Genome Server, EBI) compared. Genomic sequences could be used for both Splice variants identified and using the Megaline Software (DNA-Star) the exon-intron limits of the murine MIZIP be cleared up.

6. Immunohistochemistry and internalization studies

HEK293 and COS7 cells were incubated in culture medium (DMEM, 10% FCS, 100 U / ml penicillin, 100 µg / ml streptomycin) at 37 ° C in a humid atmosphere with 5% CO ₂ and passaged at confluence (every 3-4 days) , To analyze the localization in eukaryotic cells, a cDNA fragment with the complete coding region of the MCH-R was cloned into the vector pcDNAIII-N-T7-tag, so that a fusion protein with an N-terminal T7 tag is expressed. A cDNA fragment with the complete coding region of the murine MIZIP was cloned into the vector pcDNA6 myc-his so that a fusion protein with a C-terminal myc-his tag is expressed. HEK293 and COS7 cells were transiently transfected using the calcium phosphate precipitation method (Ref. 12). In order to increase the transformation efficiency, the COS7 cells were treated with a glycerol shock (15% glycerol in HBSP, pH 7.5) 3 hours after transfection. After overnight incubation at 37 ° C., 5% CO ₂ , the cells were reacted to cover glasses coated with poly-D-lysine and incubated for a further 24 hours. To analyze the ligand-dependent internalization, the transfected HEK293 cells were incubated for 30 min with MCH (10 ^-6 M) in culture medium. MCH-treated and untreated cells were fixed 2 × 5 min with 3% paraformaldehyde in PBS, washed 3 × with PBS-T (PBS + 0.1% Triton X100) and blocked with 2% FCS in PBS-T. For immunohistochemical detection, the cover slips were washed overnight at 4 ° C. with anti-MCH-R antibody (polyclonal from rabbits, provided by G. Hervieu, SmithKline Beecham, Brentford) 1: 1000 and monoclonal anti-myc antibody (Sigma, clone 9E10) 1: 3000 in PBS-T, 2% FCS. After washing (5 × 10 min at room temperature with PBS-T), the coverslips were washed with goat anti-rabbit-Cy2 conjugate and goat anti-mouse Cy2 conjugate, each 1: 1000, for 2 h at room temperature incubated in PBS-T, 2% FCS. After washing 5 × 10 min at room temperature with PBS-T, the coverslips were covered in glycerol gelatin, examined with a Leica Aristoplan fluorescence microscope and documented with a Hamamatsu ORCA CCD camera with the Openlab software (Improvision).

7. Generation of polyclonal MIZIP antisera

For the immunization of guinea pigs and rabbits with human The following 3 GST-MIZIP fusion proteins are produced by MIZIP:

7.1. Production of the fusion proteins 7.1.1. GST-Saxnt-MIZIP (amino acids 1-227)

For this purpose, a cDNA fragment (nucleotides: 228-916) coding for the entire human MIZIP into the vector pGEX-4T2 (Amersham Pharmacia Biotech, Freiburg). The vector and that with Using the PCR primer (forward primer: L9-FAgex CAGGATCCGCCAT- GACCGACTTCAAATTG; reverse primer: L9-RSgex CCCTCGAGCGT- CATCGCTCTGGCTCAAGC) are created after digestion with BamHI / XhoI in the restriction sites obtained cloned.

7.1.2. GST-N-MIZIP (amino acids 1-168)

For this purpose, a cDNA fragment (nucleotides: 228-734) coding for the N-terminal, 168 amino acid human MIZIP- Area in the vector pGEX-4T2 (Amersham Pharmacia Biotech, Freiburg) as under 7.1.1. cloned using however following PCR primer (forward primer L9-FAgex, CAGGATCCGCCAT- GACCGACTTCAAATTG; reverse primer: L9-R2gex, CTCGAGCTCATAG- TAGGTGCAAGAGTT).

7.1.3. GST-MYND-MIZIP (amino acids 154-227)

For this a cDNA fragment (nucleotides: 691-916) coding for the C-terminal human MIZIP comprising the MYND domain Area in the vector pGEX-4T2 (Amersham Pharmacia Biotech, Freiburg) as under 7.1.1. cloned using however following PCR primer (forward primer: L9-FA2gex TGGGATCCGGGATGTAGTGGAAGAGGAGG; reverse primer L9-RSgex CCCTCGAGCGTCATCGCTCTGGCTCAAGC).

7.2. Expression and purification of the fusion proteins

E. coli BL21 are made with the vector cDNA constructs transfected, by means of IPTG the expression of the respective GST fusion protein induced and after lysis of the bacterial cells the fusion proteins using glutathione Sepharose 4B Regulation of the manufacturer (Amersham Pharmacia Biotech, Freiburg) isolated. The isolated fusion proteins are stored at 4 ° C.

7.3. immunization

The rabbits or guinea pigs are immunized after a standard immunization protocol (Fa Pineda, Berlin): Zur Primary immunization is in each case 100 µg of fusion protein in PBS an emulsion 1: 1 with complete Freudian adjuvant intradermal injected; the 1st booster vaccination is given after 20 days by subcutaneous injection of 50 µg fusion protein in PBS in an emulsion 1: 1 with incomplete Freudian adjuvant; to A further 10 days take place analogously to the 1st, 2nd and 3rd Booster immunizations; on the 61st day the 1st Blood collection to check the antisera and the 4th Booster immunization; after another 15 days the 5th Booster immunization; on the 90th day due to the determined title the whole blood is taken from the animals.

7.4. Control of the antisera

The cellular components of the blood are centrifuged off (5 min at RT and 2000 × g), the serum supernatant is removed, aliquoted and stored at -20 ° C. The specificity and the titer of the immune sera are determined by an indirect ELISA test. For this purpose, 500 ng antigen (of the respective GST-MIZIP fusion protein) or 500 ng GST control protein is placed in the wells of special microtiter plates (Falcon Micro-Test III Flexible Assay Plate) and bound to the plate surface at 4 ° C. overnight. The wells are washed twice with TBS-T, then the surface is blocked for 2 h with 200 μl of 1% BSA in TBS-T at RT and 50 μl of the antisera diluted in PBS (1: 1000-1: 10,000) into the Given deepening. After 2 h of incubation at RT, the wells are washed 6 × 5 min with TBS-T at RT and the bound antibodies by a specific peroxidase-coupled 2nd antibody and subsequent color reaction are detected as follows: Incubation of the wells with 50 μl of peroxidase-coupled Goat anti-rabbit or goat anti-guinea pig IgG, 1: 5000 in TBS-T for 1 h at RT, 6 × 5 min wash with TBS-T at RT, enzymatic detection in 100 µl peroxidase buffer with ortho-phenylenediamine ( OPD; 0.4 mg / ml) and H ₂ O ₂ (0.012%) as substrates, 30 min at RT, termination of the reaction by adding 25 µl 3 MH ₂ SO ₄ and evaluation in an ELISA reader by measuring the absorption at 492 nm.

• 1. zur Bestimmung und Lokalisation von humanem und murinem MIZIP in Liquor, Blut und Geweben einschließlich Tumorzellen (Gesamt-MIZIP-, MYND-MIZIP- und N-MIZIP-spezifisches Antiserum),
• 2. zur Inhibierung der Interaktion zwischen der MYND-Domäne und interagierender Proteine wie z. B. MCH-R (MYND-MIZIP-spezifisches Antiserum) und
• 3. zur Inhibierung der Interaktion zwischen dem N-terminalen MIZIP-Bereich und interagierender Proteine wie z. B. MCH-R (N-MIZIP-spezifisches Antiserum).

The MIZIP antisera obtained serve

• 1. for the determination and localization of human and murine MIZIP in cerebrospinal fluid, blood and tissues including tumor cells (total MIZIP, MYND-MIZIP and N-MIZIP-specific antiserum),
• 2. to inhibit the interaction between the MYND domain and interacting proteins such. B. MCH-R (MYND-MIZIP-specific antiserum) and
• 3. to inhibit the interaction between the N-terminal MIZIP region and interacting proteins such. B. MCH-R (N-MIZIP-specific antiserum).

8. Generation of monoclonal antibodies

To obtain monoclonal antibodies directed against MIZIP, approximately 6-week-old Balb / c mice are immunized as follows: 2-5 mg of purified MIZIP protein or MIZIP protein fragments (see polyclonal antisera) in PBS were injected intraperitoneally into the mice. Repeated injections take place after 4 and 6 weeks, with the first immunization with the addition of Freund's complete adjuvant and the subsequent immunizations with Freund's incomplete adjuvant as an addition. One week after the last injection, blood is drawn from the animals and the antibody titer of the serum obtained from this is checked by means of ELISA (15). High titer mice are injected with 2 mg MIZIP in PBS without adjuvant 3 days before the fusion. Monoclonal antibodies are produced according to standard protocols (16). The immunized mice are killed by cervical dislocation and the spleen is prepared. After carefully shredding the spleen in 5 ml PGP solution (140 mM NaCl, 5.2 mM KCl, 5 mM NaH ₂ PO ₄ , 10 mM Na ₂ HPO ₄ , 10 mM glucose, 5 mg / l phenol red), after sedimentation and Discard coarser pieces of tissue and wash the spleen cells several times in PGP solution. The spleen cells are mixed 1: 2 with cells of the myeloma line P3X63 Ag8.653 (17) in PGP solution and mixed for 6 min. Centrifuged together at 800 rpm and 37 ° C. After the supernatant has been suctioned off, the cell pellet is gently whirled up, and then 1 ml of fusion medium (1 g of PEG 4000 in 1 ml of PGP medium, 0.1 ml of DMSO) is slowly added with gentle shaking. After incubation for 90 s at 37 ° C with gentle shaking, 25 ml of PGP solution is stopped in 3 min to stop the fusion. added dropwise with mixing. After adding a further 25 ml of PGP solution, the cells are centrifuged off and din 25 ml of HAT medium (0.1 mM hypoxanthine, 0.4 aminopterin, 1.6 mM thymidine in RPM1, (Gibco / BRL), 15 μg / ml oxaloacetate , 5 µg / ml sodium pyruvate, 0.2 U / ml bovine insulin, 100 U / ml penicillin, 0.1 mg / ml streptomycin, 20% FCS (Gibco / BRL)), then on 5 96-well cell culture plates in which mouse peritoneal macrophages are distributed in 200 ml HAT medium / hole. The macrophages are prepared the day before. After 3 days, half of the volume of the medium is renewed. After 2 weeks, the supernatants of the individual holes are tested for antigen recognition in the ELISA, and the immunopositive clones are subcloned in several steps. So many subcloning steps are carried out until only single cell clones are left.

The rearing and expansion of the obtained subcloned Hybridoma cells are made in RPMI medium with the addition of 10% FCS. to Conditioning of the medium, if necessary, Peritoneal macrophages are added by rinsing the abdominal cavity obtained from Balb / c mice with a 0.34 M sucrose solution become.

The proteins from the cell culture supernatants are also Ammonium sulfate precipitated (50% saturation), dialyzed against PBS, and the monoclonal antibodies using immunoaffinity chromatography on mAK-HB-58 (directed against κ chain of mouse IgG's, ATCC, Rockville, Maryland, USA) isolated. The purity of the antibodies is checked using SDS-PAGE.

9. Generation of MIZIP-specific cDNA probes

For the analysis of RNA expression in different organs Northern and dot blot hybridizations are as follows cDNA probes generated for the human and murine MIZIP:

9.1. Human cDNA probe

A cDNA fragment of the human MIZIP (nucleotides 103-916) is amplified by means of a PCR reaction (forward primer: L9-F CCCGCCTGGCTGCTACCCCGAC; reverse primer: L9-RS CGTCCTCGCTCTGGCCTCAAG) and with the aid of the TOPO-cloning kit (Clontech) in the Vector pCRII-TOPO cloned. The insert is isolated from this clone by digestion with EcoRI and, after gel separation, extracted using Ultrafree-DA DNA extraction columns (Millipore). As a hybridization probe, 50 ng cDNA insert is labeled with α- ³² P-dCTP using the Prime-It II random prime labeling kit (Stratagene) (specific activity> 1 × 10 ⁹ dpm / µg DNA).

9.2. Murine cDNA probe

In an analogous procedure, a cDNA fragment of the murine MIZIP1 (nucleotides 149-835) is generated by PCR from a murine embryonic cDNA (13.5 dpc embryo) with the primers mL9-FA2 (forward primer: GCCTGGCCATGACCGACTTTA) and mL9-RS (reverse primer: CTCTTCATGGTCCTAAGC ) amplified and cloned in pCRII-TOPO. As described above, the insert is isolated by EcoRI digestion and purified by gel extraction. As a hybridization probe, 50 ng cDNA insert is labeled with α- ³² P-dCTP using the Prime-It II random prime labeling kit (Stratagene) (specific activity> 1 × 10 ⁹ dpm / µg DNA).

9.3. Blot Mialysen

Northern blots (human 12-lane MTN blot, human brain MTN blot IV, mouse brain MTN blot) and the multiple tissue array dot blot human MTE from Clontech, Heidelberg, are used for 1 according to the manufacturer (Clontech, Heidelberg) h at 65 ° C with 10 ml ExpressHyb solution prehybridized in the hybridization oven and then incubated with freshly denatured probes in 5 ml ExpressHyb solution (Clontech) at 68 ° C for 2 h (the human MTE overnight at 65 ° C) in the hybridization oven , After washing 3 × 10 min at RT (the human MTE at 65 ° C.) in 2 × SSC, 0.05% SDS and 4 × 10 min at 50 ° C. in 0.1 × SSC, 0.1% SDS Blots packed in plastic film and exposed on X-ray film with intensifying screens for 1-3 days or 7 days for human MTE at -70 ° C (see Fig. 9).

10. Generation of a MIZIP-deficient mouse line

As an animal model for examining the functions of MIZIP Fragment of the murine MIZIP gene, which is part of exon 2, and contains exons 3 and 4 against a DNA fragment which contains a LacZ gene and a neomycin cassette. After homologous recombination, this leads to the synthesis of a Fusion protein from a truncated, non-functional MIZIP- Fragment (44 N-terminal AS) and the β-galactosidase, as well as Resistance to G418.

The targeting vector is produced as previously described (18). A 2.4 kb EcoRV Cla1 fragment from the 5 'region of the MIZIP gene (including the exons.) Is inserted into the vector pPNT between the herpes simplex virus thymidine kinase gene (for negative selection) and the Neo cassette 1a and 1b and a partial sequence of exon 2) with subsequent LacZ gene in the reading frame of the MIZIP. A 3.5 kb EcoRI / EcoRV fragment of the 3 'region of the MIZIP gene, including exon 5, is cloned onto the neo cassette ( FIG. 10).

The transfection of the Es cell line J1, the selection and detection of the homologous recombination by Southern blot hybridization, and the injection of the Es cells in blastocysts and the generation of homozygous mutants is carried out by standard methods (19, 20). After selection with Gancyklovir (negative selection against randomly inserted vectors) and G418 (positive selection for neomycin-resistant clones), individual ES cell clones are isolated, expanded and analyzed. Successful homologous recombination is detected by Southern blot. For this purpose, the genomic DNA of the Es cells is digested with XbaI and ClaI, separated by gel electrophoresis and blotted on nylon membranes. Since an XbaI interface is lost in the mutated MIZIP gene as a result of the homologous recombination, the probe E6 (450 bp cDNA probe generated by Exon6, see FIG. 10) detects a 6.8 kB in the wild-type MIZIP MIZIP mutated a 9 kB XbaI / ClaI fragment. To generate MIZIP-ko mice, positively tested Es cell clones are injected into blastocysts from C57BL / 6 mice and then implanted into pseudopregnant C57BL / 6 mice. The chimeric mice produced in this way are mated with C57BL / 6 mice and their offspring are examined for the presence of the mutated MIZIP by Southern blot with the E5 probe. Back-crossing produces homozygous MIZIP mutant mice.

Figures legends

Fig. 1 regulation of energy balance and appetite behavior. Arrowheads mean a stimulating effect, crossbars an inhibiting effect, upward and downward arrows mean an increase or decrease in expression. ARC, Arcuratus nucleus; BGS, blood-brain barrier; LHA, Lateral Hypothalamic Area; MCH, melanine concentrang hormone; MCH-R, MCH receptor, MIZIP, MCH receptor interacting zinc finger protein; α-MSH, α-melanocyte stimulating hormone; NPY, neuropeptide Y; CNS, central nervous system.

Fig. 2 cDNA and amino acid sequence of the human MIZIP. The amino acids are specified in the one-letter code. Right, number of amino acids; left, number of nucleotides. The MYND domain is underlined, the star marks the stop codon. Between the inverted nucleotide pairs, the sequence is interrupted by intron regions (5 in total) (see also FIG. 4).

Fig. 3 protein sequence of the human MIZIP (A) and comparing the MIZIP-MYND domain with MYND domains of other proteins (B). A. Putative sequence motifs of MIZIP (PFAM and Predict Protein programs). B. Comparison of the MYND domain of the MIZIP with MYND domains of previously known proteins. Identical amino acids are shown inverted. Deafl, deformed epithelial autoregulatory factor (Ref. 13); MTG8, myeloid translocation gene on chromosome 8 (Ref. 14). Blu represents an unspecified human gene. F1N21.16 corresponds to a clone from the Arabi dopsis thaliana genome project.

Fig. 4 Genomic localization and gene structure of the human MIZIP.
The MIZIP gene was located on chromosome 9q34.3 by comparing the cDNA sequence of the human MIZIP with the human genome sequence (NCBI genome BLAST). Gene structure of the human MIZIP. Black boxes indicate the exon sequences that are spliced into the isolated cDNA sequence, the coding area is marked in gray. The number of base pairs for the respective exon is given in brackets. ORF, open reading frame. C. The exon-intron junctions are marked in bold in the exon areas.

Fig. 5 Comparison of the murine splice variants of MIZIP. The sequences of exons 1a (MIZIP2) and 1b (MIZIP1) are highlighted in bold, the MYND domain is marked by a frame, the stop codons in the 5'-untranslated region are underlined. For further information see Fig. 2.

Fig. 6 gene structure of the murine MIZIP. By comparing the cDNA sequences of the murine splice variants 1 (MIZIP1) and 2 (MIZIP2) with the database of the murine genome project (SSAHA server, Ensemble Genome Server, EBI), the gene structure of the murine MIZIP could be shown. The markings were made analogously to FIG. 4.

Figure 7 In vitro interaction assays with recombinant MIZIP and MCH-R.
A. Overlay Assay: GST control proteins and GST-MIZIP fusion proteins were separated using SDS-PAGE, blotted onto nitrocellulose filters and stained with Ponceau red. After an overlay with the MCH-RC terminus, a specific signal is visible at MIZIP (arrowheads), (IB with rabbit anti-MCH-R-AK).
B. GST pull-down assay: the MCH-RC terminus (fusion protein with 6 × HIS-N-tag) can only be precipitated by GST-MIZIP.
AK, antibody; GST, glutathione-S-transferase; HIS, histidine; IB, immunoblot; ÜS, supernatant; M, marker proteins; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis.

Figure 8 Expression of MIZIP and MCH-R in transfected HEK293 and COS7 cells.
A. HEK cells transfected with MCH-R cDNA were used for 0 (a), 10 (b) or 30 (c, d) min. treated with MCH; in d the treatment was carried out in the presence of 0.45 M sucrose. The cells were then fixed and the receptor localized by immunofluorescence.
B. Fluorescence micrographs of MIZIP- (a, e), or MIZIP- and MCH-R- (bd, fh) transfected HEK293 cells are shown after immunohistochemical detection of MIZIP (via C-terminal MYC tag, anti-MYC / Anti-mouse Cy3) and MCH-R (via anti-MCH-R / anti-rabbit Cy2). Colocalization of both proteins is shown in the overlay (d, h). The cells in (eh) were 30 min. incubated with 10 ^-6 M MCH. a, MIZIP is expressed cytoplasmic in HEK293 cells, even after stimulation with MCH (e). bd, if MIZIP is coexpressed with MCH-R, both interaction partners are colocalized on the cell membrane. fh, stimulation with MCH leads to internalization of MCH-R in cells which only express MCH-R (internal control by cell with dashed cell membrane in fh), in cells which co-express MIZIP and MCH-R, part of the remains Interaction partners on the cell membrane (arrows), both are also colocalized in aggregates on the cell membrane (arrowheads).
C. MIZIP is also localized in the nucleus in COS7 cells. The COS7 cells were co-transfected with MIZIP and MCH-R as described for the HEK293 cells and the location of the transfected proteins was shown immunohistochemically. Bars, 10 µm.

Fig. 9 Expression of MIZIP in human and murine tissues.
A. Hybridization of the human multiple tissue Northern blots MTN-Hum 12 and MTN-B4 (Clontech) with a human MIZIP probe shows the expression of an approximately 1.5 kb mRNA in different tissues, especially in the brain, heart, skeletal muscles, liver and kidney. MIZIP is expressed in the brain in all examined regions.
B. Hybridization of the murine multiple tissue Northern blot MTN mouse (Clontech) with a murine MIZIP probe (total MIZIP1) shows the expression of 4 different sizes (1.5 kb; 3.5 kb, 4 kb and 7 kb) mRNAs in testis, liver, brain and heart, weaker in spleen and kidney.
C. Hybridization of the multiple tissue array dot blot human MTE (Clontech) with a human MIZIP probe shows the expression especially in cerebellum, stomach, placenta, testis and tumor cell lines, such as HeLa 53 and the leukemia cell lines HL-60 and K-562 , In addition, MIZIP is expressed in all examined areas of the brain (putamen, hippocampus, pituitary, cortex), in the heart, especially in the apex, in the duodenum, in the salivary glands, in the liver, kidney, adrenal gland, lung, thyroid gland and in fetal tissues; kb, kilobases of the markers (A, B).

Fig. 10 Schematic representation of the genomic structure of the murine wild-type MIZIP gene (wT-MIZIP), the targeting vector for homologous recombination (TV) and the genomic structure after homologous recombination (mut-MIZIP).

The black blocks indicate the exon regions (1-6) of the murine MIZIP gene, above the interfaces of the restriction enzymes ClaI (C), EcoRI (E), EcoRV (V) and Xbal (X) are shown. The DNA probe E6 (exon 6) enables the specific differentiation of wild-type (wT) and co-MIZIP XbaI / ClaI fragments (XbaI restriction site in intron 3 no longer present after homologous recombination) in the Southern blot (MIZIP - wT, 6.8 kB; MIZIP-mut, 9 kB). HSV-tk, herpes simplex virus thymidine kinase, LacZ pneo, DNA fragment with LacZ gene and neo cassette. Bibliography (1) Schwartz, MW, Woods, SC, Porte, D. Jr., Seeley, RJ, Baskin, DG (2000) Central nervous system control of food intake. Nature 404, 661-671.
(2) Jeanrenaud, B., Rohner-Jeanrenaud (2001) Effects of neuropeptides and leptin on nutrient partitioning: dysregulations in obesity. Annu. Rev. Med. 52, 339-331.
(3) Spiegelman, BM, Flier, JS (2001) Obesity and the regulation of energy banance. Cell 104, 531-543.
(4) Presse, F., Sorokovsky, I., Max, JP, Nicolaidis, S. and Nahon, JL (1996) Melanin-concentrating hormone is a potent anorectic peptide regulated by food-deprivation and glucopenia in the rat. Neuroscience, 71, 735-745.
(5) Kokkotou, EG, Tritos, NA, Mastaitis, JW, Sliker, L., Maratos-Flier, E. (2001) Melanin-concentrating hormone receptor is a target of leptin action in the mouse brain. Endocrinology 142, 680-686.
(6) Shimada, M., Tritos, NA, Lowell, BB, Flier, JS and Maratos-Flier, E. (1998) Mice lacking melanin-concentrating hormone are hypophagic and lean. Nature, 396, 670-674.
(7) Qu, D., Ludwig, DS, Gammeltoft, S., Piper, M., Pelleymounter, MA, Cullen, MJ, Mathes, WF, Przypek, R., Kanarek, R. and Maratos-Flier, E. (1996) A role for melanin-concentrating hormones in the central regulation of feeding behavior. Nature, 380, 243-247.
(8) Ludwig, DS, Mountjoy, KG, Tatro, JB, Gillette, JA, Frederich, RC, Flier, JS and Maratos-Flier, E. (1998) Melanin-concentrating hormone: a functional melanocortin antagonist in the hypothalamus. At the. J. Physiol. 274, E627-633.
(9) Ludwig, DS, Tritos, NA, Mastaitis, JW, Kulkarni, R., Kokkotou, E., Elmquist, J., Lowell, B., Flier, JS and Maratos-Flier, E. (2001) Melanin- concentrating hormones overexpression in transgenic mice leads to obesity and insulin resistance. J. Clin. Invest., 107, 379-386.
(10) Gietz, RD and R. A Woods (1998) Transformation of yeast by the lithium acetate / singlestranded carrier DNA / PEG method. In: Methods in Microbiology 26th Eds. AJ P Brown and MF Tuite. Academic Press, New York.
(11) Zitzer, H., Richter, D. and Kreienkamp, HJ (1999) Agonist-dependent interaction of the rat somatostatin receptor subtype 2 with cortactin-binding protein 1. J. Biol. Chem., 274, 18153-18156.
(12) Roth, A., Kreienkamp, H.-J., Meyerhof, W, Richter, D. (1997) Endocytosis of the rat somatostatin receptors: subtype discrimination, ligand specificity, and delineation of carboxy terminal positive and negative sequence motifs , DNA Cell Biol. 16, 111-119.
(13) Gross, CT and McGinnis, W. (1996) DEAF-1, a novel protein that binds an essential region in a deformed response element. EMBO J 15, 1961-1970.
(14) Sacchi, N., Tamanini, F., Willemsen, R., Denis-Donini, S., Campiglio, S. and Hoogeveen, AT (1998) Subcellular localization of the oncoprotein MTG8 (CDR / ETO) in neural cells , Oncogene 16, 2609-2615.
(15) Engvall, E., and Perlman, P. 1971. Enzyme-linked immunosorbent assay (ELISA): Quantitative assay of immunoglobulin G. Immunochemistry 8: 871-879.
(16) Fazekas de St. Groth, and Scheidegger, D. 1986. Production of monoclonal antibodies: strategy and tactics. J. Immunol. Methods 35: 1-21.
(17) Kearney, JF, Radbruch, A., Liesegang, B. and Rajewsky, K. 1979. A new mouse myeloma cell line that has lost immunoglobulin expression but permits the construction of antibody-secreting hybrid cell lines. J. Immunol. 123: 1548-1550.
(18) Kreienkamp, HJ, Akgün, E., Baumeister, H., Meyerhof, W., Richter, D. (1999) Somatostatin receptor subtype 1 modulates basal inhibition of growth hormone release in somatotrophs. FEBS Lett. 462, 464-466.
(19) Papaioannou, V. & Johnson, R. (1993) in Gene Targeting: A Practical Approach, ed. Joyner, AL (IRL, Oxford), 107-146.
(20) Sambrook, J., Fritsch, EF, Maniatis, T. (1989) Molecular Coning: A Laboratory Manual, 2 ^nd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
(21) Feinstein, PG, Kornfeld, K., Hogness, DS and Mann, RS (1995) Identification of homeotic target genes in Drosophila melanogaster including nervy, a protooncogene homologue. Genetics 140, 573-586. SEQUENCE LISTING

Claims (30)

1. An isolated polynucleotide encoding a protein that interacts with the melanin-concentrating hormone receptor (MCH-R) a) is a polynucleotide which encodes a protein interacting with the MCH-R with the amino acid sequence shown in SEQ ID NO: 2 or with an amino acid sequence which is at least about 90% identical to the amino acid sequence shown in SEQ ID NO: 2, b) is a polynucleotide with the sequence shown in SEQ ID NO: 1, 3 or 4, c) is a polynucleotide which hybridizes under stringent conditions with a polynucleotide mentioned in (a) or (b), d) is a polynucleotide with a sequence which differs from the polynucleotide sequences mentioned in (a) to (c) due to the degeneration of the genetic code, or e) is a polynucleotide which is a fragment, a derivative or an allelic variation of a polynucleotide mentioned in (a) to (d). 2. Expression vector which is a polynucleotide according to claim 1 contains. 3. host cell which has an expression vector according to claim 2 contains. 4. Protein encoded by a polynucleotide according to claim 1 becomes. 5. Protein that with the Melanin-concentrating hormone receptor (MCH-R) interacts, characterized in that it is the amino acid sequence shown in SEQ ID NO: 2. 6. Protein, characterized in that it is a homologue or is a fragment of the protein of claim 5, the Amino acid sequence has a degree of homology of at least 85% to that corresponding section of that shown in SEQ ID NO: 2 Sequence, and essentially the same possesses biological activity. 7. A method for producing a protein interacting with MCH-R, in which a) cultivating the host cell according to claim 3 under conditions which are suitable for the expression of the protein and man b) the protein is isolated from the host cell culture. 8. A method for the detection of a polynucleotide coding for a protein interacting with the MCH-R in a biological sample, in which a) a polynucleotide according to claim 1 is hybridized with a nucleic acid material of a biological sample to form a hybridization complex and one b) detects the hybridization complex. 9. a method for producing antibodies against the protein, the homologue or the fragment according to claim 4, 5 or 6, where you have non-human mammals with a protein, a homologue or a fragment according to claim 4, 5 or 6 immunized and the antibodies from a biological Sample of non-human mammal isolated. 10. The method according to claim 9, characterized in that the non-human mammals a guinea pig or a Rabbit is. 11. Antibody obtainable by a method according to claim 9 or 10. 12. Antibody according to claim 11, characterized in that it is a polyclonal or monoclonal antibody. 13. A method for the detection of a polynucleotide according to claim 1 or a protein, homologue or fragment Claim 4, 5 or 6, in which one with a biological sample in contact with a reagent that is specific to the Polynucleotide or the protein, the homologue or fragment interacts. 14. The method according to claim 13, characterized in that the interacting with the protein, homologue or fragment Reagent is an antibody according to claim 11 or 12. 15. Diagnostic kit for performing the method according to claim 13 or 14. 16. Procedure for screening for substances that have activity of a protein interacting with the MCH-R, at which is a connection to be tested with a through a A polynucleotide according to claim 1 encoded protein in contact and the binding of the connection to be tested is attached Detects the protein, using a compound attached to the Protein binds as a possible therapeutic agent Decrease in the activity of the protein identified. 17. Method of screening for substances that affect activity regulate a protein interacting with the MCH-R, at which you have a connection to test with one of one A polynucleotide according to claim 1 encoded protein in contact and the activity of the protein with the MCH-R interact, demonstrating one connection that the Activity of the protein to interact with the MCH-R, increased, as a possible therapeutic agent for increasing the Activity of interaction of MCH-R and proteins identified, and taking a compound that detects the activity of the Protein to interact with the MCH-R decreased as possible therapeutic agent for reducing the Activity of interaction of MCH-R and proteins identified. 18. Method of screening for substances that affect activity of a protein to interact with the MCH-R where you have a connection to be tested with a The polynucleotide according to claim 1 is brought into contact and the Binding of the compound to be tested to the polynucleotide demonstrating where a compound attached to the polynucleotide binds as a possible therapeutic agent for reduction the activity of the protein to interact with the MCH-R, identified. 19. Use of antibodies according to claim 11 or 12 for in vitro investigation of the expression of the protein according to claim 5, in which a human biological sample with the Antibodies to bind the antibody to the protein appropriate conditions and contact the bond the antibody detects the protein. 20. Transgenic non-human mammal, thereby characterized in that it has the protein with the amino acid sequence according to SEQ ID NO: 2 not functionally expressed. 21. A transgenic non-human mammal according to claim 20. characterized in that the gene for the with the Melanin Concentrating Hormone Receptor (MCH-R) interacting protein encoded, completely or partially deleted is. 22. A transgenic non-human mammal according to claim 20. characterized in that a fragment of the gene intended for with the melanin-concentrating hormone receptor (MCH-R) interacting protein encoded by a LacZ gene and a Neomycin resistance gene is exchanged. 23. A transgenic non-human mammal according to claim 22. characterized in that it replaces the protein Fusion protein from the 44 amino acid long N-terminal Fragment and β-galactosidase expressed. 24. A transgenic non-human mammal according to claims 20 to 23, characterized in that it is a rodent. 25. Method of producing a transgenic non-human Mammal according to claim 20 or 21, wherein the gene, the for that with the melanin-concentrating hormone receptor (MCH-R) interacting protein encoded, in whole or in part deleted. 26. Method of producing a transgenic non-human Mammal according to claim 20 or 21, in which a fragment of the gene responsible for the melanin-concentrating- Encoding hormone receptor (MCH-R) interacting protein, with a LacZ gene and a neomycin resistance gene. 27. The method according to claim 26, characterized in that the Fragment of part of exon52, exon 3 and exon 4 includes. 28. The method according to claims 20 to 27, characterized characterized in that the non-human mammal is a rodent. 29. Use of a non-human mammal according to the Claims 20 to 24 for research and development of diagnostic markers for the detection of disorders in the Regulation of appetite behavior. 30. Use of a non-human mammal according to the Claims 20 to 24 for research and development of Active ingredients for regulating appetite behavior.