DD275704A1 - PROCESS FOR PRODUCING BARLEY PLANTS - Google Patents
PROCESS FOR PRODUCING BARLEY PLANTS Download PDFInfo
- Publication number
- DD275704A1 DD275704A1 DD32008288A DD32008288A DD275704A1 DD 275704 A1 DD275704 A1 DD 275704A1 DD 32008288 A DD32008288 A DD 32008288A DD 32008288 A DD32008288 A DD 32008288A DD 275704 A1 DD275704 A1 DD 275704A1
- Authority
- DD
- German Democratic Republic
- Prior art keywords
- glucanase
- gene
- beta
- endo
- barley plants
- Prior art date
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
Die Erfindung bezieht sich auf ein Verfahren, das eine beta-Glukanase herzustellen erlaubt, die in der Brauindustrie zur Verarbeitung grosser Rohfruchtmengen eingesetzt werden kann, um die Viskositaet der Braumaische erhoehende Glukan-Verbindungen hydrolytisch zu spalten; dafuer soll nach Moeglichkeit kein oder nur in geringer Menge ein Glukanasepraeparat verwendet werden, sondern die Braugerste mit einem Glukanase-Gen bereits in der Pflanze versehen sein. Zu diesem Zweck wird ein Gen fuer die beta-Glukanase in einer Expressionskassette angeordnet, die auf einem Vektorplasmid konstruiert wird, das in Gerstenpflanzen transformiert werden muss. Die transformierten Pflanzen werden selektiert und regeneriert und liefern im Maischprozess die erforderliche beta-Glukanase.The invention relates to a process which makes it possible to produce a beta-glucanase which can be used in the brewing industry for the processing of large amounts of raw fruit in order to hydrolytically cleave the viscosity of the brewing-increasing glucan compounds; For this purpose, if possible, no or only a small amount of a glucanase supplement should be used, but the malting barley must already be provided with a glucanase gene in the plant. For this purpose, a gene for the beta-glucanase is placed in an expression cassette which is constructed on a vector plasmid which must be transformed into barley plants. The transformed plants are selected and regenerated and deliver the required beta-glucanase during the mashing process.
Description
Die Erfindung betrifft ein Verfahren zur Herstellung von Gerstenpflanzen, insbesondere für die Verwendung in der Brauindustrie, die mit dem Gen für eine thermostabile endo-beta-1,3-1,4-Glukanase ausgestattet sind.The invention relates to a process for the production of barley plants, in particular for use in the brewing industry, which are equipped with the gene for a thermostable endo-beta-1,3-1,4-glucanase.
Für die Herstellung verschiedener Nahrungs-, Genuß- und Futtermittel werden Glukanase-Präparate eingesetzt, wenn die hydrolytische Spaltung der beta-glykosidischen Bindungen von beta-1,3-1,4-Glukanen beabsichtigt ist; vor allem in der Brauindustrie wird durch den Einsatz solcher pflanzenglukan-hydrolislerender Enzyme die Verarbeitung größerer Rohfruchtmengen, zum Beispiel von Gerste anstelle von Malz, möglich, ohne daß dabei Schwierigkeiten bei der Filtration und Läuterung der Braumaische infolge ungenügend abgebauter, viskositätserhöhender Glukan-Verbindungen zu befürchten wären.Glucanase preparations are used for the preparation of various foods, foods and feeds, if the hydrolytic cleavage of the beta-glycosidic bonds of beta-1,3-1,4-glucans is intended; especially in the brewing industry, the use of such plant glucan-hydrolyzing enzymes makes it possible to process larger quantities of raw fruit, for example barley instead of malt, without any difficulty in filtering and refining the brewing owing to insufficiently degraded, viscosity-increasing glucan compounds would.
Es ist seit langem bekannt, die Viskosität der Braumaische mit Hilfe von beta-Glukanasen me?ophiler Bacillus-Stämme, wie von Bacillus amyloliquefaciens oder von Bacillus subtilis, herabzusetzen/1/. Auch die Verwendung gentechnisch manipulierter Bacillus-Stämme, die das beta-Glukanase-Gen von Bacillus amyloliquefaciens in ampiifizierter Form auf einem Vektorplasmid enthalten, ist zur Verbesserung der Ausbeute von mesophller Glukanase entsprechend einem älteren Vorschlag der gleichen Anmelderin bereits ins Auge gefaßt/2/.It has long been known to reduce the viscosity of brewing with the aid of beta-glucanases of metabolic Bacillus strains such as Bacillus amyloliquefaciens or Bacillus subtilis / 1 /. Also, the use of genetically engineered Bacillus strains containing the beta-glucanase gene of Bacillus amyloliquefaciens in amplified form on a vector plasmid is already envisaged for improving the yield of mesophlic glucanase according to an earlier proposal of the same Applicant / 2 /.
Der Nachteil dieser votbekannten Verfahren besteht darin, daß ein spezielles Enzym der Braumaische zugesetzt werden muß lediglich, um deren Viskosität abzusenken, ohne daß ein solches Präparat sonst gebraucht würde, und daß nach Aufbereitung der Braumaische das zugesetzte Enzym inaktiviert ist.The disadvantage of these well-known methods is that a special enzyme of the braumatic must be added only to lower their viscosity, without such a preparation would otherwise be needed, and that after processing of brewing the added enzyme is inactivated.
Es ist auch schon bekannt, das Gen für endo-beta-1,3-1,4-Glukanase von Bacillus subtilis in verschiedenen Hefestämmen zur Expression zu bringen/3/; IAI', /5/; /β/. Dabei wird dieses Gen in ein in Saccharonyces cerevisiae autonom replizierendes Plasmid eingebaut und als Selektionsmarker die Resistenz gegenüber Kupfer genutzt. Leider sind bei diesen Konstruktionen die entstehenden Transformanten mitotisch Instabil, das heißt, nach mehreren Passagen auf nichtselektivem Medium gehen die Plasmide und damit das Glukanase-Gen verloren.It is also known to express the gene for endo-beta-1,3-1,4-glucanase of Bacillus subtilis in various yeast strains / 3 /; IAI ', / 5 /; / Β /. This gene is incorporated into a self-replicating in Saccharonyces cerevisiae plasmid and used as a selection marker resistance to copper. Unfortunately, in these constructions, the resulting transformants are mitotically unstable, that is, after several passages on nonselective medium, the plasmids and thus the glucanase gene are lost.
Ferner Ist es gelungen, eine Brauereihefe - Saccharomyces cerevisiae var. carlsbergensis - zu konstruieren, bei der das Gen für endo-beta-1,3-1,4-Glukanase des Pilzes Trichoderma reesel In das Genom einer Hefe integriert worden ist/7/. Dabei wird aber dieses Gen durch Austausch mit dem Gen für Phosphoglyzeratkinase In das Chromosom der Hefe eingebaut. Da diese Kinase ein E£zym der Glykolyse Ist und das zugehörige Gen beim Einbau des Gens für die Glukanase in mindestens einer Kopie verloren -geht, kommt es bei diesen Brauereihefen, die in der Regel polyploid sind, zur Verringerung der Aktivität der Phosphoglyzeratkinase und damit zu verminderter Wachstumsgeschwindigkeit.Furthermore, it was possible to construct a brewery yeast - Saccharomyces cerevisiae var. Carlsbergensis - in which the gene for endo-beta-1,3-1,4-glucanase of the fungus Trichoderma reesel has been integrated into the genome of a yeast / 7 / , However, this gene is incorporated into the chromosome of the yeast by exchange with the gene for phosphoglycerate kinase. Since this kinase is an enzyme of glycolysis and the associated gene is lost in at least one copy during the incorporation of the gene for the glucanase, these brewery yeasts, which are generally polyploid, reduce the activity of the phosphoglycerate kinase and thus to reduced growth rate.
Inzwischen wurden diese Schwierigkeiten durch einen Vorschlag der Anmelderln/8/ teilweise boseltlgt. Trotzdem ist es generell unpraktisch, daß mikroblelle Enzyme für den Brauvorgang speziell entweder direkt zugeführt werden müssen, was von manchen Herstellern als nicht natürlich strikt abgelehnt wird, oder die Brauhefe entsprechend manipuliert werden muß, wobei auf den fernoron Zusatz von Enzymen nicht vollständig verzichtet worden kann; in jedem Fall sind diese Verfahren durchweg kostspielig und erfordern ständige technologische Botreuung.In the meantime, these difficulties have been partially addressed by a proposal from applicants / 8 /. Nevertheless, it is generally impractical that microbial enzymes for the brewing process specifically either directly must be fed, which is not naturally rejected by some manufacturers as not natural, or brewing yeast must be manipulated accordingly, with the fernoron addition of enzymes can not be completely dispensed with ; In any case, these processes are consistently expensive and require constant technological advocacy.
Die Erfindung hat das Ziel, die Wirtschaftlichkeit des Brauprozosses hinsichtlich der Verwendung von endo-beta-1,3-1,4-Glukanase zu verbessern und don weltgohendon Einsat: von Gorsten-P.ohfrucht anstelle von Malz zu ermöglichen, ohne die oben ausführlich beschriebenen Schwierigkeiten In Kauf nehmen zu müssen,The aim of the invention is to improve the economy of the brewing process with respect to the use of endo-beta-1,3-1,4-glucanase and to allow the use of gorsten poh fruit instead of malt, without the above detailed the difficulties described have to be accepted,
Demzufolge hat sich die Erfindung die Aufgabe gestellt, Gerstenpflanzen genetisch so zu verändern, daß sie im Brauprozeß selbst genügend endo-beta-1,3-1,4-Glukanase bereitstellen, ohne daß spezielle Zusätze direkt oder über die Brauhefe benötigt werden, und daß diese Glukanase bereits gebildet wird, wenn die Gerstensamen reifen.Accordingly, the invention has the object of genetically modifying barley plants so that they provide sufficient endo-beta-1,3-1,4-glucanase in the brewing process itself, without special additives are needed directly or through the brewing yeast, and that This glucanase is already formed when the barley seeds are ripening.
Erfindungsgemäß wird die Aufgabe dadurch gelöst, daß eine Expressionskassette einschließlich des Gens für die thermostabile endo-beta-1,3-1,4-Glukanase auf einem Vektorplasmid konstruiert wird, das sich vorzugsweise in Escherichia coli vermehren läßt, daß die DNS dieses nunmehr rekombinanten Piasmids in Zellen von Gerstenpflanzen transformiert wird und nach Selektion von tatsächlich transformierten Zellen vollständige Gerstenpflanzen regeneriert werden, wobei die Expressionskassette aus einer pflanzlichen Promotor-Region, einer Transkriptions-Initiations-Region mit nachfolgender, für das Gen für endo-beta-1,3-1,4-Glukanase kodierenden Region einschließlich einem Stop-Signal für die Translation, und einer 3'-flankierenden Region für korrektes processing und Polyadenyliorung und damit die Expression der mRNS der endo-beta-1,3-1,4-Glukanase besteht. Auf diese Weise werden die Nachteile des Standes der Technik in überraschend einfacher Weise beseitigt. Durch die Erfindung läßt sich nun die Bildung der thermostabilen endo-beta-1,3-1,4-Glukanase beliebig steuern. Son kann man ohne Schwierigkeit erreichen, daß das Genprodukt bereits Im nichtgekeimten Gerstenkorn akkumuliert wird, so daß der Anteil unvermalzter Gerstenrohfrucht beim Maischvorgang ohne weiteres erhöht werden kann. Bemerkenswerterweise gestattet es die Erfindung, auf mikrobielles Enzym zu verzichten und damit den Brauvorgang zu verbilligen, ohne daß in den sonstigen technologischen Prozeß eingegriffen werden müßte.According to the invention the object is achieved in that an expression cassette including the gene for the thermostable endo-beta-1,3-1,4-glucanase is constructed on a vector plasmid, which can preferably be propagated in Escherichia coli that the DNA this now recombinant Piasmids is transformed into cells of barley plants and after selection of actually transformed cells complete barley plants are regenerated, wherein the expression cassette from a plant promoter region, a transcription initiation region with following, for the gene for endo-beta-1,3- 1,4-glucanase coding region including a stop signal for translation, and a 3 'flanking region for correct processing and polyadenylation and thus the expression of the mRNA of endo-beta-1,3-1,4-glucanase. In this way, the disadvantages of the prior art are eliminated in a surprisingly simple manner. By means of the invention, the formation of the thermostable endo-beta-1,3-1,4-glucanase can now be controlled as desired. Son can be achieved without difficulty that the gene product is already accumulated in the non-germinated barley grain, so that the proportion of unvermalzter barley raw fruit during mashing process can be easily increased. Remarkably, the invention makes it possible to dispense with microbial enzyme and thus to cheapen the brewing process, without having to intervene in the other technological process.
eines DNS-Fragmentes mit dem Gen für die endo-beta-1,3-1,4-Glukanase von Bacillus macerans angegeben.of a DNA fragment with the gene for the endo-beta-1,3-1,4-glucanase of Bacillus macerans.
kodierende Region für das Glukanase-Gen einschließlich der kompletten Promoter-Region trägt/9/, werden mittels descoding region for the glucanase gene including the complete promoter region carries / 9 /, by means of the
23 Nukleotide vor dem ATG-Startkodon und führt zu einer partiellen Entfernung des Promotors stromaufwärts der -10-Region.23 nucleotides in front of the ATG start codon and results in partial removal of the promoter upstream of the -10 region.
einen Vektor pUC 19/9/ enden Schnittstellen Hind III und Dra I/Hinc Il wird das partiell promotorlose, verkürzte DNS-Fragment in folgender Weise innerhalb der. multi cloning site" des Vektors pUC 19 eingebaut: 5'-Ende-Hindlll/Sph l/Pst I-DNS Fragment-a vector pUC 19/9 / ends Hind III and Dra I / Hinc II becomes the partially promoterless, truncated DNA fragment in the following manner within the. multi cloning site of vector pUC 19 incorporated: 5 'end HindIII / Sph I / Pst I DNA fragment
gewonnen.won.
nachweislich auch In anderen Pflanzen nachgeschaltett Gene exprimieren/10/. Das Plasmld ρ delta 4/12/10/ enthält denproven also in other plants downstream genes express / 10 /. The plasmid ρ delta 4/12/10 / contains the
3'-flanklerendc Region eingeschleust; ein Sau3 Α-Fragment des Samenprotein-Gens Legumin B4 enthält die notwendigen3'-Flanklerendc region introduced; a Sau3 Α fragment of the seed protein gene Legumin B4 contains the necessary
von Zellen von Gerstenpflanzen einzusetzen.of cells of barley plants.
auch auf diesem Wege ein für die direkte Transformation geeignetes Vektorplasmid.also in this way a suitable vector for direct transformation vector plasmid.
die 5'-Reglon der mRNS kodierenden Sequenz Teile der Samenprotein-Kodierungs-Sequenz enthalten, um die korrekteThe 5'-Reglon of the mRNA coding sequence contains parts of the seed protein coding sequence to obtain the correct
mit dem aus 780 Basenpaaren bestehenden DNS-Fragment mit dem Glukanase-Gen In fachüblicher Weise in das bereits genannte Plasmld pUC 18 eingebaut und direkt transformiert, gegebenenfalls zusammon mit einem Selektionsmarker. Auch einwith the DNA fragment consisting of 780 base pairs with the glucanase gene In a customary manner into the already mentioned Plasmld pUC 18 and directly transformed, optionally together with a selection marker. Also a
werden. In unmittelbarer Nachbarschaft dor Exprosslonskassette befindet sich wio bereits erwähnt ein In den Gerstenpflanzen solektlorbaros Marker-Gen, bolsplelsweiso das die Kanamyzin-Resistenz vermittelnde npt-Gon unter der Kontrolle eines konstitution Promotore wie otwa CaMV35S.become. In the immediate vicinity of the exproslon cassette, wio already mentions a solektlorbaros marker gene in the barley plants, bolsplelsweiso the npt-gon conferring kanamycin resistance under the control of a constitutional promoter such as otwa CaMV35S.
rosuspondiert, wolchos 0,6MoI Mannit sowie 60 · 10"' Mol CaCI1 und 10"1 Mol MES-Puffer mit einem pH-Wert von 6,6 enthält.rosuspondiert, Wolchos 0.6MoI mannitol and 60 x 10 "'Mol CaCI 1 and 10" 1 mol MES buffer with a pH of 6.6 contains.
10* Protoplaston In einem Volumon von 0,26 · 10"1I worden 15 · 10"· g Vektor-DNS In zirkulärer Form in oinem Volumen von10 * Protoplaston In a Volumon of 0.26 x 10 "1 I was 15 x 10" · g vector DNA in circular form in oinem volume of
16 · 10"'l zugesetzt sowie daran anschließend 0,1 · 10"' I Polyethylonglykol 6000 (24'C In 0,6 Mol Mannit und 10"' Mol16 × 10 -5 l, and then 0.1 × 10 -5 l polyethylglycol 6000 (24 ° C. in 0.6 mol mannitol and 10 -6 mol
das nur Vs der Konzentration an Makro- und Mikrosalzen enthält und als Osmotikum Mannit (Gesamtmolarität - 0,7 osmol), als Hormone 10~3g/l Zeatln und 10~3g/l 2,4-D sowie niedrigschmelzende Agarose (Endkonzentration = 0,6%) von BRL/17/ und als selektives Agens 10...20 · 10~3g/l G418, Heranwachsende Kolonien werden auf Aktivität der vom npt-Marker-Gen kodierten Neomyzin-Phospho-Transferase und auf korrekte Integration der Expressionskassette, (Southern-Hybridlsierung) getestet. Auf diese Weise selektierte CaIIi werden zu Gerstenpflanzen regeneriert und auf Expression des Glukanase-Gens während der Samenreife kontrolliert.containing only Vs of the concentration of macro- and micro-salts and as an osmoticum mannitol (total molarity - 0.7 osmol), as hormones 10 ~ 3 g / l Zeatln and 10 ~ 3 g / l 2,4-D and low-melting agarose (final concentration = 0.6%) of BRL / 17 / and as a selective agent 10... 20 × 10 -3 g / l G418, Adolescent colonies are tested for activity of the neptincin gene encoding neomycin phospho-transferase and for correct Integration of the expression cassette, (Southern hybridization) tested. CaIIi selected in this way is regenerated into barley plants and monitored for expression of the glucanase gene during seed maturation.
LherinirLherinir
IM Borr!8t,R.u.Schroeder,K.-UZbl.Bokt.ll.Abt.,136(1S81),S.324-329 /2/ DD-Patentschrlft 226012 /3/ GB-Patentschrift 2175590 /4/ EP-Patentschrift 147198 /5/ Cantwell, B.A.etal.,Curr.Genet. 11 (1986), S.65-70 /6/ Hinchliffe,E./Box,W.G.,Curr. Genet.8(1984),S.471-475 /7/ Penttilae, M. E. et al., Curr. Genet. 12 (1987), S.413-420 IM Borr! 8t, Rusch Roeder, K.-UZbl.Bokt.ll.Abt., 136 (1S81), S.324-329 / 2 / DD-Patentschrlft 226012/3 / GB Patent 2175590/4 / EP Patent 147 198 / 5 / Cantwell, BAetal., Curr. Genet. 11 (1986), pp. 65-70 / 6 / Hinchliffe, E. / Box, WG, Curr. Genet.8 (1984), pp. 471-475 / 7 / Penttilae, ME et al., Curr. Genet. 12 (1987), p.413-420
/9/ DD-Patentanmeldung WP C12 N/315 7061 /10/ DD-PatentanmeldungWPC12N/3051366 /11/ DD-Patentschrift 240911 /12/ Montagu, M. ν. et al., tab. Genet./Univ. Gent, unveröffentl. /13/ Brandt, A. et al., Carlsberg Res. Comm. 50 (1985), S. 333-345 /14/ Schubert, R. et al., Zentralinstitut für Genetik und Kulturpflanzenforschung der AdW der DDR, unveröffentl. /15/ Luehrs, R./Loerz, H., Planta (im Druck) /16/ Kao, K.M./Michayluk, M. R., Planta 115 (1974), S.355-367 /17/ Hersteller: Gribzo/BRL GmbH (BW)/ 9 / DD patent application WP C12 N / 315 7061/10 / DD patent application WPC12N / 3051366/11 / DD patent 240911/12 / Montagu, M. ν. et al., tab. Genet./Univ. Ghent, unpublished / 13 / Brandt, A. et al., Carlsberg Res. Comm. 50 (1985), pp. 333-345 / 14 / Schubert, R. et al., Central Institute for Genetics and Crop Plant Research of the AdW of the GDR, unpubl. / 15 / Luehrs, R./Loerz, H., Planta (in press) / 16 / Kao, KM / Michayluk, MR, Planta 115 (1974), p.355-367 / 17 / manufacturer: Gribzo / BRL GmbH ( BW)
by: Jim Pustel Iby: Jim Pustel I
29.8.88TRANSLATIONVON BGLMACNSO Seite 129.8.88TRANSLATION BY BGLMACNSO Page 1
70 80 90 100 110 120 130 140 15070 80 90 100 110 120 130 140 150
160 170 180 190 200 210 220 230 240160 170 180 190 200 210 220 230 240
250 260 270 280 290 300 310 320 330250 260 270 280 290 300 310 320 330
340 350 360 370 380 390 400 410 420340 350 360 370 380 390 400 410 420
* ♦ ♦ · * ♦ ♦ * ♦* ♦ ♦ * * ♦ ♦ * ♦
4X) 440 450 460 470 480 490 500 5104X) 440 450 460 470 480 490 500 510
52C 530 540 550 560 570 580 590 60052C 530 540 550 560 570 580 590 600
610 620 630 640 650 660 670 (380 690610 620 630 640 650 660 670 (380 690
700 710 720 730 740 750 760 770 780700 710 720 730 740 750 760 770 780
790 . 800 810 820 830 840 850790. 800 810 820 830 840 850
·♦♦·♦♦♦· · ♦♦ ♦♦♦
AAATATACGAGCAATTAATATGATTGCAGCTGGGCATGAGCTiTrrAGTCCACTCCAGGCATGC LysTyrThrSerAsn—AAATATACGAGCAATTAATATGATTGCAGCTGGGCATGAGCTiTrrAGTCCACTCCAGGCATGC LysTyrThrSerAsn
238 Codons insgesamt 4 Start (ATG)-Codon(s), 1 Stop-Codon(s), 0 unidentifizierte(s) Codon(s)238 codons total 4 start (ATG) codon (s), 1 stop codon (s), 0 unidentified codon (s)
Claims (1)
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DD32008288A DD275704A1 (en) | 1988-09-23 | 1988-09-23 | PROCESS FOR PRODUCING BARLEY PLANTS |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DD32008288A DD275704A1 (en) | 1988-09-23 | 1988-09-23 | PROCESS FOR PRODUCING BARLEY PLANTS |
Publications (1)
Publication Number | Publication Date |
---|---|
DD275704A1 true DD275704A1 (en) | 1990-01-31 |
Family
ID=5602644
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
DD32008288A DD275704A1 (en) | 1988-09-23 | 1988-09-23 | PROCESS FOR PRODUCING BARLEY PLANTS |
Country Status (1)
Country | Link |
---|---|
DD (1) | DD275704A1 (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0449376A2 (en) * | 1990-03-23 | 1991-10-02 | Gist-Brocades N.V. | Production of enzymes in seeds and their use |
WO1992005259A1 (en) * | 1990-09-13 | 1992-04-02 | Gist-Brocades N.V. | Transgenic plants having a modified carbohydrate content |
WO1995002042A1 (en) * | 1993-07-07 | 1995-01-19 | Biomolecular Research Institute Ltd | (1 → 3, 1 → 4)-β-GLUCANASE OF ENHANCED STABILITY |
WO1997032986A2 (en) * | 1996-03-05 | 1997-09-12 | Friedrich Weissheimer Malzfabrik | Process for the production of degradation and/or conversion products of storage substances present in transgenic plant material with the help of a malting process |
WO1998005788A1 (en) * | 1996-08-05 | 1998-02-12 | Mogen International N.V. | Improved process for the production of alcoholic beverages using maltseed |
WO2001059141A2 (en) * | 2000-02-10 | 2001-08-16 | Washington State University Research Foundation | Methods and compositions that utilize barley as a foodstuff for animals |
-
1988
- 1988-09-23 DD DD32008288A patent/DD275704A1/en not_active IP Right Cessation
Cited By (10)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0449376A2 (en) * | 1990-03-23 | 1991-10-02 | Gist-Brocades N.V. | Production of enzymes in seeds and their use |
EP0449376A3 (en) * | 1990-03-23 | 1991-11-06 | Gist Brocades Nv | Production of enzymes in seeds and their use |
WO1992005259A1 (en) * | 1990-09-13 | 1992-04-02 | Gist-Brocades N.V. | Transgenic plants having a modified carbohydrate content |
EP0479359A1 (en) * | 1990-09-13 | 1992-04-08 | Gist-Brocades N.V. | Transgenic plants having a modified carbohydrate content |
WO1995002042A1 (en) * | 1993-07-07 | 1995-01-19 | Biomolecular Research Institute Ltd | (1 → 3, 1 → 4)-β-GLUCANASE OF ENHANCED STABILITY |
WO1997032986A2 (en) * | 1996-03-05 | 1997-09-12 | Friedrich Weissheimer Malzfabrik | Process for the production of degradation and/or conversion products of storage substances present in transgenic plant material with the help of a malting process |
WO1997032986A3 (en) * | 1996-03-05 | 1997-11-20 | Weissheimer Friedr Malzfab | Process for the production of degradation and/or conversion products of storage substances present in transgenic plant material with the help of a malting process |
WO1998005788A1 (en) * | 1996-08-05 | 1998-02-12 | Mogen International N.V. | Improved process for the production of alcoholic beverages using maltseed |
WO2001059141A2 (en) * | 2000-02-10 | 2001-08-16 | Washington State University Research Foundation | Methods and compositions that utilize barley as a foodstuff for animals |
WO2001059141A3 (en) * | 2000-02-10 | 2001-12-06 | Univ Washington | Methods and compositions that utilize barley as a foodstuff for animals |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
DE69133533T2 (en) | Expression of phytase in plants | |
DE69416839T2 (en) | DNA ENCODING AN ENZYME WITH ENDOGLUCANASE ACTIVITY FROM -i (TRIDODERMA HARZIANUM) | |
DE3888381T2 (en) | Yeast vector. | |
DE3854249T2 (en) | Recombinant Humicola Lipase and Process for the Production of Recombinant Humicola Lipases. | |
EP0270496B1 (en) | Method for the transformation of plant protoplasts | |
DE69020151T2 (en) | GENETICALLY SHAPED NEW PLANT PHENOTYPES. | |
DE69132422T2 (en) | XYLANASE PRODUCTION | |
DE69637252T2 (en) | PROCESS USING A TISSUE-SPECIFIC PROMOTER | |
DE69008172T2 (en) | POTATO ALPHA AMYLASE GENES. | |
DE69433499T2 (en) | ENZYME WITH XYLANASE ACTIVITY FROM ASPERGILLUS ACULEATUS | |
EP0375092B1 (en) | Potato tuber specific transcriptional regulation | |
DE4004800C2 (en) | Transgenic plants changed in habit and yield | |
DD254211A5 (en) | Method for producing plypeptides | |
DE69333016T2 (en) | Rhamnogalacturonan acetylesterase (RGAE) from Aspergillus aculeatus | |
DE3854256T2 (en) | EXPRESSION VECTOR FOR YEAST. | |
DD275704A1 (en) | PROCESS FOR PRODUCING BARLEY PLANTS | |
DE69232197T2 (en) | Cloning and expression of genes coding for enzymes from fungi that break down arabinan | |
DD265426A5 (en) | Method for increasing the rate of carbon dioxide and ethanol production of yeast | |
EP0222366A2 (en) | Process for the preparation of human lysozyme | |
DE3751326T2 (en) | Amylolytic enzyme-producing microorganisms constructed by recombinant DNA technology and their use in fermentation processes. | |
DE69432988T2 (en) | FOR DNA SEQUENCES ENCODING AMMONIUM TRANSPORTERS AND PLASMIDES, BACTERIA, YEARS AND PLANT CELLS THEREOF | |
DE19619917A1 (en) | Potato plants with a reduced activity of the cytosolic starch phosphorylase and a changed germination behavior | |
DE69231940T2 (en) | Recombinant DNA coding for an endochitinase | |
DE4040954C2 (en) | Process for the production of pathogen-resistant plants | |
WO1986003774A1 (en) | A method of transforming fungi with a vector |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
RPI | Change in the person, name or address of the patentee (searches according to art. 11 and 12 extension act) | ||
ENJ | Ceased due to non-payment of renewal fee |