DE10003573A1 - Inhibition of carbohydrate-modifying enzymes in host organisms - Google Patents

Abstract

The present invention relates to a method for the post-translational inhibition of a carbohydrate-modified enzyme in a host organism, preferably a transgenic plant. A gene that codes for a peptide or a protein is expressed in the host organism. Said peptide or protein is provided with at least one of the following characteristics: (a) said peptide or protein binds to the carbohydrate-modified enzyme and inhibits the activity thereof, (b) binds, modifies or decomposes a specifically or selectively acting cofactor for the carbohydrate-modified enzyme, (c) binds, modifies or decomposes a specific substrate for the carbohydrate-modified enzyme or (d) catalyses the synthesis of an organic or inorganic compound, whereby said synthesis directly or indirectly inhibits the carbohydrate-modified enzyme. In a preferred embodiment, the peptide or protein is linked to an additional peptide or protein which allows the inhibiting peptide or protein to be localised within a specific cell compartment of the cells pertaining to the host organism.

Description

The present invention relates to a method for post-translational inhibition of a carbohydrate-modifying Enzyme in host organisms, preferably in a transgenic Plant, and a suitable one for carrying out the method Plant.

Carbohydrates play an essential role in metabolism of organisms, both as independent molecules, e.g. B. Strength in plants, as well as chemically to other substance classes bound forms, e.g. B. in the glycosylation of proteins. In animal cells, the glycosylation residues play as well their specific structure also plays an important role in the subcellular localization of the relevant glycosylated Proteins. Because of advances in genetic engineering, it is become possible in a transgenic organism Composition of carbohydrates, e.g. B. modified starch in potatoes, or that of the glycosylation side chains of proteins, e.g. B. in transgenic plants. On the one hand, this enables new applications for familiar ones Products, e.g. B. by improving their properties, such as with potato starch through development of transgenic plants, which produce homogeneous, one-component modified starch, be made possible. On the other hand, functional Changes z. B. human produced in plants Proteins can be obtained for therapeutic purposes should be used, for example, by the Switching off the activity of the β-1,2-N- Acetylglucosaminyltransferase I (GnTI) the otherwise in Plant connection of α (1,3) fucose and β (1,2) xylose residues to the present protein-bound High-mannose-type glycosylation backbone prevented becomes. This can achieve a human immune tolerance  that are otherwise typical of the vegetable Glycosylation structure is not given.

So far, these modification approaches are usually carried out by the widespread antisense or Co-suppression technology sought. The disadvantages of this Methods are, for example, in their known difficult quantitative reproducibility and controllability. In addition mostly only partial effects are achieved, which in Individual cases with modified direct products are tolerable may be, but in no way in inhibiting one Enzyme function. So in the example of GnTI inhibition one complete deactivation of the enzyme function over the entire Life cycle of a production plant for a human Therapeutic agent must be guaranteed, otherwise there are traces or even higher proportions of the undesirable starting structures in the Product may be included. This is particularly important for very efficient and occurring in only small quantities Enzymes and with very stable enzymes with a long one Half-life. Attacks the antisense or Co-suppression of a specific enzyme only partially, so at least small amounts of the enzyme in question, which is then the unwanted Cause modification. Such a contaminated product is z. B. not suitable for therapeutic applications.

The invention is therefore essentially technical Problem, a method of inhibiting carbohydrate modifying enzymes in host organisms represent the disadvantages of the prior art does not have the described method, d. H. especially ensures that the escapement is reliable and essentially is complete.

The solution to this technical problem is provided by Provision of those identified in the claims Embodiments achieved.  

The present invention relates to a method that does not the transcription of the coding for the enzyme in question cDNA by antisense or co-suppression, d. H. Overexpression the cDNA in question in the antisense or sense direction, starts, but - much more controllable - post-translational on the enzymatic activity of the enzyme itself. This is expressed by the expression of a gene in the Host organism achieved that for a peptide or protein encodes that at least one of the following properties comprises: (a) it binds to the carbohydrate-modifying Enzyme itself and inhibits its activity, (b) it binds, modifies or builds a specific or selective acting cofactor for the carbohydrate-modifying enzyme ab, (c) it binds, modifies or builds a specific one Substrate for the carbohydrate-modifying enzyme, or (d) catalyzes the synthesis of an organic or inorganic compound that modifies the carbohydrate Inhibits enzyme directly or indirectly.

The present invention has over the known Antisense and co-suppression technology for switching off endogenous enzyme functions in an organism, in particular Advantage on that not from protein expression in the first Cell of the organism to complete suppression of the Enzyme production must take place, but at the appropriate time the enzyme function inhibition can be activated. For example, the inhibition of the function of GnTI a major advantage: As long as the antisense or Co-suppression of GnTI gene expression is not complete, can still form some molecules of the GnTI enzyme become. Since this enzyme is very efficient, they are sufficient remaining molecules from the unwanted xylose and Fucose residues on the trimmed "high mannose" glycosylation base structure and thus the effectiveness of the Destroy antisense or co-suppression approach. If, on the other hand, one leads to a desired one in a plant Time, for example, by the function-inhibiting reaction  Activation of an inducible promoter that the Inhibitor-encoding cDNA controls can be complete Inhibition reaction take place. The time required until Completeness of the inhibition is dependent on the "on-rate" of the Inhibitors dependent and can be determined experimentally. Once the inhibition reaction is complete, e.g. B. in a bioreactor plant, the production of a therapeutic Protein controlled via a second induced promoter to be activated. By completely inhibiting the Enzyme function is not at risk of wrong "Background reaction" more. Another according to the invention The advantage is that any that occur physiological or growth disorders (or in plants agronomic or resistance impairments) avoided can be, because only at a late point shortly before the Production of the desired substance the modification of the Carbohydrate is switched off. In this invention Approach are e.g. B. antibodies or fragments thereof particularly suitable because it is very stable in host organisms and consequently efficient molecules.

The present invention thus relates to a method for post-translational inhibition of a carbohydrate-modifying enzyme in a host organism, which is characterized in that a gene is expressed in the host organism which codes for a peptide or protein which has at least one of the following properties:

• a) it binds to the carbohydrate-modifying enzyme itself and inhibits its activity;
• b) it binds, modifies or builds a specific one or selective cofactor for the carbohydrate modifying enzyme;
• c) it binds, modifies or builds a specific one Substrate for the carbohydrate-modifying enzyme; or
• d) it catalyzes the synthesis of an organic or inorganic compound that the carbohydrate  modifying enzyme directly or indirectly inhibits.

The term "carbohydrate-modifying." Enzyme "refers to any enzyme used in the biosynthesis of free carbohydrates is involved in the organism and the Structure of free oligomeric or polymeric carbohydrates catalyzed in the biosynthesis of free carbohydrates in Organism is involved and free mono-, oligo- or polymeric carbohydrates modified, or in biosynthesis of free carbohydrates is involved in the organism and free oligomeric or polymeric carbohydrates degraded. Is too any enzyme meant in the biosynthesis of others Substances, especially proteins, bound carbohydrates in the Organism is involved and the construction of bound mono-, catalyzed oligomeric or polymeric carbohydrates in the Biosynthesis of other substances, in particular proteins, bound carbohydrates is involved in the organism and bound mono-, oligo- or polymeric carbohydrates modified or in the biosynthesis of other substances, especially proteins, bound carbohydrates in the organism is involved and bound mono-, oligo- or polymers Carbohydrates degraded.

Process for the construction of the for the invention Methods required nucleic acid constructs, i.e. H. Nucleic acid constructs that contain the gene to be expressed are known to the person skilled in the art and, for example, also described in common standard works (e.g. Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). The Gen is preferably inserted into a vector, whereby it the vector is in particular a plasmid, a cosmid, a virus, a bacteriophage or another in the Genetic engineering usual vector acts. These vectors can have other functional units that stabilize of the vector in the host organism. Furthermore, at Use of a plant as a host organism "left border" -  and contain "right border" sequences of agrobacterial T-DNA be, whereby a stable integration into the genome of Planting is made possible. Furthermore, a termination sequence be present, the correct completion of the transcription and the addition of a poly-A sequence to the transcript serves. Such elements are described in the literature (Gielen et al., EMBO J. 8 (1989), 23-29) and any exchangeable. When used in plants, these can Vectors, for example, the terminator of octopine synthase Agrobacterial gene included.

To prepare the introduction of desired genes in Host organisms, e.g. B. higher plants, are large Number of cloning vectors available, one Replication signal for E.coli and a marker gene for selection contain transformed bacterial cells. examples for such vectors are pBR322, pUC series, M13mp series, pACYC184 etc. The desired gene can be found on a suitable gene Restriction interface to be introduced into the vector. The Plasmid obtained is used for the transformation of E. coli cell len used. Transformed E.coli cells are in one suitable medium, then harvested and lysed. The plasmid is recovered. As a method of analysis to characterize the plasmid DNA obtained in general restriction analysis, gel electrophoresis and other biochemical-molecular biological methods used. After each manipulation, the plasmid DNA can be cleaved and DNA fragments obtained can be ver with other DNA sequences be knotted.

For the introduction of the above nucleic acid constructs or vectors in a plant cell are a variety of Techniques available. These techniques include the Transformation of plant cells using T-DNA from Agrobacterium tumefaciens or Agrobacterium rhizogenes as a means of transformation, the fusion of protoplasts, the Injection or electroporation of DNA, the introduction of  DNA using the biolistic method and others Possibilities.

For the injection and electroporation of DNA into plant cells len are in themselves no special requirements for the ver plasmids used. Simple plasmids, such as pUC derivatives can be used. But from such transformed cells whole plants are regenerated, there should be a selectable marker. Suitable Selectable markers are known to the person skilled in the art and for this purpose include the neomycin phosphotransferase gene, the Phosphinotricin acetyltransferase gene or that Hygromycin phosphotransferase gene. Depending on the implementation method desired genes in the plant cell can add further DNA Sequences may be required. Are z. B. for the Transformation of the plant cell, the Ti or Ri plasmid used, at least the right limit, often however, the right and left boundaries of the Ti and Ri plasmid T-DNA as a flank area with the genes to be introduced get connected.

If Agrobacteria are used for the transformation, the DNA to be inserted is cloned into special plasmids, and either in an intermediate vector or in a bi när vector (see Examples 1-3 below). Intermediaries Vectors may be due to sequences that are homologous to Sequences of the T-DNA are, by homologous recombination in the Ti or Ri plasmid of the agrobacteria can be integrated. This also contains those for the transfer of T-DNA necessary vir region. Intermediate vectors cannot Replicate agrobacteria. Using a helper plasmid the intermediate vector on Agrobacterium tumefaciens be transmitted. Binary vectors can be found in both E.coli and also replicate in agrobacteria. They contain one Selection marker gene and a linker or polylinker, which framed by the right and left T-DNA border region become. They can be transformed directly into the agrobacteria  become. The agrobacterium serving as the host cell should be Plasmid carrying a vir region included. The vir region is necessary for the transfer of T-DNA into the plant cell. Additional T-DNA may be present. That like that transformed agrobacterium is used to transform Plant cells used.

For the transfer of the DNA into the plant cell, plant Explants expediently with Agrobacterium tumefaciens or Agrobacterium rhizogenes. From the infected plant material, e.g. B. leaf pieces, stem segments te, roots, protoplasts or suspension cultivated Plant cells can then be stored in a suitable medium Antibiotics or biocides for the selection of transformed cells whole plants can be regenerated again. The Plants obtained in this way can then be switched on in the presence of led DNA to be examined. Alternative systems to The transformation of monocotyledonous plants is the Transformation using the biolistic approach, the electrically or chemically induced DNA uptake in Protoplasts, the electroporation of partially permeabilized cells that macro-inject DNA into inflorescences Microinjection of DNA into microspores and pro-embryos DNA uptake by germinating pollen and DNA uptake in Embryos through swelling (for an overview: Potrykus, Physiol. Plant (1990) 269-273). During the transformation dicotyler Plants using Ti plasmid vector systems using Agrobacterium tumefaciens is established, more recent ones Work on the fact that monocotyledonous plants of the Transformation using vectors based on Agrobacterium are accessible.

In those that can be used in the method according to the invention In principle, plants can be plants of any kind Act plant species, d. H. both monocot and dicotyledonous plants. They are preferably useful plants, especially plants such as wheat, barley, rice, corn,  Sugar beet, sugar cane, Brassicaceaen, legumes, tobacco or Potato. The expression of the desired inhibitor usable parts of plants basically affect every any part of the plant, at least propagation material and Crop products of the plants, for example fruits, seeds, Bulbs, rhizomes, seedlings, cuttings etc.

For inhibiting the activity of the carbohydrate-modifying Proteins suitable for enzyme are known to the person skilled in the art and include, for example, inhibitory or neutralizing Antibodies that bind to the enzyme, or inhibitory or neutralizing peptides (see also the following Examples 1-3). Process for making one for one certain gene encoding antibodies are known to those skilled in the art known. To do this, the antibodies with the desired one must first be used Specificity can be generated. Process for obtaining such Antibodies are known to the person skilled in the art and include for example with regard to polyclonal antibodies Use of the desired enzyme or a fragment thereof or one derived from the amino acid sequence synthetic peptide (or optionally the substrate or of the cofactor) is more suitable as an immunogen for immunization Animals and the extraction of serum. The next step will be then produced monoclonal antibodies. Procedure for Production of monoclonal antibodies are known to the person skilled in the art also known. For this purpose, cell hybrids are made, for example Antibody-producing cells and myeloma cells are produced and cloned. A clone is then selected, the produces an antibody with the desired specificity. This antibody is then isolated. Examples of cells that produce antibodies are spleen cells, Lymph node cells, B lymphocytes etc. Examples of animals that can be immunized for this purpose are mice, Rats, horses, goats and rabbits. Leave the myeloma cells from mice, rats, humans or other sources receive. Cell fusion can be done, for example, by well-known methods by Köhler and Milstein  carry out. The cell hybrids obtained by cell fusion, d. H. Hybridomas are made using the appropriate enzyme, Substrate or cofactor by the enzyme-antibody method or a similar process. Become clones obtained for example with the limit dilution method. The clones obtained become intraperitoneal to BALB / c mice injected, after 10 to 14 days the ascites fluid removed from the mouse and the monoclonal antibody by known methods, for example Ammonium sulfate fractionation, PEG fractionation, Ion exchange chromatography, gel chromatography or Affinity chromatography, purified. The nucleic acid of the desired antibody is isolated and sequenced. Of that starting from the desired nucleic acid constructs, the for the desired antibody or a fragment thereof code accordingly for the method according to the invention Standard procedures are made. The invention Antibodies not only affect antibodies that have activity inhibit the carbohydrate-modifying enzyme itself, but also those that cause the carbohydrate-modifying enzyme inhibit that they have a specific cofactor or bind specific substrate.

In a preferred embodiment of the invention The process is thus the carbohydrate-modifying enzyme inhibitory peptide or protein an inhibitory or neutralizing antibody.

The term "antibody" as used herein also applies Fragments of the antibody, e.g. B. Fab, Fv or "single chain Fv "fragments that have the same epitope specificity and effect like the full antibody exhibit. In a preferred embodiment of the method according to the invention is the antibody a catalytic antibody that the compounds mentioned above, e.g. B. enzymes, substrates or Cofactors, modified or degraded so that the usual reaction catalyzed by this enzyme no longer or only  can still run to a small extent. Such catalytic Antibodies are known to the person skilled in the art.

Process for the selection of suitable inhibitory or neutralizing peptides are also known to the person skilled in the art. This includes e.g. B. the "phage display" technology, which the rapid isolation of the desired peptide from molecular Banks allowed (Ladner et al., Directed evolution of novel binding proteins (1995); US. Patent 583 7500).

Peptides or proteins suitable for binding, modifying or breaking down a specific or selectively acting cofactor of the carbohydrate-modifying enzyme are also known to the person skilled in the art and these include, for. B. antibodies or degrading enzymes. In this context, e.g. B. on the inhibition of NAD-dependent malate dehydrogenases, such as the NAD-dependent malate dehydrogenase from chloroplasts of Arabidopsis thaliana, by NAD-binding enzymes, e.g. B. the glucose-6-phosphate dehydrogenase from Leuconostoc mesenteroides, by means of binding NAD + in chloroplasts of transgenic Arabidopsis plants. Cu ²⁺ dependent enzymes, e.g. B. the chloroplastic superoxide dismutase from spinach can be inhibited, for example, by the expression of a Cu-binding protein, such as a bovine amine oxidase from bovine, in chloroplasts of transgenic plants. Finally, the expression of human hemoglobin e.g. B. be used in transgenic tobacco for the complexation of iron, whereby the activity of iron-dependent enzymes, for. B. is inhibited by catalases.

Peptides or proteins suitable for binding, modifying or breaking down a specific substrate of the carbohydrate-modifying enzyme are likewise known to the person skilled in the art or can be isolated by known selection methods. These include, for example, the antibodies or degrading enzymes discussed above. Furthermore, the removal of the substrate can also be achieved in that the substrate is consumed by the expression of an enzyme competing for the same substrate. Such enzymes or genes coding for them can easily be determined and used by the person skilled in the art on the basis of the known metabolic pathways for carbohydrate-modifying enzymes. Here z. B. be mentioned that the synthesis of aromatic amino acids (Phe, Tyr) from the common precursor molecule L-arogenate, which either by arogenate dehydrogenase (= arogenate: NAD oxidoreductase) to phenylalanine or by arogenate dehydratase (= arogenate hydrolase) ) is converted to tyrosine. The overexpression of arogenate dehydrogenase e.g. B. from Actinoplanes missouriensis (Hund et al., Z. Naturforschung 44 (1989), 797-801) in transgenic plants leads to a preferred production of phenylalanine, the synthesis of tyrosine then being almost completely suppressed, while the overexpression of arogenate Dehydratase e.g. B. from Sorghum bicolor (Siehl and Conn, Arch. Biochem. Biophys. 260 (1988), 822-829) leads conversely to the preferred production of tyrosine and the phenylalanine formation is suppressed.

Furthermore, the method according to the invention can also be carried out by expressing in the host organism a gene which codes for an enzyme which synthesizes an organic or inorganic compound which directly, for example, modifies the carbohydrate-modifying enzyme. B. by binding to the enzyme itself, or indirectly, e.g. B. by interaction with cofactors and / or substrates inhibits. Suitable enzymes or genes coding for them are known to the person skilled in the art. It is e.g. B. referred to the finding that plant and animal diamine oxidases such. B. inhibited by histamine. Thus, these enzymes can be inhibited by the expression of an enzyme leading to the formation of histamine, e.g. B. by the expression of bacterial histidine decarboxylase from Lactobacillus (Gallagher et ah, J. Mol. Biol. 230 (1993), 516-528), which uses histidine as a substrate.

Furthermore, it can be used for the implementation of the invention Process be favorable, the inhibitor of carbohydrate modifying enzyme, e.g. B. the antibody, not only in the Host organism, especially cells thereof, but in that to bring the same subcellular compartment in which the Inhibition reaction should take place. This offers z. B. on if the inhibitory reaction should take place in the Golgi apparatus or that enzyme to be inhibited is a plastid or mitochondrial occurring enzyme.

In a preferred embodiment of the invention The method is therefore the inhibitory peptide or protein linked another peptide or protein that the Localization of the inhibitory peptide or protein within specific cell compartments of the cells of the host organism, e.g. B. the transgenic plant, for example in the plastids or mitochondria. Suitable peptides or proteins and DNA sequences coding therefor and methods for Linking with inhibitory peptides or proteins z. B. Antibodies, such that both the peptides and the proteins are still active as well as the transportation to the desired one Cell compartment takes place, are known to the expert and for example, in Anderson and Smith, Biochem. J. 240 (1986), 709-715; Baszczynski et al., Nucl. Acids Res. 16 (1988), 4732 described. In a particularly preferred embodiment of the The method according to the invention is the one for inhibition peptide or protein used linked peptide or protein a Golgi, plastid, or mitochondrial localization signal.

Furthermore, in a preferred embodiment of the inventive method that for the desired protein coding gene linked to an inducible promoter what e.g. B. the inhibition of the carbohydrate-modifying enzyme and z. B. the change in glycosylation patterns in one transgenic plant allowed at a desired time. Suitable promoters are known to the person skilled in the art and for this purpose include the anaerobically inducible GapC4 promoter  from maize (Bülow et al., Molecular Plant Microbe Interactions 12, (1999), 182-188), the ethylene inducible PAL promoter or "Hydroxyproline rich glycoprotein" promoter (Ecker and Davies, Proc. Natl. Acad. Sci. USA 84, (1987), 5202-5206) or the ethanol-inducible promoter from Aspergillus nidulans (Caddick et al., Nature 16, (1998), 177-180).

In a further preferred embodiment of the the method according to the invention is the carbohydrate modifying enzyme one that participates in starch synthesis or protein glycosylation is involved. For example it's an invertase, an ADP-glucose pyrophosphorylase, an α- (1,6) fucosyl transferase or a β-mannosidase. Is particularly preferred as a carbohydrate-modifying enzyme "Granule Bound Starch Synthase" (GBSS) or β-1,2-N- Acetylglucosaminyltransferase I (GnTI).

Are as host organisms in the process according to the invention Plants, especially crops and especially wheat, Barley, corn, sugar beet, sugar cane, one Brassicaceae, one Legume, tobacco and a potato plant preferred.

The present invention also relates to plant seeds, Plant cells or plants, e.g. B. Plants that a gene described above for expressing a peptide or Protein for post-translational inhibition of a carbohydrate modifying enzyme included.

The following examples illustrate the invention.

example 1 Inhibition of GBSS activity in transgenic Potatoes by Expression of a specific scFv antibody

The DNA for the transit peptide from the gene coding for the small subunit of ribulose-biphosphate carboxylase (for plastid localization) (Anderson and Smith, Biochemical Journal 240 (1986), 709-715) was modified by means of a PCR reaction in such a way that an NcoI restriction site was inserted at the 5 'end and the sequence GTCGAC, which contains a SalI site, was inserted at the 3' end. The PCR reaction included the following primer sequences: 5 ': CCATGGCTTCTATGATATCCTCTTCAG; 3 ': GTCGACGCACTTT ACTCTTCCACCATTGC; The cDNA for a "Granule Bound Starch Synthase" (GBSS) inhibiting scFv antibody was modified by means of a PCR reaction in such a way that at the 5 'end the sequence GTCGAC, which contains a SalI restriction site, and at the 3' end an XbaI- Restriction interface were inserted. The PCR reaction comprised the following primer sequences: 5 ': GTCGACATGAAATACCTATTGCCTAC; 3 ': TCTAGATGCGGCCGCACCTAGGACGG. Both cDNA fragments were digested with NcoI and SalI or SalI and XbaI, so that overhanging ends were formed. The cDNA fragments obtained were simultaneously inserted into the vector pRT100 (Töpfer et al., Nucleic Acids Research 15 (1987), 5890; Odell et al., Nature 313 (1985), 810), which contains an expression cassette with the CaMV 35S- Contains promoter and termination sequences. After cleavage with HindIII, the expression cassette coding for the recombinant scFv antibody was isolated and inserted into the binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-598; Porsch et al., Plant Molecular Biology 37 : 581-585 (1998). The expression vector pSR 8-30 / t-scFv (GBSS) was obtained.

This was used to transform E.coli SM10. Transformants were mixed with Agrobacterium GV 3101 and incubated overnight at 28 ° C (Koncz and Schell, Molecular and General Genetics 204 (1986), 383-396; Koncz et al., Proc. Natl. Acad. Sci. USA 84 (1987 ), 131-135). Selection was carried out for carbenicillin, the bla gene required for this being present in the above expression vectors. Selection clones of Agrobacterium tumefaciens were cut from leaves of the potato plant cv and cut several times on the middle rib. Désirée applied and the leaves were incubated for 2 days at 20 ° C in the dark. The agrobacteria were then washed off and plant growth substances were added to the potato leaves, so that shoots regenerated preferentially. Furthermore, non-transformed cells in the potato leaves were killed by adding kanamycin to the plant medium. Growing shoots were cut off and rooted on medium without plant growth substances, but with kanamycin. The further cultivation of the potato plants was carried out in the usual way.

The detection of the expressed scFv antibody was carried out by antibodies that bind to scFv or protein L in a Western blot or ELISA. For this purpose, the total protein of the potato material was isolated and used in the corresponding detection methods. The biological effect of inhibiting GBSS activity in the transgenic potato tubers and the resulting change in the starch composition has been demonstrated by biochemical separation methods known to the person skilled in the art (Kuipers et al., Plant Molecular Biology 26 (1994), 1759-1773).

It was shown that the plastid expression of the recombinant antibody inhibited GBSS function. Further showed that this caused the composition of the starch was changed.

Example 2 Inhibition of GnTI activity in transgenic Potato plants by expression of a specific scFv antibody

The DNA for the Golgi localization signal was derived from the gene encoding rabbit β-1,2-N-acetylglucosaminyltransferase I (GnTI) (Burke et al., J. Biol. Chem 267, (1992), 24433-24440) by means of a PCR reaction (5 'primer sequence: CCATGGATGCTGAAGCAGTCTGCTGG; 3' primer sequence: GTCGACACGTGTCCAGAAGAAGAGGAGGAG) so modified that at the 5 'end an NcoI interface and at the 3' end the sequence GTCGAC, which is a SalI Interface contains, were inserted. The cDNA for a GnTI-inhibiting scFv antibody was determined by means of a PCR modification reaction (5 'primer sequence: GTCGACATGAAATACCTATTGCCTAC; 3' primer sequence: TCTAGATGCGGCCGCACCTAGGACGG at the 5 'end by incorporating the sequence GTCGAC, which has a SalI interface The cDNA fragments were digested with NcoI + Sall or Sall + XbaI so that overhanging ends were formed. The cDNA fragments obtained were inserted into the vector pRT110, which contains an expression cassette with CaMV 35S promoter and termination sequences (Töpfer et al., Nucleic Acids Reserch 15 (1987), 5890; Odell et al., Nature 313 (1985), 810-812). After cleavage with HindIII, the for the recombinant scFv antibody-coding expression cassette isolated and inserted into the binary vector pSR 8-30 (Düring et al., Plant Journal 3 (1993), 587-598; Porsch et al., Plant Molecular Biology 37 (1998), 581-585 ) The Expr essence vector pSR 8-30 / g-scrv (GnTI) obtained. Transgenic potato plants were produced as described in Example 1.

The inhibition of GnTI activity was demonstrated by the Enzyme activity test methods known to those skilled in the art (Schaewen et al., Plant Physiology 102: 1109-1118 (1993) or standardized structural analysis methods of Glycosylation residues on vegetable proteins (Lerouge et al., Plant Journal 10 (1996), 713-719).

It was shown that the Golgi localization of the recombinant Antibody inhibits the GnTI function. It was also shown that thereby the composition of the glycosylation residues vegetable proteins were modified and none α (1,3) -Fucose- and β (1,2) -xylose residues contained more.  

Example 3 Inhibition of GnTI activity in transgenic Potato plants by expression of a inhibitory peptide

The DNA for the Golgi localization signal was derived from the gene encoding rabbit β-1,2-N-acetylglucosaminyltransferase I (GnTI) (Burke et al., J. Biol. Chem. 267 (1992), 24433-24440) by means of a PCR reaction (5 'primer sequence: CCATGGATGCTGAAGCAGTCTGCTGG; 3' primer sequence: GTCGACACGTGTCCAGAAGAAGAGGAGGAG) so modified that at the 5 'end an NcoI interface and at the 3' end the sequence GTCGAC, which is a SalI Interface contains, were inserted. The cDNA for a GnTI-inhibiting peptide which is contained in the protein hPSTI (GnTI) selected from the "peptide phage display bank"("pSKAN Phagemid Display System", MoBiTec, Göttingen, Germany) (Rottgen and Collins, Gene 164, (1995), 243-250) was modified in this way by means of a linker ligation (at the 5 'end with the 5'-phosphorylated oligonucleotide CCGTCGACAT and at the 3' end with the 5'-phosphorylated oligonucleotide GCTCTAGAGC), that it received a ScaI site at the 5 'end and an XbaI restriction site at the 3' end. Both modified cDNA fragments were digested with the restriction enzymes NcoI and SalI or SalI and XbaI, so that overhanging ends were formed. The cDNA fragments obtained were inserted into the vector pRT110, which contains an expression cassette with CaMV 35S promoter and termination sequences (Töpfer et al., Nucleic Acids Research 15 (1987), 5890; Odell et al., Nature 313 (1985), 810-812). This gave the new vector pRT110 / g hPSTI (GnTI). After cleavage with HindIII, the expression cassette coding for the recombinant protein g-hPSTI (GnTI) was isolated and inserted into the binary vector pSR 8-30 (Duringing et al., Plant Journal 3 (1993), 587-598; Porsch et al. , Plant Molecular Biology 37 (1998), 581-585). The expression vector pSR 8-30 / g-hPSTI (GnTI) was obtained. Transgenic potato plants were produced as described in Example 1.

The inhibition of GnTI activity was demonstrated by the Enzyme activity test methods known to those skilled in the art (Vischer and Hughes, Eur. J. Biochem. 177, (1981), 275-284) or standardized structural analysis methods of Glycosylation residues on vegetable proteins (Lerouge et al., Plant Journal 10 (1996), 713-719).

It was shown that the Golgi localization of the recombinant Proteins inhibits GnTI function. It was also shown that thereby the composition of the glycosylation residues vegetable proteins were modified and none α (1,3) -Fucose- and β (1,2) -xylose residues contained more.

Claims (14)

1. A method for post-translational inhibition of a carbohydrate-modifying enzyme in a host organism, wherein a gene is expressed in the host organism which codes for a peptide or protein which has at least one of the following properties:

• a) it binds to the carbohydrate-modifying enzyme itself and inhibits its activity;
• b) it binds, modifies or degrades a specific or selectively acting cofactor for the carbohydrate-modifying enzyme;
• c) it binds, modifies or degrades a specific substrate for the carbohydrate-modifying enzyme; or
• d) it catalyzes the synthesis of an organic or inorganic compound which directly or indirectly inhibits the carbohydrate-modifying enzyme.

2. The method of claim 1, wherein in the host organism for several different peptides or proteins coding genes are expressed. 3. The method according to claim 1 or 2, wherein the peptide or Protein an inhibitory or neutralizing antibody is. 4. The method of claim 3, wherein the antibody is a is catalytic antibody. 5. The method according to any one of claims 1-4, wherein the inhibitory peptide or protein with another peptide or protein that is linked to the location of the inhibitory peptide or protein within one  specific cell compartment of the cells of the Host organism. 6. The method according to claim 5, wherein the further peptide or protein a Golgi, plastid or mitochondria Localization signal is. 7. The method according to any one of claims 1-6, wherein the or the genes expressed in the host organism with a inducible promoter are functionally linked. 8. The method according to any one of claims 1-7, wherein the Carbohydrate-modifying enzyme is an enzyme that is linked to the starch synthesis is involved. 9. The method of claim 8, wherein the enzyme "granule Bound Starch Synthesis "is. 10. The method according to any one of claims 1-7, wherein the Carbohydrate-modifying enzyme is an enzyme that is linked to protein glycosylation is involved. 11. The method of claim 10, wherein the enzyme β-1,2-N- Acetylglucosaminyltransferase I (GnTI). 12. The method according to any one of claims 1 to 11, wherein the Host organism is a useful plant. 13. The method of claim 12, wherein the crop Wheat, barley, corn, sugar beet, sugar cane, one Brassicaceae, a legume, tobacco or one Potato plant is. 14. Plant seeds, plant cells or plants that have the following contain one of the claims 1-11 defined gene.