DD296700A5 - METHOD FOR PRODUCING A NUCLEOTIDE SEQUENCE CODED FOR THE AMPHIREGULIN GENE AND MODIFIED CELLS CONTAINING THIS NUCLEOTIDE SEQUENCE. - Google Patents

Abstract

The present invention relates to a process for producing a nucleotide sequence coding for the amphiregulin gene and modified cells containing said nucleotide sequence, characterized in that the RNA is separated from cells which express an amphiregulatory activity and optionally further purified and purified isolating the coding DNA by cDNA cloning; or separating the genomic DNA, cleaving and isolating the encoding DNA by genomic cloning; and optionally coupling the respective isolated DNA fragment with a control sequence for controlling replication, transcription and / or translation; Host cells are transformed with an expression vector comprising a nucleotide sequence prepared in this way and cultured these cells. {Method; manufacture; amphiregulin; fragments; peptides; proteins; nucleotide sequence; modified cell; plasmid; Antibody; pharmaceutical agent; Medicine; neoplasia; Wound care; bone resorption; Immune response}

Description

-2- 296 Field of application of the invention

1 Introduction

The present invention relates to a method for producing a nucleotide sequence coding for the amphiregulin gene and modified cells containing this nucleotide sequence. This allows the production of the bifunctional growth regulatory factor amphiregulin in larger quantities. Amphiregulin shows a strong inhibition of the growth of several tumor-derived cell lines while promoting the cell growth of several other cell lines. Furthermore, a further therapeutic scope for this bifunctional growth regulator is described, such. For the treatment of wounds and for the diagnosis and treatment of cancer. The nucleotide sequences can be used as probes for detecting the biosynthesis of amphiregulin.

Characteristic of the known state of the art

2. State of the art

Cellular growth and differentiation seems to be accelerated, sustained, and regulated by a variety of stimulatory, inhibitory, and synergistic factors and hormones. The change and / or collapse of the cellular homeostatic mechanism seems to be the fundamental cause of growth-related diseases, including neoplasia. Growth modulating factors are involved in a variety of pathological and physiological processes such as signal transduction, cell communication, growth and development, embryogenesis, immune response, hematopoesin, cell survival and differentiation, inflammation, tissue repair and remodeling, atherosclerosis and cancer. Because of their potential use in the diagnosis, prognosis and treatment of cancer, there is great interest in their isolation and characterization as well as in the elucidation of the functional mechanisms of growth-regulating factors. In addition, understanding these factors may lead to a better understanding of basic mechanisms of normal growth control and their loss in cancer cells.

Factors such as epidermal growth factor (EGF), transforming growth factor-α (TGF), platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), nerve growth factor (NGF), transforming growth factor-ß (TGF ß) , Insulin growth factor I and II (IGF I, IGF II), hematopoietic growth factor, such as erythropoietin, colony stimulating factors (CSF 1 and 2), interleukins (IL-1 to 6), interferons (IFN α, β, γ ), Tumor necrosis factor α and β (TNFα, β), leucoregulin, oncostatin M and other less defined factors are proteins that modulate growth and differentiation and are of different cell types either under normal physiological conditions or in response to an exogenous one Stimulation produced. Most of these factors appear to be autocrine or paracrine. (Goustin et al., 1986, Cancer Res. 46: 1015-1029; Rozengurt, 1986, Science 234: 161-166; Pardee, 1987, Cancer Res. 47: 1488-1491; Sachs, 1986, p. Amer : 40-47, Marshall 1987, Cell 50: 5-6, Melcher and Anderson, 1987, Cell 30: 715-720, Clemens and McNurlan, 1985, Biochem J. 226: 345-360, Nathan, 1987, J. Chem. Clin Invest 79: 319-326, Sporn and Roberts, 1986, J. Clin Invest 78: 329-332, Old, 1987, Nature 326: 330-331, Beutler and Cerami, 1987, New Eng Weinstein, J. Cell Biochem., 33: 213-224; Zarling et al., 1987, Proc Natl. Acad., See, USA 83: 9739-9744, Sporn and Todaro, Med., 316: 379-385; Eng., J. Med. 303: 878-880; Sporn and Roberts, 1985, Nature 313: 745-747). Biologically active phorbol esters, such as α-O-tetradecanoyl-phorbo MS acetate (TPA), are in vivo effective tumor promoters and triggers and modulators for a wide variety of biological and biochemical reactions both in vivo and in vitro (Blumberg, 1981, Crit. Rev. Toxicol 9: 153-197; Slaga, 1983, Cancer Surv. 2: 595-612). It has been known for some time that TPA inhibits the growth of the human breast adenocarcinoma cell line MCF-7. In addition, TPA alters the morphology of MCF-7 cells in that TPA-treated cells exhibit morphological features of secretory cells (Osborne et al., 1981, J. Clin Invest 67: 943-951, Valette et al., 1987 , Cancer Res. 47: 1615-1620).

Object of the invention

The aim of the invention is to provide nucleotide sequences which encode the amphiregulin gene and modified cells which contain this nucleotide sequence and which can be used for the production of amphiregulin.

Explanation of the essence of the invention

It is an object of the present invention to provide methods of producing a nucleotide sequence encoding the amphiregulin gene and modified cells containing this nucleotide sequence.

3. Summary of the invention

The present invention relates to amphiregulin, a growth-regulating factor which has unusual cell growth-regulating activity. Amphiregulin inhibits the growth of neoplastic cells and enhances the growth of certain normal cells. Amphiregulin is an extremely hydrophilic glycoprotein with an average molecular weight of 22,500 daltons, and is found in two distinct but functionally equivalent forms, a truncated and a larger. With the exception of the additional six N-terminal residues found in the larger form, the two forms are absolutely homologous at the amino acid level (Figure 12). The present invention is based in part on the observation that TPA-treated MCF-7 cells release a glycoprotein which inhibits the growth of the A431 and other tumor cell epidermal cancer cell lines but promotes the growth of normal human fibroblasts and some other cells.

The present invention will be described by way of example in which amphiregulin is detected, purified to homogeneity and characterized structurally and functionally accurately. In other examples, the isolation and sequencing of both cDNA and genomic clones encoding the amphiregulin precursor is described. These clones are used to produce expression vectors capable of directing a high rate of synthesis of biologically active amphiregulin in transformed bacteria and transfected eucaryotic host cells. A wide variety of applications for this factor is shown in the description.

4. Short description of the figures

Fig. 1: preparative reversed-phase HPLC of flow and wash fraction

2: semi-preparative reversed-phase HPLC of the combined fractions 47 to 62 from FIG. 1

Fig. ЗA: analytical reversed-phase HPLC of pool I of the previous run Fig. 3B: analytical reversed-phase HPLC of pool II of the previous run,

FIG. 4: Gel permeation chromatography of fractions from FIGS. 3A and 3B with Bio-SilTSK250 columns. The

Chromatography was performed as described in Section 6.3.2. described, performed.

(A) HPLC of the concentrated fraction 35 (Fig.

(B) HPLC of concentrated fraction 36 (Fig.

(C) HPLC of Concentrated Fraction 37 (Fig.

(D) HPLC of concentrated fractions 41 and 42 together (Figure 3B);

Fig. 5: Analysis of purified AR and S-pyridylethylated-AR (SPE-AR) by gel permeation HPLC

Bio-Sil TSK 250 columns. Chromatography was performed as described in Section 6.3.2. described, performed. The molecular weight standard used was ovalbumin, 43 kD; Chymotrypsinogen A, 25 kD; Ribonuclease 14 kD; and insulin, 6 kD;

(A) AR

(B) SPE-AR;

Figure 6: Analysis of AR and SPE-AR on a reversed-phase Ultrapore RPSCC3 column (4.6mm x 75mm)

a gradient between 0.1% TFA as the first solvent and acetonitrile with 0.1% TFA as the second solvent at a flow rate of 1 ml / min, at room temperature. 1ml fractions were collected.

(A) AR

(B) SPE-AR

Figure 7: SDS-PAGE analysis of AR proteins

(A) a 15% SDS PAGE gel (0.75mm x 18cm x 15cm, Bio-Rad) in a discontinuous buffer system was developed at a constant current of 30mA. As molecular weight standards were used: phosphorylase B, 92.5kD; BSA, 66.2 kD; Ovalbumin, 43 kD; Carbonic anhydrase31 kD; Chymotrypsinogen A, 25.7 kD; Soybean trypsin inhibitor, 21.5kD; Lactoglobulin, 18.4kD; Lysozyme, 14.4 kD; Aprotonin, 6.2 kD; and insulin subunit, 3 kD.

Lane 1: AR, Lane 2: NG-AR Lane 3: SPE-AR Lane4: NG-SPE-AR

(B) 20% STS-PA-GE minigel (0.75 mm x 10 cm x 7 cm) developed at a constant voltage of 200 V. The same molecular weight standards were used.

Lane 1: AR Lane 2: NG-AR

Lane 3: Phospholipase treated with NG-AR separated on rp HPLC. Figure 8: IEF analysis of ^w l-labeled AR. The following standards with pl values between 4.65 and 9.6 were

used: phycocyanin, 4.65; β-lactoglobulin B, 5.1; Bovine carboanhydrase, 6.1; Human carbonic anhydrase, 6.5; Equine myoglobin, 7.0; Whale carbonic anhydrase 6.5; a-chymotrypsin, 8.8; and cytochrome C, 9,6.

Figure 9: (A) Dose-response curve of AR on inhibition of ¹²⁶ L deoxyuridine incorporation into DNA of A-431 cells;

(B) Influence of AR on the Stimulation of ¹²⁵ I Deoxyuridine Incorporation Into Human Foreskin Fibroblast DNA (Sadamoto).

Figure 10: Influence of ¹²⁵ I-EGF binding on fixed A-431 cells or A-431 plasma membranes by mouse EGF and AR. Binding tests were performed as described in Section 6.1.5. 100 μΙ or δΟ μΙ samples in wells were used for tests with fixed cells or membranes.

symbol Type of recipe competitor • Fixed cells EGF ▲ Fixed cells AR O membrane EGF Δ membrane AR

Fig. 11: Hydropathicity analysis of AR and human EGF (Kyte and Doolittle)

(A) AR (residues 1-84)

(B) AR (residues 44-84)

(C) EGF (residues 1-53)

(D) AR precursor (residues 1-252) and EGF (residues 1-53)

(The arrangement is as shown in Figure 13 such that cysteine, residue 46 of mature AR corresponds to cysteine residue # 6 of matured EGF);

Figure 12: Amino acid sequence of mature AR and truncated AR. It became the standard one-letter code for Amino acids used: Alanine (A), arginine (R), asparagine (N), aspartic acid (O), cysteine (C), glutamine (Q), glutamic acid (E), Glycine (G), histidine (H), isoleucine (I), leucine (L), lysine (K), methionine (M), phenylalanine (F), proline (P), serine (S), Threonine (T), tryptophan (W), tyrosine (Y) and valine (V).

FIG. 13: Comparison of the amino acid sequences of amphiregulin (AR) and members of the EGF superfamily FIG. 14: (A) ¹²⁵ I-AR binding to cellulose (OO), denatured DNA-cellulose (DD) and native DNA-cellulose ( A - Δ)

(B) ^12S I-AR binding to cellulose (O-O) and to DNA-cellulose (D-D) is compared to ¹²⁶ L-EGF binding

on cellulose (Δ-Δ) and on DNA-cellulose (V-V) Fig. 15: Synthetic amphiregulin peptides produced by solid phase technique. Five peptides corresponding to residues 166-184 (# 259), 108-130 (# 264), 31-50 (# 279) 71-90 (# 280), and 221-240 (# 281) synthesized by means of solid-phase synthesis and subsequently by means of the reverse phase

HPLC purified Fig. 16: nucleotide sequence and deduced amino acid sequence descDNA clone spar I for human amphiregulin;

Figure 17: Genomic human amphiregulin sequence Figure 18: Schematic diagram of the exon structure and protein domains of the AR molecule with respect to the genomic sequence

Fig. 19: nucleotide sequence of the pDCHBAR 1 expression vector Fig. 20: nucleotide sequence for pTacAPAR 1; Fig. 21: Nucleotide sequence of pTacAPHILE.

5. Detailed description of the invention

The present invention relates to amphiregulin (AR), nucleotide sequences coding for AR and the AR precursor and the Production of AR using conventional or recombinant DNA methods. AR, a new cell-growth-regulating factor, is being different from TPA-treated MCF-7 cells in two, but

functionally equivalent forms expressed and secreted. The two forms are structurally identical with the exception of six additional amino-terminal residues in the larger form. AR has a very potent inhibitory activity on the

DNA synthesis in neoplastic cells and therefore can be used as an effective antitumor compound. From

Of particular interest is the ability of AR to promote the growth of fibroblasts and other normal cells. AR can therefore be of use in the treatment of such conditions requiring cell growth acceleration (e.g.

Burns and wounds). AR, its fragments or derivatives have widespread potential therapeutic utility in the art Treatment and monitoring of neoplasia, as well as in wound treatment. AR can also be used to modulate the Bone resorption and the immune response, as well as to stimulate the arachidonic acid cascade be used. The Amphiregulants and the gene products, processes for their preparation and their use are described in detail in

following subsections and described in the examples.

5.1 Preparation and purification of amphiregulin

Amphiregulin is secreted by the human breast carcinoma cell line MCF-7 upon treatment with the tumor-stimulating compound 12-0-tetradecanoyl-phorbol-13-acetate (TPA). Amphiregulin can also be isolated from the conditioned media of such cultured TPA-treated MCF-7 cells and subsequently purified to obtain high specific activity. Amphiregulin may also be isolated from other cell lines, with or without induction, by treatment with TPA or other tumor-stimulating compounds. On the other hand, amphiregulin can be produced by recombinant DNA techniques or by solid phase peptide synthesis.

Amphiregulin can be purified using various methods and techniques known in the art, including e.g. Chromatography (e.g., reversed phase, liquid, gel exchange, liquid exchange, ion exchange, size exclusion, and affinity chromatography), centrifugation, electrophoresis, different solubility, or other standard techniques for purifying a protein.

According to a specific embodiment of the present invention, MCF-7 cells are treated with TPA for 48 hours and grown in fresh serum-free medium for 4 days. The resulting conditioned medium is separated and as described in section

6.2, used to make unpurified AR. A combination of reversed-phase liquid and gel permeation chromatography can be used to purify AR to homogeneity as described in Section 6.3. Purified AR is obtained which is 1842 times to 2700 times enriched in comparison to the starting material. The method is reproducible and gives AR preparations with specific activities between 2.7 and 3.4 × 10 ⁶ units / mg protein.

5.2 Amphirae training

5.2.1 Isolation and cloning of amphiregulin gene

According to the invention, the coding nucleotide sequence for human amphiregulin or a functional equivalent thereof Production of recombinant molecules which control the expression of the human amphiregulin product. The coding nucleotide sequence for AR can be isolated from cells that produce AR-like activity. For example, according to a specific embodiment, the human breast carcinoma cell line MCF-7 is the source of the AR-encoding nucleotide sequence used. One can copy the coding sequence by cDNA cloning of such cells

recovered and purified RNA or obtained by genomic cloning. One can either a cDNA or genomic

Genbank of clones from the generated DNA fragments using techniques known from the prior art

are known and use, for example, restriction enzymes.

Fragments containing the AR gene can be identified in a variety of ways using known methods. For example, part of the amino acid sequence of AR can be used to derive the corresponding DNA sequence, and then the DNA sequence is chemically synthesized, radioactively labeled and used as a hybridization probe.

Other methods for isolating the AR gene include, for. B. the chemical synthesis of the gene sequence itself based on a known sequence z. B. derived from the amino acid sequence of AR. On the other hand, in vitro translation of selected mRNA followed by functional or immunological assays with the translated products can be used. The identified and isolated gene can then be inserted into a suitable cloning vector. A large number of vector host systems are known and applicable in the art. Possible vectors include e.g. As plasmids or modified viruses, wherein the vector system and the host cell are compatible. Such vectors are e.g. Bacteriophages, such as λ derivatives or plasmids, such as pBR322 and pUC plasmid derivatives. Recombinant molecules can be introduced into the host cell via transformation, transfection, infection, electroporation, etc. In a particular embodiment, the AR gene expressed from MCF-7 cells is cloned by selecting mRNA which is produced in response to treatment of MCF-7 cells with TPA and constructing a cDNA library in bacteriophage λ gt10 , Since untreated MCF-7 cells apparently do not synthesize and secrete AR protein, it has been thought that the induction of AR by TPA is also noticeable at the transcriptional level and that such a cDNA library contains elevated levels of AR-containing sequences Contains dimensions. Screening of the cDNA library with degenerate and best guess oligonucleotides based on the use of human codons (Lathe, 1985, J. Mol. Biol. 183: 1-12 and Section 8.1., Supra) resulted in isolation These cDNA clones were then used to characterize the AR mRNA and the AR gene, and the nucleotide sequence of the AR cDNA (Section 8.2, above and Fig. 16) can be used to derive the primary AR gene. Due to the inherent degeneracy of the coding nucleotide sequence, other DNA sequences which encode substantially the same or a functionally equivalent amino acid sequence may also be used to carry out the methods of the present invention Such changes in the AR nucleotide sequence include deletions, additions, or Substitutions of different nucleotides resulting in a sequence coding for the same or a functionally equivalent gene The gene product may contain deletions, additions or substitutions of amino acid residues within the sequence which result in silent changes to produce a bioactive product. Such amino acid substitutions may be on the basis of similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity, and / or amphiphatic nature of the residues involved. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; Amino acids with uncharged polar head groups or non-polar head groups with similar hydrophilicity values include the following compounds: leucine, isoleucine, valine, glycine, alanine, asparagine, glutamine, serine, threonine, phenylalanine, tyrosine.

The AR cDNA can be used as a probe to detect AR mRNA in TPA-induced MCF-7 cells. The AR mRNA has a length of about 1400bp.

As described in Section 9, below, the AR cDNA can be used to characterize the AR gene. The assignment of the chromosome for the human AR gene was determined by in situ hybridization of ³ H-labeled AR cDNA with normal metaphase chromosomes. As a result, the human AR gene was found on chromosome 4 in the region 4ql13-21, which was thought to play some role in the differentiation of lymphocytes (see Section 9.2, below). The cDNA was also used to isolate the genomic DNA comprising the entire AR gene, including the 5 'regulatory region. The AR gene was found to be 10kb in length and divided into 6 exons. The 5 'regulatory region was incorporated into an expression vector containing a promoter-free chloramphenicol acetyltransferase (CAT) gene. This construction was capable of stimulating transcription of the CAT gene after transient introduction into MCF-7 cells. Addition of TPA stimulated 6- to 7-fold activity (see section 9.4 below). According to particular embodiments of the present invention, this 5'-regulatory region can be used in expression vectors to control the transcription of the AR gene or other structural genes. The chimeric AR-CAT construction can also be used to search for factors that regulate the expression of AR (see Section 9 and following).

5.2.2 Construction of the expression vector containing the coding sequence for amphiregulin In order to express biologically active AR in mature form, such a vector / host system should be chosen, not for high transcription and translation rates, but also for correct processing of the gene product provides. This is especially important when the entire coding sequence of the amphiregulin precursor is used in the expression construct, as the mature form of amphiregulin is likely to be derived from a precursor product via cellular processing events. For example, a mammalian host cell system may be selected for its ability to correctly process and secrete amphiregulin into the extracellular environment. In the present case, in particular, two forms of mature amphiregulin appear to be synthesized as the middle portion of a common 252-amino acid precursor, from which the two mature forms are released by differential proteolytic processing. In addition, amphiregulin will be glycosylated and further subjected to tyrosine sulfation, again highlighting the importance of selecting the expression system capable of performing these post-translational modifications, if desired in the final product. A variety of animal / host expression vector systems (i.e., vectors containing the necessary elements to direct replication, transcription, and translation of the coding AR sequence in a suitable host cell) are known to those skilled in the art. These include, for example, virus expression vector / mammalian host cell systems (e.g., cytomegalovirus, vaccinia virus, adenovirus, and the like) insect virus expression vector / insect cell systems (e.g., baculovirus); or non-viral promoter expression systems derived from the genomes of mammalian cells (e.g., the mouse metallothionein promoter). The expression elements of these vectors differ in their strength and specificity. Depending on the host / vector system used, any of a number of suitable transcriptional and translational elements may be used. For example, when cloning in a mammalian cell system, promoters derived from the

Genome of mammalian cells (eg, mouse metallothionein promoter) or from viruses that proliferate in these cells (eg, vaccinia virus 7.5K promoter or the "Moloney murine sarcoma virus long terminal repeat") Recombinant DNA or synthetic methods can also be used to transcribe the inserted sequence.

In addition, specific initiation signals are required for adequate translation of the inserted protein coding sequence. These signals include the ATG initiation codon and adjacent sequences. In the event that the entire AR gene, including its own initiation codon and adjacent sequences, were inserted into an appropriate expression vector, no additional translation control signals are required. However, if only part of the coding sequence is inserted, exogenous translational control signals including the ATG initiation codon must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the AR coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of different, both natural and synthetic origin. The effectiveness of the expression can be increased by incorporation of transcriptional attenuation sequences, enhancer elements, etc.

Any method already described for inserting DNA fragments into a vector may be used to construct expression vectors containing the AR gene and appropriate transcriptional / translational control signals. These methods may involve in vitro recombinant DNA techniques, synthetic techniques and in vivo recombinations (genetic recombination).

For example, when an adenovirus is used as the expression vector, the AR coding sequence may be linked to the adenovirus transcriptional / translational control complex, e.g. B. the "late promoter" and "tripartite Ieader" sequence are ligated. These chimeric genes can then be inserted into the adenovirus genome by in vitro or in vivo recombination. Insertion into a non-essential region of the viral genome (e.g., E1 or E3 region) results in an intact recombinant virus capable of expressing AR in the infected host. Similarly, the Vaczina 7.5 K promoter can be used.

An alternative expression system for the expression of AR is an insect system. In such a system, nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The AR-encoding substance may be cloned in non-essential regions (eg, the polyhedrin gene) of the virus under the control of an AcNPV promoter (eg, the polyhedrin promoter). Successful insertion of the AR coding sequence results in inactivation of the polyhydric ring and production of non-occluded recombinant viruses (i.e., viruses without the protein envelope encoded by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted gene is expressed.

Retroviral vectors provided in amphotropic packaging cell lines enable very effective expression in numerous cell types. This method allows the determination of a cell-type-specific processing, regulation or function of the inserted protein-coding sequence.

In addition, a host cell strain can be selected which modulates the expression of the inserted sequence or modifies and processes the gene product as desired. Promoter-dependent expression may be increased in the presence of certain inducers (eg, zinc or cadmium ions for metallothionine promoters). This allows the expression of genetically engineered AR to be controlled. This is important in the event that the protein product of the cloned foreign gene acts lethal on host cells. Furthermore, modifications (e.g., glycosylation) and processing (e.g., cleavage) of the protein product are important to the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins. Suitable cell lines of the host system can be selected to ensure the correct modification and processing of the expressed foreign protein

 Examples of expression vectors used according to the invention are:

PlasmidpSV2Neo

Plasmid pSV2 Neo is described in Southern et al., (1982) J. Mol. Applied Genetics 1,327-341.

PlasmidpSV2dhfr

The plasmid pSV2dhfr (Subramani et al., 1981, Mol. Cell. Biol. 1,854-864) contains the murine dihydrofolate reductase gene (dhfr) under the control of the SV40 promoter.

Plasmid рНЗМ

The plasmid рНЗМ (Aruffo et al., 1987, Proc Natl. Acad. Sci., USA, 84, 3665-3369) contains a chimeric promoter composed of the human cytomegalovirus (CMV) AD169 immediate early enhancer linked to HIV LTR. Positions -67 to +80. LTR is followed by a polylinker with the 5 'to 3' junctions: Hind III, XbaI, Xhol, BstXI, Xhol, Pst I and Xba 1. The small t antigen splice / polyadenylation signals of pSV 2 and an SV40 "Origin" of replication is located downstream of the polylinker (in the З 'direction), the latter allowing amplification in cells containing the SV40 large T antigen (the COS and WOP cells). A suppressor tRNA gene favors growth in pVX-related vectors and bacteria bearing the P3 plasmid (such as MC1061 / P3).

Plasmid pH ЗМ / ЬОпсМ

Plasmid рНЗМ / ЬОпсМ was provided by Najma Malik, Oncogen. It contains the simian TGF-β-δ 'untranslated sequence and the leader sequence linked to the Oncostatin M coding sequence and inserted pH 3M and at the Hind III / Xho I (filled) interface. The TGF-β sequence consists of the 85 bp 5 'untranslated region beginning at a HindIII site (starting from the pSP65 polylinker) and an adjacent Pst I site of the TGF-β cDNA, followed by 87 bp, which encode the 29-amino acid long signal sequence, which is normally cleaved between a glycine leucine dipeptide sequence.

PlasmidpH3ARP

The plasmid pH 3ARP is a рНЗМ-derived vector designed for transient expression of the AR precursor in COS cells. The plasmid contains 13bp of the AR 5 'untranslated region and the entire coding sequence as well as З' untranslated sequences. This plasmid was prepared by ligating the 4kb fragment of the рНЗМ vector after digestion with Hin III and XbaI, with the oligonucleotides EVSAL3 and EVSAL4 and the gel-purified 1.1 kb Hgal / XbaI cDNA fragments from pAR1. EVSAL3 and EVSAL4 are complementary to the 5'-Hind III, EcoRV, Sal I, and Hga! Interfaces. The construction also contains the EcoRI to Xbal polylinker sites of pEMBL18 following the S 'untranslated region.

5 ' EcoRV Hga I 3 ' Hind III Sail EVSAL3 AG CTTGATATCGTCGA EVSAL4 ACTATAGCAGCTGACGC

Plasmid pSVDR / bOM

The plasmid pSVDR / bOM was provided by Jeff Kallestad, Oncogen. It represents a fusion between pSV2 dhfr and pH3 M / bOM and is a vector with a cDNA controlled by the CMV / HIV promoter from pH 3 M and flanked by the TGF-β signal sequence and SV40 polyadenylation signals and additionally having the mouse dhfr gene driven by the SV40 early promoter. The plasmid was prepared by ligation of BamHI / NruI (filled) digested pH3 M / bOM with BamHI digested pSV2 dhfr.

Plasmid pHras

The plasmid pHras is a mammalian expression vector and has been described by Stan McKnight, Univ. of Washington, Dept. developed by Pharmacology. The plasmid is a pML-related vector containing a 754bp EcoRI to Tthlll I fragment from Harvey Ras LTR, a polylinker with SmaI, BamHI, Sail, PstI, HindIII and CIaI sites followed by the mouse DHFR cDNA and the Hepatitis B virus З'-untranslated / polyadenylation signal contains. The distance from BamHI in the polylinker to the ATG of the DHFR is 54 bp.

Plasmid pHLARGE

The plasmid pHLARGE represents a mammalian expression construct containing the 10kb AR genomic sequences (SmaI to HindIII) controlled by Harvey ras LTR and followed by a non-functional, promoter-free DHFR gene. It was prepared by tri-ligation of the following fragments: 4,6kbpHrasSmal / HindIII fragment; 6.0kbSmal / HindIII Ar genomic fragment of pARH12; and 6.4 kb HindIII AR genomic fragment of pARH6.

Plasmid pHLARG 1 pcD

The plasmid pHLARG 1 pcD is a polycistronic mammalian expression construct. It contains the AR precursor cDNA sequence followed by the mouse dhfr gene under the control of a single Harvey ras LTR sequence. The primary transcript represents 74bp polycistronic information between the stop codon of AR and the dhfr ATG start codon, thereby reinitiating the ribosome and continuing translation. pH 3ARP was digested with EcoRV and a 700 bp fragment was isolated. This fragment contained the 13 bp AR-5 'untranslated region, the complete AR precursor coding region, and 21 bp of the 5' untranslated sequence. This fragment was ligated to the BamHI cut, filled and phosphatase treated vector pH ras.

Plasmid pLOSNL

Plasmid pLOSNL was provided by Dusty Miller, Fred Hutchison Cancer Research Center, Seattle, WA. This retroviral expression vector was designed to generate high titers of amphotropic helper-free viral material capable of infection but not replication in a wide variety of hosts. The vector contains: a mutant Moloney murine leukemia virus LTR with deleted packaging signals; psi ± sequences; the ornithine transcarbamylase (OCT) gene with two Xho! interfaces for insertion of a cDNA and subsequent inactivation of the OTC gene; SV 2 Neo, a selectable marker; the 3 'LTR; and a pBR322 amp-resistance scaffold.

Plasmid pLARSNL

The plasmid pLARSNL is an amphotropic retroviral expression construct containing the AR precursor encoding cDNA region lacking a poly (A) tail and controlled by viral LTR. SV2 Neo allows the selection of expressing transfectants. pLARSNL was generated by ligation of the 800bp SaI I fragment from pHLARG 1 pcD with the 7.7kb fragment of the Xho I-digested and phosphatase-treated pLOSNL vector fragment.

5.2.3. Identification of transfectants or transformants expressing the amphiregulin gene.

The host cells containing the recombinant AR coding sequence and capable of expressing the biologically active mature product can be identified by at least four general methods:

(a) DNA-DNA, DNA-RNA or RNA antisense (reverse RNA) hybridization

(b) presence or absence of "marker" gene functions;

(c) determining the transcription rate based on the expression of the AR mRNA transcript in the host cell; and

(D) Detection of the mature gene product by immunoassay and finally by its biological activity

In the first method, the human AR coding sequence inserted in the expression vector is detected by DNA-DNA hybridization using probes. These probes include nucleotide sequences that are homologous to the coding sequence of human AR.

In the second method, the recombinant expression vector and host system can be identified and selected based on the presence or absence of particular marker gene functions. Examples of marker gene functions are thymidine kinase activity, antibiotic resistance, methotrexate resistance, transformation phenotype, formation of occlusion body in baculovirus, etc. If e.g. the AR coding sequence is inserted within a marker gene sequence of a vector, recombinants containing the AR coding sequence can be identified by the lack of marker gene function. Alternatively, a marker gene may be placed in tandem with the AR sequence under the control of the same or a further promoter to control the expression of the AR coding sequence. The expression of the marker due to induction or selection indicates the expression of the AR coding sequence.

In the third method, the transcriptional activity for the AR coding region can be determined by hybridization assays. For example, polyadenylated RNA can be isolated and analyzed by Northern blotting using a probe homologous to the AR coding sequence or portions thereof. In addition, the entire nucleic acid of the host cell can be extracted and assayed for hybridization with such probes. In the fourth method, expression of the mature protein product by immunological means, e.g. By Western blotting, immunoassays such as radioimmunoprecipitation, enzyme-linked immunoassays, etc. In a final assay to determine the function of the expression system, the biologically active AR gene product is detected. When the gene product is secreted by the host cell, the cell-free medium of the transferred host cell culture can be separated and tested for AR activity. If the gene product is not excreted, cell lysates can be tested for activity. In both cases, biological assays such as the growth inhibition and stimulation assays described herein or the like may be used.

5.3. StrukturvonAmphiregulin

Amino acid sequencing of purified AR revealed that the preparation consisted of an unequal mixture of two nearly identical forms of AR (see Figure 12). The larger of the two forms comprises about 16% of the preparation. The second form, the truncated AR, comprises the vast majority of the preparation and differs from the longer form in the absence of the amino-terminal hexapeptide SVRVEQ. Otherwise, the two forms are absolutely homologous at the amino acid level.

AR is an extremely hydrophilic glycoprotein with an average molecular weight of 22,500 daltons. Upon N-glycanase treatment to remove N-linked carbohydrates, AR migrates as a single band having a relative molecular weight of 14,000. This roughly matches the molecular weight determinations for AR from gel permeation chromatography data. Under non-reducing conditions AR migrates in a similar way. AR is therefore a single-stranded glycoprotein.

The primary structure of AR was compared to a variety of protein sequences. These comparisons show that AR is a novel protein that shows no significant structural homology with any of the compared proteins. However, the primary structure of AR is related to the structure of several other growth factors, most of which belong to the EGF superfamily. It therefore makes sense to classify AR as a member of this group of proteins since several structural features of this protein run parallel to highly conserved structural features found within the EGF protein family. For example, the N-terminal AR sequence is similar to the N-terminal sequences of TGFa, VGF and MGF. These regions are rich in proline, serine and threonine residues. AR also has sites for N-linked glycosylation, similar to the N-terminal precursor regions of TGFs and VGF. AR also shows sequence homology with other EGF-like proteins by conserving 6 cysteine residues involved in 3 disulfide bonds and defining the secondary structure of the mature forms of these growth factors. An analysis of the hydropathic properties, however, reveals significant differences between homologous AR and EGF sequences. For further comparisons between AR and other members of the EGF superfamily, see Table I, Figure 13 and Sections 9.7 and 9.8.

Table I species Region # 1 EGF score COAG. # 2 protein humanely CLHDGVCMYIE > 20 <20 CNCVVGYIGERC EGF humanely CFH GTCRFLV <25 > 25 CVCHSGYVGARC TGF-a vaccinia CLH GDCIHAR <20 <20 CRCSHGYTGIRC VGF Shope CLNNGTCFTIA CVCRINYEGSRC SGF humanely CLNXGSCKDDI CWCPFGFEGKNC Factor IX humanely CQNXGKCKDGL CTCLEGFEGKNC Factor X humanely CLHXGRCLEVE CHCPVGYTGPFC Factor XII humanely CCGXGTCIDGI CDCRSGWEGRFC Protein C humanely CIH GECKYIE CKCQQEYFGERC AR Combined Homology Scores for Regions # 1 and # 2 Score AR score <40 Growth Factor family <40 Coagulation factors > 40 Amphiregulin subfamily

The amphiregulin amino acid sequences given in Figure 12, as well as functional equivalents, are the subject of this invention. For example, the amphiregulin product may include deletions, additions or substitutions of amino acid residues within the sequence that result in silent changes and produce a bioactive product. Such amino acid substitutions may be made on the basis of similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and / or amphipathic nature of the corresponding residues. For example, negatively charged amino acids include aspartic acid and glutamic acid; positively charged amino acids include lysine and arginine; Amino acids with uncharged polar head groups of similar hydrophobicity include the following compounds: leucine, isoleucine, valine, glycine, alanine, asparagine, gutamine, serine, threonine, phenylalanine and tyrosine.

5.4 Properties of Amphiregulin

Amphiregulin is a single-stranded glycoprotein with an average molecular weight of 22,500 daltons and exhibits bifunctional growth-modulating activities in a variety of cell cultures. AR is structurally related to the EGF family of growth factors and may additionally be functionally similar to other members of this family. One indication of this is the pronounced competitive behavior towards EGF in receptor binding. AR represents a monomeric protein that requires intramolecular disulfide bond activity to show activity. Glycosylation is not required for its biological activity. The protein is stable to mild acid and base treatment; also at 30 ° C heat treatment at 56 ° C. The biological activity of AR is completely lost after reduction, to 5 min of heat treatment at 100 ⁰ C, and by digestion with trypsin, endopeptidase Lys-C, EndopeptidaseArg and endopeptidase Glu.

By proteolytic cleavage with phospholipase D, AR appears to be converted to an active fragment or active fragments having a relative molecular weight of about 5600 (as determined by SDS-PAGE analysis). Active fragments of AR are the subject of the present invention and are discussed in more detail in Section 5.5, below. AR shows in vitro pronounced anti-proliferative effects on several human cancer cell lines of epithelial origin. For example, the DNA synthesis of epidermal carcinomas from vulva A431 cells, breast adenocarcinoma HTB 132 cells, cervical epidermoid carcinoma CRL-1550 cells, ovarian papillary adenoma HTB75 cells, ovarian teratocarcinoma HTB-1572 cells and Breast Adenocarcinoma HTB-26 cells are effectively inhibited. One observes a 50% inhibition of DNA synthesis in A431 cells after treatment with O, 13nM AR.

Normal Rat Kidneys NRK-SA6 cells usually do not form colonies in soft agar. However, in combination with exogenous EGF and TGF-β in the culture medium of these cells, anchorage-independent growth is induced, indicating a transformed phenotype. A combination of exogenous AR and TGF-β also induces anchorage-independent growth of NRK-SA6 cells, but to a lesser extent (see Table V). This provides a direct indication of the functional relationship of AR and EKF.

The synergistic effect of AR and TGF-ß implicates AR as an important factor in the regulation of cell growth. For the first time, the present invention provides auxiliaries for investigating the complex relationships of normal cell growth control and the characteristic loss of growth control in neoplastic cells. AR also induces profiling of human foreskin fibroblasts (Table IV). There is a two-fold increase in DNA synthesis in these cells at an AR concentration of about 5OpM. A maximum, about sixfold stimulation is observed at about 5nM.

The mechanism of influencing cell proliferation or growth inhibition by AR is unknown. Preliminary studies to characterize AR receptor binding indicate that AR may have a specific receptor. AR shows a competitive behavior with EGF in binding to the EGF receptor and possibly also in binding to other common receptors, possibly including the AR-specific receptor itself. It is known that the binding of a ligand to the EGF receptor produces a growth-stimulating signal, in part by activation of tyrosine kinase activity. The binding of AR to the EGF receptor can similarly initiate a proliferative response and / or conversely, block the initiation of a proliferative signal by limiting the number of available EGF receptors for binding EGF or other signal producing ligands. On the other hand, another mechanism by which AR inhibits cell growth is conceivable and is suggested by the data in Table I. Four clones of the A431 cell line with variable EGF binding sites per cell were tested for their sensitivity to AR inhibitory activity. The observed lack of correlation between AR sensitivity and the number of EGF binding sites per cell indicates that the AR-generated growth inhibition signal is initiated by a receptor binding that does not involve the EGF receptor. Such receptor binding may possibly antagonize growth-profilerative signals which are dependent on other growth factors, such as e.g. TGF-o. were triggered. AR can thus exert its antiproliferative effect by specifically blocking the cell's mitogenic response to TGF-α or other autocrine growth factors.

AR is an extremely hydrophilic protein whose amino acid sequence produces a distinctive hydropathicity profile that shows only a slight similarity to the profiles of other proteins of the EGF family (Figure 11). AR is a basic protein with a pI of 7.6 to 8.0.

5.4.1 Characterization of AR induction by TPA

TPA induces a plauotropic cell response, including changes in cell morphology, cell proliferation and differentiation in membrane transport, receptor-ligand interactions, protein phosphorylation, and phospholipid metabolism. Protein kinase C (PKC) is a Ca ²⁺ and phospholipid-dependent protein kinase and acts as a receptor for TPA. The binding of TPA to PKC results in the phosphorylation of a variety of substrates, such as growth factor receptors, cytoskeletal proteins, and trans-activating regulatory proteins.

c-AMP represents another molecule that exerts different effects on cells, predominantly via the c-AMP-dependent protein kinase A. The intracellular c-AMP content is regulated by a combination of receptor mediated activation and adenylate cyclase inhibition. Some studies indicate that TPA- and c-AMP-induced gene expression is one

converge together. To investigate the regulation of AR gene expression, the influence of various activators or inhibitors of these two regulatory pathways on the production of AR-specific RNA in MCF-7 cells was determined.

Forskolin is an active ingredient that activates adenylate cyclase and increases the level of intracellular cAMP. When administered to MCF-7 cells at a concentration of 25μΜ over a period of 4h, a marked stimulation of the AR mRNA is observed. The results indicate that cAMP also plays a role in the regulation of AR expression.

5.5 Amphiregulin-derived derivatives, analogues and peptides

The production and use of derivatives, analogs and peptides derived from AR are also provided by the present invention. Such derivatives, analogs and peptides showing growth modulating activity can be used in the diagnosis, prognosis and treatment of a variety of neoplasias. Such derivatives, analogs or peptides may have enhanced or decreased biological activity compared to native AR and may expand or decrease the range of AR GIA susceptible cells. Similarly, for the production and use of derivatives, analogs and peptides derived from AR, useful applications, e.g. in the treatment of wounds and burns. These AR-derived proteins may show increased or decreased growth-stimulating activity and / or show greater or lesser range of action on cells that respond to the growth-stimulating activity of AR. AR derivatives, analogs and peptides of the present invention may be prepared using a variety of prior art adjuvants. Methods and manipulations on the genetic level as well as on the protein level are likewise provided by the invention. At the protein level, a variety of chemical modifications can be made to produce AR-like derivatives, analogs, or peptides using prior art methods. Examples include specific cleavage by cyanogen bromide, endopeptidases (trypsin, chymotrypsin, V8 protease and the like) or exopeptidases or acetylation, formylation, oxidation, etc.

5.6 Anti-amphiregulin antibody production

The present invention also relates to the production of polyclonal and monoclonal antibodies which recognize amphiregulin or related proteins.

Various methods known in the art may be used to produce polyclonal antibodies to AR epitopes. For the production of antibodies, various host animals, such. As rabbits, mice, rats, etc. are immunized by injection of the AR protein or a synthetic AR peptide. For this purpose, various adjuvants can be administered to enhance the immune response depending on the nature of the host, such as. Freund's (complete or incomplete) adjuvant, mineral gels such as aluminum hydroxide, surfactants such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhollyme-thymocyanines, dinitrophenol, or possibly suitable human adjuvants such as BCG (Bacillus Calmette -Guinin) and Corynebacterium parvum.

A monoclonal antibody for an AR epitope can be prepared using any technique that allows the production of antibody molecules by continuous cell line cultures. These include, for example, the hybridoma technique originally described by Kohler and Milstein (1975, Nature 256: 455-497), and the more recent human B-cell hybridoma TechniMKosbor et al., 1983, Immunology Today 4.72) and EBV hybridoma. Technique (CoIe et al., 1985, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. p.77-96).

Antibody fragments containing the idiotype of the molecule can be prepared by known techniques.

For example, such fragments include the F (ab ') ₂ fragment, which can be produced by pepsin digestion of the antibody molecule; the Fab 'fragments generated by reduction of the disulfide bridges of the F (ab') ₂ fragment and the two Fab 'or Fab fragments that can be generated by treating the antibody with papain and a reducing agent.

Antibodies against AR can be used for the qualitative and quantitative detection of mature AR and its precursor and its subcomponents, in the affinity purification of AR proteins and in the detection of AR biosynthesis, its metabolism and function. Antibodies to AR can also be used in diagnostic and therapeutic agents.

5.7 Uses of Amphiregulin

The bi-functional nature of AR allows a wide variety of in vitro and in vivo applications.

Any type of compounds containing AR or fragments or derivatives thereof which exhibit growth inhibition and / or growth-stimulating activity alone or in conjunction with other biologically active growth factors, inhibitors or immunomodulators can be employed in the applications and methods of the invention. Localization of the AR gene in a region involved in lymphocyte differentiation indicates that AR may be involved in hematopoietic cell development, activation or immunosuppression. This finds support by the homology between the AR-3 untranslated region and similar regions of other cytokines. The present compounds can be used to modulate angiogenesis, bone resorption, immune response, and synaptic and neuronal effector functions. AR can also be used to modulate the arachidonic acid cascade. The enzymatic oxidation of arachidonic acid leads to a variety of important products, such as prostaglandins, thromboxanes, prostacyclins and leukotrienes. These products are extremely potent ubiquitous agents with a variety of physiological effects, such as muscle contraction, platelet aggregation, leukocyte migration and gastric secretion. AR, AR-related molecules and mixtures thereof can be used particularly in the treatment of injuries as well as for the diagnosis and treatment of cancer.

5.7.1 Treatment of wounds

AR may be used in a method of treating injuries such as cutaneous injury, corneal injury, various other epithelial and stromal injuries, such as chronic ulcer, burns, surgical incisions, traumatic wounds, and injury to hollow, epithelial-limited organs, such as the esophagus, the stomach, the large and small intestines, the mouth, the genital area and the urinary tract. The method is based on the topical application of the treatment agent containing AR in a physiologically acceptable carrier. The compositions of this invention can be used to treat a variety of injuries, including essentially all cutaneous injuries, corneal injuries, and injuries to epithelium-restricted hollow organs of the body. Wounds suitable for treatment include injuries caused by trauma, such as burns, abrasions, cuts, etc., as well as surgery-induced injuries such as surgical incisions and skin grafts. Other conditions suitable for treatment with the agents of the invention further include chronic conditions such as chronic ulcer, diabetic ulcer, and other non-healing (trophic) conditions.

AR may be included in physiologically acceptable carriers for application to the affected area. The type of carrier is variable and depends on the respective application site. For an application on the skin, a cream or ointment is used as a base; suitable bases include lanolin, silvaden (Marion) (especially for the treatment of burns), Aquaphor (Duke Laboratories, South Norwatk, Connecticut), etc. If desired, it is possible to incorporate AR-containing agents into bandages and other dressings around the wound continuously suspend the peptide. Aerosol applications are also possible. There is no critical concentration for AR in the agent used for treatment; however, it should be sufficient to induce epithelial cell proliferation. The agents may be applied topically to the respective area, typically using eyedrops for the eyes or creams, ointments or lotions for the skin. In the case of the eyes, repeated treatment is desirable, usually at intervals of 4 hours or less. In the case of the skin, it is desirable to continuously maintain the treating agent on the respective surface during the healing process, the treating agent being applied two to four times a day or more frequently. The amount of the polypeptide of the invention used depends on the mode of administration, the use of other active compounds, etc., and generally ranges from 1 pg to 100 pg . The polypeptide of the invention may be used with a physiologically acceptable carrier such as saline, phosphate buffered saline, etc. The amount of compound used is determined empirically based on the response of the cells observed in vitro and based on the response of experimental animals to the polypeptides of the invention or to formulations containing the polypeptides of the invention.

AR compounds may be used alone or in combination with other growth factors, inhibitors or immunomodulators.

5.7.2 Diagnosis and treatment of neoplasia

The agents of the invention can be used for the diagnosis, prognosis and treatment of a wide variety of neoplasias.

There are a variety of diagnostic applications of AR and related molecules.

According to the present invention, the polypeptides of the present invention may be labeled such as a radioisotope, an enzyme, a fluorescent marker, a chemiluminescent marker, an enzyme fragment, a particle, etc.

get connected. Such compounds can be used to determine the number of AR receptors on a cell. The identification of AR receptors serves as an indication of the potential responsiveness of the cell to biological effects of AR and related molecules. AR, AR-related molecules and / or antibodies thereto can be used in competitive assays for detecting AR in media, especially in physiological media. A variety of diagnostic tests known in the art may be used.

The presence and content of AR in body fluids and tissues may be proportional or inversely proportional to the presence and spread of certain cancers. Assays for the determination and / or quantification of AR may find application in cancer diagnosis and prognosis (see section 5.6, above).

The present invention further relates to the detection of AR mRNA. Tests which use nucleic acid probes to detect sequences which wholly or partly contain the known gene sequence are known and applicable in the art. The content of AR mRNA may indicate the presence or persistence of neoplasia. Therefore, assays to quantify AR mRNA levels are useful diagnostic tools.

In addition, malignant numbers expressing the AR receptor can be detected using labeled AR or AR-related molecules by means of a receptor binding assay or by using antibodies to the AR receptor. One can differentiate cells due to the presence and density of the AR receptors, predicting the susceptibility of such cells to biological activities of AR.

AR can be used as an anti-neoplastic compound. For in vivo use, the agent of the invention may be administered in a variety of ways. Examples include injection, infusion, as well as topical and parenteral administration, etc. Administration can be carried out in any physiologically acceptable carrier, such as e.g. As phosphate-buffered saline, saline, sterilized water, etc. take place. AR and related molecules may also be encapsulated in liposomes as well as conjugated to antibodies that recognize and bind to the tumor or cell-specific antigens, thereby enabling targeting of the agents of the invention.

AR may be useful in vivo for inducing terminal differentiation of tumor cells. Such cells have abandoned the normal pathway of cell differentiation characteristic of normal cells and are capable of uninterrupted proliferation. In contrast, normal cells differentiate into cells which in most circumstances are incapable of further cell division. Therefore, the ability of AR to reactivate normal cell differentiation in tumor cells, and ultimately disrupt tumor growth, may find valuable use in tumor therapy.

AR and related derivatives, analogs and peptides may be used alone or in combination with at least one other antiproliferative compound, such as an interferon, TGF-β1, TGF-β2, tumor necrosis factor-β.Tumornecrosis factor-a

etc. in the treatment of hormone-responsive carcinomas which may affect a variety of organs, such as lung, breast, prostate, colon, etc. Hormone-sensitive carcinomas can also be treated by induction of AR production in the carcinoma cells. Examples of inducers are estrogens, such as 17-B-estradiol, compounds with antiestrogen activity, such as tamoxifen. Any combinations of these compounds can be used as inducers.

The compounds of the invention can be used in vitro to inhibit cell growth of cell lines which, unlike non-sensitive cells, exhibit AR sensitivity. In this way, heterogeneous mixtures or cell lines can be freed of unwanted cells, the undesired cells reacting to the growth-inhibiting activity of AR. For example, the compounds of the present invention can be used in vitro to eliminate malignant cells from bone marrow or autologous medulla transplants, as well as to eliminate or inhibit the proliferation of malignant cells in blood prior to reinfusion.

The most effective AR concentration for inhibiting the proliferation of a given cell can be determined by adding different concentrations of AR to the respective tumor cells and by recording the inhibitory potency of cell proliferation. The most effective concentration of a single inducer and / or a combination of inducers can be determined by recording AR production in carcinoma cells.

embodiments

Example 6 Production, Purification and Characterization of Human Amphiregulin The following subsections describe the purification and characterization of amphiregulin from TPA-treated MCF-7 cells.

6.1 Material and Methods

The following procedures were used to induce AR synthesis in MCF-7 cells and to prepare and characterize substantially pure AR.

6.1.1 SDS polyacrylamide gel electrophoresis

Proteins were analyzed on SDS-PAGE Slab gels (normal or mini-Bio-Rad system) as described (Leammli, 1970, Nature 227: 680-685) and detected by silver staining (Merril et al., 1981, Science 211 : 1437-1439).

6.1.2 Isoelectric Focusing

The isoelectric focusing was performed essentially based on the description of the Isolab Technical Data Sheet for Resolve IEF-GeI. The samples were then loaded onto preformed agarose gels (85 x 100 mm, pH3-10) and focused on a Resolve FR-2 500 isoelectrofocusing unit using a Bio-Rad ЗОООХі computer-controlled electrophoresis apparatus. IEF standards were focused next to the sample, stained, and the dry gel placed on a Kodak X-Omat AR film in a DuPont Cronex illumination and intensification screen.

6.1.3 Proteiniodination

Proteins were labeled with ¹²⁵ I using the chloramine-T method (Barridge, 1978, Methods Enzymol., 50: 54-65).

6.1.4 Protein determination

The protein concentrations were determined by absorption at different wavelengths (210 to 280 nm). The methods of Lowry (Lowry et al., 1951, J. Biol. Chem. 193: 265-275) and Bradford (1976, Anal. Biochem. 72: 248-252) were performed using bovine serum albumin as a standard.

6.1.5 ¹²⁵ -I-EGF binding assay

Binding assays were performed in either 48-well tissue culture dishes when freshly grown and / or formalin-fixed A431 cells were used as described (Carpenter et al., 1979, J. Biol. Chem. 254, 4484-4891, -Shoyab et al , 1979, Nature 279: 387-391; DeLarco et al., 1980, J. Biol. Chem. 225: 3685-3690). The determination was carried out in 96-well polyvinyl chloride plates by immobilization of the plasma membrane (Kimball and Warren, 1984, Biochem., Biophys. Acta 771, 82-88).

6.2 Production of Amphiregulin

6.2.1 Separation of conditioned media from TPA-treated MCF-7 cells MCF-7 cells were grown in TISOCorning tissue culture bottles in a total volume of 25 ml of 50% IMDM (Iscove's Modified Dulbecco's Media) + 50% DMEM at 0.6 μJ / ml insulin and 15% heat-inactivated fetal bovine serum (complete MCF-7 medium). Approximately 1 x 10 ⁶ cells are inoculated per bottle and incubated at 37 ° C with 5% CO ₂ . On day 6, all media is removed and 20 ml of fresh complete MCF-7 medium containing 100ng / ml TPA is added to each bottle. 48h later, the medium is removed and each flask is washed with 15ml 50% IDMM + 50% DMEM (serum free medium) and incubated after addition of 25ml fresh serum free medium to each flask at 37 ° C in 5% CO ₂ . 4 days later, the conditioned serum-free medium is isolated and stored after centrifuging cell components at -20 ⁰ C. The bottles are again loaded with 25 ml of serum-free medium and conditioned serum-free medium is isolated every 3 or 4 days. Part of the conditioned medium of each individual isolate is tested for growth inhibitory activity (GIA) on A431 human epidermal carcinoma cells. Usually, three to four times conditioned medium is separated from each series of TPA-treated MCF-7 cells.

6.2.2 Isolation of crude AR

About 4500 ml of conditioned medium is thawed and centrifuged at 4 ° C and 3500 rpm for 15 min. The supernatant is concentrated in a 2 liter Amicon concentrator using a YM10 membrane (Amicon) at 4 ° C. If the volume of the retentate is about 200 ml, add 1000 ml of cold Mili-E-Q water and re-concentrate the mixture

The concentrate is removed and transferred to a precooled 250 ml Corning centrifuge container.

Concentrated acetic acid is added slowly with stirring to a final concentration of 1M acetic acid. The mixture is stored for 1 h at 4 ° C and centrifuged for 20 min. At 40,000 bei gbei4 ° C in a SorvalRC-5 B centrifuge. The supernatant is separated and stored at 4 ° C. The pellet is suspended in 30 ml of 1M acetic acid and recentrifuged as described above. The supernatant is carefully separated again and combined with the first supernatant and then dialyzed against 1710.1 M acetic acid in a spectroprotial dialysis tube No. 3 (molecular weight exclusion about 3000). The dialysis buffer is changed 3 times within 2 days. The retentate is lyophilized. The dry product is isolated, pooled, weighed and stored at -20 ⁹ C until further use. This product is called raw powder.

6.3 Purification of amphiregulin

6.3.1 Reversed-phase liquid chromatography

950 mg of the raw powder (from about 91 serum-free conditioned medium) is suspended in 300 ml of 0.1% TFA (trifluoroacetic acid) and 20 ml. Centrifuge at 7000 x g. The supernatant is carefully separated and applied to a preparative CI8 column (2.54 cm χ 27 cm, 55-105 microns, water) equilibrated in water with 0.1% TFA. Then the chromatographic support was suspended in acetonitrile (MeCN) with 0.1% TFA, the slurry was poured into a 2.54 cm diameter column and washed with 400 ml MeCN in 0.1% TFA and then with 600 ml 0.1 % TFA equilibrated in water. The flow rate is 4ml / min. and the chromatography is carried out at room temperature. The column is washed with 650 ml in 0.1% TFA in water. The run and wash fraction are collected together. Then elute as follows:

(1) 650m 120% MeC N / H ₂ O with 0.1% TFA

(2) 650ml 40% MeCN / H ₂ O with 0.1% TFA

(3) 650ml 60% MeCN / НгО with 0.1% TFA and

(4) 750ml 100% MeCN with 0.1% TFA.

A sample of each fraction is tested for GIA. About 77% of total GIA activity is found in the run and wash fractions.

Run and wash fractions are isocratically applied to a preparative Partisil 10ODS-3 column (10 microns, 2.2 x 50 cm, Whatman) attached to a high-resolution liquid chromatography (HPLC) system (Waters). The flow rate is 4 ml / min. After applying the sample to the column, the column is washed with 250 ml of 0.1% TFA in water. A linear gradient is generated between 0.1% TFA in water as the first solvent and acetonitrile with 0.1% TFA as the second solvent. The conditions for the gradient are as follows:

0 to 15% in 10МІП., 15 to 15% in ЗОМіп., 15 to 25% in 150МІП., 25 to 65% in ЮОМіп., And 65 to 100% in 10min. HPLC grade solvents were used. 14 ml fractions are collected and samples from each fraction are assayed for GIA. Two broad activity peaks are found (Figure 1). The first eluted peak (eluted between 20-23% acetonitrile) is further purified and characterized.

The fractions 47 to 62 are combined. Add 224 ml of 0.1% TFA in water to the pooled fractions. The mixture is isocratically applied to a semi-preparative p-Bondapak CI8 column (7.8 x 300 mm, Waters) at a flow rate of 2 ml / min, at room temperature. The parameters of the linear gradient are: 0 to 17% in 10 minutes, 17 to 17% in ЗОМіп., 17 to 25% in 320 minutes and 25 to 100% in 40 minutes. The flow rate is 1 ml / min Application of the gradient and fractions with a volume of 4ml are collected. Samples of these are tested for GIA. Two major activity maxima are obtained which are eluted at an acetonitrile concentration of about 20% and 21%, respectively (Figure 2). Fractions 49 to 53 are combined and 20 ml of 0.1% TFA are added. The mixture is isocratically applied to a μ-Bondapak CI8 column (3.9 x 300 mm, Waters) at a flow rate of 1 ml / min, at room temperature. The gradient parameters are: 0-18% in 10 minutes, 18 to 18% in 30 minutes, 18 to 25% in 280 minutes. and 25 to 100% in 20min. The flow rate is 0.4 ml / min, and the fraction volume is 2 ml. Most of the activity is eluted from the column at an acetonitrile concentration of about 21.5% (Figure ЗA). Fractions 54-59 (Figure 2) are pooled and chromatographed under identical conditions as indicated for Figure 6A. Most of the activity is eluted from the column at an acetonitrile concentration of about 22.2% (Figure 3B).

6.3.2 Gel permeation chromatography

The fractions 35 to 38 (FIG. 6A) are each concentrated to 70 μΙ using a Speed Vac concentrator (Savant) and admixed with the same volume of acetonitrile with 0.1% TFA. These 140-цІ-РгоЬеп are applied in tandem on two Bio-sil TSK-250 columns (each 7.5 χ 300 mm, Bio-Rad). Elution is isocratic with a mobile phase of 50% acetonitrile / H ₂ O with 0.1% TFA at room temperature. The flow rate is 0.4 ml / min, and a writing speed of 0.25 cm / min .; 0.4 ml fractions are collected and samples thereof tested for GIA. The elution profiles of fractions 35, 36 and 37 (Fig. A) are shown in Figs. 4A, 4B and 4C, respectively. Fractions 41 and 42 (Fig. 3B) are pooled, concentrated to 70μΙ and subjected to gel permeation chromatography as described above. The elution profile is shown in Fig.4D.

6.4 Cell growth tests

6.4.1 Cell Growth Modulation Assays Using DNA- ²⁵ I Deoxyuridine Incorporation Tests are performed on 96-well plates (Falcon 3072). Human epidermal powder carcinoma cells (A431) are used as growth inhibitory activity (GIA) and human foreskin fibroblast test cells

(Sadamoto) used as indicator cells for determination of growth-stimulating activity (GSA). 3.5 × 10 ⁴ cells in 50 μM DMEM with 5% heat-inactivated fetal bovine serum (FBS), penicillin / streptomycin (PS) and glutamine (test medium) are placed in all wells except the peripheral wells. In the peripheral wells transferred 50μΙ PBS. 3 hours later, 50 μΙ of the sample to be tested in test medium is added to each well while only 50 μΙ of test medium is added to the control wells. 3 wells are used per concentration of the sample to be tested. The plates are incubated at 37 ^° C. for 2 to 3 days. Subsequently, 100 μΙ of a solution of ^12S modo-2'- ^l26 l-deoxyuridine (4Ci / mg-0.5 mCi / ml) (2 μΙ / ml in test medium) was added and incubated the plates at 37 ⁰ C. After 4 to 6 days, the medium is aspirated from the wells and washed 1 χ with 200μΙ PBS. Add 200 μΙ methanol to each well, incubate the plates for 10 min. at room temperature and the methanol is filtered off with suction. Add 200 μL of sodium hydroxide to each well and incubate ЗОМіп plates. at 37 ° C. Sodium hydroxide is removed with the aid of "Titertek plugs" (Flow Labs), the plugs are transferred to 12 χ 75 mm plastic tubes and measured in a gamma counter to quantify the ¹²⁶ MUdR fitting.

6.4.2 Softager Colony Test

An O.5 ml base layer of O, 5% agar (Agar Noble, Difco Laboratories, Detroit, Mich.) In DMEM with 10% heat-inactivated FBS is added to Costar 24-well tissue culture plates. 0.5 ml of a 0.3% agar with the same medium-FBS mixture, 5 to 10 x 10 ³ test cells and factors to be tested at various concentrations are used to cover the first agar layer. Incubate the plates at 37 ⁰ C in a humidified atmosphere of 5% CO ₂ in air and feeding again after 7 days by addition of 0.5 ml of 0.3% agar containing the same medium and the same concentrations of the compound to be tested contains. The colonies are counted unfixed and unstained and the number of colonies with more than 20 cells are determined between the 7th and the 14th day.

6.4.3 Cell growth inhibition test

A431 cells are χ 2.1 10 ⁴ cells per well in 0.3 ml medium (DMEM with 10% FBS, P / S glutamine) were plated in Costar (24Näpfchen about 2 cm ² per well), and 2 h at 37 ⁰ C. incubated. Subsequently, the test compounds are added at different concentrations each 2x in 0.3 ml of medium in each well. The control wells contain medium without sample. The plates are incubated at 37 ° C for 72h. The medium is then aspirated, the cells are washed with 1 ml PBS / well, detached with 0.5 ml trypsin (0.5% EDTA, 0.5 mM) and counted using a Coulter counter.

6.5 Analysis of the AR primary structure

6.5.1 Reduction and S-pyridylethylation

AR (20-30μ9) is dried in an I.S ml microcentrifuge polypropylene tube and suspended in ΙΟΟμΙ 3M urea in 0.05M TRIS-HCl, pH 7.5.

4μΙ 2-mercaptoethanol are added to the mixture, mixed, purged with nitrogen and incubated at 25 ° C. After 2.5h you give 4.5 μ! Add freshly distilled 4-vinylpyridine to the mixture, rinse the tube again with nitrogen and incubate for 2 h at 25 ° C. The reaction mixture is acidified to pH 2.0 with 10% TFA. The S-pyridylethylated AR is purified by rp HPLC using a μ-Bondapak CI8 column (3.9 x 300 mm, Waters). The acetonitrile concentration is increased linearly (1% / min) within 55 min. At a flow rate of 1 ml / min. The first solvent used is 0.1% TFA. S-pyridylethylated AR (SPE-AR) is eluted at about 26.5% acetonitrile, an about 4% higher acetonitrile concentration than for untreated AR.

6.5.2 N-glycanase treatment

AR or S-pyridylethylated AR (10 to 20μ9) is dried in 1.5ml polypropylene microcentrifuge tubes and suspended in 80μl 0.1M phosphate buffer, pH 5.5. The mixture is incubated at 37 ° C for 16 hours, 0.9 ml of 0.1 TFA is added to the reaction mixture and a sample is injected into an Ultrapore RPSC C3 rp HPLC column (4.6 x 75 mm, Altex) at a flow rate of 1 ml / min, following equilibration of the column with 0.1% TFA as the first solvent, acetonitrile with 0.1% TFA as the second solvent, acetonitrile concentration being linear (0.4% / min) over 85 min At room temperature, N-deglycosylated AR and N-deglycosylated S-pyridylethylated AR are eluted at an acetonitrile concentration of approximately 16.5 and 20.5%, respectively.

6.5.3 Enzymatic cleavage of N-glycanase-treated S-pyridylethylated AR

Cleavage with endopeptidase Lys-C is carried out in 60 μM 0.1 M TRIS-acetic acid buffer, pH 8.0 within 16 h at 25 ° C. The enzyme / substrate ratio is 1 to 5 (w / w).

Endopeptidase-Arg and S. aureus V8 protease digestion M ammonium bicarbonate carried out in 80μΙ 0.05M TRIS-HCl, pH 8.0 and 0.1 within 16 h at 37 ⁰ C. The enzyme / substrate ratio is again 1 to 5.

6.5.4 Chemical cleavage

For CNBr cleavage on the methionine residue, 5 μg of N-glycanase-treated S-pyridylethylated AR are dried in 1.5 ml polypropylene microcentrifuge tubes, suspended in 75 μl of 70% formic acid and then mixed with 25 μl of a CNBr solution (25 mg / ml in 70% HCOOH). added. Mix and rinse the tube with nitrogen. The reaction is carried out for 22 h at 25 ⁰ C in the dark. The reaction mixture is diluted to 1.1 ml with water and dried in a Speed Vac concentrator. The dried sample suspended in 20 μM 2-aminoethanol, 10 min. stored at 22 ⁰ C and then vacuum dried. The mixture is suspended in 0.9 ml of 0.2% TFA.

6.5.5 Peptide isolation

The peptides are separated on a reverse phase HPLC C8 column (4.6 x 100 mm, Whatman) connected to a Waters HPLC system. The acidified sample (pH 2.0) is applied at a flow rate of 1 ml / min to a column equilibrated with 0.1% TFA (first solvent). Subsequently, the column is washed with 15 ml of 0.1% TFA. Linear gradients are used between the first solvent and the second solvent acetonitrile with 1% TFA. The gradient parameters are: Obis 50% in 125Min. at a flow rate of 0.5 ml / min.

6.5.6 Amino acid analysis

Dried samples are hydrolyzed with constant boiling HCl (5.7 M Pierce) containing 1% (v / v) of phenol at reduced pressure in a Teflon-sealed glass hydrolysis ampoule (Pierce) at 105 ° C for 16 h. The hydrolysates are dried in a Speed Vac concentrator (Savant Instruments) and derivatized with phenylisothiocyanate for 20 min. At room temperature. The phenylthiocarbamyl amino acid derivatives are analyzed by rp HPLC on an octadecyl column (4.5 x 250mm, IB). There is a linear gradient between the first solvent (0.15M sodium acetate, pH 6.4, 0.05% triethylamine, titrated to pH 6.4 with acetic acid) and the second solvent (60% acetonitrile) at a flow rate of 1 ml / min , used at 38 ° C.

6.5.7 Determination of the amino acid sequence

Peptide sequences are determined on an Applied Biosystem Model 475 gas phase sequencer as described (Hewick et al., 1981, J. Biol. Chem. 256: 7990-7997). Three pre-cycles of Edman degradation are performed prior to loading the sample before each run. 25% TFA is used to convert the triazoline derivatives to the phenylthiohydantoinamic acids. Identification of the phenythiohydantoin amino acids is performed on-line on a Model 120 A PTH Analyzer (Applied Biosystem) as described (Hunkapiller and Hood, 1983, Science 219: 650-659).

6.5.8 Different treatments

50 to 100 units of either semi-purified (semi-preparative rp CI8 step) or purified AR are used for these experiments (Table 1). N-glycanase and O-glycanase are raised by Genzyme Corp., Boston; all other enzymes are purchased from Boehringer Mannheim Biochemicals or Worthington Biochemicals. The treatments are carried out in 50 to 200 μΙ of a suitable buffer. The enzymes are used in excess, usually 5 to 20% (w / w) of the substrate concentration. After the treatments, samples are tested for GIA after removal of interfering compound by various analytical means. In most cases, the pH of the samples is adjusted to about 2 with 10% TFA. The samples are loaded on a reverse-phase Ultra-pore RPSC C3 column (4.6 x 75 mm, Altex) equilibrated with 0.1% TFA. The column is washed with the first solvent 0.1% TFA. Subsequently, the elution is carried out using acetonitrile with 0.1% TFA as the second solvent. The gradient parameters are 0 to 50% 0.2 min and 50 to 50%, 19.8 min. The flow rate is O, 5ml / min. and fractions of 2ml volume are collected. Samples of these are tested for GIA. The AR activity is usually eluted with fraction 4.

6.6 DNA binding studies

The binding of AR to native calf thymus DNA cellulose, denatured calf thymus DNA, and cellulose is performed as described (Herick and Alberts, 1971, Methods Enzymology 21: 198). The celluloses (10 mg) are rehydrated in 500 μl loading buffer (20 mM Tris pH 7.4.10% glycerol, 1 mM EDTA, 1 mM β-mercaptoethanol, 100 mg / μl BSA and 50 mM NaCl). The reactions are carried out twice in 1.5 ml Eppendorf containers with 300μΙ hydrated (packed volume) cellulose samples, which are washed 5x with loading buffer. Subsequently, 0.2 ng of ¹²⁵ I-AR (specific activity 425 pCi / pg) or other ¹²⁵ l-labeled proteins in 250 μl loading buffer are added to each vessel. The samples are mixed and incubated for 20 min. At 4 ° C with periodic shaking and then washed 5x with 200 μΙ loading buffer. The elution was carried out step by step with 0.1 M, 0.15 M, 0.25 M, 0.6 M, 1 M and 2 M NaCl in loading buffers (5 × with 200 μΙ at each concentration). As the specific bound material, one which is eluted at a NaCl concentration of 0.25M or greater is considered. The material eluted at a concentration of 0.15 M NaCl or less is considered non-specifically bound.

6.7 results

6.7.1 Production of AR by TPA-treated MCF-7 cells

MCF-7 cells grown on a plastic substrate show typical ephitelial properties: the cells are small and polygonal in shape. TPA induces marked morphological dose-dependent changes. Following TPA treatment, MCF-7 cells lose their defined morphology, become rounded and proliferate. TPA results in a dose-dependent reduction in cell number and an increase in cell volume compared to untreated cells.

Serum-free conditioned medium of MCF-7 cells does not contain any detectable growth-inhibiting activity for A431 cells. However, serum-free supernatant, which is isolated after 2 to 3 days treatment of MCF-7 cells with TPA, inhibits the proliferation of A431 epidermal carcinoma cells. Optimal induction of inhibitory activity is observed at 25 to 100 ng / ml TPA. Even after removal of TPA, TPA-treated MCF-7 cells secrete this activity into the serum-free medium for at least another 8 days. Although a reduction in growth-inhibiting activity is observed within this period after TPA removal, these results indicate amphiregulin, the expression of which has been implicated or enhanced in TPA-treated MCF-7 cells.

6.7.2 Initial characterization

Table II summarizes the effect of various physical chemical and enzymatic treatments on the anti-proliferative activity of amphiregulin. Growth inhibitory activity (GIA) persists despite treatment with 1M acetic acid, 1M ammonium hydroxide, 6M urea, 0.01M sodium metaperiodate, heating to 56 ° C for 30 minutes, and

Treatments with neuraminidase, N-glycanase, O-glycanase, lipase, phospholipase A2, C or D obtained. However, the activity responds to heat treatment at 100 ° C for 10 minutes, reduction, reduction and 4-vinylpyridine treatment and digestion with proteinases such as trypsin, endopeptidase Lys-C, endopeptidase-Arg and endopeptidase-Glu (V8). These results indicate that amphiregulin is a protein containing cysteine in disulfide bridges, which are of essential importance for biological activity. The protein may contain oligosaccharide and / or lipid moieties which are not obligatory for biological activity.

Table II

Influences of various treatments on the GIA of amphiregulin

treatment

Percent of control

1 M acetic acid, 2 h at 4 ⁰ C 102

1MNH ₄ OH for 2 hours at 4 ⁰ C 97

56 ° C at 30 in 96

100 ⁰ C at 10 in 5

6 M ureas at 25 ° C) 82

0.2 M 2-mercaptoethanol (2.5 h at 25 ^° C.) 6

2-mercaptoethanol + 4-vinylpyridine (2.5 h at 25 ^° C.) + (2 h at 25 ^° C.) 1

0.01 M sodium metaperiodate (6h at 4 ° C dark) 86

TPCK trypsin (6h at 37 ° C) 3

TPCK-trypsin + soybeans inhibitor (6 h at 37 ⁰ C) 82

Soybean trypsin inhibitor (6 h at 37 ^° C.) 109

Endopeptidase Lys-C (20 h at 25 "C) 5

Endopeptidase Arg (16h at 37 ° C) 4

Endopeptidase Glu (16h at 37 ° C) 6

Neuraminidase (16 h at 37 ° C) 103

N-glycanase (16h at 37 ° C) 90

O-glycanase (16h at 37 ° C) 102

Neuraminidase + N-glycanase (16 h at 37 ° C) 94

Neuraminidase + O-glycanase (16 h at 37 ⁰ C) 105

Phospholipase A 2 (6 h at 37 ° C) 82

Phospholipase C (6 h at 37 ° C) 95

Phospholipase D (6 h at 37 ^° C.) 80

Lipase (6 h at 37 ° C) 111

6.7.3 Purification of amphiregulin

A summary of amphiregulin purification is included in Table III. An 1842-fold enrichment with 5.1% yield for the TsK 250-l fraction I and a 2270-fold enrichment with 1.7% yield for the TSK fraction II is achieved. The process is reproducible. Amphiregulin was purified 4x with similar results. The specific activity of purified amphiregulin ranges from 2.7 to 3.4 x 10 ^e units / mg protein. Purified amphiregulin from the TSK-250-I column has a specific activity of 3.0 χ 10 ⁶ and was used for structure determination and other biochemical studies

used.

Table III Summary of Amphiregulin (GIA) Purification

fraction Volume (m Protein (цд) GIA * (UnitsXIO " ³ ) Specific activity UnitsXIO " ³ per mg Yield% Cleaning (-fold) Crude 300 916.600 1363 1.49 100 1 Prep. Cl 8 runs. wash fraction 950 532000 1052 1.98 77.2 1.3 Prep. rp. ODS 225 2,281 286 125.43 21.0 84.2 Semi prep. rp.CI8-l -Il 20 20 339 235 97 92 286.14 391.49 7.1 6.7 192.0 262.7 Anal rp. Cl 8-1 -Il 6 6 242 173 50 46 206.61 265.89 3.7 3.4 138.7 178.4

TSK250-I

3.6

25.5

2,745.10

5.1

1 842.3

Continuation Table III

fraction Volume ImL) Protein (μ9> GIA * (UnitsXIO " ³ ) Specific activity UnitsXKT ³ per mg Yield% Cleaning (-fold) I-A I-B I-C 1.6 1.2 0.8 6.6 11.4 7.5 15 33 22 2,272.73 2,894.74 2,933.33 1.1 2.4 1.6 1,525.3 1,942.8 1,968.7 TSK250 II 1.2 6.8 23 3,382,35 1.7 2,270,0

* The details are given in section 6.1.3 and the following subsections. One unit of GEA corresponds to the amount of factor required to inhibit ¹²⁵ I deoxyuridine uptake in A431 cells by 50%.

6.7.4 Analysis of amphiregulin (AR) and S-pyridylethylated amphiregulin (SPE-AR) by HPLC

Gel permeation chromatography of AR and SPE-AR over a TSK column (7.5mm χ 600mm, Bio-Rad) is shown in Figures 5A and 5B, respectively. The activity was eluted together with the protein peak (5 Å). The molecular weight of AR and SPE-AR was determined from the data in Figure 5 and is approximately 14,000 and 17,000, respectively. The calculated molecular weights for the structures of truncated AR and AR in Figure 12 are approximately 8500 and 9100 daltons, respectively.

AR and SPE-AR were eluted as symmetrical single peaks from an Ultrapore RPSC C3 rp HPLC column (4.6 mm χ 75 mm, Altex) (Figures 6A and b). The GIA was eluted along with the protein peak (Fig. 6A). SPE-AR was eluted at an acetonitrile concentration of about 21%, and thus at about 4% higher acetonitrile concentration compared to untreated protein. These results indicate that AR is rich in cysteine residues that are modified by 4-vinylpyridine, rendering AR more hydrophobic and thus eluting at a higher acetonitrile concentration.

6.7.5 SDS-PAGE analysis of AR

Figure 7A shows an analysis of AR, N-glycanase-treated AR (NG-AR) SPE-AR and N-glycanase-treated AR (NG-SPE-AR) in 15% acrylamide under reducing conditions (Fig ). AR and SPE-AR migrate in the gel as broad diffuse single bands with a mean relative molecular weight of 22,500 within a range of 20,000 to 25,000 (lanes 1 and 3). The treatment of AR and SPE-AR with N-glycanase leads to a higher migration rate of these proteins. NG-AR and NG-SPE-AR migrate in the form of a single lane with an average molecular weight of 14,000 and 14500 daltons, respectively. Similar results are obtained when the proteins are analyzed in a 15% gel under nonreducing conditions (data not shown). Treatment of AR with neuraminidase, O-glycanase or neuraminidase and O-glycanase together does not result in alteration of electrophoretic mobility in a gel under reducing or non-reducing conditions. AR is thus a single-stranded glycoprotein and contains one or more N-linked oligosaccharide chains that are not required in vitro for the GIA of AR.

Treatment of NG-AR or AR with phospholipase D (PLD) (cabbage) results in GIA reduction to 80% of the control value. PLD-treated NG-AR is applied to a C3-rp HPLC column and the purified active peaks are analyzed on a 20% SDS-PAGE (Figure 7B). A single band with Mr 5600 can be observed. These results indicate that PLD or one or more protease contaminants in the PLD preparation converts AR into one or more active fragments.

6.7.6 Analysis of AR by Isoelectric Focusing (IEF)

An IEF analysis of ¹²⁶ L-labeled AR is performed according to the instructions in Section 6.1.1.2, above. AR is focused as a single broad band with an δ value between 7.6 and 8 (Figure 8).

NG-AR is fixed as a single band with an δ value of 8.05. AR thus represents a basic single N-bridged glycoprotein.

6.7.7 Biological properties

The inhibition of ¹²⁵ I-deoxyuridine uptake into the DNA of A431 cells by different concentrations of purified AR is given in Figure 9A. A 50% inhibition of DNA synthesis is observed at approximately 0.24ng / well. A 50% inhibition of DNA synthesis in A431 human epidermal carcinoma cells is therefore observed at a pure protein concentration of about 0.13 nM. It should be noted that the growth-inhibiting activity of AR is dependent on experimental bindings such as the number of cells per well (cell density), the time of factor application, the duration of treatment, the serum concentration and other variables.

When A431 cells are grown in the presence or absence of various concentrations of AR, and cell growth is recorded by counting the cells, it is found that AR inhibits dose-dependently in A431 proliferation (data not shown). The extent of ¹²⁶ l-deoxyuridine incorporation into the DNA thus represents a good measure of cell growth.

The stimulation of ¹²⁵ I-deoxyuridine uptake into DNA of human foreskin fibroblasts (Sadamoto) as a function of various concentrations of purified AR is shown in Figure 9B. There is a twofold stimulation of ¹²⁵ I-deoxyuridine incorporation at about 0.7 ng / ml or about 0.05 nM AR. The maximum response is a six-fold stimulation of ^12s l-deoxyuridine incorporation into these fibroblasts. AR thus acts as a growth factor for human fibrolasts even in the presence of 5% FBS. The effect of AR on the incorporation of ¹²⁶ l-deoxyuridine into the DNA of various tumor cell lines and non-tumor human cell lines as well as some non-human cell lines was investigated. The data are summarized in Table IV. AR inhibits the growth of various clones of A431 cells, human mammary carcinoma cells HTP132, human ovarian teratocarcinoma cells HTP1575, human cervical epidermal carcinoma cells CRL155, human ovarian papillary adenoma cells НТВ 75 and human breast adenocarcinoma cells НТВ 26. The Factor shows no significant effect on a variety of cells (Table III). AR stimulates the uptake of ¹²⁵ l-deoxyuridine in several human fibroblast cell lines,

in human pituitary tumor cells CRL7386, in human ovarian adenocarcinoma cells HTB77, in the liver cells BSCI of the African green monkey and rat kidney cells SA6. AR does not significantly affect the proliferation of T, B or endothelial cells. AR does not suppress human proliferative or cytotoxic T cell responses in mixed leukocyte culture reactions (MLC).

AR represents a monomeric protein which requires disulfide bonds within the protein chain for its activity. Glycosylation is not required for the activity. AR is stable under mildly acidic and basic conditions and at 30 ° C heat treatment at 56 ° C. The biological activity of AR is completely lost by the reduction by 5 minute heat treatment at 100 ⁰ C, by digestion with trypsin, endopeptidase Lys-C endopeptidase ARG or endopeptidase GLU.

Table VI

Effect of amphiregulin on the proliferation of cells *

indicator cells growth growth inhibitor stimulator activity activity GIA (Units) " (Units) GSA humanely Vulvaepidermal carcinoma A431 125 humanely Breast adenocarcinoma НТВ 132 240 humanely Cervixepidermal carcinoma CRL1550 28 humanely Ovarian papilla RADIO НТВ 75 19 humanely Ovarian teratocarcinoma НТВ 1572 55 humanely Breast adenocarcinoma НТВ 26 5 humanely MelanomA375 N.D. N.D. humanely Breast adenocarcinoma ZR 7530 N.D. N.D. humanely Breast adenocarcinoma MCF-7 N.D. N.D. humanely LungenadenokarzinomA549 N.D. N.D. humanely Prostate adenocarcinoma PC3 N.D. N.D. humanely Colon carcinoma H3347 N.D. N.D. humanely Lymphoblastoid (T cells) CEM N.D. N.D. humanely EBV-transformed B cells N.D. N.D. humanely Laryngeal epidermal carcinoma Hep 2 N.D. N.D. humanely Cervical carcinoma CRL1594 N.D. N.D. humanely Ovarian adenocarcinoma НТВ 77 25 humanely Foreskin Fibrolastics (Sadamoto) 225 humanely Foreskin Fibrolasts (Goodwin) 70 Bovin Fetal cardiac endothelial cells N.D. N.D. Murin Balb / 3T3 N.D. N.D. Simian African Green Meerkat Kidney cells BSC-1 65 Kidney SA 6 45

A 125 Units (GIA on A431 cells) of AR are suspended in 250μΙ assay medium, serially diluted serially with assay medium. Six dilutions are used for each cell. The fractions are on

growth modulating activity is tested and the GIA and GSA units are calculated; b A GIA rarity is defined as that amount of factor which results in a 50% inhibition of the

¹²⁵ l-deoxyuridine uptake into cells is needed

 с A GSA unit is defined as the amount of the factor that leads to a 100% increase in the

²⁵ I-deoxyuridine uptake into the cells is required

 N.D. = undetectable

The influence of AR and EGF on NRK-SA6 cell colony formation in soft agar in the presence or absence of TGF-β was tested. The results are summarized in Table V. In the presence of TGF-ß, EgF induces a dose-dependent and anchorage-independent growth of SA6 cells. AR is a very weak inducer for SA-G colony formation in Softagar.

Table V

Effect of AR and EGF on NRK-SA6 cell colony formation in soft agar

encore Number of colonies described. (per ml) per 6 fields none 0 TGF-ßdng) 0 AR (2 ng) 0 AR (4 ng) 0 AR (2 ng) + TGF-βdng) 7 AR (4ng) + TGF-βdng) δ EGF (2 ng) 0 EGF (4ng) 6 EGF (2ng) + TGF-βdng) 30 EGF (4ng) + TGF-βdng) 114 The tests were as in section

6.7.8 Effect of AR on the binding of EGF to its specific receptors It is found that AR inhibits the binding of ¹²⁵ I-EGF to A431 cells as well as to A431 plasma membranes (Figure 10). A 50% inhibition of ¹²⁶ l-EGF binding to fixed cells and membranes is observed at approximately 1.1 nM and 1.8 nM EGF, respectively, while a 50% reduction in EGF binding to cells and membranes at approximately 1 , 8nM and 5.7 nM AR, respectively.

Unlabeled EGF inhibits ¹²⁵ I-EGF receptor interaction at higher concentrations in both systems. The competition maxima with AR were 75% and 50% for binding to cells and membranes, respectively. The competition curves for AR are not parallel with those of EGF. These results indicate that AR shows less activity on EGF receptors than EGF itself. In addition, the AR-specific receptor could be closely related to the EGF receptor.

From several selected clones of the A431 cell line with different sensitivity to AR inhibition, a lack of correlation between AR sensitivity and the number of EGF receptors per cell or K _D value can be observed.

Table VI Lack of correlation between amphiregulin sensitivity of different A431 clones and the K _D value of the EGF receptor

EGF binding parameters K ₀ (NM) relative 1.80 sensitivity A 431 clones Binding site per cell 3.13 (GIA) to AR A-3 4.6 χ 10 ⁵ 1.38 34 F-8 9.0 χ 10 ⁵ 3.18 20 A-2 5.1 χ 10 ^s 11 A-8 5.3 x 10 ^s 1

Different A431 clones were selected by growth in soft agar. EGF binding was performed according to section 6.6.1.5 above. Kd and the number of binding sites were derived from Scatchards plots (Scatchard et al., 1949, Ann. N.Y. Acad.

51: 660-672).

6.7.9 Chemical structure of amphiregulin

The amino acid sequence of AR was deduced from the microsequence analysis of S-pyridylethylated protein (SPE-AR) and the fragments produced by endoproteinase Lys-C, Staphylococcus aureus protease V8 and endopeptidase Arg. The sequences of the truncated protein as well as the protein with six additional amino acids are the following:

Shortened AR

1 10 20

VVKPPQNKTE SENTSDKPKR KKKGGKNGK 30 40 50

NRRNRKKKNPC NAEFQNFCIH GECKYI

60 70 78

EHLE AVTCKCQQEY FGERCGEK

Bigger AR

1 10 20

SVRVEQVVKP PQNKTESENT SDKPKRKKK

30 40 50

G GKNGKNRRNR KKKNPCNAEFQNFCI

60 70 80 84

HGECK YIEHLEAVTC KCQQEYFGER CGEK

In the sequences given above, the amino acids are named with the usual one-letter code for an amino acid. Amino acids whose identity is not fully protected are given in parentheses. The letter "X" denotes amino acids of unknown identity, the amount of the larger AR is about 16% of the truncated AR.

The protein sequence of AR was compared to all proteins in the National Biomedical Research Foundation database (PIR 13) and in the Genetic Sequence Database (Bolt Beranek and Newman, Inc. Los Alamos National Laboratory DNA Sequence library (Release γ # 12). These searches revealed that AR is a novel protein belonging to the EGF superfamily of growth factors, including EGF (mouse, human, rat, bovine, etc.), TGF-α, viral growth factors (Vaczina, Myso, Shopefibroma), human Plasminogen activator, bovine factor IX, human factor X, LDL receptor, bovine protein C, human proteoglycan core protein, product of Drosophila Notch gene, product of C. elegans Mn 12 gene, and the product of "cell lineage" specific Genus for sea urchin S. purpuratus A comparison of the AR structure with the structures of proteins of the EGF superfamily reveals that AR, like other members of the EGF superfamily containing the characteristic six essential cysteine residues, i The preservation of the distances between the cysteine residues and contains a part of the characteristic strongly conserved amino acids. It appears that AR is to be classified between EGF and TGF-like members and MGF and SFGF-like members of the growth factor family, in particular with regard to the occurrence of asparagine. For example, at position 2 (first cysteine = 1) all TGFs and EGFs have a proline residue, VGF has a glycine residue and MGF, SFGF and AR have an asparagine residue. In the same loop at position 7, EGF's and VGF's have a glycine residue, TGF's a glutamine residue and MGF, SFGF and AR an asparagine residue. However, in the third loop, AR does not have the conserved beta at position 34 (either asparagine in MGF and SFGF and one glycine residue in all the other members), but has a glutamic acid residue (low beta potential) at this point. AR has a different structure for the highly conserved third loop, which can affect receptor binding. The AR also lacks the asparagine residues, which may be used in MGF and SFGF as glycosylation sites within the growth factor structure.

The N-terminal sequence of AR shows some analogy with the N-terminal sequences of TGFs, VGF and MGF in that it is rich in prolines, serines and threonines such as TGFs and VGF potential N-linked glycosylation sites (in reality one site). and also has the potential for O-linked glycosylation in this area, as this region is rich in serines, threonines and prolines. This region is highly conserved between the N-terminus of the TGF precursor and the N-terminus of VGF and appears to be a highly glycosylated region.

AR is an extremely hydrophilic protein, especially in the region of amino acids 8 to 45 (FIG. 2). The hydropathicity profile of AR shows little similarity to the profiles of other members of the EGF family. The hydrophilicity profile of the C-terminal region of AR differs from other members of the EGF family in structural similarity to other members of this family (Figures 11 B and C).

6.7.10 Specific binding of AR to DNA

¹²⁶ I-AR is tested for its ability to bind to cellulose, denatured DNA-cellulose and native DNA-cellulose according to the test conditions in section 6.6, above. The results in Figure 14A indicate that AR specifically binds to both denatured and native DNA cellulose, but not cellulose itself. The binding to native DNA was 3 to 4χ greater than the binding of denatured DNA.

The ability of AR to bind specifically to DNA distinguishes AR from all other members of the EGF superfamily.

For example, EGF is unable to bind to DNA cellulose (Figure 14B). The results strongly suggest that the hydrophilic 45 amino acid N-terminal domain of AR, which is found neither in EGF nor in other members of the EGF family, is a nuclear localization sequence involved in the "targeting" of AR is involved to the nucleus, where then the factor interacts with the DNA.

Example 7: Antibodies to Amphiregulin

The production of antibodies to AR, synthetic AR and AR precursor peptides is described in the following subsections.

7.1 Material and Methods

7.1.1 Solid Phase Peptide Synthesis

Amphiregulin is prepared and purified according to Section β. Five peptides containing residues 31-50 (# 279), 71-90 (# 280), 108-130 (# 264), 166-184 (# 259) and 221-240 (# 281) corresponding to the AR primary structure (Figure 15) are synthesized by solid phase technique on an automated peptide synthesizer made by Applied Biosystems Inc. as described (Merrifield, 1963, J. Amer. Chem. Soc. 85: 2149). The synthesized peptides are cleaved from the carrier resin by means of HF (Tarn et al., 1988, J. Amer. Chem. Soc. 105: 6442). The synthetic peptides are purified by reverse phase HPLC.

7.1.2 Antibody production

Polyclonal antisera to mature AR and synthetic AR peptides chemically conjugated to keyhole limpet hemocyanin (KLH) are produced in young adult New Zealand white rabbits. The synthetic peptides are conjugated with KLH as described (Ishikawa et al., 1983, Immunoassay 4: 235). Matured AR was not paired. AR or the peptide conjugates are emulsified with the Ribi adjuvant system (Ribi Immunochem Research, Inc., Hamilton, MT). A total dose of 1 ml is administered to each rabbit: 0.8 ml intramuscularly at two sites in each hind leg and 0.2 ml subcutaneously at one site. For the generation of antisera to mature AR 30pg mature AR is used for the first inoculation and 15k for the following "booster" injections. For production of antisera to synthetic AR-peptides 100 цд of the conjugated peptide are used for the first injection and 50 цд for the subsequent booster injections. The booster injections are made every three to four weeks, and the rabbit is bled 10 to 14 days after the booster injection.

7.1.3 Immunoprecipitation

AR is radiolabeled with ¹²⁵ I using the chloramine-T method (Barridge, 1978, Methods Enzymol. 50: 54-65). 10μΙ polyclonal serum (or diluted in PBS) is combined with 10μΙ ¹²⁵ I-AR (50ng / ml, specific activity 425 cc / цd) and 30μΙ PBS and assayed essentially as described (LeBier et al., 1982, J. Immunol : 2287-2292).

7.1.4 Radioimmunoassay

Polygonal sera are diluted 1:50 in PBS. ¹²⁶ I-AR (1 цд / ті, specific activity 425 цСі ^ д) is diluted 1: 200 with TNEN / 0.1% BSA (20 mM TrispH 7.4.5 mM EDTA, 15 mM NaCl, 0.05% NP-40, 0.1% BASA). 10 μΙ unlabeled Ar (1 mg / ml), 10 μΙ diluted polyclonal serum and 30 μΙ diluted ¹²⁶ I-AR are combined and incubated at room temperature for 45 min. A protein A Sepharose solution is prepared as follows: 200mg dry protein A Sepharose (Pharmacia) is rehydrated with 1.4ml PBS ipsa 80g of the Rehydrate is washed and 400μΙ with a solution of 100mM Tris pH 8.1 , 15 mM NaCl, 0.5% Triton X-100.2 mM PMSF, 1% aprotinin and O ^ g / ml of levpeptin. 20 μΙ protein A solution is then added to the mixture and an additional 30 min. incubated. The Sepharose is then washed 2x with 500μΙ TNEN / 0.1% BSA, suspended in 50μΙ SB (80mM Tris pH 6.8.3% SDS, 15% glycine, 0.01% bromophenol blue, 5% β-mercaptoethanol) and heated to 100 ° C for 5 min. The samples are centrifuged and the supernatants are checked for radioactivity in a gamma counter. With this procedure, 100pg of AR can still be detected.

7.1.5 Enzyme-linked immunosorbent assay

The solid phase micro ELISA method has been modified from US application 740124. Terasaki microtrays are added to each well by adding 5μΙ of the synthetic AR peptide diluted in PBS to various concentrations. Then the solution is allowed to dry overnight at room temperature. 5% Blotto in PBS is added to the plates and allowed to stand at room temperature for 1 hour. In the next step, 10 μl dilutions of the polyclonal antibody solution (diluted in PBS / 1% Blotto / 0.05% Triton X-100) are added to each well, incubated for 1 h at room temperature and then washed 4x with PBS. 5μΙ of peroxidase-conjugated goat anti-rabbit IgG (Cappel) is added to each well at 1: 1000 dilution in PBS / 1% Blotto / 0.05% Triton X-100, incubated for 1 h at room temperature and then 6x washed with PBS. 10μl of the Micro-EIA-Chromogan solution (Genetic Systems Corp.) are added in a 1:20 dilution. Subsequently, the absorption at OD _{492 is determined} after 20 min. and 40 minutes according to the Genetic Systems Micro EIA manual.

7.1.6 Western blotting

The samples are electrophoresed on a 15% polyacrylamide gel or a 16% tricine polyacrylamide gel in a BioRad minigel apparatus. The gel is then loaded with a nitrocellulose sheet into the cassette so that the nitrocellulose sheet is placed in the cassette so that the nitrocellulose is placed on the cathode side. The protein transfer occurs at a current of 400mA and constant power within 30 min. The nitrocellulose is then removed and immersed in 2.5% Blotto / PBS / 0.2% NP-40 overnight at 4 ° C.

The nitrocellulose filter is then washed with antiserum diluted in 2.5% Blotto / PBS / 0.2% NP-40 reaction buffer, 90 min. On a shaker at room temperature, followed by 4 washes (5 min. each) in 2.5 blotto / PBS / 0.2% NP-40.

Alkaline phosphatase-conjugated Protein A (Cappel) diluted 1: 500 in 2.5% Blotto / PBS / 0.25% NP-40 is then added to the nitrocellulose sheet and incubated for 60 min. At room temperature in a shaker. The filter is then washed 4x with PBS / 0.2% NP-40 (3 min each!) Followed by a 5 minute incubation in APS buffer (10 mM Tris pH 9.5, 10 mM NaCl, 5 mM MgCl ₂ ) are developed in a color reagent (40 ml of APS buffer, 12 mg of Б-ггот ^ -сЫог-З-indoylphosphate (Sigma), 6.8 mg of nitroblue tetrazolium (Sigma) prepared immediately before use and filtered through a 0.2 μm filter), the reaction is quenched with H ₂ O and then air dried.

7.2 Characterization of AR Antibodies

Polyclonal antibodies to mature AR and synthetic AR peptides are characterized by radioimmunoprecipitation, radioimmunoassay, ELISA, and Western blotting. The results are summarized in Table VII.

Table VII Characterization of antibodies to amphiregulin and synthetic AR peptide

polyclonal Test Method ELISA WB Serum against RIP RIA ND 1: 250 Matured AR 1: 256 " 1: 250 (1 ng) (.100pb) ^b ND ND Peptide 259 1: 256 ND 1: 100 1: 100 Peptide 264 1: 256 1: 250 (5 ng) (0.1 ng) (.100 pb) 1: 500 (1 ng) 1: 100 ND Peptide 279 ND ND (5 ng) 1: 100 ND Peptide 280 ND ND (5 ng) 1: 100 ND Peptide 281 ND ND (5 ng)

a dilution of the antisera required.

b The values in brackets indicate the sensitivity of the method

RIP = Radioimmunopräipition

RIA = radioimmunoassay

ELISA = enzyme-linked immunosorbent assay

WB = Western blotting

ND = not determined

8. Example: cDNA cloning of the amphiregulin precursor

The following example describes cloning and analysis of cDNAS encoding the amphiregulin precursor from TPA-treated human MCF-7 carcinoma cells.

8.1. material and methods

8.1.1 RNA preparation

The RNA is isolated from subconfluent cells grown in T150 tissue culture flasks or from freshly thawed tissue cultures using the guanidinium method described by Chirgwin (1979, Biochemistry, 19, 5294). Cells from four T150 bottles are washed in PBS, trypsinized and washed again in PBS. The pellet is suspended in 8 ml of 4 M guanidinium isothiocyanate solution. The DNA is reduced during the passage of the solution through a "18-gauge" needle. With the sample 2.4 ml of a 5.7 M CsCl solution in a Beckman SW41Ti cups are overlaid and at 32,000 rpm for 20 h at 20 ⁰ C. The pellets are resuspended in 300μΙ 2.5M CsCl and precipitated at room temperature with 2 volumes of EtOH The pellets are resuspended in 300μΙ H ₂ O and added after addition of 35μΙ 3Μ sodium acetate (pH 5.1) and 800μΙ EtOH RNA is precipitated at -70 ° C. the precipitation is repeated and the dried short RNA. then the RNA is quantitated at OD ₂₆ O and stored at -70 ⁰ C resuspended in H ₂ O ΙΟΟμΙ.

8.1.2 "Random primed" label with ³² P-TTP

Specific fragments for the AR coding region are excised from low gel temperature agarose (BioRad) and probed with ³² P-TTP (NEN, 300 Ci / mmol) using the random primed method of Feinberg (1983, Anal. Biochem., 137, 266.) Unincorporated deoxyribonucleosides are removed for chromatography on a 1.5 ml Sephadex-50 column Specific activities are typically in the range of 0.5-2.5 x 10 ⁹ cpm ^ g.

8.1.3 RNA Gene and Northern Blot Analysis

10 or 20μ9 of the total RNA are electrophoresed on 1.2% agarose / formaldehyde gels for Northern blot analysis. The agarose / formaldehyde gels are prepared in 480 mM N-morpholinopropanesulfonic acid (MOPS), pH 7.0 / 1 mM EDTA / 10 mM sodium acetate / 2M deionized formaldehyde (pH 5.6) in an IBI VCV chilled-plate gelator. RNA is denatured in the same buffer with 50% formamide at 65 ⁰ C and separated in 1 x MOPS at 20 to 3OmA for 3 to 5h. The gel becomes ЗОМІп. rinsed in 10x SSC and transferred to Hybond-N membrane (Amersham), prehybridized UV-crosslinked (1200 μ Joules) and 5x SSPE (1X SSPE is O, 18M NaCl / 10 mM sodium phosphate, pH7, 7.0 mM EDTA ), 5x Denhardt's, 0.5% SDS, and 20pg / ml denatured salmon sperm DNA hybridized as a carrier. Hybridizations are performed at 42 ° C for 16h with 2 x 10 ⁶ cpm / ml ³² P-ARBPI. The blots are washed several times in 2x SSC with 0.1% SDS at room temperature and with 1x SSC / 0.1% SDS at 65 ° C and on a Kodak X-OMAT-FiIm with two Dupont-Lightning Plus intensifying screens at - 7O ⁰ C launched. The bands are classified as (+) if they are visible overnight, as (+/-) if they are visible after 3 days, and as (+ +) if they are detectable after 6 hours.

8.1.4 cDNA cloning

RNA is isolated from MCF-7 cells after a 24.40 and 72h continuous treatment with 100pg / ml of ^ -O-tetradecanoyl-phorboMS acetate (TPA). Poly (A) ⁺ RNA is isolated from individual pools of these samples and used as template for double-stranded cDNA synthesis as described (Gubler and Hoffman, 1983, Gene 25: 263). G-extended cDNA is ligated into the EcoRI site of Xgt 10 using the BR 1 oligonucleotide adapters (Rose et al., 1986, Proc Natl Acad. See, USA, 83: 1261-1265).

Specifically, 5 μl of poly (A) ⁺ RNA are heat denatured from TPA-treated MCF-7 cells and treated with 5 μg oligo (dT) using 100 U reverse transcriptase in 45 μΙ reaction volume. The synthesis of the second strand is performed using 4U RNase H and 115 U E. coli DNA pol I. 10 μg of T4 DNA polymerase are used to remove the З 'protruding ends to produce blunt ends. The entire 6.8 μg of double-stranded cDNA are segregated on a Sephadex G 50 column. It selects cDNAs greater than 500bp. Subsequently, 150ng cDNA is extended by dG tailing using the terminal deoxynucleotidyltransferase. The dG-tailed cDNA is ligated to the EcoRI site of Xgt 10 using the BR 1 adapter (AATTCCCCCCCCCCCC). The ligated DNA is packaged in vitro (Grosveld et al., 1981, Gene 13: 227-237) and plated on E. coli C600 rK ~ mK hf I with an efficacy of 10 ⁶ recombinant gcDNA. Double nitrocellulose filterprints of 2.5χ 10 ⁵ recombinants are made and the filters are screened with l ³² P] -labeled "best guess" and degenerate oligonucleotide probes (Table VII, below). Derived from the automated Edman degradation of AR after N-glycanase treatment, reduction and S-pyridyl-ethylated AR (Section 6, supra).

sequence C e K K N C K Q Y C Q I e e (Y) F Q N F C Long probe ACA CTT TTC TTT TTG ACA TTT GTT ATA ACG GTT TAA CTT CTT AT 5 ' AAG GTC TTG AAG ACG degeneration Degenerate G C I C H G C C G e C C C 3 ' DAY C GTA CTC (H) ARD41 (Y) ACA I P H N A GT5 ' V T C K C 20 AG G TAA GGT GTA TTA CGA CAC TGG ACG TTC ACG (64-fold) 3 ' Q Q G Y C (K) R C G (E) ARD58 GTC GTC CCG ATG ACG TT 5 ' e GCC ACA CCG CT 5 ' 20 V V e P L e CTC K T e S e (32x) Best Guess CAC CAC CTC GGG GAC CTC TTC TGT CTC AGG GTC 3 ' N T e D F G (R) ARK31 TTG TGG CTC CTC AAA CCG A TG 53 K P Q CGA TTC GGG GTC e 3 ' S K P CTC ARK41 AGA TTC GGG D 67 CTG K 3 ' TTG ARNT 59

Restriction analysis reveals a small number of cleavage sites in the cDNA inserts of pAR1, with an interface of Bsml, EcoRV, Hgal, Nael, Pvull, SmaI and SstI and two Sspl sites. No digestion within the insert occurs with BamHI, CIaI, EcoRI, HindIII, KpnI, PstI, Pvul, Sphl, Stul, and XbaI. A 170 bp BspI-PvUII fragment is isolated and used as a probe for a second cDNA library of 100,000 recombinants prepared as described above. One identifies 13 positive clones with inserts in a wider range from 300bp to 1.3kb, with six inserts larger than 1kb and five inserts having a single Sstl interface known to be within a 100bp Fragment at the 5 'end of pAR1. Four of the five inserts (pAR3, pAR5, pAR9, pAR13) are subcloned for further restriction and sequence analysis. All of these clones have identical restriction patterns based on Bsml, EcoRV, Pvull, Sstl, and SmaI except for pAR9, which is shortened by 100bp at the З 'end and later found to be of an As sequence possibly suitable for priming with oligo (dT).

8.2 Nucleotide sequence analysis of AR cDNA clones

Exact oligonucleotide primers are used to sequencing both strands of the 1,230 bp pAR 1 clone using the dideoxy chain termination method (Sanger et al., 1977, Proc. Natl., Acad. Sci. USA, 74: 5463-5467 ). The entire nucleotide sequence and the deduced amino acid sequence of the clone pAR 1 is shown in FIG. 16. An open reading frame of 965 bp starts at nucleotide # 1. The first AUG is at position 210, but does not match the optimal Kozak consensus for translation start regions (Kozak, 1984, Nucleic Acids Research 12: 857-872, Kozak, 1986 , Cell 44: 283-292) because a purine is missing at position -3. However, such AUG triplets may serve as the initiator codon (as Kozak has found for about 3% of the information studied, possibly also important is the presence of adenosine at position -1 in all of these "less preferred" AUGs and in the mRNA of Although a second methionine is present at nucleotide 378 and is consistent with the initiator consensus sequence, it is believed that the first AUG is the translation start point proper since it is followed by a predicted 19 amino acid sequence consisting predominantly of hydrophobic residues. which is interrupted by 3 prolines, which is typical of a signal peptide sequence (Heijne, 1983, J. Biochem., 133: 17-21).

The longest open reading frame, starting with a methionine, encodes a 252 amino acid polypeptide and receives the 19-residue signal peptide. The encoded sequence follows a 5'-untranslated sequence of 209 nucleotides. The coding sequence is followed by the translation stop signal (TAA) and the З'-untranslated sequence of 262 nucleotides. A potential poly (A) addition signal sequence (AATAA) is found 64 nucleotides upstream (in the 5 'direction) of a series of 15 adenylate residues, which is likely to represent the poly (A) -TaU. The З'-untranslated region of AR contains four copies of the sequence ATTTTA, which is also found in certain lymphokines cytokines and proto-oncogenes. In GM-CSF, this sequence mediates destabilization and degradation of the RNA (Shaw, 1986, Cell 46: 659-667). Conservation of this moiety in functionally similar molecules indicates that AR is also related to this class of lymphokines. The cDNA sequence confirms the mature AR peptide sequence (Section 6, supra) with the exception of amino acid 113 (Figure 15), which is determined by protein sequencing as aspartic acid (D). An asparagine (AAT = N) is derived from the cDNA clones for this purpose. Of five cDNAs examined, all 5 'ends were within the first 25 bp of the pAR1 sequence.

A comparison of the cDNA sequence with the best guess probes revealed a total homology of 74% (ARK41) and 77% (ARK31) .No of the samples matched at more than 8 consecutive base pairs, but 50 out of 67 nucleotides from ARK41 revealed a detectable signal under conditions of very low stringence The codon usage in the AR mRNA sequence differs considerably from the frequencies of use as reported by Lathe (Lathe, 1985, J. Mol. Biol. 183: 1-12) In this case, the degenerate oligonucleotides gave stronger signals: From the cDNA and protein sequences, two proteins with a molecular weight of 9772 and 9173 respectively for the two forms of mature AR on the basis of the cDNA sequence (Figs The hydropathic profile of the AR precursor is given in Figure 11D.

The AR precursor has three potential N-glycosylation sites, one in the N-terminal domain (position 30 in Figure 16) and two in the hydrophilic region of the mature AR (positions 113 and 119). It is known that glycosylation contributes 10 to 12 kd to the molecular weight of mature AR and is probably caused by carbohydrate addition to one or both of these positions in the hydrophilic domain.

The N-terminal serine-rich domain of the AR precursor (Figure 15) contains three potential tyrosine sulfation sites at Y ⁸¹ , Y ⁸³ , Y ⁸⁷ due to the presence of acidic residues, turn-inducing amino acids, and the absence of steric steric residues Huttner, 1987, TIBS 12: 301-303). Most tyrosine-sulfated proteins are secretory proteins. It is believed that modifications by tyrosine sulfation are involved in the activation, transport, or proteolytic processing of the precursor proteins. The serine-rich domain of AR may also contain O-bridged carbohydrate chains due to the large number of serine / threonine residues (23 out of 81) in this region of the molecule, which are bridging sites for this. In this regard, it should be noted that O-glycosylated forms of another member of the TGF family, TGF-a, have been detected (Ignotz et al., 1986, PNAS, 83, 6307-6311). None of the serine residues in the AR precursor are consistent with the consensus sequence for the cAMP-dependent kinase phosphorylation sites (Grima et al., 1985, Proc Natl Acad., See, USA, 82: 617-621). In addition, none of the tyrosine residues has flanking sequences similar to known phosphotyrosine residues.

The hydrophilic domain of the mature AR protein consists of a variety of positively charged amino acids (16 of 37 residues are lysine or arginine residues) including two consecutive regions of 4 to 5 basic charged residues. The SV40 large T antigen core targeting signal is similar to this AR region and contains a characteristic KKKRK sequence, with small amino acids (glycine, alanine, proline) possibly precedent for the formation of an helical structure (Burglin et al., 1987, EMBO 6: 2617-2625, Dingwall et al., 1987, EMBO 6: 69-74). Mutational analysis identifies four consecutive basic residues as the dominant feature of the SV40 core localization sequence (Lanford, 1984, Cell, 37, 801-813) Other nuclear proteins with similar portions of basic amino acids that may be involved in nuclear targeting include nucleoplasm, polyomavirus large T, histones, and nvmyc A fusion of several nuclear signal sequences to the genes for chicken pyruvate kinease, albumin, immunoglobulin, ferritin and β-galactosidase lead to a localization of these otherwise cytoplasmic proteins on the nucleus (Moreland, 1987, Mol. Cell. Biol. 7: 4048-4057). Whether the hydrophilic sequences in AR participate in nuclear targeting of this growth modulator has not been verified. However, the ability of AR to specifically bind to DNA suggests a functional role for AR at the core. Here, AR can regulate DNA synthesis, the cell cycle, or a variety of other nuclear processes.

The TGF-α precursor contains a variety of cysteines in the C-terminal cytoplasmic domain, with some of these residues covalently attached to palmitate (Bringman, 1987, Cell, 48, 429-440). In contrast, the AR precursor lacks any cysteine residues in the cytoplasmic domain, and it is believed that the precursor contains no palmitate residues. Although the biological function of palmitate attachment is unknown, this is another difference between AR and other members of the EGF superfamily.

8.3 Cellular sources of amphiregulin synthesis

Northern blot analysis (Thomas, 1980, PNAS, 77, 5201) using a ³² P-labeled AR cDNA fragments shows hybridization of a single 1.4 Kb RNA species in a variety of normal human tissue cell lines and tumor cell lines. A single band is found in Northern blots when either AREB1 (a 480bp BstEII Pvull fragment of pAR 1 containing the entire coding region of maternally-derived AR and a portion of the N-terminal precursor and transmembrane domains) or AR 170 (a 170bp bsml Pvull fragment from pAR1 containing only the C-terminal half of mature AR) as labeled probes. The results in Table IX below show that low expression (+) of AR RNA is found in normal adult lung tissue and pancreatic tissue. A lower, just detectable expression (+/-) can be detected in normal kidney, liver and brain tissue.

Table IX

Normal human tissue ARRNA

Lung +

Liver +/-

Pancreas +

Kidney +/- spleen

Brain +/-

Placenta -

Intestine, fetal -

Since AR is originally isolated from TPA-treated MCF-7 cells, the determination of the time course of TPA induction of AR RNA in these cells is of interest. MCF-7 cells are treated with TPA for 0,1,3,6,18,24 and 48 h, the total RNA is isolated and each lane is separated on a 1.2% formaldehyde-agarose gel, transferred to nylon membranes and screened with an ARBP1 probe which is complementary to the entire coding region of mature AR. An impressive increase in the 1.4 kb AR RNA species can be observed as early as 1 h after TPA treatment, reaching maximum values between 18 and 24 h. Subsequent Northern blots using a ³² P-ARBP1 probe demonstrate TPA stimulation of AR-RNA synthesis in other breast cancer cell lines, however, peak values never reach the high levels of TPA-induced MCF-7 cells.

A number of tumor cell lines are examined for their AR RNA content both before and 24 h after TPA induction. The results are summarized in Table X. With few exceptions, TPA-treated human breast cancer cell lines are the only sources of detectable levels of AR RNA. One such exception is Caki-1, a human clear cell renal carcinoma cell line that expresses high levels of AR RNA, which are comparable to the levels detected in the TPA-induced MCF-7 cells. All reviewed TPA-treated breast carcinoma cell lines show AR-specific hybridization.

AR apparently has a functional role in the adult lung, pancreas, kidney, liver, and brain, and may be involved in a variety of processes, such as wound healing, tissue repair, and maintenance of neuronal cells.

Table X

Human cell line origin AR RNA content

non-induced TPA-induced

MCF-7 (HTB22) breast adenocarcinoma

HBL-IOO (HTB 124) chest, normal

BT-474 (НТВ 20) breast ductal carcinoma

MDA-MB-157 (HTB24) Breast medullary carcinoma

MDA-MB-361 (НТВ 27) Breast adenocarcinoma

SK-BR-3 (HTB30) brain metastasis

BT-476 breast adenocarcinoma

JEG-3 (HTB36) breast carcinoma

Caki-1 (НТВ 46) choriocarcinoma

SK-HEP-KHTB 52) Kidney Clear Cell Carcinoma

G-401 (CRL 1441) Skin Metastasis

HEPM (CRL 1486) Liver adenocarcinoma - +/-

A-431 (CRL 1555) Embryonic palatal mesenchyme

HBL-299 (CCL 137) epidermoid carcinoma - -

HUF foreskin fibroblast - +/-

Example 9: Genomic cloning and analysis of the amphiregulin gene

The following example describes the genomic cloning of the human amphiregulin gene, its structure and intron / exon organization. Functional and evolutionary links to the EGF superfamily of growth factors are also discussed.

9.1 Material and Methods

9.1.1 Southern blot hybridizations

Total genomic DNA is isolated from subconfluent cells in T150 tissue culture flasks (Maniats, 1982, In Molecular Cloning: A Laboratory Manual). 20,000 of DNA are digested with the indicated restriction enzymes, electrophoresed on a 0.8% agarose gel, and hybridized on Hybond-N (Amersham) with 2 × SCC bottoms buffer (Southern, 1975, J. Mol. Bio., 98, 503-517). blotted. The DNA is bound under the action of short-wave UV (1200pJoules). The filters are hybridized at 65 ° C overnight in hybridization buffer containing 2 χ 10 ^е cpm of ³² P-labeled AR-specific fragment per ml (6x SSC, 5x Denhardt's solution, 0.5% SDS and 20 цд / ті sheared denatured salmon sperm DNA). The probes are up to a specific activity 5-25 χ 10 ⁸ cpm / pg "Random prime" marks the filters are washed extensively at 65 ° C in 1x SSC and incubated overnight at -. 70 ⁰ C autoradiographed.

9.1.2 Construction of genomic library

The bacteriophage lambda L41,7 is selected as a cloning vector and the phosphatase-treated arms are prepared after digestion with BamHI, EcoRI and HindIII. High molecular weight DNA from MCF-7 cells is digested with HindIII, electrophoresed on 0.8% low gel temperature agarose (BioRad) and fractionated by size, the agarose fraction maximally enriched with the desired restriction fragment being at 65 ° C The mixture is then melted and the DNA extracted therefrom with phenol and NaOAc, followed by ethanol precipitation and resuspension to 25-100 Kd / L The Genbank constructions consist of a ligation (overnight at 14 C) of 100ng Lambda L47.1 Armen and 40 ng of extracted and size-fractionated DNA in a reaction volume of 5μΙ in the presence of T4 DNA ligase (Biolabs) Recombinant phages are in vitro with extracts from the E. coli strains BHB 2688 N 205 recA "(lambda imm ⁴³⁴ - clats b 2 red 3 Eam4 Sam 7) and BHB2690 N202 recA "(lambda imm ⁴³⁴ clts Ь2 red3 dam 15 Sam7) (Grosveld, 1981, Gene, 13, 227-223). Genetic libraries are determined for E. coli LE 392. Genomic Clones are with de n AR-specific probes are screened by in situ plaque hybridization (Benton, 1987, Science 196, 180-182) and the DNA isolated from the plaque-purified positive clones (Huynh, 1985, In DNA cloning techniques: a practical approach, D. Glover, eds. [Oxford: IRL Press], p.49-78). Cut out the HindIII inserts and subclone them in pEMBL 18 for restriction analysis and propagation.

9.1.3 Primer Extension Test

Isolate RNA from MCF-7 cells as described in Section 8. Synthetic oligonucleotides which are complementary to nucleotides 40 to 60 (ARAP) and 76 to 97 (ARCP) in the AR cDNA sequence are amplified by T4 polynucleotide kinase to a specific activity of 2 to 5 x 10 ⁸ s / цд ³² Р-епатагкіеП. 1 million cpm of the labeled oligonucleotide

as a primer for 1-strand cDNA synthesis with 50 cc of MCF-7 RNA as described in Section 8.1.4. The product is treated with RNase A, extracted with phenol and chloroform, ethanol precipitated in 80% formamide denatured at 100 ° C for 5 min and analyzed by electrophoresis on a standard 8% polyacrylamide 7M urea sequencing gel.

9.1.4 CAT test

MCF-7 cells are cultured as described in Section 6.2.1. For each test, 1-2 x 10 ⁶ cells are plated in a 100 mm dish in 10 ml of medium, and added 24h later with 20 cc of calcium phosphate-precipitated supercoiled plasmid DNA (Southern and Berg, 1982) rinsed 4h after transfection and shock treated with 25% glycerol for 90 sec, rinsed again and overlaid with 20ml fresh medium containing 0 or 100 ng / ml TPA, cells are washed and 40h after glycerol shift The CAT activity is determined essentially as described by Gormane et al. (1982). The cell extract (3-50 μΙ) is eluted with 2.5 .mu.l and purified by sonication in 100 .mu.l 0.25M Tris-HCl (pH 7.8) mCi ¹⁴ C-chloramphenicol (NEN) in a reaction volume of 150μΙ 0.5M Tris (pH 7.8) and 0.5 mM acetyl-CoA was added. The reaction mixture is incubated for 2 h at 37 ⁰ C, and extracted with 1 ml ethyl acetate on a silica gel TLC plate with CHCl ₃ : 1-butano l (95: 5). The TLC plates are dried and autoradiographed. The acetylated and the non-acetylated ¹⁴ C-chloramphenicol is quantified by counting the excidenced bands in Optifluor. Units of CAT enzyme activity indicate those цд chloramphenicol which are acetylated per hour and per pound of protein in a cell extract.

9.1.5 In situ chromosomal hybridization

The plasmid pAR9 is random-prime-labeled with ³ H-TTP and used for hybridization with normal human metaphase cells prepared from phytohernagglutinin-stimulated peripheral blood lymphocytes (500 to 800 band stages) .This probe corresponds to an AR cDNA. a large part of the З'-untranslated region is missing and incorporated into the EcoRI site of pEMPL 18.

Hybridization is performed with 2,4,20 and 40ng of the probe per ml of the hybridization mixture as described (Le Beau, 1985, PNAS, 82, 6692-6696). The autoradiograms are prepared using a Kodak NTP-2 nuclear track emulsion and the films are applied for 7 to 60 days. Chromosome bands are visualized by staining with "quinicrine mustard".

9.2 Chromosomal location of the AR gene

The chromosomal attachment of the human AR gene is determined by in situ hybridization of the ³ H-labeled AR cDNA with normal metaphase chromosomes. Silver grains are distributed on 50 metaphase smears with 30% non-randomly distributed on bands 4q 13-4q 21. This result is confirmed by the polymerase chain reaction (PCR) with hamster / human somatic cell hybrid DNA containing only human chromosome 4. Oligonucleotide primers derived from the AR exon 3 and the flanking intron generate a 220bp PCR fragment exclusively in human DNA and in the chromosome 4-containing hybrid DNA, while the hamster DNA gives a negative result.

The chromosomal region 4q 13-4q21 also contains the genes for major or melanoma growth-stimulating activity (Anisowicz, A. et al., 1987, Proc. Natl. Acad. Sei., USA, 84, 7188-7192; A. Reichmond et al., 1988, J. EMBO, 2025-2033), for the c-kit receptor (Yarden et al., 1987, J. EMBO 6,3341-3351), platelet factor 4 (PF4) (Griffin et al , 1987, Cytogenetic Cell Genet. 45, 43-73), the interferon-gamma inducible factor IP-10 (AD Luster et al., 1987, Proc. Natl. Acad. Sei, USA, 84, 1868-1871). , for the vitamin D binding protein (group-specific component) (NE Cook et al., 1986, Human Genetics 73, 225-229, JL McCombs et al., 1986, Cytogenet Cell Genet, 42, 62-64), and for Statherin, a calcium-regulating salivary protein (Sabatini LM et al., 1987, Am. J. Hum. Genet., 41, 1048-1060). The gene for EGF is located further away at 4q25.

Gro, IP-10 and PF4 belong to a class of structurally related peptides that may form a growth factor family clustered on chromosome 4. c-kit encodes a cell surface receptor structurally and functionally related to a plurality of growth factor receptors having tyrosine-specific kinase activity, such as. EGF receptor, the neu oncogene, the PDGF receptor and the insulin receptor. Genes for ligands and the associated receptors are generally located on different chromosomes, but some are also common in a particular chromosomal region (Groffin, 1983, Nucl. Acids Res. 11: 6331-6339; Pettenati, 1987, Proc. Natl. Acad., P. USA 84: 2970-2974). The ligand for c-kit has not yet been identified, so AR should be tested for such activity.

Specific translocations are found in a variety of malignant changes. The most commonly observed cytogenetic aberration in congenital acute lymphoblastic leukemia (ALL), t (4; 11) (q21; q23), relates to the region in which AR has been localized (S. Heim et al., 1987, Leukemia, 1, 26-23). ALL are now classified by morphology (as defined by the French-American-British Cooperative Group [FABJ]), B and T cell markers, and chromosome analysis. These classifications serve as the basis for diagnosis, prognosis and treatment of ALL. One third of all cases of ALL involve specific translocations and t (4; 11) corresponds to a prognostic grouping that is commonly found in children less than 16 months of age with an average lifespan of less than 1 year (Kocova et al., 1985, Cancer Genetics and Cytogenetics 16, 21-32).

Translocations involving region 4q21 are also found in T lymphomas (EG Levine et al., 1986, Cancer Res. 46, 6481-6488) and in a case of acute myeloblastic leukemia (AML) (A. Human Genet., 76, 106-108). This region also contains the genes for a dental dysgenesis syndrome and the "piebald trait" of an inherited disease that results in spotty skin pigmentation due to lack of melanoblast migration and differentiation (JJ Hoo et al., 1986, Human Genet. Binding studies between AR and the chromosomes 4q13-4q21 localized disorders allows the determination of the significance of this co-localization.Current cytogenetic analysis indicates that the region 4q contains 21 genes involved in lymphocytic differentiation as an indication of further biological activities or applications for the growth-regulating molecule of the invention.

9.3 Genomic cloning

Southern blot analyzes (Section 9.1) of HindIII-EcoRI or BamHI-digested MCF-7 DNA, when hybridized with an 830 bp probe ( ³² P-labeled Pvull / Bsml-digested pAR1), yield the 5 'Region of the AR gene contains single bands of 12 kb, 8kb and 20kb, indicating that the AR gene is in a single copy. A 170 bp probe (AR 170, Bsml-Pvull) from the З 'end of the mature AR containing the transmembrane domain and cytoplasmic domain coding regions hybridizes to the same HindIII, EcoRI and BamHI fragments and also to another 7.5 kb HindIII fragment, indicating that most of the AR coding region is split between two HindIII fragments of 12 and 6.5 kb. Identical banding can be observed in Southern biot analyzes with digested DNA from human placenta, brain, melanoma (SK-MEL 28), breast cancer (HTB36I, epidermoid carcinoma (A431), and lung cancers), indicating that the AR gene The two HindIII fragments of the MCF-7 DNA are cloned, since they may contain most of the AR gene or the entire AR gene and the adjacent sequences, and the HindIII digested MCF 7-DNA is fractionated by size and the appropriate fractions are ligated with λ L47.1 From a variety of positive clones, the two clones λ ARH12 and λ ARH β are selected for detailed studies, the 12 and 6.4 kb inserts are subcloned into pEMBL 18 and mapped to various restriction sites Using exact oligonucleotide primers and direct sequencing of several smaller subclones, the sequences are seeded determined exons and their intron compounds, with no discrepancies arise to the cDNA sequence.

9.4 Characterization of the AR-5'-regulatory region

Genomic cloning of AR results in the isolation of 6.5 kb of the 5 'flanking sequence contained in the 12kb HindIII fragment. The 688 bp fragment of the first EcoRI site in the 5 'direction from exon 1 to SmaI site in exon 1 (position 40 in the cDNA) is subcloned and sequenced on both strands. These results are summarized in FIG. 17.

Primer extension is performed on MCF-7 RNA with two separate oligonucleotides from exon 1. One major transcript start point (confirmed by both oligonucleotides) is located 1 bp 5 'to the longest cDNA clone. Two subordinate points are found in the +1 and +2 positions in the cDNA sequence, confirming that many of the cDNA clones are mostly full-length. For a functional confirmation of the regulatory region of the AR gene, a chimeric gene (pXARE 1 CAT) is constructed which covers the 688 bp Eco RI to Smal AR 5 'flanking region (sequences 648 to +40, with +1 as the main start point of the Transcription) and controls the expression of a promotor-free chloramphenicol transferase (CAT) gene. This construction has the ability to stimulate transcription of the CAT gene following insertion into MCF-7 cells, with a 6- to 7-fold stimulation of activity by the addition of TPA. This confirms both structurally and functionally the cloning of the 5 'end of the AR gene. In addition, a series of 5'-CAT deletion mutants are constructed containing the AR sequences -539 to +40 (EIa), -387 to +40 (EIb), -277 to +40 (Eic), -148 to +40 (EId), -77 to +40 (EIe), -79 to +40 (EIg), or +19 to +40 bp (EIH) in the same vector. At deletion below the -77 level, basal activity is lost, ie, EIh shows no measurable activity, and all of these constructions show 3.5- to 7-fold enhanced expression as a result of 40-hour treatment with 100 ng / ml TPA. These constructions can be further used in experiments to determine the effects of morphogens, mitogens, growth factors, drugs or fermentation crude extracts on the regulation of AR expression and thus to identify new therapeutic agents.

Nuclear run-off experiments show 3 to 5-fold increased transcription of AR as a result of TPA treatment, and indicate that increased promoter activity is at least partially responsible for TPA induction of AR. Northern blot analyzes with MCF-7 cells treated with TPA in the presence or absence of actinomycin D indicate relatively stable AR RNA, with a half-life greater than 4h. The induction of AR expression as a result of TPA treatment is therefore multi-faceted and involves increased transcription of a fairly stable RNA.

9.5 Intron / exon organization of the AR gene, AR protein domains, evolutionary and functional relationships

The entire genomic sequence of human amphiregulin is shown in FIG. The relationship between exons and the protein domains is shown schematically in FIG.

Primer extension analyzes of AR mRNA and studies with chimeric AR / CAT promoter constructs (CAT chloramphenicol acetyl transferase, a marker gene) localize a functional promoter in the 64bp region 5 'to the end of the longest cDNA clone. Furthermore, there is a consensus TATA box 29 bp upstream from the 5 'end of the cDNA sequence. In front of the З 'end of the gene is a consensus polyadenylation signal sequence located 64 nucleotides away from the poly (A) -TaH in the cDNA. The primary transcript of the AR gene has a size of about 10.2kb.

Six exons encode the human AR precursor and comprise 10.2kb of genomic DNA. The AR exons are 112 to 270 bp long and separated by introns between 1.25kb and 2.1kb in size. The five introns of AR disrupt the coding sequence such that the protein domains are products of the individual exons. Exon 1 encodes the 5 'untranslated domain and the signal peptide domain, exon 2 encodes the N-terminal precursor, exon 5 contains the cytoplasmic region and exon 6 represents the З' untranslated region. Exon 3 and exon 4 encode for the mature AR protein and include both the hydrophilic and EGF-like sequences as well as the likely transmembrane domain. The connection between exons 3 and 4 can be found between the second and third loop of the EGF-like region.

If one superimposes the exon junctions of the amino acid sequences of AR, EGF and TGF-a, it is clear that all these proteins are encoded by two exons and that the intervening intron is located in the same position. In addition, each of the З 'exons encodes the transmembrane domain of the corresponding precursor protein. In contrast, the EGF-like region is located on a single exon in all the other mammalian EGF homologs for which the exon structure was determined: including the new EGF-like repeats in the EGF precursor (Gray, 1983, Nature, 303.722-725); the three repeats in the LDL receptor (Yamamoto, 1984, CeI., 39, 27-38); and from that

in each case a repeat in rat fibronection (Patel, 1987, EmboJ., 6, 2565-2572) and in human coagulation factor XII (Cool, 1987, J. Biol. Chem. 262, 13662-13673) invertebrate homologs, such as Drosophilia Notch Genes and lin-12 from C. elegans also contain multiple EGF-like repeats (Kidd, 1986, Molec Cell Cell Biol., 6, 3094-3108, Greenwald, 1985, Cell, 43, 583-590). In contrast to the mammalian genes, most EGF-like repeats in Notch are contained in a single coding region with only four of the 36 structures being separated by intervening sequences. Remarkably, two of these four structures show greater agreement with AR than with the notch repeat consensus, and a structure is even disrupted by an intron in the same CXC sequence as in EGF, TGF-a, and AR. The nematode lin-12 gene contains at least 11 EGF-like units, nine of which are present in the first exon and the remaining two units are found in other exons, flanking the intact EGF-like unit by introns.

Differences in the structure of the exons from different organisms coding for the EC-like repeats indicate their different origin. One group contains an EGF-like structure bounded by introns, and the other group to which AR belongs has an interrupted structure. The similarities in sequence between the two groups could be as a result of a converging evolution or intron insertion after their diverging from a common gene ancestor.

The intron arrangement within the same CXC sequence of EGF, TGF-a, and AR and one of the notch repeats indicates a common origin, but closer investigation reveals a different "intron phasing." Intron phasing indicates this whether the intron interrupts the reading frame after the first (I), second (II) or third (0) nucleotide of a codon. It is believed that "phasing" is evolutionary in that it enables the shifting of exons containing functional domains within different proteins, EGF and TGF have a "Phase H" intron in the EGF-like moiety while AR and Notch have "Phase I" introns. A similar shift of one nucleotide is found in the penultimate intron within the protease domain of complement factor B and elastase (Cambell, 1983, PNAS, 80, 4464, Swift, 1984, J. Biol. Chem., 259, 14271) The non-random positions of these introns may indicate that a specific intron insertion sequence is present in these genes, on the other hand, there may have been a selection pressure for a division of the coding region at this site the sequences at the exon-intron binding site within the EGF-like unit for human EGF, TGF-a and AR and the first Notch repeat do not give any direct repeats, the m can often observe with transposable elements. However, all four structures have the sequence "gtaagt" which delimits the binding site This sequence may have some function in splicing this intron Viral EGF homologs contain no introns, a comparison between VGF, EGF, TGF-a and AR However, a homology in the field of transmembrane, while growth factors from Myxoma and "Shope viruses" end before this hydrophobic region. More recent studies indicate that the TGF-α precursor is synthesized as a transmembrane protein, with differential proteolytic cleavage leading to the secretion of larger forms which may be cell type specific (Teixido, 1987, Nature, 326, 883-885).

Other EGF homologues that contain transmembrane domains include the coagulation factors, LDL, and the homeotic genes Notch and lin-12, although they are not adjacent to an EGF-like repeat. The presence of the EGF structure in several membrane-bound precursors indicates that in some cases they are processed as secreted growth factors or remain in a membrane associated state and have a function in intercellular and / or intracellular communication.

Some of the AR homologs include homeotic invertible genes. Homeotic gene products are involved in the regulation of cell development. For example, the Notch gene product mediates the correct progression of an ectodermal cell into a neuroblast or a dermoblast. In Notch mutants, all of these cells become neuronal and the offspring, all brain and no skin, are destroyed. A homeotic gene may have an autocrine function to produce or stabilize a particular state in the cells expressing the gene product, and may also be involved in the regulation of such conditions in adjacent cells via cell-cell interactions. It remains to be investigated whether AR has a regulatory influence on the developmental status of certain cell types.

9.6 Processing of mature amphiregulin

Characterization of the AR cDNA reveals that the 78- and 84-amino acid forms of AR are synthesized as the midportion of a 252 amino acid transmembrane precursor form (Section 8.2). The sites for the proteolytic cleavage of the AR precursor that would result in the release of the mature AR do not match any cleavage site of any known protease. At the N-terminal end of the interfaces are found Asp-Asp / Ser-Val and Glu-Gln / Val-Val, while the C-terminal sites have the following amino acids Glu-Lys / Ser-Met. The two forms of AR appear to be the result of further proteolytic processing of a common precursor, since all cDNA clones and genomic clones have the same sequence in this region. Interestingly, an intron lies between the two N-terminal junctions and it is possible that "intron-sliding" is responsible for these differences: MCF-7 cells produce 80% of the AR in the larger 84-amino acid form, while the choriocarcinoma cell line НТВ36 80 In order to determine whether these differences are associated with changes at the DNA level, the polymerase chain reaction technique (Scharf, 1986, Science, 233, 1076-1078) used to isolate the AR exon 3 from MCF-7 cells and TNT-36 cells that produce large quantities of AR mRNA: an AR-Intron-specific "sense" oligonucleotide and an "antisense" Oligonucleotide of the coding region of exon 3 was used for specific amplification of the intermediate 220 bp fragment of the AR gene from both DNA sources, and direct sequence analysis did not reveal any discrepancies in the intron-exon binding site or in the exon-3 coding sequence between these two human DNA sources. This is another indication that the two forms of AR are formed by differential proteolytic cleavage of the precursor.

9.7 Structural comparison of AR and EGF-like growth factors

AR shows a clear sequence homology with other EGF-like proteins, whereby 6 cysteines forming 3 disulfide bridges are conserved and determine the secondary structure of the mature growth factor. Previous computer-assisted comparisons of amino acid sequences result in categorization of EGF-like structures into two distinct groups: growth factors and coagulation factors (see Figure 13). Two sequence models were selected for comparison with AR and other known DNA or protein sequences. The selection is based on the fact that these sequences can be distinguished between the two protein groups and that very few gaps are required for an optimal match. The exact sequences are given in Table 1. The first region corresponds to the first 11 amino acids of the second loop in EGF and the second region corresponds to the third cysteine loop in EGF. Four members of each group of growth factors and coagulation factors are selected to produce consensus sequences based on their proven functional and structural homology. If possible, human sequences will be selected, as a comparison with human AR is sought. The growth factors include: human EGF, TGF-a, VGF and Shope growth factor; coagulation factors include: human factors IX, X, XII and protein C. AR was also compared to the database for both of these homology blocks. The consensus sequence was weighted based on the frequency of occurrence of a residue at a particular location.

Structural functional analyzes of various TGF-a, VGF and EGF derivatives have recently led to the identification of several residues necessary for the biological activity of these growth factors. Recombinant proteins, synthetic peptides, site-specific chemical derivatives and proteolytic degradation reactions have been used to create altered molecules. Some generalizations include (the positions are given in relation to the arrangement in Figure 15): the 6 cysteine residues (positions 1,19,15,26,28 and 37) and their disulfide loops (1-15,9-26,28- 37) are required for biological activity; N-terminal extensions have little effect on activity; an aromatic radical (F, Y) is required at position 8; a non-conservative replacement of Y ³² , D ^41, or L ⁴² results in a loss of activity and / or a marked decrease in receptor formation or autophosphorylation.

AR meets all the criteria that define those residues required for EGF receptor binding and / or for mitogenic activity except for the last two criteria. Matured AR ends immediately before D ⁴ 'and has neither this nor the critical residue leucine 42, yet it interacts with EGF receptor binding and substitutes EGF in some mitogen assays. However, these differences may be responsible for the non-saturable receptor binding kinetics as well as their functional differences from EGF. These differences can be seen in the study of TGF-β synergism, the differential effect on selected A431 subclones, cross-linking, phosphorylation, and the ability to bind to DNA. The extremely hydrophilic region and the N-terminus of mature AR may contribute some of these differences in receptor binding or biological activity.

9.8 AR subcategory of the EGF superfamily

Based on the comparison in Figure 13 and on computer analyzes based on Table I (page 25), the evolutionary distance is calculated. This calculation is used to derive a dendrogram for the EGF superfamily. This step requires the presence of the cysteines, with one point added for each remainder to be found in the weighted consensus sequence. This evolutionary family tree predicts that AR can be classified into a new subset of EGF-like growth factors based on structural and functional homology. Such a model reveals that there are additional members of this growth family and that they can be identified on the basis of homology with the above sequence patterns based on three criteria: a combined score for the two growth factor regions greater than 20, a combined coagulation factor region score "less than 20, and a" combined AR region score "greater than 20. All new molecules that meet these criteria are likely to have some functional homology with EGF, TGF-a, VGF, or AR molecules with a" combined AR region score greater than 40 are classified as members of the AR family within the EGF superfamily and would thus be the subject of the present invention.

10. Example: Bacterial Expression of Amphiregulin 10.1 Materials and Methods 10.1.1 Plasmid Constructions

Plasmid pARD1

The plasmid pARD1 contains the 1.4kb EcoRI cDNA fragment (pARD in pEMBLE18 with a T / C exchange at nucleotide position 532 in the cDNA corresponding to the valine valine sequence at the amino terminal end of the mature AR Base exchange is generated by site directed mutagensis and confirmed by sequence analysis, which allows access to the junction between the AR amino terminal prcessory domain and the hydrophilic region by creating a Ddel site (CTAAG).

Plasmid pARSTOP

The plasmid pARSTOP is an intermediate construction for the production of an AR secretion vector. pARD 1 is digested with Sspl and XbaI and the 515 bp fragment is isolated which codes for the carboxy-terminal 9 amino acids of the mature AR, the transmembrane and cytoplasmic domain, and the З'-unsaturated region. The 4.7 kb (Sspl-XbaI) fragment containing the remaining amino-terminal region of the AR cDNA was gel-purified and ligated with the kinased, annealed complementary oligonucleotides ARSTOP1 and ARSTOP2 (Figure below). These oligonucleotides have a 5'-smooth end which is compatible with an Sspl site, followed by that sequence common to the carboxy-terminal 9 amino acids of the mature AR sequence, a TAA stop codon, and an EcoRV and XbaI site coded.

YFGERCGEK * EcoRV / XbaI ARSTOPl 5 'ATTTCGGTGAACGGTGTGGGGAAAAGTAAGATATCT ARSTOP2 3' TAAAGCCACTTGCCACACCCCTTTTCATTCTATAGAGTC

Plasmid pbAR

Plasmid pbAR contains a promoter-free TGF-β leader linked to the mature 78 amino acid form of AR. The plasmid is prepared by ligating oligonucleotides bLARN 3 and bLARN4 with the 240bp Ddel-XbaI fragment from pARSTOP in EcoRI / XbaI-digested pEMPL18. bLARN 3 and bLARN4 are complementary and produce a 5'EcoRI and a 3'Ddel overhang and a single Nael site compatible with the one interface near the carboxyterminal end of the TGF-β leader sequence. Ligation destroys the Ddel site and generates the correct amino acid sequence valine valine at the amino terminus of mature AR.

SstII

AGVVKPPQNKTESE PHILI 5 'GGGAGTAGTTAAGCCGCCCCAAAACAAGACGGAAAGTGA PHIL2 3 'CGCCCTCATCAATTCGGCGGGGTTTTGTTCTGCCTTTCACT NTSDKPKRKKKGG PHIH 5 'AAATACTTCAGATAAACCCAAAAGAAAGAAAAGGGAGG PHIL2 3 'ITrATGAAGTCTATTTGGGTTTTCTTTCTTTTCCCTCC

EcoRI

KNGKNRRNRKKKN PHILI 5 'CAAAAATGGAAAAATCGAAGAAACAGAAAGAAGAAG PHIL2 3 'ѲТТІТТАССТТГІТГАС (ЛТСІТТСТСТ

Plasmid pDCHBARI

Plasmid pDCHBARI is a mammalian expression vector (Figure 19) designed to secrete the processed, mature 78 amino acid form of AR. It contains the TGF-β leader / mature AR sequence from pbAR under the control of the CMV / HIV promoter flanked by an SV ^ polyadenylation signal. The vector also contains Sv2dhfr in the same transcriptional orientation. PSVDR / bOM is digested with Nael and XbaI and the 6kb vector is separated from the excised OncoM coding sequence. pbAR is also digested with Nael and XbaI and the 260 bp fragment responsible for the carboxy-terminal 5-amino acids of the TGF-β signal sequence and the mature amino acid sequence of 78, followed by a termination codon and an EcoRV and XbaI Interface were isolated; the compounds are confirmed by sequence analysis.

Plasmid pDCHBPHILE

The plasmid pDCHBPHILE is a mammalian expression vector and is used to secrete a chimeric AR / EGF protein. The plasmid is also generated to facilitate future fusion constructions between the hydrophilic AR domain and other growth factors. This construction is accomplished by ligating the 6.5 kb fragment of the pDCHBARI vector produced by Sstll / Xbal digestion, the 175 kp EcoRI / XbaI fragment containing the synthetic human EGF gene, and the oligonucleotides PHIL1 and PHIL2 generated. These oligonucleotides are complementary to the 5'-SstII and 3'EcoRI extensions and encode the last residues of the TGF-β signal sequence and the entire hydrophilic AR domain. pDCHBAR 1 contains the CMV / HIV promoter, all amino acids of the TGF-β signal sequence (except for the last amino acid) and the SV40 polyadenylation sequence. The EGF fragment was prepared by Dr. med. Timothy M.Rose (Oncogen) and contains suitable interfaces for further manipulation.

10.1.2 Preparation of the pTAC Vector

The plasmid TacPak / EGF is provided by Dr. Timothy M.Rose (Oncogen) and consists of the following units: trp-lac hybrid promoter and Cro gene Shine-Delgarno sequence isolated from a Bgl 1 ll / Bam HI fragment from the expression vector ρ 135-1, which in turn was derived from pDR450 (Pharmacia); the alkaline phosphatase signal sequence derived from synthetic oligonucleotides TacPak 1 and TacPak2 (Dr. Rose, Oncogen); the synthetic EGF sequence derived from plasmid pBM22 / PAK / EGF; derTranskriptionsterminations region; the pBR322 scaffold with the neomycin resistance gene derived from plasmid ρ 135-1. TacPak / EGF is digested with BamHI, filled with dATP and dGTP in "2-basic" to obtain an interface that is compatible with the "2-basic" filled Sall site and then digested with Pvul. This digestion removes the synthetic EGF gene and most of the alkaline phosphatase signal sequence leaving the Tac promoter, the Shine-Delgarno sequences and the initiation ATG intact. The 2.8 kb fragment is gel purified.

10.1.3 Preparation of a modified amphiregulin cDNA fragment

Plasmid pARSTOP is digested with Sail, "2-basic" filled in with TTP and dCTP to create an interface compatible with the 2-basic-filled (dATP, dGTP) BamHI extension and then digested with Ddel and BgII subsequent digestion was required to separate concurrent DNA from the desired 242 bp fragment encoding the short form of the mature AR, starting with VKPP and ending at CGEK followed by a synthetically inserted stop codon The 243 bp fragment is transfected cleaned a gel.

10.1.4 Preparation of Synthetic Oligonucleotides ALKPAR1 and ALKPAR2

The complementary synthetic oligonucleotides ALKPAR1 and ALKPAR2 are prepared with a 5'Pvul overhang compatible with the partially filled TacPak / EGF Pvul / BamHI fragment and a 3'Ddel extension compatible with the partially filled pARSTOP Ddel / Sall fragment , They are based on an Applied Biosystems Oligonucleotide Synthesizer

synthesized and purified on an acrylamide gel. Phosphates are added to the oligonucleotides with the T4 kinase and equimolar amounts are annealed with slow cooling after heat denaturation.

Pvul Ddel

IALALLPLLFTPVTKAVV

ALKPARi 5 ¹ сх ^ хстпхллттпга ^ стсстсптх ^ о ^ 3 '

ALKPAR2 3 * ТАСОХС ^ тЛХ ^^ ІАСаЛЗДЗ ^ СААС ^^ 5 '

10.1.5 Ligation and isolation of pTacAPARI

The 243bp partially-filled Ddel-Sall AR fragment, the partially filled 2.8kb Pvul / BamHI TacPak / EGF vector fragment, and the kinased and annealed ALKPAR1 + 2 oligonucleotides are ligated into DNA using DNA ligase E. coli JM 109 cells and selected on LB / neomycin plates. The correct construction was confirmed by restriction digestion and DNA sequencing. The sequence of pTacAPAR is shown in FIG.

10.1.6 Preparation of chimeric AR-hydrophilic domain / EGF gene fragment

The plasmid pDCHBPHILE is digested with Sstll and XbaI to generate the 286 bp fragment that is responsible for the last two residues of the TGF signal sequence (AG), for the 37 residues of the hydrophilic domain of AR (VVKP ... RKKK) and for the 53 residues large synthetic sequence from the mature human sequence (NSDS ... WELR) encoded. The 286 bp fragment is gel purified.

10.1.7 Preparation of Synthetic Oligonucleotides APAREGF1 and APAREGF2

The complementary synthetic oligonucleotides APAREGF1 and APAREGF2 are generated with a 5 'Pvul overhang, compatible with the pTacAPAR 1 Pvul / Xbal fragment and a 3' Sst II extension, compatible with the pDCHBPHILE SstII / XbaI fragment. The oligonucleotides are synthesized on an Applied Biosystems Oligonucleotide Synthesizer and purified using an acrylamide gel. The phosphates are added to the oligonucleotides using T4 kinase and annealed equimolar amounts with slow cooling after heat denaturation.

Pvul Sstll

IALALLPLLFTPVTK

APAREGFl 5 'CGCCCTCGCACTTCTCCCACTGCTGTTCACTCCAGTGACACC 3' APAREGF2 3 'TAGCGGGAGCGTGAAGAGGGTGACGACAAGTGAGGTCACTGTGGCG 5'

10.1.8 Ligation and isolation of pTACAPHILE

The 286bp Sstll / XbaI fragment encoding the hydrophilic domain of AR linked to the mature EGF sequence, the 2.8kb Pvul / XbaI pTacAPAR 1 vector fragment, and the kinased annealed APARegf 1 + 2 oligonucleotides are used DNA ligase, transformed into competent E. coli JM109 and selected on LB / neomycin plates. The correct construction is confirmed by restriction analyzes and DNA sequencing. The nucleotide sequence of pTacAPHILE is shown in FIG. The expected translation product should be cleaved between the dipeptide Ala-Gly which follows the alkaline phosphatase signal sequence, adding an additional residue (glycine) to the hydrophilic domain of AR. The nucleotide sequences that differ from the normal human sequence are highlighted (Figure 20).

10.1.9 Purification of Recombinant Amphiregulin

The plasmids pTacAPAR 1 and pTacAPHILE are transformed into E. coli complex JM 109 cells. These are grown to confluence in 10 ml LB at 37 ° C to an A ₆₀ O of 0.7. The cultures are then induced with 100 μΜ EPTG and grown for 24 to 72 hours. The cultures are centrifuged off twice at 5000 rpm for 15 minutes each. The pellet is set aside and purification is continued with the supernatant. Samples are concentrated in an Amicon ultrafiltration apparatus with YM 5 membranes (excl. Molecular weight 5000). The concentrate is diluted with 5 volumes of MiIIiQ water and reconcentrated to Vw of the original culture volume. Glacial acetic acid is added to a concentration of 1 M and the samples are kept for 2 to 24 hours at 4 ° C. The samples are centrifuged at 19,000 rpm at 4 ° C in Oakridge vials in an SS34 rotor for 20 min, the pellet is extracted with 20 ml of 1 M acetic acid, and the supernatants are pooled. The clear supernatants are then dialysed against 0.1 M acetic acid for 2 days, lyophilized and stored at -20 ⁰ C. The cell pellets and the crude dried supernatant are tested for AR protein by immunoblotting and growth inhibition assay (GIAs). The cell pellet of 50 μΙ confluent numbers or 100 to 200 μΙ dried supernatant is analyzed on a leyoTricin polyacrylamide gel. Stain the gel with Fast Green, transfer to nitrocellulose, and perform Western blots as described in Section 7.1.6.

10.2 Results and discussion

The cell pellets of tranformants containing pTacAPAR 1 contain large amounts of an immunoreactive protein which migrates at 10 kd, as well as some degradation products and possible dimers. The supernatants contain approximately 100 to 200 ng / ml of the secreted immunoreactive AR. By GIA with the supernatants an activity of approximately 150 ng / ml AR on the A431-A3 indicator cell line is determined in comparison with purified native AR. Large quantities of immunoreactive protein are produced in this system, most of which is aggregated within the cell. Tests with periplasmic preparations and supernatants reveal secretion of active protein after 2 to 3 days. pTacAPHILE provides a convenient tool for attaching the hydrophilic domain of AR to the N-terminus of any cloned gene. This region can alter the binding characteristics to the normal receptor of the ligand

The nuclear localization sequence may function, bind to DNA, or transport through a lipid membrane or other membrane that is normally impermeable to the attached factor.

11. Deposit of microorganisms

The following microorganisms have been deposited with the Agricultural Research Culture Collection, Northern Regional Research Center (NRRL) under the following accession numbers:

Micro organism plasmid Deposit no. Escherichia coli HB101 par B-18438 EscherichiacoliHBIOI pARH12 B-18439 Escherichia coli HB101 pARH6 B-18440 Escherichia coli JM109 pTacAPARI B-18441 Escherichia coli JM109 pTacAPHILE B-18442

Claims (12)

A process for producing a nucleotide sequence coding for the amphiregulin gene and modified cells containing said nucleotide sequence, characterized in that a) from cells expressing amphiregulin-like activity, i) the RNA is separated and optionally further purified and the coding DNA by cDNA cloning isolated; or
ii) separating the genomic DNA, cleaving and encoding the DNA by genomic DNA Cloning isolated; and
iii) optionally coupling the respective isolated DNA fragment with a control sequence for controlling replication, transcription and / or translation; b) transforming host cells with an expression vector comprising a nucleotide sequence prepared according to step a), and c) cultivating these cells. 2. The method according to claim 1, characterized in that the mRNA from the human breast cancer cell line MCF-7 after pretreatment with "^ -O-tetradecanoyl-phorboMS acetate (TPA) isolated and constructed a cDNA library in the bacteriophage Xgt10 , 3. The method according to claim 1, characterized in that one obtains a genomic nucleotide sequence which codes for the amphiregulin and comprises a nucleotide sequence which is shown substantially in Fig. 17. 4. The method according to claim 1, characterized in that one obtains a nucleotide sequence which codes for the amphiregulin precursor and comprises the coding nucleotide sequence, which substantially in Fig. 16 from about the nucleotide residue no. 1 to about the nucleotide residue No. 1243 shown is. 5. The method according to claim 1, characterized in that the nucleotide sequence coding for amphiregulin comprises that nucleotide sequence which is shown substantially in FIG. 16 from nucleotide Nos. 528 to 761. 6. The method according to claim 1, characterized in that the cells are Escherichia coli cells. 7. The method according to claim 1, characterized in that the second nucleotide sequence which controls the gene expression comprises a tac promoter. 8. The method according to any one of claims 1 to 7, characterized in that one obtains a nucleotide sequence which is contained in the plasmid pAR 1, which is carried by an Escherichia coli cell line and deposited in the NRRL under the accession number B-18438. 9. The method according to any one of claims 1 to 7, characterized in that one obtains a nucleotide sequence which is contained in the plasmid pARH 12, which is carried by an Escherichia coli cell line and deposited with the NRRL with the accession number B-18439. 10. The method according to any one of claims 1 to 7, characterized in that one obtains a nucleotide sequence which is contained in the plasmid pARH6, which is carried by an Escherichia coli cell line and deposited with the NRRL with the accession number B-18440. 11. The method according to any one of claims 1 to 7, characterized in that one obtains a nucleotide sequence which is contained in the plasmid pTacAPAR 1, which is supported by an Escherichia coli cell line deposited with the NRRL with the accession number B-18441. 12. The method according to any one of claims 1 to 7, characterized in that one obtains a nucleotide sequence which is contained in the plasmid pTacAPHILE, which is carried by an Escherichia coli cell line and deposited with the NRRL with the accession number B-18442 , Here are 34 drawings