DE10058907A1

DE10058907A1 - New nucleic acid encoding soluble cytokine receptor, useful for diagnosis and treatment of e.g. immune disease, also related protein and antibodies

Info

Publication number: DE10058907A1
Application number: DE2000158907
Authority: DE
Inventors: Betram Weiss; Robert Sabat; Khusru Asadullah; Luisella Toschi
Original assignee: Schering AG
Current assignee: Bayer Pharma AG
Priority date: 2000-11-17
Filing date: 2000-11-17
Publication date: 2002-06-06

Abstract

Nucleic acid (I) is: (i) a sequence (1; 750 bp), (3; 1255 bp) or (5; 810 bp), all reproduced; (ii) the equivalent of (i) within the degeneracy of the genetic code or; (iii) a sequence that hybridizes to (i) or (ii) under stringent conditions and encodes a polypeptide with cytokine receptor activity. (I) is other than a genomic sequence. Independent claims are also included for the following: (1) polypeptides (II) encoded by (I); (2) a vector containing at least one copy of (I) or a fragment of it; (3) a cell transformed with (I) or the vector of (2); (4) antibodies (Ab) directed against (II); (5) a pharmaceutical composition containing (I), the vector of (2), the cell of (3), sequences antisense to (I), (II) or Ab.

Description

Die Erfindung betrifft ein neues Mitglied der Zytokinrezeptorfamilie Klasse 2.The invention relates to a new member of the class 2 cytokine receptor.

Die Zytokinrezeptorfamilie Klasse 2 wurde auf Grund der strukturellen Ähnlichkeit zwischen Proteinen definiert, die alle eine hohe Homologie zu Fibronectin Typ III aufweisen. Alle bisher beschriebenen Mitglieder dieser Familie bestehen aus drei Domänen, aus einer extrazellulären, einer transmembranären und einer intrazellulären Domäne. Die extrazelluläre Domäne umfasst ca. 200 Aminosäuren und besteht aus zwei Subdomänen mit je 100 Aminosäuren. Diese Subdomänen beinhalten konservierte Cysteine, Proline und Tryptophane, die bei der charakteristischen Faltung der Subdomänen eine Rolle spielen. Die intrazelluläre Domäne ist für die Initiierung der Signal-Transduktion verantwortlich. Der erste Schritt dafür ist die Bindung eines Liganden (z. B. Interleukin-10) an die extrazelluläre Domäne des für ihn spezifischen Rezeptors 1 (z. B. IL-10R1). Es folgt die Assoziation mit dem für den Liganden spezifischen Rezeptors 2 (z. B. IL-10R2) zu einem Komplex. Der Rezeptor 2 ist nicht in der Lage alleine den Liganden zu binden, aber seine Assoziation zu dem Komplex Ligand-Rezeptor 1 ist für die Leitung des Signals ins Zellinnere/Zellkern essentiell.The class 2 cytokine receptor family was due to the structural similarity between Defined proteins, all of which have a high homology to fibronectin type III. All so far described members of this family consist of three domains, one of extracellular, a transmembrane and an intracellular domain. The Extracellular domain comprises about 200 amino acids and consists of two subdomains with 100 amino acids each. These subdomains include conserved cysteines, prolines and Tryptophans, which play a role in the characteristic folding of the subdomains. The Intracellular domain is responsible for the initiation of signal transduction. The first The step for this is the binding of a ligand (eg Interleukin-10) to the extracellular one Domain of its specific receptor 1 (eg IL-10R1). It follows the association with ligand specific receptor 2 (eg IL-10R2) to a complex. The Receptor 2 is unable to bind the ligand alone but its association with it the complex ligand receptor 1 is responsible for the conduction of the signal into the cell interior / nucleus essential.

Die Zytokinrezeptorfamilie Klasse 2 (CRF2) umfasst Rezeptoren für Immunmediatoren wie Interleukin 10 (IL-10), Interferon γ(IFN-γ), IFN-α und IFN-β, die für die Initiierung, Verlauf und Abschaltung von Immunreaktionen von entscheidender Bedeutung sind. Diese Mediatoren finden schon aktuell Einsatz in der Klinik.The Class 2 cytokine receptor family (CRF2) includes receptors for immune mediators such as Interleukin 10 (IL-10), interferon γ (IFN-γ), IFN-α, and IFN-β, which are responsible for initiation, progression, and Shutdown of immune reactions are crucial. These mediators already find use in the clinic.

IL-10 beispielsweise gehört zu den wichtigsten inhibitorischen Mediatoren des Immunsystems. Es hemmt die spezifische Immunantwort. Dabei scheint von besonderer Bedeutung die Beeinflussung der antigenpräsentierenden Zellen zu sein. IL-10 vermeidet die Entstehung und Reifung der Dendritischen Zellen aus Monozyten. Darüber hinaus reduziert es die Expression von MHC Klasse II und von kostimulatorischen Molekülen wie B7-2 der Monozyten und Makrophagen und somit eine adäquate Antigenpräsentation diese Zellen. Zusätzlich hemmt IL-10 die Sekretion von Interleukin-12, einem Mediator, der bei der Generierung der zellulären Immunität eine wichtige Rolle spielt. IL-10 inhibiert nicht nur die spezifische, zelluläre Immunantwort sondern beeinflusst negativ auch die unspezifische Immunreaktionen. Es hemmt die Sekretion von proinflammatorischen Zytokinen wie TNF-α, IL-1β, IL-6, IL-8, GM-CSF der Monozyten, Makrophagen und neutrophilen Granulozyten. Darüber hinaus stimuliert die Freisetzung von anti-inflammatorischen Mediatoren wie IL-1RA und lösliche TNF-α Rezeptoren. Die Bedeutung dieses Zytokines für die Limitierung der spezifischen und unspezifischen Immunreaktionen ist durch den Phänotyp der IL-10- defizienten Mäuse untermauert, die schwere Entzündungen des Darmes entwickeln, welche latent verlaufen. Diese überschiessende Immunreaktionen auf "normale" Nahrungsmittel- Antigene kann durch die IL-10 Applikation überwunden werden. Nachdem bei der ersten Applikation von IL-10 bei gesunden Probanden eine gute Verträglichkeit festgestellt wurde, findet aktuell die therapeutische Anwendung bei Erkrankungen wie z. B. Psoriasis, Morbus Crohn und Rheumatoide Arthritis statt, die durch eine starke, pathologische Immunaktivierung gekennzeichnet sind. IL-10 übt auf bestimmte Zellpopulationen wie z. B. NK-Zellen aber einen positiven Einfluss aus, was besondere Bedeutung für die Abwehr gegen virale Infektionen und Tumoren hat. Es stimuliert die zytotoxische Aktivität der NK- Zellen. Zudem steigt es die IL-2-induzierte Proliferation und Zytokinproduktion dieser Zellen.IL-10, for example, is one of the most important inhibitory mediators of the Immune system. It inhibits the specific immune response. It seems special Importance to be the influence of the antigen-presenting cells. IL-10 avoids the Genesis and maturation of monocyte dendritic cells. In addition, reduced it expresses MHC class II expression and costimulatory molecules such as B7-2 Monocytes and macrophages and thus an adequate antigen presentation of these cells. In addition, IL-10 inhibits the secretion of interleukin-12, a mediator found in the Generating cellular immunity plays an important role. IL-10 not only inhibits the specific, cellular immune response but also adversely affects the non-specific Immune reactions. It inhibits the secretion of proinflammatory cytokines such as TNF-α, IL-1β, IL-6, IL-8, GM-CSF of monocytes, macrophages and neutrophilic granulocytes. It also stimulates the release of anti-inflammatory mediators such as IL-1RA and soluble TNF-α receptors. The importance of this cytokine for the limitation of specific and unspecific immune responses is due to the phenotype of IL-10 deficient mice, which develop severe inflammation of the intestine, which latent. These overshooting immune responses to "normal" food Antigens can be overcome by the IL-10 application. After at the first Application of IL-10 was found to be well tolerated in healthy volunteers, currently finds the therapeutic use in diseases such. Psoriasis, Morbus Crohn's and rheumatoid arthritis take place through a strong, pathological Immune activation are characterized. IL-10 exerts on certain cell populations such. B. But NK cells have a positive influence, which is of particular importance for the defense against viral infections and tumors. It stimulates the cytotoxic activity of NK Cells. In addition, it increases the IL-2-induced proliferation and cytokine production of these cells.

INF-γ ist einer der potentesten Stimulatoren des Immunsystems. Es aktiviert die Monozyten und Makrophagen, verstärkt den respiratory burst und damit die Fähigkeit diese Zellen nicht nur phagozytierte Mikroben sondern auch unter bestimmten Bedingungen Tumorzellen abzutöten. Darüber hinaus stimuliert IFN-γ die zytotoxische Aktivität der NK-Zellen. Es verstärkt außerdem die spezifische Immunantwort. Es erhöht die Expression von MHC Klasse 1 und induziert bei einer ganze Reihe von Zellen die Expression von MHC Klasse II. Anschließend wirkt es direkt auf T- und B-Zellen und fördert ihre Differenzierung. Die IFN-γ- defizienten Mäuse zeigen als Ausdruck der mangelnden Aktivierung der Monozyten und Makrophagen eine hohe Empfindlichkeit gegenüber experimentellen Infektionen mit z. B. Mycobakterien, Parasieten und Viren. IFN-γ wird therapeutisch zur Rekonstruktion und zur Stimulation des Immunsystem eingesetzt.INF-γ is one of the most potent stimulators of the immune system. It activates the monocytes and macrophages, does not increase the respiratory burst and thus the ability of these cells only phagocytosed microbes but also tumor cells under certain conditions kill. In addition, IFN-γ stimulates the cytotoxic activity of NK cells. It also enhances the specific immune response. It increases the expression of MHC Class 1 and induces the expression of MHC class II in a number of cells. Subsequently, it acts directly on T and B cells and promotes their differentiation. The IFN-γ- deficient mice show expression of the lack of activation of the monocytes and Macrophages have a high sensitivity to experimental infections with z. B. Mycobacteria, parasites and viruses. IFN-γ is used therapeutically for reconstruction and for Stimulation of the immune system used.

Patientenstudien zeigten, daß ein erhöhtes Risiko für Infektionen mit Mykobakterien mit einem Defekt im Interferon-γ-Rezeptor1 (IFN-γR1) korreliert (M. J. Newport et al 1996, N Engl J Med. 335 (26): 1941-9). Eine Punktmutation in diesem Rezeptor führt dazu, daß der Rezeptor nicht auf Zelloberllächen exprimiert wird. Trotzdem fanden Newport et al einen Einfluß von IFNγ auf bestimmte Funktionen der Monozyten dieser Patienten, die den mutierten Rezeptor haben. Sie geben 3 verschiedene Hypothesen als Erklärung für diese scheinbar widersprüchlichen Ergebnisse an. Eine davon ist, daß es eventuell einen bisher nicht identifizierten zusätzlichen Rezeptor für IFN-γ gibt.Patient studies showed an increased risk of mycobacterial infections with correlates with a defect in the interferon-γ receptor1 (IFN-γR1) (M.J. Newport et al 1996, N Engl J Med. 335 (26): 1941-9). A point mutation in this receptor causes the Receptor is not expressed on cell surface. Nevertheless, Newport et al Influence of IFNγ on certain functions of the monocytes of these patients receiving the have mutant receptor. They give 3 different hypotheses as an explanation for this seemingly contradictory results. One of them is that it may be one so far unidentified additional receptor for IFN-γ.

Zur gezielten Beeinflussung von Immunreaktionen ist es daher notwendig, weitere bisher unbekannte Zytokinrezeptoren zu finden. For the targeted influencing of immune reactions, it is therefore necessary, more so far to find unknown cytokine receptors.

Die vorliegende Erfindung stellt ein neues Mitglied der Zytokinrezeptor Klasse 2-Familie genannt CRF2-n3 bereit.The present invention provides a new member of the cytokine receptor class 2 family called CRF2-n3 ready.

Ein Gegenstand der vorliegenden Erfindung ist eine Nukleinsäure, welche
An object of the present invention is a nucleic acid which

a) the nucleotide sequence shown in Seq ID No. 1,
b) one of the sequences from a) in the context of the degeneration of the genetic code corresponding nucleotide sequence or
c) one with the sequences from a. and / or b. under stringent conditions hybridizing nucleotide sequence, with the proviso that the nucleic acid is different from the genomic sequence.

Diese Nukleinsäuren kodieren für ein Polypeptid, das ein neues Mitglied der Familie der Zytokinrezeptoren Klasse 2 ist, oder für Abschnitte davon. Die Zytokinrezeptorfamilie Klasse 2 wird im folgenden CRF2 genannt.These nucleic acids encode a polypeptide that is a new member of the family of Cytokine receptors is grade 2, or for sections of it. The cytokine receptor family class 2 is called CRF2 in the following.

Der Begriff "Hybridisierung unter stringenten Bedingungen" gemäß der vorliegenden Erfindung wird bei Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) definiert. Ein stringente Hybridisierung liegt beispielsweise vor, wenn nach dem Waschen für 1 h mit 1 × SSC und 0,1%SDS bei 50°C, vorzugsweise bei 55°C, besonders bevorzugt bei 62°C und am meisten bevorzugt bei 68°C, insbesondere für 1 h in 0,2 × SSC und 0,1% SDS bei 55°C, vorzugsweise bei 62°C und am meisten bevorzugt bei 68°C noch ein Hybridisierungssignal beobachtet wird. Die Nukleinsäuren, die unter diesen Bedingungen mit der in Seq. ID. No 1 gezeigten Nukleinsäure oder einer dieser Sequenz im Rahmen der Degeneration des genetischen Codes entsprechende Nukleotidsequenz hybridisiert, sind auch Gegenstand der vorliegenden Erfindung.The term "hybridization under stringent conditions" according to the present This invention is described in Sambrook et al. (Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989). A stringent hybridization is for example when after washing for 1 h with 1 x SSC and 0.1% SDS at 50 ° C, preferably at 55 ° C, more preferably at 62 ° C, and most preferably at 68 ° C, especially for 1 h in 0.2 x SSC and 0.1% SDS at 55 ° C, preferably at 62 ° C and most preferably at 68 ° C still a hybridization signal is observed. The nucleic acids that under these conditions with the in Seq. ID. No 1 shown nucleic acid or one of these Sequence corresponding to the degeneration of the genetic code Nucleotide sequence hybridized, are also the subject of the present invention.

Die erfindungsgemäße Nukleinsäure ist vorzugsweise eine DNA. Sie kann aber auch eine RNA umfassen.The nucleic acid according to the invention is preferably a DNA. But she can also do one Include RNA.

Die erfindungsgemäße Nukleinsäure kann aus einer aus menschlichen Zellen hergestellten cDNA Bibliothek oder einer genomischen Bibliothek erhalten werden.The nucleic acid according to the invention can be made from a human cell cDNA library or genomic library.

Der Begriff genomische Sequenz wird gemäß der vorliegenden Erfindung verwendet für die der erfindungsgemäßen DNA entsprechende genomische Sequenz, die sich auf Chromosom 6q24.1-25.2 befindet. In öffentlichen Datenbanken ist der Klon 503F13 (accession NO: AL050337) zugänglich. Es ist bekannt, daß dieser das Gen für den Interferon-γ-Rezeptor enthält. Es ist jedoch nicht bekannt, daß ein weiteres Gen auf diesem Chromosomenabschnitt liegt. Die vorliegende Erfindung identifiziert den Anfang (78552 bp) und das Ende des Gens (106834 bp) und die Intron/Exon-Struktur des Gens (s.Fig. 2).The term genomic sequence is used according to the present invention for the genomic sequence corresponding to the DNA of the invention, which is located on chromosome 6q24.1-25.2. In public databases the clone 503F13 (accession NO: AL050337) is accessible. It is known that this contains the gene for the interferon-γ receptor. However, it is not known that another gene lies on this chromosome section. The present invention identifies the beginning (78552 bp) and the end of the gene (106834 bp) and the intron / exon structure of the gene (see Figure 2).

Im Gegensatz zu allen bisher bekannten Mitgliedern der CRF2 ist das erfindungsgemäße neue Mitglied dieser Familie, genannt CRF2-n3, nicht membranständig. Es besitzt keine transmembranäre Domäne sondern nur eine extrazelluläre Domäne. Es wird von der Zelle, in der es produziert wird, sezerniert und liegt dann in Körperflussigkeiten als löslicher . Rezeptor vor.In contrast to all previously known members of CRF2 is the invention new member of this family, called CRF2-n3, not membranous. It has none transmembrane domain but only an extracellular domain. It is from the cell, in which it is produced, it secretes and is then more soluble in body fluids. Receptor in front.

CRF2-n3 kann zwar seinen spezifischen Liganden, das Zytokin, binden, aber da er ein löslicher Rezeptor ist also nicht auf einer Zellmembran verankert ist, kann er keine Signale in das Zellinnere weiterleiten. Dadurch wird die Wirkung des Zytokins eingeschränkt oder aufgehoben.Although CRF2-n3 can bind its specific ligand, the cytokine, but because it does soluble receptor is therefore not anchored to a cell membrane, it can not receive signals in forward the cell interior. As a result, the effect of the cytokine is limited or canceled.

Es besteht aber auch die Möglichkeit, daß das Zytokin durch die Bindung an den löslichen Rezeptor an einen anderen Ort des Organismus transportiert wird. Es ist durch die Bindung an CRF2-n3 vor proteolytischem Abbau geschützt. Dadurch kann das Zytokin noch lange nach seiner Freisetzung aus Zellen und vor allem an einem anderem Ort des Oganismus seine biologische Wirkung ausüben. Dabei wird das Zytokin aus dem Komplex mit CRF2-n3 wieder freigelassen und kann an membranständige Rezeptoren binden.But there is also the possibility that the cytokine by binding to the soluble Receptor is transported to another location of the organism. It is through the bond protected from proteolytic degradation by CRF2-n3. This allows the cytokine for a long time after its release from cells and above all in another place of the organism to exert its biological effect. The cytokine is released from the complex with CRF2-n3 released and can bind to membrane-bound receptors.

Außerdem kann CRF2-n3, nachdem er sein spezifisches Zytokin gebunden hat, mit rezeptor negativen Zellen assoziieren und so bestimmte biologische Effekte auslösen. In diesem Fall ist die Entstehung des Komplexes aus löslichem Rezeptor und dem Zytokin die Voraussetzung für biologische Effekte des Zytokins.In addition, CRF2-n3 can bind to its specific cytokine receptor associate negative cells and thus trigger certain biological effects. In this case is the origin of the complex of soluble receptor and the cytokine the Prerequisite for biological effects of the cytokine.

Die Erfindung betrifft auch eine Nukleinsäure, welche einen Protein-kodierenden Abschnitt der in Seq ID No 1 dargestellten Nukleotidsequenz umfaßt. Die in Seq. ID No. 1 dargestellte Nukleinsäure enthält einen offenen Leserahmen, der sich von Position 304 bis Position 999 erstreckt und einem Polypeptid mit der Länge von 231 Aminosäuren entspricht.The invention also relates to a nucleic acid which comprises a protein-coding section comprising the nucleotide sequence set forth in SEQ ID No 1. The in Seq. ID No. 1 shown Nucleic acid contains an open reading frame ranging from position 304 to position 999 extends and corresponds to a polypeptide of length 231 amino acids.

Gegenstand der Erfindung sind auch Nukleinsäuren, welche eine mehr als 80%ige, vorzugsweise eine mehr als 90%ige und besonders bevorzugt mehr als 95%ige Identität zu der in Seq ID No 1 dargestellten Nukleotidsequenz aufweisen.The invention also relates to nucleic acids which are more than 80% pure, preferably more than 90% and more preferably more than 95% identity have the nucleotide sequence shown in Seq ID No 1.

Weiterhin betrifft die Erfindung eine erfindungsgemäße Nukleinsäure, die für einen Zytokinrezeptor Klasse 2 oder einen Abschnitt davon kodiert. Furthermore, the invention relates to a nucleic acid according to the invention, which is suitable for a Cytokine receptor class 2 or a portion thereof encoded.

Ebenfalls Gegenstand der Erfindung sind Polypeptide, welche von einer erfindungsgemäßen Nukleinsäure kodiert werden. Die erfindungsgemäßen Polypeptide haben vorzugsweise die in SEQ ID No 2 dargestellte Aminosäuresequenz oder eine Identität von mehr als 80%, vorzugsweise von mehr als 90% und besonders bevorzugt von mehr als 95% zu der Aminosäuresequenz gemäß SEQ ID No 2.The invention likewise relates to polypeptides which are derived from a Nucleic acid are encoded. The polypeptides of the invention preferably have the amino acid sequence shown in SEQ ID No 2 or an identity of more than 80%, preferably greater than 90%, and more preferably greater than 95% to that Amino acid sequence according to SEQ ID No 2.

Die Erfindung betrifft ferner einen Vektor, welcher mindestens eine Kopie einer erfindungsgemäßen Nukleinsäure oder einen Abschnitt davon aufweist. Vektoren können prokaryontische oder eukaryontische Vektoren sein. Beispiele für Vektoren sind pPRO (Clontech), pBAD (Invitrogen), pSG5 (Stratagene), pCl (Promega), pIRES (Clontech), pBAC (Clontech), pMET (Invitrogen), pBlueBac (Invitrogen). In diese Vektoren kann mit den dem Fachmann bekannten Methoden die erfindungsgemäße Nukleinsäure eingefügt werden. Die erfindungsgemäße Nukleinsäure befindet sich vorzugsweise in Verbindung mit Expressionssignalen wie z. B. Promotor und Enhancer auf dem Vektor.The invention further relates to a vector comprising at least one copy of a Nucleic acid of the invention or a portion thereof. Vectors can be prokaryotic or eukaryotic vectors. Examples of vectors are pPRO (Clontech), pBAD (Invitrogen), pSG5 (Stratagene), pCI (Promega), pIRES (Clontech), pBAC (Clontech), pMET (Invitrogen), pBlueBac (Invitrogen). In these vectors can with the the Professionally known methods, the nucleic acid according to the invention are inserted. The Nucleic acid according to the invention is preferably in conjunction with Expression signals such. B. promoter and enhancer on the vector.

Gegenstand der Erfindung ist weiterhin eine Zelle, welche mit einer erfindungsgemäßen Nukleinsäure oder einem erfindungsgemäßen Vektor transformiert ist. Als Zellen können z. B. E. coli, Hefe, Pichia, Sf9, COS, CV-1 oder BHK verwendet werden. Mit üblichen Methoden kann die Zelle mit einem Vektor, der die erfindungsgemäße Nukleinsäure enthält, transformiert werden.The invention further relates to a cell, which with a novel Nucleic acid or a vector according to the invention is transformed. As cells can z. B. E. coli, yeast, Pichia, Sf9, COS, CV-1 or BHK. By usual methods the cell may be treated with a vector containing the nucleic acid according to the invention, be transformed.

Die Erfindung betrifft ebenfalls Antikörper gegen ein erfindungsgemäßes Polypeptid. Ein Antikörper gegen ein erfindungsgemäßes Polypeptid kann monoklonal oder polyklonal sein. Er kann gegen das gesamte erfindungsgemäße Polypeptid oder gegen Fragmente davon gerichtet sein. Die Gewinnung eines solchen Antikörpers erfolgt nach Standardmethoden durch Immunisierung von Versuchstieren.The invention also relates to antibodies against a polypeptide of the invention. On Antibody to a polypeptide of the invention may be monoclonal or polyclonal. It may be active against the entire polypeptide of the invention or against fragments thereof be directed. The recovery of such an antibody is carried out according to standard methods by immunization of experimental animals.

Gegenstand der Erfindung ist weiterhin eine pharmazeutische Zusammensetzung, welche als aktive Komponente eine erfindungsgemäße Nukleinsäure, einen erfindungsgemäßen Vektor, eine erfindungsgemäße Zelle, eine gegen die Nukleinsäuresequenz gemäß Seq ID No 1 gerichtete antisense Nukleinsäure, ein erfindungsgemäßes Polypeptid oder einen erfindungsgemäßen Antikörper enthält.The invention furthermore relates to a pharmaceutical composition which as active component a nucleic acid according to invention, an inventive Vector, a cell according to the invention, one against the nucleic acid sequence according to Seq ID No.1 directed antisense nucleic acid, a polypeptide of the invention or a contains antibody according to the invention.

Die erfindungsgemäße antisense Nukleinsäure ist eine DNA und/oder RNA, die komplementär zu einer erfindungsgemäßen mRNA ist. Sie kann die gesamte komlementäre Sequenz oder Teilsequenzen umfassen. The antisense nucleic acid according to the invention is a DNA and / or RNA which is complementary to an mRNA according to the invention. It can be the entire komlementäre Sequence or partial sequences.

Die pharmazeutischen Zusammensetzungen der Erfindung werden mit den üblichen festen oder flüssigen Trägerstoffen oder Verdünnungsmitteln und den üblichen pharmazeutischen und technischen Hilfsstoffen entsprechend der gewünschten Applikationsart mit einer geeigneten Dosierung in an sich bekannter Weise hergestellt. Tabletten können beispielsweise durch Mischen des Wirkstoffs mit bekannten Hilfsstoffen, beispielweise inerten Verdünnungsmitteln wie Dextrose, Zucker, Sorbit, Mannit, Polyvinylpyrrolidon, Sprengmitteln wie Maisstärke oder Alginsäure, Bindemitteln wie Stärke oder Gelatine, Gleitmittel wie Carboxypolymethylen, Carboxymethylcellulose, Celluloseacetatphthalat oder Polyvinylacetat, erhalten werden. Wirkstoffe enthaltende Kapseln können beispielsweise hergestellt werden, indem man den Wirkstoff mit einem inerten Träger wie Milchzucker oder Sorbit mischt und in Gelatinekapseln einkapselt.The pharmaceutical compositions of the invention are solidified with the usual or liquid carriers or diluents and the usual pharmaceutical and technical auxiliaries according to the desired type of application with a suitable dosage prepared in a conventional manner. Tablets can for example, by mixing the active ingredient with known excipients, for example inert diluents such as dextrose, sugar, sorbitol, mannitol, polyvinylpyrrolidone, Disintegrants such as corn starch or alginic acid, binders such as starch or gelatin, Lubricants such as carboxypolymethylene, carboxymethyl cellulose, cellulose acetate phthalate or Polyvinyl acetate can be obtained. Active ingredients containing capsules, for example be prepared by mixing the active ingredient with an inert carrier such as lactose or Mix sorbitol and encapsulate in gelatine capsules.

Die erfindungsgemäßen pharmazeutischen Zusammensetzungen können auch in geeigneten Lösungen wie beispielsweise physiologischer Kochsalzlösung zur Anwendung kommen.The pharmaceutical compositions according to the invention can also be used in suitable solutions such as physiological saline solution for use come.

Für die parenterale Applikation sind insbesondere ölige Lösungen, wie zum Beispiel Lösungen in Sesamöl, Rizinusöl und Baumwollsamenöl, geeignet. Zur Erhöhung der Löslichkeit können Lösungsvermittler, wie zum Beispiel Benzylabenzoat oder Benzylalkohol, zugesetzt werden.For parenteral administration are in particular oily solutions, such as Solutions in sesame oil, castor oil and cottonseed oil, suitable. To increase the Solubility may be solubilizers, such as benzyl benzoate or benzyl alcohol, be added.

Gegenstand der Erfindung ist ferner die Verwendung einer erfindungsgemäßen pharmazeutischen Zusammensetzung zur Diagnostik bei Immunerkrankungen oder in der Reproduktionmedizin.The invention further relates to the use of an inventive pharmaceutical composition for diagnosis in immune diseases or in the Reproductive Medicine.

Der Begriff Immunerkrankungen wird hierin verwendet für Immunerkrankungen im engeren Sinne (z. B. Autoimmunerkrankungen) und für Erkrankungen für dessen Verlauf das Immunsystem eine entscheidende Rolle spielt, wie z. B. Tumorerkrankungen und chronische/lebensbedrohende Infektionen (unzureichende Immunantwort).The term immune disorders is used herein for narrower immune disorders Senses (eg autoimmune diseases) and for diseases for the course of which Immune system plays a crucial role, such as B. tumors and chronic / life-threatening infections (insufficient immune response).

Unter physiologischen Bedingungen, d. h. im gesunden Menschen, wird CRF2-n3 in der Plazenta und in der Brustdrüse sehr stark exprimiert. Diese ungewöhnliche gewebsspezifische Expression von CRF2-n3 ermöglicht die Nutzung der erfindungsgemäßen pharmazeutischen Zusammensetzungen zur Diagnostik, Prävention und Behandlung von Reproduktions- und Immunerkrankungen.Under physiological conditions, d. H. in healthy people, CRF2-n3 is in the Placenta and very strongly expressed in the mammary gland. This unusual tissue-specific expression of CRF2-n3 allows the use of the Pharmaceutical compositions according to the invention for diagnosis, prevention and Treatment of reproductive and immune diseases.

Plazenta und Brustdrüse spielen immunologisch eine wichtige Rolle bei der Reproduktion und Entwicklung von Nachkommen. Die immunologische Balance zwischen Mutter und Kind wird fast ausschliesslich über diese zwei Organe gesteuert. Die Plazenta gewährleistet, dass der Fetus, der immunologisch eigentlich als fremd identifiziert werden müßte, nicht wie z. B. ein transplantiertes Organ abgestossen sondern toleriert wird. Dieses Phänomen der immunologischen Toleranz wird durch in der Plazenta produzierte immunmodulierende Faktoren erreicht. Gleichzeitig ist die Plazenta auch mitverantwortlich für die "normale" Entwicklung des Immunsystems des Fetus. Unmittelbar nach der Geburt muss sich der Säugling mit den immunologischen Gefahren seine Umwelt erfolgreich auseinandersetzen. Aber weil er zum diesem Zeitpunkt noch kein voll funktionstüchtiges Immunsystem besitzt, wird er von der so genannten Leihimmunität der Mutter unterstützt. Dabei spielt die Muttermilch eine entscheidende Rolle. In der Muttermilch finden sich Mediatoren, die das Immunsystem des Säuglings beeinflußen.Placenta and mammary gland play an important immunological role in reproduction and development of offspring. The immunological balance between mother and child is almost exclusively controlled by these two organs. The placenta ensures that the fetus, which would have to be identified immunologically as foreign, not such. B. a transplanted organ is rejected but tolerated. This phenomenon of immunological tolerance is produced by immunomodulating in the placenta Factors achieved. At the same time, the placenta is also responsible for the "normal" Development of the immune system of the fetus. Immediately after birth must be the Infant with the immunological hazards successfully deal with his environment. But because he does not have a fully functional immune system at this time, He is supported by the so-called loan immunity of the mother. It plays the Breastmilk plays a crucial role. There are mediators in breast milk who use the Affect the infant's immune system.

Der erfindungsgemäße CRF2-n3 ist ein Faktor in diesen immunmodulatorischen Systemen der Plazenta und der Brustdrüse.The CRF2-n3 according to the invention is a factor in these immunomodulatory systems the placenta and the mammary gland.

Unter pathophysiologischen Bedingungen wird CRF2-n3 auch in Geweben exprimiert, in denen im gesunden Zustand nur eine geringe Expression nachweisbar ist. Ein deutlicher Unterschied in der Expression ist z. B. in der Haut zu messen. In gesunder Haut ist die Expression gering, jedoch bei der Psoriasis, einer entzündlichen Hauterkrankung mit immunologischen Hintergrund, nimmt sie deutlich zu.Under pathophysiological conditions, CRF2-n3 is also expressed in tissues, in those in healthy condition only a low expression is detectable. A clearer Difference in the expression is z. B. in the skin to measure. In healthy skin is the Expression low, however, in psoriasis, an inflammatory skin disease with immunological background, it increases significantly.

Bei der Psoriasis handelt es sich um eine wichtige Modellerkrankung, die wesentliche Gemeinsamkeiten mit anderen Immunerkrankungen, bei denen ein Typ1 Zytokinmuster von entscheidender Bedeutung ist, hat. Hierzu gehören unter anderem die Rheumatoide Arthritis, die Multiple Sklerose, entzündliche Darmerkrankungen wie Morbus Crohn und Colitis Ulcerosa, sowie die Transplantationsrejektion nach Organtransplantation. Die Psoriasis bietet die Möglichkeit, exemplarisches Wissen für diese Erkrankungen mit einem ähnlichen pathophysiologischen Mechanismus zu generieren (Asadullah et al. Drugs of Today 1999, 35(12): 913-924; Romagnani, S. J Clin Immunol 1995, 15: 121-9).Psoriasis is an important model disease, the essential Similarities with other immune disorders in which a type 1 cytokine pattern of is crucial. These include, among others, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease such as Crohn's disease and colitis Ulcerosa, as well as the transplantation rejection after organ transplantation. The psoriasis provides the opportunity to provide exemplary knowledge for these diseases with a similar one pathophysiological mechanism (Asadullah et al Drugs of Today 1999, 35 (12): 913-924; Romagnani, S. J Clin Immunol 1995, 15: 121-9).

Diese unterschiedliche Expression in gesundem und kranken Gewebe ermöglicht die Nutzung der erfindungsgemäßen pharmazeutischen Zusammensetzung zur Diagnostik, Prävention und Behandlung von Immunerkrankungen wie Psoriasis, Rheumatoide Arthritis, Multiple Sklerose, entzündliche Darmerkrankungen wie Morbus Crohn und Colitis Ulcerosa, sowie die Transplantationsrejektion nach Organtransplantation.This differential expression in healthy and diseased tissue allows the Use of the pharmaceutical composition according to the invention for diagnostics, Prevention and treatment of immune diseases such as psoriasis, rheumatoid arthritis, Multiple sclerosis, inflammatory bowel disease such as Crohn's disease and ulcerative colitis, and transplant rejection after organ transplantation.

Immunerkrankungen gehen häufig mit einer veränderten Expression oder einer Mutation eines Zytokinrezeptors einher. Die vorliegende Erfindung ermöglicht die Diagnostik des CRF2-n3 bei Immunerkrankungen speziell in der Reproduktionsmedizin. So kann es z. B. durch eine fehlerhafte Immunreaktion zur Abstoßung des Fetus kommen. Die Diagnostik kann auf Basis der Nukleinsäure oder des Polypeptids erfolgen. Dazu werden Patienten entweder Blut- oder Gewebeproben entnommen. In diesen Proben kann die Menge an erfindungsgemäßen Polypeptid durch einen Immuntest bestimmt werden. Dazu werden Antikörper gegen ein erfindungsgemäßes Polypeptid oder gegen Fragmente davon hergestellt und diese dann in einem ELISA (enzyme-linked-immunosorbent assay), in einem RIA (radioimmunoassay) oder in der Immunhistochemie verwendet. Alternativ wird RNA aus den Proben gereinigt und die Menge an erfindungsgemäßer mRNA durch Northern Blot, PCR oder Chip-Hybridisierung gemessen. Bei der Chip-Hybridisierung sind auf speziellen Nukleinsäure-Chips erfindungsgemäße Nukleinsäuren oder Fragmente davon vorhanden. Die Menge an erfindungsgemäßer Nukleinsäure kann auch durch in situ Hybridisierung mit antisense-RNA, die gegen eine erfindungsgemäße Nukleinsäure gerichtet ist, bestimmt werden. Dabei kann die antisense-RNA mit digoxigenin, ³²P oder ³³P markiert sein.Immune diseases are often associated with altered expression or mutation of a cytokine receptor. The present invention enables the diagnosis of CRF2-n3 in immune disorders, especially in reproductive medicine. So it may be z. B. come through a faulty immune response to rejection of the fetus. The diagnosis can be based on the nucleic acid or the polypeptide. For this patients are taken either blood or tissue samples. In these samples, the amount of polypeptide of the invention can be determined by an immunoassay. For this purpose, antibodies are produced against a polypeptide according to the invention or against fragments thereof and these are then used in an enzyme-linked immunosorbent assay (ELISA), in an RIA (radioimmunoassay) or in immunohistochemistry. Alternatively, RNA is purified from the samples and the amount of mRNA according to the invention is measured by Northern blot, PCR or chip hybridization. In the case of chip hybridization, nucleic acids or fragments thereof according to the invention are present on specific nucleic acid chips according to the invention. The amount of nucleic acid according to the invention can also be determined by in situ hybridization with antisense RNA which is directed against a nucleic acid according to the invention. The antisense RNA may be labeled with digoxigenin, ³² P or ³³ P.

Mit Hilfe der oben beschriebenen Diagnostik können auch Mutationen nachgewiesen werden. So können z. B. durch Hybridisierung der Patienten-DNA oder -RNA mit einer erfindungsgemäßen Nukleinsäuresequenz Mutationen einzelner Nukleotide nachgewiesen werden.Mutations can also be detected using the diagnostics described above become. So z. B. by hybridization of patient DNA or RNA with a Nucleic acid sequence according to the invention detected mutations of individual nucleotides become.

Die Ergebnisse der Diagnostik können dann mit dem Krankheitsbild der Patienten korreliert werden.The results of the diagnosis can then be correlated with the clinical picture of the patients become.

Die erfindungsgemäße pharmazeutischen Zusammensetzung kann zur Herstellung eines Medikaments zur Behandlung oder Prävention von Reproduktions- und Immunerkrankungen, die auf einem relativen Mangel an CRF2-n3 beruhen, verwendet werden. Dies kann geschehen durch die Applikation von rekombinantem Protein oder den Einsatz von Gentherapie. Dabei wird ein Vektor, der eine erfindungsgemäße Nukleinsäure enthält, konstruiert und appliziert. Beispiele sind Vektoren, die aus Adenovirus, Adenovirus associated virus, Herpes simplex virus oder SV40 abgeleitet sind. Die Gentherapie kann nach einem Protokoll wie von Gomez-Navarro et al. (Eur. J. Cancer (1999) 35, 867-885) beschrieben durchgeführt werden. Die Applikation kann lokal, d. h. direkt in das betroffene Gewebe oder systemisch, d. h. über den Blutkreislauf erfolgen. Dies führt zu einer erhöhten Expression des erfindungsgemäße Polypeptids.The pharmaceutical composition according to the invention can be used to prepare a Medicament for the treatment or prevention of reproductive and immune diseases, which are based on a relative lack of CRF2-n3. This can done by the application of recombinant protein or the use of Gene therapy. In this case, a vector containing a nucleic acid according to the invention, designed and applied. Examples are vectors derived from adenovirus, adenovirus associated virus, herpes simplex virus or SV40 are derived. Gene therapy can according to a protocol as described by Gomez-Navarro et al. (Eur. J. Cancer (1999) 35, 867-885) be described described. The application can be local, d. H. directly into the affected Tissue or systemic, d. H. done via the bloodstream. This leads to an increased Expression of the polypeptide of the invention.

Die erfindungsgemäße pharmazeutischen Zusammensetzung kann auch zur Behandlung oder Prävention von Reproduktions- und Immunerkrankungen, die auf einer relativen Überexpression des erfindungsgemäßen CRF2-n3 beruhen, verwendet werden. Dazu kann eine antisense Nukleinsäure verwendet, die die Expression der erfindungsgemäßen Nukleinsäure verhindert. Weiterhin können erfindungsgemäße Antikörper verwendet werden, die die biologische Aktivität des Rezeptors hemmen.The pharmaceutical composition of the invention may also be used for treatment or prevention of reproductive and immune diseases, which are based on a relative Overexpression of the CRF2-n3 according to the invention, can be used. This can uses an antisense nucleic acid which is the expression of the invention Prevents nucleic acid. Furthermore, antibodies according to the invention can be used, which inhibit the biological activity of the receptor.

Bevorzugt ist die Verwendung der erfindungsgemäßen pharmazeutischen Zusammensetzung zur Herstellung eines Medikaments zur Behandlung oder Prävention von Psoriasis.Preference is given to the use of the pharmaceutical according to the invention Composition for the manufacture of a medicament for the treatment or prevention of Psoriasis.

Die erfindungsgemäße pharmazeutischen Zusammensetzung kann weiterhin zur Beeinflußung der Bindung eines Liganden an andere membranständige Rezeptoren verwendet werden. CRF2-n3 kann z. B. einen Liganden des Rezeptors binden und dadurch die Wirkung des Liganden auf die Zelle beeinflußen. So können Immunerkrankungen, die auf eine zu hohe Konzentration des Liganden zurückzuführen sind, behandelt werden.The pharmaceutical composition according to the invention can furthermore be used for Influencing the binding of a ligand to other membrane-bound receptors be used. CRF2-n3 may e.g. B. bind a ligand of the receptor and thereby affect the effect of the ligand on the cell. So can immune disorders that are on Too high a concentration of the ligand are to be treated.

Ein erfindungsgemäßes Polypeptid oder eine erfindungsgemäße Nukleinsäure kann zur Auffindung von Liganden des erfindungsgemäßen CRF2-n3 verwendet werden. Neben bekannten Zytokinen können auch bisher unbekannte Zytokine als Ligand den Rezeptor binden. Die Messung kann mit verschiedenen Methoden erfolgen. Eine Möglichkeit ist, das Polypeptid gemäß Seq ID. No. 2 oder Teile davon an eine feste Matrix zu binden, mit zu testenden Lösungen in Kontakt zu bringen und die gebundene Substanzen zu identifizieren. Zu testende Lösungen können beispielsweise Körperflüssigkeiten oder eine Mischung von synthetisch oder rekombinant hergestellten Peptiden oder Polypeptiden sein. Diese Peptide oder Polypeptide können markiert sein, z. B. mit Biotin.A polypeptide according to the invention or a nucleic acid according to the invention can be used for Detection of ligands of the CRF2-n3 invention can be used. Next known cytokines can also previously unknown cytokines as a ligand receptor tie. The measurement can be done with different methods. One way is, that Polypeptide according to Seq ID. No. 2 or parts of it to bind to a solid matrix, with to to contact testing solutions and to identify the bound substances. Solutions to be tested may include, for example, body fluids or a mixture of be synthetically or recombinantly produced peptides or polypeptides. These peptides or polypeptides may be labeled, e.g. B. with biotin.

Weiterhin kann ein erfindungsgemäßes Polypeptid oder eine erfindungsgemäße Nukleinsäure zur Auffindung von Modulatoren des CRF2-n3 verwendet werden. Diese Modulatoren modulieren die Bindung des natürlichen Liganden an den Rezeptor. Sie können sowohl als Antagonisten als auch als Agonisten wirken. Antagonisten hemmen die Bindung des natürlichen Liganden an den Rezeptor und können zur Behandlung von Krankheiten eingesetzt werden, die auf eine zu starken Aktivität des Zytokins beruhen. Agonisten verstärken die Bindung des natürlichen Liganden an den Rezeptor und können bei Patienten verwendet werden, die eine verminderte Konzentration des natürlichen Liganden oder eine geringe Expression des Rezeptors aufweisen. Modulatoren können in einem Bindungsassay identifiziert werden. Furthermore, a polypeptide of the invention or an inventive Nucleic acid can be used to detect modulators of CRF2-n3. These Modulators modulate the binding of the natural ligand to the receptor. You can act both as antagonists and as agonists. Antagonists inhibit the binding of the natural ligand to the receptor and can be used to treat diseases be used, which are based on an excessive activity of the cytokine. agonists enhance the binding of the natural ligand to the receptor and may be in patients be used, which has a decreased concentration of the natural ligand or a have low expression of the receptor. Modulators can be used in a binding assay be identified.

Die Erfindung wird durch folgende Abbildung und Beispiele näher erläutert.The invention is further illustrated by the following figure and examples.

pictures

Abb. 1 zeigt die Gewebsexpression von CRF2-n3 Fig. 1 shows the tissue expression of CRF2-n3

Abb. 2 zeigt welches Exon der genomischen DNA für welche Bereiche der cDNA kodiert. FIG. 2 shows which exon of the genomic DNA codes for which regions of the cDNA.

Examples example 1 Detection of a new cytokine receptor based on the different Effect of human IL-10 and EVB encoded protein BCRF1

Es sind vier virale IL-10-Homologe beschrieben, vom Ebstein-Barr-Virus, vom Cytomegalievirus, vom equinen Herpesvirus Typ 2 und vom Ort-Virus. Das Ebstein-Barr- Virus kodiert ein Protein BCRF1, deren Aminosäurensequenz zu 83% mit humanen IL-10 (hIL-10) identisch ist. Die meisten Unterschiede beruhen auf der Deletion des N-terminalen Bereichs des humanen Zytokins und haben als Folge eine schwächere Bindung des BCRF1 am IL-10R1. BCRF1 spielt bei der Wechselwirkung zwischen dem Virus und dem infizierten Organismus, d. h. bei Ausbreitung einer EBV-Infektion eine wichtige Rolle. Wir untersuchten die biologische Wirkung von BCRF1 auf humane Monozyten, die in vivo die Hauptzielzellen des humanen Zytokins sind. Wir charakterisierten den Einfluss von beiden Mediatoren auf die LPS-induzierte Freisetzung von TNF-α und auf die Expression von verschiedenen Oberflächenmolekülen der Monozyten (MHC Klasse II, kostimulatorische Moleküle, Rezeptoren für Immunglobuliene). Aus dem antikoagulierten, venösen Blut der gesunden Spender wurden die Lymphozyten und die Monozyten (PBMC) durch eine Dichtengradientzentrifugation separiert. Um den inhibitorischen Einfluss von hIL-10 und BCRF1 auf dis LPS-induzierte TNF-α Freisetzung zu bestimmen wurden diese Zellen 1 Stunde mit verschiedenen Konzentrationen von BCRF1 oder hIL-10 bei 37°C und in der feuchten 5% CO₂-haltigen Atmosphäre vorinkubiert. Anschließend wurden die Zellen mit 100 ng/ml LPS 3 Stunden in gleicher Umgebung stimuliert. Es folgte Abnahme des zellfreien Kulturüberstandes und die Bestimmung des TNF-α mittels ELISA. Humanes IL-10 hemmt dosisabhängig die TNF-α Freisetzung. BCRF1 übt eine ähnliche Wirkung aus, die aber wahrscheinlich auf Grund des schwächeren Bindung an IL-10R1 des viralen Homologs erst in höheren Konzentrationen (ab ca. 3 ng/ml) zum Ausdruck kommt. Wir charakterisieren auch den Einfluss der beiden Mediatoren auf die Expression von verschiedenen Oberflächenmolekülen der humanen Monozyten. Die separierten PBMC wurden 24 Stunden mit verschiedenen Konzentrationen von BCRF1 oder hIL-10 bei 37°C und in der feuchten 5% CO₂-haltigen Atmosphäre inkubiert. Anschließend wurde die Expression von den Oberflächenmolekülen der Monozyten mittels Durchflußzytometrie bestimmt. Humanes IL-10 hemmt dosisabhängig die Expression von MHC Klasse II gleichzeitig aber verstärkt die Expression der Rezeptoren für die Immunglobuline Klasse G (CD16, CD32, CD64). BCRF1 induziert wieder ähnliche Veränderungen. Interessanterweise mit hohen Konzentrationen von BCRF1 (30 ng/ml bis 100 ng/ml) induziert man eine maximale, mit hlL-10 identische Verstärkung der Expression des schwach-affinen IgG-Rezeptors CD16. Gleiche Konzentrationen von BCRF1 sind aber nicht in der Lage eine maximale Wirkung auf die Expression von dem stark-affinen IyG-Rezeptor CD64, die identisch ist mit der durch hll-10 induzierten Expression, auszuüben. Diese unterschiedliche Regulierung, in einem Fall identisch mit der von hIL-10 (CD16) im anderen Fall unterschiedlich (CD64), demonstriert die Existenz von zwei IL-10R Subtypen. Der Subtyp-1, der aus einem IL-10R1 und einem IL- 10R2 besteht, ist für die Hochregulierung der Expression von CD16 verantwortlich. An ihn binden sowohl hIL-10 als auch BCRF1. Der Subtyp-2 enthält statt des IL-10R1 ein neues Mitglied der Zytokinrezeptorfamilie Klasse 2. An den Subtyp-2 bindet hIL-10R1 aber nicht BCRF1. Für die Regulierung der Expression von CD64 sind beide Subtypen verantwortlich. Weil BCRF1 den Subtyp-1 bindet, übt es auf die Expression einen gewissen Einfluss aus, aber da BCRF1 nicht in der Lage ist, den Subtyp-2 zu binden, kann es nicht die maximale, hIL-10-identische Wirkung entfalten.Four viral IL-10 homologs are described, Ebstein-Barr virus, cytomegalovirus, equine herpesvirus type 2 and locus virus. The Ebstein-Barr virus encodes a protein BCRF1 whose amino acid sequence is 83% identical to human IL-10 (hIL-10). Most of the differences are due to the deletion of the human cytokine N-terminal region and, as a consequence, weaker binding of BCRF1 to IL-10R1. BCRF1 plays an important role in the interaction between the virus and the infected organism, ie in the spread of EBV infection. We examined the biological effect of BCRF1 on human monocytes, which are the major target cells of the human cytokine in vivo. We characterized the influence of both mediators on the LPS-induced release of TNF-α and on the expression of different surface molecules of the monocytes (MHC class II, co-stimulatory molecules, receptors for immunoglobulins). From the anticoagulated venous blood of the healthy donors, lymphocytes and monocytes (PBMC) were separated by density gradient centrifugation. To determine the inhibitory effect of hIL-10 and BCRF1 on LPS-induced TNF-α release, these cells were incubated for 1 hour with various concentrations of BCRF1 or hIL-10 at 37 ° C and in the humidified 5% CO ₂ -containing atmosphere pre-incubated. Subsequently, the cells were stimulated with 100 ng / ml LPS for 3 hours in the same environment. There followed a decrease in the cell-free culture supernatant and the determination of TNF-α by ELISA. Human IL-10 dose-dependently inhibits TNF-α release. BCRF1 exerts a similar effect, but probably due to the weaker binding to IL-10R1 of the viral homologue only in higher concentrations (from about 3 ng / ml) is expressed. We also characterize the influence of the two mediators on the expression of different surface molecules of the human monocytes. The separated PBMC were incubated for 24 hours with various concentrations of BCRF1 or hIL-10 at 37 ° C and in the humidified 5% CO ₂ -containing atmosphere. Subsequently, the expression of the surface molecules of the monocytes was determined by means of flow cytometry. Human IL-10 dose-dependently inhibits the expression of MHC class II but at the same time strongly inhibits the expression of the receptors for the immunoglobulin class G (CD16, CD32, CD64). BCRF1 induces similar changes again. Interestingly, high levels of BCRF1 (30 ng / ml to 100 ng / ml) induce maximal enhancement of hlL-10 expression of the weak affinity IgG receptor CD16. Equal concentrations of BCRF1, however, are unable to exert maximum effect on expression of the high-affinity IyG receptor CD64, which is identical to hll-10-induced expression. This differential regulation, in one case identical to that of hIL-10 (CD16) in the other case different (CD64), demonstrates the existence of two IL-10R subtypes. Subtype-1, which consists of an IL-10R1 and an IL-10R2, is responsible for upregulating the expression of CD16. Both hIL-10 and BCRF1 bind to it. Subtype 2 contains a new member of the class 2 cytokine receptor family instead of IL-10R1. HIL-10R1 does not bind to subtype 2 but BCRF1. For the regulation of the expression of CD64 both subtypes are responsible. Because BCRF1 binds subtype-1, it has some influence on expression, but because BCRF1 is unable to bind subtype-2, it can not produce the maximum, hIL-10 identical effect.

Example 2 Expression in various human tissues

Die Expression von CRF2-n3 in verschiedenen humanen Geweben wurde mittels einer quantitativen RT-PCR Methode bestimmt. Dazu wurde eine "real time PCR" (TaqMan-PCR) verwendet.The expression of CRF2-n3 in various human tissues was assessed by means of a quantitative RT-PCR method. For this purpose, a "real time PCR" (TaqMan-PCR) used.

Die Beseitigung von etwaiger kontaminierender genomischer DNA und die reverse Transkription der mRNA wurden wie folgt durchgeführt: 2 µg der total RNA wurden in 40 µl mit 5× moloney murine leukemia virus reverser Transkriptase (M-MLV RT) puffer (Gibco BRL, Eggenstein, Germany) und 10 mmol/L Dithiothreitol, 250 µmol/L jeweils von dATP, dUTP, dGTP und dCTP (Pharmacia biotech, Uppsala, Schweden), 1 Einheit/µL RNasin Ribonuclease Inhibitor (Promega, Mannheim, Germany), 25 ng/µL random hexadeoxynucleotide primer (Promega) und 0.05 Einheiten/µL RQ1 DNase (Promega) bei 37°C für 30 min inkubiert. Die Proben wurden dann auf 95°C für 10 min erhitzt und anschließend auf Eis gekühlt. Nach der Zugabe von 1 Einheit/µL RNasin Ribonuclease Inhibitor (Promega) und 5 Einheiten/µL M-MLV RT (Gibco BRL), wurden die Proben für 10 min bei Raumtemperatur und folgend für eine 1 h bei 37°C inkubiert. Anschließend wurden die Enzyme durch Erhitzen auf 95°C für 10 min inaktiviert. Die resultierende cDNA wurde in jeweils 3 Ansätzen (3fach Bestimmung) mittels der real-time TaqMan PCR unter Verwendung eines ABI Prism 7700 Sequence Detector System (Perkin-Elmer Cetus, Forster City, C.A., U.S.A.) analysiert. Für die Detektion der CRF2-n3-spezifischen cDNA Sequenz, wurden die folgenden PCR primer und eine fluorochrom-markierte Oligonucleotidsonde, unter Verwendung der Primer Express software (Perkin-Elmer Cetus) konstruiert:
SEQUENZ (sense primer) CTCAGTCAACGCATGAGTCTCTG
SEQUENZ (antisense primer) CAGGCTGCCATTGCAAAAT
6-Carboxy-fluorescein (FAM)-SEQUENZ-6-Carboxy-tetramethyl-rhodamine (TAMRA) (sense probe) AGCCTCAGAGGGTACAATTTCAGTCCCG.The removal of any contaminating genomic DNA and the reverse transcription of the mRNA were carried out as follows: 2 μg of total RNA were transfected into 40 μl with 5x moloney murine leukemia virus reverse transcriptase (M-MLV RT) buffer (Gibco BRL, Eggenstein, Germany ) and 10 mmol / L dithiothreitol, 250 μmol / L each of dATP, dUTP, dGTP and dCTP (Pharmacia biotech, Uppsala, Sweden), 1 unit / μL RNasin ribonuclease inhibitor (Promega, Mannheim, Germany), 25 ng / μL random hexadeoxynucleotide primer (Promega) and 0.05 unit / μL RQ1 DNase (Promega) at 37 ° C for 30 min. The samples were then heated to 95 ° C for 10 minutes and then cooled on ice. Following the addition of 1 unit / μL RNasin ribonuclease inhibitor (Promega) and 5 units / μL M-MLV RT (Gibco BRL), the samples were incubated for 10 min at room temperature followed by 1 h at 37 ° C. Subsequently, the enzymes were inactivated by heating to 95 ° C for 10 min. The resulting cDNA was analyzed in 3 assays (3-fold assay) by real-time TaqMan PCR using an ABI Prism 7700 Sequence Detector System (Perkin-Elmer Cetus, Forster City, CA). For the detection of the CRF2-n3 specific cDNA sequence, the following PCR primers and a fluorochrome-labeled oligonucleotide probe were constructed using the Primer Express software (Perkin-Elmer Cetus):
SEQUENCE (sense primer) CTCAGTCAACGCATGAGTCTCTG
SEQUENCE (antisense primer) CAGGCTGCCATTGCAAAAT
6-carboxy-fluorescein (FAM) SEQUENCE-6-carboxy-tetramethyl-rhodamine (TAMRA) (sense probe) AGCCTCAGAGGGTACAATTTCAGTCCCG.

Zudem wurde der mRNA Gehalt der kodierend für das "house keeping gene" Homo sapiens hypoxanthine phosphoribosyltransferase-1 (HPRT-1) ist und als interne Kontrolle gilt parallel in jeder einzelnen Probe bestimmt. Die Sequenz des HPRT-1-spezifischen primer Paares und die fluorogene Sonde, basierend auf den reversen komplimentären cDNA strang, war wie folgt:
AGTCTGGCTTATATCCAACACTTCG (sense primer),
GACTTTGCTTTCCTTGGTCAGG (antisense primer),
FAM-TTTCACCAGCAAGCTTCGACCTTGA-TAMRA (sense Sonde).In addition, the mRNA content coding for the house keeping gene Homo sapiens hypoxanthine phosphoribosyltransferase-1 (HPRT-1) was determined and as internal control is considered in parallel in each individual sample. The sequence of the HPRT-1 specific primer pair and the fluorogenic probe based on the reverse complementary cDNA strand was as follows:
AGTCTGGCTTATATCCAACACTTCG (sense primer),
GACTTTGCTTTCCTTGGTCAGG (antisense primer),
FAM-TTTCACCAGCAAGCTTCGACCTTGA-TAMRA (sense probe).

Die PCR Amplifikation wurde unter Verwendung von 1 µL reversen transcriptions Mix in einem Endvolumen von 50 µL, der den TaqMan universal master mix (Applied Biosystems, Weiterstadt, Germany) und 200 nmol/L der spezifischen Sonde und 900 (CRF2-n3) bzw. 300 (HPRT-1) nmol/L des jeweiligen Primers enthielt, durchgeführt. Die genannten Konzentrationen waren zuvor in Vorversuchen als optimal identifiziert worden. Signifikante Fluorescence Signale wurden definiert als der Schwellenwert Zyklus der mittels der TaqMan instrument-assoziierten Software version 1.6.3. (Applied Biosystems) berechnet wurde. Es wurde der CRF2-n3-mRNA Gehalt berechnet in Relation zu dem für HPRT-1.PCR amplification was performed using 1 μL reverse transcriptions mix in a final volume of 50 μL containing the TaqMan universal master mix (Applied Biosystems, Weiterstadt, Germany) and 200 nmol / L of the specific probe and 900 (CRF2-n3) and 300, respectively (HPRT-1) nmol / L of the respective primer carried out. The mentioned Concentrations had previously been identified as optimal in preliminary experiments. significant Fluorescence signals were defined as the threshold cycle of the TaqMan instrument-associated software version 1.6.3. (Applied Biosystems). It the CRF2-n3 mRNA content was calculated in relation to that for HPRT-1.

Die Gewebsspezifische Analyse der Genexpression zeigte, daß der neue Zytokinrezeptor vornehmlich in der Plazenta und in der Brustdrüse (hier sogar stärker als das House keeping Gene) exprimiert wird (Abb. 1).Tissue-specific analysis of gene expression revealed that the new cytokine receptor is predominantly expressed in the placenta and mammary gland (even stronger than the housekeeping gene here) ( Figure 1).

Example 3 Expression under pathophysiological conditions

Die Untersuchung sollte die Fragen beantworten, ob die Expression von CRF2-n3 regulierbar ist und ob sie sich zwischen physiologischen und pathophysiologischen Zuständen unterscheidet. Dazu wurde RNA aus Hautbiopsien von gesunden Kontrollprobanden mit RNA aus Hautbiopsien von Patienten mit Psoriasis verwendet. Die Bestimmung wurde wie im Beispiel 1 beschrieben durchgeführt.The investigation should answer the questions whether the expression of CRF2-n3 is regulatable and whether it is between physiological and pathophysiological States different. For this, RNA from skin biopsies of healthy Control subjects using RNA from skin biopsies from patients with psoriasis. The Determination was carried out as described in Example 1.

Die Bestimmung ergab eine über 10-fach stärkere Expression von CRF2-n3 in läsionaler Haut von Patienten mit Psoriasis in Vergleich zu Haut der gesunden Kontrollprobanden. The determination revealed a more than 10-fold stronger expression of CRF2-n3 in lesional Skin of patients with psoriasis compared to skin of healthy control subjects.

Example 4 Cloning of CRF2-n3 and expression in E. coli

Zunächst wurde eine cDNA Bibliothek aus humaner Plazenta hergestellt. Dazu wurden 4 µg total RNA (Firma Clontech) in den Reaktionen des GeneRacer™ kit (Invitrogen, CA USA) verwendet. Die modifizierte mRNA aus der letzten Reaktion wurde mit dem GeneRacer™ OligodT primer für die reverse Transkription eingesetzt.First, a human placenta cDNA library was prepared. For this purpose, 4 ug total RNA (Clontech) in the reactions of the GeneRacer ™ kit (Invitrogen, CA USA) used. The modified mRNA from the last reaction was used with the GeneRacer ™ OligodT primer used for reverse transcription.

Die cDNA für CRF2-n3 wurde mittels einer RACE-PCR (RACE- Rapid Amplification of cDNA Ends) gewonnen. Die DNA-Polymerase für die PCR war das ThermoZyme™ von Invitrogen. 5'- und 3'-RACE wurden wie folgt durchgeführt:
The cDNA for CRF2-n3 was obtained by means of a RACE-PCR (RACE Rapid Amplification of cDNA Ends). The DNA polymerase for the PCR was Invitrogen's ThermoZyme ™. 5 'and 3' RACE were performed as follows:

Ansatzvolumenbatch volume 5'-RACE5'-RACE 50 µl50 μl Plazenta cDNAPlacenta cDNA 2 µl2 μl GeneRacer™ 5' primer (10 µM)GeneRacer ™ 5 'primer (10 μM) 1 µl1 μl Genspezifischer primer (GSP) #2R (25 µM)Gene specific primer (GSP) # 2R (25 μM) 1 µl1 μl 5× ThermoZyme™ PCR Puffer5 × ThermoZyme ™ PCR buffer 10 µl10 μl dNTP Lösung(10 mM je)dNTP solution (10mM each) 1 µl1 μl ThermoZyme™ (1 U/µl)ThermoZyme ™ (1 U / μl) 1 µl1 μl Steriles WasserSterile water 34 µl34 μl

Ansatzvolumenbatch volume 3'-RACE3 'RACE 50 µl50 μl Plazenta cDNAPlacenta cDNA 2 µl2 μl GeneRacer™ 3' primer (10 µM)GeneRacer ™ 3 'primer (10 μM) 1 µl1 μl GSP #1F (35 µM)GSP # 1F (35 μM) 1 µl1 μl 5× ThermoZyme™ PCR Puffer5 × ThermoZyme ™ PCR buffer 10 µl10 μl dNTP Lösung(10 mM je)dNTP solution (10mM each) 1 µl1 μl ThermoZyme™ (1 U/µl)ThermoZyme ™ (1 U / μl) 1 µl1 μl Steriles WasserSterile water 34 µl34 μl

Die folgende "cycling" Programme für die RACE-PCR wurden in den Thermocycler Perkin- Elmer 9600 eingestellt:
The following "cycling" programs for the RACE-PCR were set in the Perkin-Elmer 9600 thermocycler:

Die Sequenzen der CRF2-n3 primer für die RACE Reaktionen waren wie folgt:The sequences of CRF2-n3 primers for the RACE reactions were as follows:

CRF2-n3 # 1F

5'-CTC AGT CAA CGC ATG AGT CTC TGA AGC-3' (sense primer)5'-CTC AGT CAA CGC ATG AGT CTC TGA AGC-3 '(sense primer)

CRF2-n3 # 2R

5'-ATA GAC ACT GCT GTT GCC AGT AAG TGC C-3' (antisense primer)5'-ATA GAC ACT GCT GTT GCC AGT AAG TGC C-3 '(antisense primer)

Anschließend wurden die Produkte der RACE in dem pCR®4-TOPO Vektor aus dem TOPO- TA cloning® kit von Invitrogen kloniert.Subsequently, the products of the RACE in the pCR®4-TOPO vector from the TOPO TA cloning® kit from Invitrogen cloned.

Die Sequenz der klonierten PCR-Produkte wurde mittels des Applied Biosystem (ABI) Prism® BigDye™ Terminator sequencing kit in einem ABI 310 capillary Sequencer bestimmt.The sequence of the cloned PCR products was determined using the Applied Biosystem (ABI). Prism® BigDye ™ Terminator sequencing kit is determined in an ABI 310 capillary sequencer.

Expression of CRF2-n3

Um das gereinigte rekombinante Protein zu gewinnen wurde die CRF2-n3 cDNA in einem E. coli Expressionsvektor kloniert.To obtain the purified recombinant protein, the CRF2-n3 cDNA was transformed into a E. coli expression vector cloned.

CRF2-n3 wurde als Fusionsprotein mit der Glutathione-S-transferase (GST) in dem Vektor pGEX-2T (Pharmacia Biotech) exprimiert. Das Fusionskonstrukt wurde anschließend in den E. coli Stamm BL21 transformiert.CRF2-n3 was used as a fusion protein with glutathione S-transferase (GST) in the vector pGEX-2T (Pharmacia Biotech). The fusion construct was then inserted into the E. coli strain BL21 transformed.

Example 5 Search for modulators

Der CRF2-n3 wird in E. coli exprimiert und mit Hilfe von Standardmethoden wie z. B. Ionenaustauschchromatographie, Affinitätschromatographie oder Gelfiltration gereinigt. Das gereinigte Protein wird auf Mikrotiterplatten gebunden. Dann wird gleichzeitig der Biotin markierte Ligand und die zu testenden Substanz zugegeben und 1 Stunde inkubiert. Anschließend wird die Mikrotiterplatte mit Puffer gewaschen und dann Avidin-FITC zugegeben. Nach weiteren 30 min Inkubation wird wieder gewaschen und dann die Fluoreszenz gemessen. In Kontrollansätzen wird nur der markierte Ligand zugegeben. Durch Messung der Fluoreszenz kann bestimmt werden, ob die zu testende Substanz den Liganden vom Rezeptor verdrängt (Fluoreszenz wird geringer), keinen Einfluß hat (Fluoreszenz entspricht der des Kontrollansatzes) oder die Bindung des Liganden verstärkt (Fluoreszenz wird stärker). Analoge Versuche werden mit ¹²⁵J markiertem Liganden durchgeführt. The CRF2-n3 is expressed in E. coli and purified by standard methods such. B. ion exchange chromatography, affinity chromatography or gel filtration. The purified protein is bound to microtiter plates. Then the biotin-labeled ligand and the substance to be tested are added simultaneously and incubated for 1 hour. Subsequently, the microtiter plate is washed with buffer and then added to avidin-FITC. After a further 30 min incubation, washing is carried out again and then the fluorescence is measured. In control approaches, only the labeled ligand is added. By measuring the fluorescence, it can be determined whether the substance to be tested displaces the ligand from the receptor (fluorescence becomes lower), has no influence (fluorescence corresponds to that of the control batch) or enhances the binding of the ligand (fluorescence becomes stronger). Analogous experiments are carried out with ¹²⁵ I labeled ligand.

SEQUENZPROTOKOLL SEQUENCE LISTING

Claims

1. Nucleic acid, characterized in that it

a) the nucleotide sequence shown in Seq ID No. 1,
b) one of the sequence from a) in the context of the degeneracy of the genetic code corresponding nucleotide sequence or
c) one with the sequences from a. and / or b. under stringent conditions hybridizing nucleotide sequence

with the proviso that the nucleic acid is different from the genomic sequence.

2. Nucleic acid according to claim 1, characterized in that it contains a protein coding portion of the nucleotide sequence shown in Seq ID No 1.

3. Nucleic acid according to claim 1 or 2, characterized in that it contains more than 80% identity to the nucleotide sequence shown in Seq. ID No. 1.

4. Nucleic acid according to one of claims 1-3, characterized in that it is for a Cytokine receptor class 2 or a portion thereof encoded.

5. Polypeptide, characterized in that it is derived from a nucleic acid according to one of Claims 1-4 is encoded.

6. Polypeptide according to claim 5, characterized in that it

a) the amino acid sequence shown in SEQ ID No 2 or
b) an identity of more than 80% to the amino acid sequence according to a. having.

7. Vector, characterized in that it contains at least one copy of a nucleic acid one of claims 1-4 or a portion thereof.

8. cell, characterized in that it reacts with a nucleic acid according to one of Claims 1-4 or a vector according to claim 8 is transformed.

9. Antibodies to a polypeptide according to any one of claims 5-7

10. Pharmaceutical composition, characterized in that it is an active component

a) a nucleic acid according to any one of claims 1-4;
b) a vector according to claim 7,
c) a cell according to claim 8,
d) an antisense nucleic acid directed against the nucleic acid sequence according to SEQ ID No. 1,
e) a polypeptide according to any one of claims 5-6 or
f) contains an antibody according to claim 9.

11. Use of a pharmaceutical composition according to claim 10 for Diagnostics in immune diseases or in reproduction medicine.

12. Use of a pharmaceutical composition according to claim 11 for Preparation of a medicament for the treatment and prevention of reproductive or Immune diseases.

Use according to claim 12 wherein the immune disease is psoriasis.

14. Use of a polypeptide according to any one of claims 5-6 or a nucleic acid according to any one of claims 1-4 for finding ligands of a polypeptide according to Claim 5.

15. Use of a polypeptide according to any one of claims 5-6 or a nucleic acid according to any one of claims 1-4 for finding modulators of a polypeptide according to Claim 5.