DD292819A7 - PROCESS FOR THE PRODUCTION OF FOREIGN PROTEINS IN ANIMAL CELLS - Google Patents

Abstract

The invention relates to a process for the production of foreign proteins in animal cells, which can be used in the biotechnological production of drugs and vaccines. A completely novel expression system for foreign genes is produced by introducing a specifically modified prokaryotic RNA polymerase into animal cells by gene transfer and stable in the cell nucleus. A vector subsequently introduced into these cells with a foreign gene under the control of a polymerase homologous promoter is activated exclusively and highly effectively by the prokaryotic polymerase. The invention is characterized in that the prokaryotic RNA polymerase is effectively synthesized by genetic engineering of a nuclear localization signal under the control of an animal promoter in animal cells, transported into the cell nucleus and becomes transcriptionally active. Genetically stable animal cell clones can be produced by the invention for the production of any desired foreign proteins which, in comparison with known ones, ensure a higher protein synthesis. Cells, animal; Expression system; RNA polymerase, prokaryotic; Promoter, homologous; Vector; RNA polymerase, modified; Nuclear localization signal}

Description

For this 4 pages drawings

Field of application of the invention

The invention relates to a general method for the production of foreign proteins in animal cells by means of prokaryotic expression elements. Application is u.a. the biotechnological production of drugs and vaccines.

Characteristic of the known prior art

Foreign gene expression in animal cells is an essential alternative to product recovery with bacteria or Hofan. Especially for the production of post-translationally modified proteins, this technique is the preferred or the only viable option. There are numerous animal expression systems known, but all use ι own cell expression machinery for product synthesis. Due to the competition of the foreign gene ..It all cell genes to the existing expression (transcription) factors on the one hand and by a shortage of stimulating factors on the other hand, but also due to the presence of very many different mRNAs occurs a limitation of protein synthesis for the foreign gene product. This is confirmed by the fact that similar theoretically very different levels of animal or viral promoters achieve similar levels in product synthesis. It has been shown that prokaryotic elements can also be active in animal cells under certain conditions. Thus, after the introduction of a T7 phage polymerase gene and a foreign gene under the control of a T7 promoter with the aid of a vaccinia virus vector, a good product formation is temporarily detected (Fuerst "* J.- ₁ . [19861 Proc. Natl. Acad. 83.8 122). However, this system has two major disadvantages. Vaccinia virus vectors represent a cytoplasmic active system that leads to cell death after a few tjges. The T7 polymerase can not read any intron-containing animal or human genes in the cytoplasm. It is not transported to the nucleus due to the lack of a nuclear localization signal. This problem is described by Dunn JJ et al. (Gene 68 [2], 1988, 2559-266), by fusing to the N-terminal end of the T7 polymerase a synthetic nuclear localization signal derived from the SV40 large T antigen. This produces a fusion protein that is transported into the nucleus of animal cells. However, it has been found that with such a construction, the nuclear-localized T7 polymerase does not show any significant transcriptional activity, and thus this construction is unsuitable for the expression of foreign proteins.

Object of the invention

The object of the invention is the production of genetically stable animal cell clones for the production of any foreign proteins, which ensure a higher protein synthesis compared to known.

Explanation of the essence of the invention

The object of the invention is to modify the T7 polymerase gene with a synthetic nuclear localization signal derived from the SV40 large T antigen so that the nuclear localized T7 polymerase has significant transcriptional activity. It is intended to establish a stable expression cell line with the polymerase in the nucleus, which guarantees a high expression performance of the system with the corresponding expression vector.

The object is achieved according to the invention by initially genetically modifying the T7 polymerase gene in such a way that the N-terminus is added as an N-terminus by a nuclear localization signal which additionally contains 11 amino acids derived from the SV40 T antigen. is replaced and effectively read by coupling to an animal promoter in animal cells. The modified polymerase synthesized after gene transfer into the recipient cells is actively transported into the cell nucleus, where it reads off subsequently introduced foreign genes under the control of a T7-poly merase homologous prokaryotic promoter highly specific and effective. The cell clone with the highest foreign protein synthesis is selected and used for fermentation.

This basic idea is implemented by the following process steps essential to the invention:

From the DNA of the bacteriophage T7, the RNA polymerase encoding gene is cleaved by restriction endonucleases. According to the literature data (Moffat et al., (1984) J. Mol. Biol. 173, 265), the coding sequence of the polymerase gene extends from nucleotide 3171 to nucleotide 5822 and can not be cloned as a contiguous fragment (Davanloo et al., (1984) Proc. Natl. Acad., 81, 2035.) It is therefore cloned into 2 subfragments, provided with linkers, and cloned between the BglII and SmaI sites of the plasmid pMKdeltaPvu (Brinster et al., 19821 Nature 296, 39) in place of the thymidine kinase gene. In the resulting plasmid, the> complete RNA polymorase gene is located directly behind the mouse metallothionein promoter required for expression.

By cleavage with the restrictases BgIII and Nrul a DNA fragment is split from this plasmid, which is the first

33 amino acids of the polymerase encoded. Since even cleavage of 20-25% of the N-terminus of the polymerase does not result in significant loss of enzyme activity (Tabor and Richardson [1985] Proc Natl Acad., 82, 1074; Schaffner et al. [1987] Nucleic Acids Res 15,8773), no significant reduction in activity is expected by separation of only 4% of the length. The split fragment is replaced by a synthetic sequence with BglII and Nrul compatible ends, respectively. This synthetic sequence contains a portion encoding the nuclear localization signal of the SV40 large T antigen with amino acids 124-133 (Thr-Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val-Glu). Prior to this sequence, the 20 nucleotides before and 12 nucleotides after the A of the Starkodons of the T antigen are placed behind the Bglll site to allow an optimal start of protein synthesis and further 18 nucleotides, which for a favorable binding amino acid sequence (KalderoR et al [1984] Cell 39: 4J9). The nuclear localization signal is followed by 13 nucleotides with an Xbal cleavage site and a Nrul-compatible sequence encoding the amino acids Arg-Leu-Asp. Thus, the first 33 amino acids of the polymerase would be replaced by 23 amino acids (Met-Asp-Lys-Val-Phe-Arg-Asn-Ser-Ser-Arg-Thr-Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val- Glu-Arg-Leu-Asp).

The resulting recombinant pMTT7N (FIG. 1) with the modified polymerase gene is introduced into animal cells by means of transfection together with the selection plasmid pMT-1 (Glanville et al. [1981] Nature 292,267). The colonies resulting from selection with cadmium sulfate are tested for the presence of T7 polymerase in the cell nucleus using an antiserum to purified T7 polymerase by immunofluorescence. This determination is supplemented by determination of the polymerase activity in cell or nuclear extracts. Thus it can be seen that the construction according to the invention has a significant polymerase activity in the cell nucleus. Thus, the expression cell line PMN is obtained, which is used with a suitable vector for the expression of foreign genes. This expression cell line pMN according to the invention was deposited in the Central Institute for Molecular Biology in the depository for cell lines under the no. ZIM-0383. As a vector for the foreign gene either a known plasmid with natural T7 promoter (PGEM plasmid) or a plasmid is used, in which a synthetic T7 promoter sequence is cloned into (eg pUC plasmid). The foreign gene is cloned into a polylinker behind the promoter. As foreign genes z. For example, the following genes coding for proteins are used: genes for hGH, tPA, HBs antigen, BLV envelope proteins, interleukin II u. a. The resulting recombinant vector is introduced by transfection into different cell clones with nuclear-localized RNA polymerase, together with another selection gene than before, preferably with the neo gene in the form of pSV2neo (Southern and Berg [1982] J. Mol. Appl. Genet 1, 327). The cell clones resulting from selection with geneticin are examined with a suitable detection system for Fiemdgen product synthesis. The starting clone with RNA polymerase, which has the highest foreign protein synthesis, is fermented. This clone can be developed in a relatively short time and with little effort into a producer of other foreign proteins; again by transfecting with a recombinant vector carrying the coding gene for the desired protein behind a T7 promoter, followed by selection and fermentation of the best producing clone.

The advantage of the invention is the independence of the foreign gene expression from the cellular expression machinery, since heterologous, prokaryotic expression elements are used. Modification of the T7 polymerase according to the invention by replacing the N-terminus with a nuclear localization signal results in significant polymerase activity in the cell nucleus. The hybrid protein form of the present invention was the only one of several others which had significant activity at the core. The stable cell line PMN with the polymerase in the cell nucleus was established, with which a high expression performance is achieved. Thus, in the case of human growth hormone (hGH) expression of 10 ⁶ cells, more than 20 μg hGH / ml of culture medium is produced in 24 hours.

The invention is a principle solution that allows to generate genetically stable cell clones for the production of any foreign proteins.

embodiment

1. Cloning of the gene for the bacteriophage T7 RNA polymerase

The nucleotide sequence of bacteriophage T7 is fully known (Runn, Studier [1983] J. Mol. Biol. 166, 477-535).

Immediately before the gene of the RNA polymerase of the phage there is a promoter of E. coli RNA polymerase. At the end of,

The T7 RNA polymerase coding sequence is in any case joined by promoter of the phage RNA polymerase. The cloning of a fragment from the phage genome containing the complete sequence of the T7 polymerase, including both promoters, would result in the autocatalytic production of the T7 polymerase and death of the bacterial host cell by overproduction of "nonsens.e" production is assembled from the cloned BstN1 / Ndel fragment of T7 DNA and a synthetic Ndel / Narl fragment containing the 150 bp sequence from Ndel site to the end of the gene without T7 promoter. DNA was cleaved with the restrictases Ndel / BstN1 and the resulting fragments were preparatively separated by electrophoresis in a 0.8% agarose gel The 3308 bp fragment of interest is excised from the gel and recovered by electroelution.

The cloning vector pUC19 (Yanisch-Perron et al. [1985] Gene 33, 103) is linearized with Ndel and the resulting 5 ends are dephosphorylated with 0.5 U / mg DNA alkaline phosphatase (calf intestine). The Ndel end of the BstN1 / Ndel fragment to be monocloned is first ligated to the vector by incubation of approximately 0.2 μg of vector with ca. 0.2 μg fragment and 0.5 U T4 DNA ligase 14 ° C overnight. The heterologous Ndel / BstN1 ends are filled in with 5 U Klenow polymerase. For the purpose of ring closure via the resulting blunt ends, the DNA is diluted to 2 mg / ml and ligated with 10 U T4 ligase overnight at 14 ⁰ C. The ligation product is transformed into competent E. coli DH5 and the plasmid DNA is prepared from individual bacterial colonies. The identification of the correct recombinant is made by length comparison and restriction analysis with Nrul / Narl; the latter also makes it possible to select recombinants in which the Ndel site is at the 3 'end of the cloned fragment.

The synthetic 150 bp Ndel / NarI fragment is made up of double-stranded single-stranded oligonucleotides (84-mer, 87-mer), each paired at the 3 'end for 10 nucleotides, filled in with Klenow polymerase, cleaved with Ndel / Narl , constructed.

84-mer

^6- CACATATGAG TCTTGTGATG TACTGGCTGA TTTCTACGAC CAGTTCGCTG ACCAGTTGCA CGAGTCTCAA TTGGACAAAA TGCC ³ '

87-mer

^B 'GCGGCGCCAC TTACGCGAAC GCGAAGTCCG ACTCTAAGAT GTCACGGAGG TTCAAGTTAC CTTTAGCCGG AAGTGCTGGC ATTTTGT ³ '

The oligonucleotides are purified by electrophoresis in 6% polyacrylamide gel purified with 8M urea and through excising from dam gel fraction of the full nucleotide length, eluting from the gel overnight at 37 ⁰ C with 0.5 M ammonium acetate and subsequent cleaning an octadecyl ( C, ₈ ) column. To check the pairing of the oligonucleotides and filling with Klenow polymerase, one of the two single-stranded oligos with ³² P _y -Gamma-ATP is desized (see below) and analyzed in a 6% polyacrylamide gel electrophoresis.

The pairing of the single-stranded oligos was carried out in equimolar concentration (a 0.1 Mg) at 28 ⁰ C for 15min in 10μΙ of the buffer (5mM Tris pH 7.5 / 5OmM NaCl / 7mM MgCl ₂ ) after 5min heating at 8O ⁰ C. To replenish this approach is incubated with 5U Klenow polymerase 0.04 mM of all NTPs for 30 min at room temperature. After precipitation of the DNA with lOfachem volumes of 96% ethanol are incubated for 1 μρ the double-stranded oligo with each 20U NdeI and NarI 2 hours heated 10 min at 7O ⁰ C, extracted with phenol and precipitated with ethanol.

The vector containing the BstN1 / Ndel fragment of the polymerase gene is cleaved with Ndel / Narl, the restrictionases inactivated and precipitated.

For ligation, 1 μg of the oligonucleotide prepared in the manner described and 3 μg of vector with 0.5U T4 ligase are incubated overnight at 14 ° C.

The ligation product is transformed into E. coli. To search for recombinants, bacterial colonies are transferred to nitrocellulose filters in a known manner, disrupted by alkaline lysis and denatured. For colony hybridization, this is done with 32p.GAMMA. _AT p markjartg 87-mer used. The final labeling of 100 ng DNA with 60 μα ³² P-oamma-ATP was carried out with 10 U polynucleotide kinase for 30 min at 37 ⁰ C. The radioactively-labeled DNA is precipitated with ethanol.

For prehybridization and hybridization, the following buffer is used: 1M NaCl / 1.0M Tris pH 7.4 / 10mMEDTA; 0.5% NP40 / 0.25% dry milk. The filters are washed after 12 h hybridization 3 times with 6 χ SSC buffer at room temperature, 1 time with 6 χ SSC at 37-42 ⁰ C and 1 time with 6 χ SSC at 68 ⁰ C for 5 min. Bacterial colonies with recombinant plasmids are identified in the autoradiogram of the filters.

From this recombinant the gene coding for complete T7 polymerase is cleaved out with Avalll / Narl, separated electrophoretically, recovered from the agarose gel by electroelution, extracted with phenol and precipitated. The cohesive ends of this fragment are filled in with Klenow polymerase.

At the same time, the plasmid pMK-Delta-Pvu is cleaved with BglII / SmaI and the larger of the two beidone fragments are prepared electrophoretically. The smooth smal end of this vector is ligated to the final-filled fragment in the presence of 10U T4 ligase overnight at 14 ° C. At the free end of this construction (3Mg), a BglII linker (1mg) is coupled with T4 ligase. After cleavage with BglII, ring closure occurs by ligation of the cohesive BglII ends. After E. coli transformation and minipreparation, the recombinant with the correct orientation of the fragment incorporated into pMK-delta-Pvu is determined by restriction analysis with EcoRI / Hpal. The resulting plasmid carrying the complete T7 polymerase gene under control of the MT promoter and the poly A signal of the TK gene is called pMTTV.

2. Modification of the T7 Polymerase Gene with a Synthetic Core Localization Signal (KLS)

FIG. 2 shows the nucleotide sequence selected in a given case which encodes the amino acid sequence of the nuclear localization signal (KLS). The preparation of the 150 bp Ndel / Nar fragment from single-stranded oligonucleotides was carried out in the manner described. The oligonucleotides used have the following sequence:

55-mer

⁵ AAGATCTTTG CAAAAAGCTTTGCAAGATGG ATAAAGTTTTTAGAAACTCC AGTAG ³ '

54-mer

⁶ CGATCTAGAG ACGTTCTACC TTTCTCTTCT TTTTTQGAGG AGTCCTACTG GAGf ³

The mating is carried out at 30 ° C. For cleavage 20 U BgIII per μ9 oligonucleotide are used. The smooth Nrul end of the fragment is formed by filling with Klenow polymerase.

The plasmid pMTT7 is digested with Bglll / Nrul and then freed in an agarose gel prepared! 145bp Bglll / Nrul fragment. 3 μg of the cleaved vector and 1 M9 of the prepared double-stranded oligonucleotide are incubated with 0.5 U T4 ligase. After ligation of the cohesive BglII ends, the batch is diluted to 20 times the volume with ligation buffer and 10U ligase added for ring closure. The ligation product is transformed into E. coli and the plasmid DNA from individual bacterial colonies subjected to restriction analysis with HindIII. A recombinant with a cloned sequence of the KLS is thereby linearized. It is named pMl I / N.

3. Preparation of a cell with stable expression of nuclear localized T7 polymerase

The plasmids pMTT7 and pMTT7N are linearized in separate batches with EcoRI (each 6μρ), precipitated with ethanol and resuspended in 220 μΙ H] O. After addition of 1 μΙ (0.3 mg) pMT-l, 30μΙ 2M CaCl ₂ and dropwise addition of 250 μΙ 2 x HBS solution (50 μM Hepes / 280 mM NaCl / 1.5 mM Na ₂ HPO ₄ pH 7.0) the sample tube Leave vibration free for 10 minutes at room temperature. The resulting fine precipitate is repeatedly repulped and placed in a cell culture flask (about 10-2OCm ² ) with 5 ml of medium, which were charged the day before with about 2 × 10 ^s cells (LTA). The cells are incubated overnight with the precipitate at 37 ° C. After changing the medium, the cells are trypsinized for 48 h at 37 ° C. and 1 / 6-1 / 10 of the cells are added to a new culture flask containing 5 ml of medium and 15 μΙ CdSO ₄ (5 mM). The change of the selection medium takes place over a period of 3 weeks at the beginning of every 2-3 days, then once a week. Colonies grown during this time are trypsinized to 10 cells / ml of culture medium and plated on a 96-well cell culture plate at 100 μΙ. The single colonies grown after about 3 weeks are trypsinized and part of the cells of each clone are examined by immunofluorescence for expression of T7 polymerase. Several clones with clearly nuclear localized T7 polymerase are then selected, transferred to culture flasks and designated PMN. Clones experimieren T7 polymerase without KLS, received the designation PM ^-.

4. Analysis of the expression of T7 polymerase with immunofluorescence

To obtain antibodies to T7 polymerase, 50 μg of purified T7 polymerase with complete Freund's adjuvant is injected into the popliteal lymph nodes of 3-month-old rabbit hindlets. Another 50 μg of the antigen are injected subcutaneously into the footpad of the rabbit. After 6 weeks, the next immunization with 100 mg of antigen is intravenous. 12 days later, the antibody titer of the serum is determined and, if sufficient activity is achieved, serum is collected, enriched with ammonium sulfate, and the gamma-globulin fraction of the preciptate is subsequently purified with DEAE-Sephadex. The antibody titer in this preparation is at least 1/256. In order to reduce non-specific binding of the polyvalent antibodies with host cell antigens, these are preabsorbed before use in immunofluorescence on fixed LTA cells, which are further used for transflection.

For immunofluorescence, the cells to be examined (PMN, PM ^-) are to pretreated with poly-Diäthyldiallyl ammonium chloride slides and incubated at 37 ⁰ C, 5% CO ₂ for 24 h. After fixing the cells with 10% formaldehyde / 0.3M sucrose for 5 min at room temperature is rinsed intensively with PBS (1 x at 37 ⁰ C, 2x at room temperature). In order to allow penetration of the antibodies into the cell interior, the cell wall is permeabilized with 1% TritonX-100 / PBS (5 min). After washing with PBS, the slides are pre-absorbed with 0.25% BSA / 0.25% gelatin / PBS for 60 min at room temperature and then incubated with the antibodies to T7 polymerase (diluted 1:50) for 1 h. After intensive washing with PBS (60 min), the specifically bound rabbit anti-T7 polymerase immunoglobulins are conjugated to goat anti-rabbit Ig antibody FITC.

5. In vitro transcription with nuclear extracts

T7 polymerase-producing cells of the lines PMN, PM "are in separate batches (each 10 ^s cells) by 2maligem washing with PBS in a Dounce homogenizer lysed (extraction buffer: 0.32 M sucrose / 3 mM CaCl _2/2 mM Mg-acetate 0.1 mM EDTA / 0.1% Triton X-100/1 mM DTT / 10 mM Tris-HCl pH8.0) The lysate is centrifuged through a "pad" of 2M sucrose / 10 mM Tris pH8.0 (30000 g / 60 min). The nuclei cleared of cytoplasmic components are lysed by centrifugation in 10% glycerol, 1 mM DTT, 1 mM EDTA, 10 mM Tris-HCl pH8.0, and the chromatin fraction in 0.12M KCl. 10% glycerol, 10 mM Tris-HCl pH8.0 and used immediately for in vitro transcription. For this, a T7 promoter-containing plasmid (z. B. pGGH 1.1) depending 50OmM CTP, ATP, TTP and 10μ0ί ³² P-UTP is incubated with the nuclear extract 1 h at 37 ⁰ C. The radioactive RNA transcripts contained in the TCA precipitate of the transcription batch are measured and the incorporation of ³² P-UTP by T7 polymerase-catalyzed transcription is determined. As a comparison, a standard T7 polymerase with a specific activity of 40,000 U / mg is used, the titration of which determines the corresponding levels of incorporation (Figure 3). With this test, it is possible to detect enzymatically active, KLS-modified T7 polymerase corresponding to 30 U of a standard enzyme in the grain fraction of about 10 ^s nuclei. With the nuclear extract of the line PM ^- , the polymerase expressed without KLS, no in vitro transcription can be detected.

6. Foreign gene expression using the T7 transcription system

In this case, the human growth hormone (hGH) gene is to be expressed by the T7 system. For this purpose, the hGH gene is obtained as a BamHI / EcoRI fragment from the plasmid pUCGHI (DD 257271) and incorporated into the BamHI / EcoRI-cleaved pGEM2 plasmid. The recombinant which carries the hGH gene in the reading direction behind the T7 promoter of the starting plasmid pGEM2 is referred to as pGGH 2.2. 6 pg be with SphI linearized pGGH 2.2 and 0.3 \ ig pRSVneo (Gorman et al. [1983] Science 221.551) used for the production of Kalziumpräzipitates. The selection of the transfected cells is carried out with 400pg / ml Geneticin. Selected colonies are trypsinized and subcloned. The culture supernatants are tested using a hGH ELISA specially developed for this purpose.

6.1. ELISA for the hGH-Nachwels

The ELISA uses monoclonal antibodies to 2 different hGH epitopes. One of these antibodies is purified by the periodate oxidation technique with horseradish peroxidase according to the protocol of Nakame, Kawaoi (1974) J. Histochem. Cytochem 22, 1084-1091) with some modifications. For the test, the following conditions are optimal: 1 anti-hGH antibody (50 / ml PBS) is transferred to 100μΙ in the cavities of a 96-microliter PVC plate and incubated overnight at 4 ° C. After washing (3 times H ₂ 0.1 times PBS / 0.05% Tween 20.1 times H ₂ O), the free binding rates of the solid phase are blocked with 0.5% BSA / PBS for 1 h at 37 ° C. After washing applied the culture supernatants (ΊΟΟμΙ), (0.25-20ng / ml hGH) to be tested and incubated for 2 h at 37 "C. Unbound components are washed off and the specifically bound hGH is developed with a peroxidase antihGH antibody (dilution 1: 1000 in 0.5% BSA / 0.05% Tween 20 / PBS) by incubation at 37 ^° C. for ² h. After intensive washing, a substrate of peroxidase (0.5% o-phenyldiamine / 0.01% H ₂ O ₂ / 0.1 M phosphate-citrate buffer pH5.0) is added and the color reaction after 15 min with 2 NH ₂ SO ₄ stopped. The colorimetric measurement is carried out at 495nm (Fig.4). This ELISA allows significant and reproducible detection of hGH in a concentration range of 250 μg / ml-20ng / ml.

6.2. Analysis of hGH-producing cells

Single clones with maximum hGH production are selected from the LTΑ cells transfected with pMTT7N and pGGH2.2 and selected and transferred to bottle cultures. 90% of the hGH produced by the cells is secreted into the medium. hGH is stable in the culture medium for more than 24 hours. The production of hGH remains stable at least 50 cell passages at least 20pg per 10 ^e cells per 24 h.

After transfection of the pM ~ line, which produces polymerase without KLS, with pGGH2.2, no significant HGH production can be detected.

Claims (6)

1. A process for the production of foreign proteins in animal) ι customs duties by transfection by using a recombinant containing the T7 polymerase gene coupled to an animal promoter and modified with a derived from the large T-antigen of the virus SV40 synthetic nuclear localization signal T7 polymerase gene into animal cells, selected a cell clone with nuclear localized T7 polymerase, transfected into this cell clone an expression vector carrying the T7 promoter and under control of this promoter encoding the foreign protein gene, selects the cell clone with the highest foreign protein synthesis and used for fermentation , characterized in that the recombinant PMTT7N (FIG. 1), which comprises the mouse, coupled to the mouse metallothionein promoter and having a nucleotide sequence containing the AA sequence Met-Asp-Lys-Val-Phe-Arg-Asn-Ser Ser-Arg-Thr-Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val-Glu-Arg-Leu-Asp containing modified T7 polymerase gene by transfect ion in animal cells, the expression cell line PMN (ZIM Accession ZIM-0383) selected and transfected into this expression cell line expression vector, which contains the foreign protein encoding gene in a polylinker in the reading direction behind the natural or synthetic T7 promoter. 2. The method according to claim 1, characterized in that the recombinant pMTT7N is prepared by substitution of the small Bglll / Smal fragment of the plasmid pMKdeltaPvu with the complete T7 polymerase gene, cleavage of the Bglll / Nrul fragment of the polymerase gene and incorporation of the nucleotide sequence having the amino acid sequence Met-Asp-Lys-Val-Phe-Arg-Asn-Ser-Ser-Arg-Thr-Pro-Pro-Lys-Lys-Lys-Arg-Lys-Val-Glu-Arg-Leu Asp encodes BglII / Nrul compatible ends in place of the cleaved fragment. 3. A method according to claim 1, characterized in that a pGEM plasmid is used as an expression vector. 4. The method according to claim 1, characterized in that a pUC plasmid is used as an expression vector. 5. The method according to claim 1, characterized in that are used as animal cells cell lines or primary cells of any species and origin of the organ. 6. The method according to claim 1, characterized in that for the expression vector as foreign protein-encoding gene that for hGH, tPA, HBS antigen, BLV envelope protein or interleukin II is used.