DD275704A1 - PROCESS FOR PRODUCING BARLEY PLANTS - Google Patents

Abstract

The invention relates to a process which makes it possible to produce a beta-glucanase which can be used in the brewing industry for the processing of large amounts of raw fruit in order to hydrolytically cleave the viscosity of the brewing-increasing glucan compounds; For this purpose, if possible, no or only a small amount of a glucanase supplement should be used, but the malting barley must already be provided with a glucanase gene in the plant. For this purpose, a gene for the beta-glucanase is placed in an expression cassette which is constructed on a vector plasmid which must be transformed into barley plants. The transformed plants are selected and regenerated and deliver the required beta-glucanase during the mashing process.

Description

Field of application of the invention

The invention relates to a process for the production of barley plants, in particular for use in the brewing industry, which are equipped with the gene for a thermostable endo-beta-1,3-1,4-glucanase.

Characteristic of the known state of the art

Glucanase preparations are used for the preparation of various foods, foods and feeds, if the hydrolytic cleavage of the beta-glycosidic bonds of beta-1,3-1,4-glucans is intended; especially in the brewing industry, the use of such plant glucan-hydrolyzing enzymes makes it possible to process larger quantities of raw fruit, for example barley instead of malt, without any difficulty in filtering and refining the brewing owing to insufficiently degraded, viscosity-increasing glucan compounds would.

It has long been known to reduce the viscosity of brewing with the aid of beta-glucanases of metabolic Bacillus strains such as Bacillus amyloliquefaciens or Bacillus subtilis / 1 /. Also, the use of genetically engineered Bacillus strains containing the beta-glucanase gene of Bacillus amyloliquefaciens in amplified form on a vector plasmid is already envisaged for improving the yield of mesophlic glucanase according to an earlier proposal of the same Applicant / 2 /.

The disadvantage of these well-known methods is that a special enzyme of the braumatic must be added only to lower their viscosity, without such a preparation would otherwise be needed, and that after processing of brewing the added enzyme is inactivated.

It is also known to express the gene for endo-beta-1,3-1,4-glucanase of Bacillus subtilis in various yeast strains / 3 /; IAI ', / 5 /; / Β /. This gene is incorporated into a self-replicating in Saccharonyces cerevisiae plasmid and used as a selection marker resistance to copper. Unfortunately, in these constructions, the resulting transformants are mitotically unstable, that is, after several passages on nonselective medium, the plasmids and thus the glucanase gene are lost.

Furthermore, it was possible to construct a brewery yeast - Saccharomyces cerevisiae var. Carlsbergensis - in which the gene for endo-beta-1,3-1,4-glucanase of the fungus Trichoderma reesel has been integrated into the genome of a yeast / 7 / , However, this gene is incorporated into the chromosome of the yeast by exchange with the gene for phosphoglycerate kinase. Since this kinase is an enzyme of glycolysis and the associated gene is lost in at least one copy during the incorporation of the gene for the glucanase, these brewery yeasts, which are generally polyploid, reduce the activity of the phosphoglycerate kinase and thus to reduced growth rate.

In the meantime, these difficulties have been partially addressed by a proposal from applicants / 8 /. Nevertheless, it is generally impractical that microbial enzymes for the brewing process specifically either directly must be fed, which is not naturally rejected by some manufacturers as not natural, or brewing yeast must be manipulated accordingly, with the fernoron addition of enzymes can not be completely dispensed with ; In any case, these processes are consistently expensive and require constant technological advocacy.

Object of the invention

The aim of the invention is to improve the economy of the brewing process with respect to the use of endo-beta-1,3-1,4-glucanase and to allow the use of gorsten poh fruit instead of malt, without the above detailed the difficulties described have to be accepted,

Explanation of the essence of the invention

Accordingly, the invention has the object of genetically modifying barley plants so that they provide sufficient endo-beta-1,3-1,4-glucanase in the brewing process itself, without special additives are needed directly or through the brewing yeast, and that This glucanase is already formed when the barley seeds are ripening.

According to the invention the object is achieved in that an expression cassette including the gene for the thermostable endo-beta-1,3-1,4-glucanase is constructed on a vector plasmid, which can preferably be propagated in Escherichia coli that the DNA this now recombinant Piasmids is transformed into cells of barley plants and after selection of actually transformed cells complete barley plants are regenerated, wherein the expression cassette from a plant promoter region, a transcription initiation region with following, for the gene for endo-beta-1,3- 1,4-glucanase coding region including a stop signal for translation, and a 3 'flanking region for correct processing and polyadenylation and thus the expression of the mRNA of endo-beta-1,3-1,4-glucanase. In this way, the disadvantages of the prior art are eliminated in a surprisingly simple manner. By means of the invention, the formation of the thermostable endo-beta-1,3-1,4-glucanase can now be controlled as desired. Son can be achieved without difficulty that the gene product is already accumulated in the non-germinated barley grain, so that the proportion of unvermalzter barley raw fruit during mashing process can be easily increased. Remarkably, the invention makes it possible to dispense with microbial enzyme and thus to cheapen the brewing process, without having to intervene in the other technological process.

Ausfuhrungebeispiel The invention will be explained in more detail using an exemplary embodiment. For this purpose, in Table 1, the nucleotide sequence

of a DNA fragment with the gene for the endo-beta-1,3-1,4-glucanase of Bacillus macerans.

The gene for the endo-beta-1,3-1,4-glucanase - hereafter referred to as glucanase gene - becomes known / 9 / from Bacillus macerans recovered and moniert. Starting from a DNA fragment of 850 base pairs, the whole

coding region for the glucanase gene including the complete promoter region carries / 9 /, by means of the

Restrictiondnzyms Dral the first 70 nucleotides at the 5 'end of the DNA fragment removed. This interface is located

23 nucleotides in front of the ATG start codon and results in partial removal of the promoter upstream of the -10 region.

The bacterial ribosome binding site is retained. In the table is the complete nucleotide sequence of the DNA fragment shown. After cloning of the truncated, now only 780 base pairs consisting of DNS fragment in

a vector pUC 19/9 / ends Hind III and Dra I / Hinc II becomes the partially promoterless, truncated DNA fragment in the following manner within the. multi cloning site of vector pUC 19 incorporated: 5 'end HindIII / Sph I / Pst I DNA fragment

Xba I / BamHI / SmaI / KpnI / SacI / EcoR I - 3'-end. So you have a module for the construction of an expression cassette

won.

To control the expression of the gene during the S ⁿ menreife be promoters from the field bean / 10 / is used, the

proven also in other plants downstream genes express / 10 /. The plasmid ρ delta 4/12/10 / contains the

Promoter of the seed protel gene Legumin B4 / 11 /; rii.rch whose cleavage at its (unique) BamH 1 interface becomes the Glucanase gene inserted; while ensuring his correct orientation. Subsequently, a herbal

3'-Flanklerendc region introduced; a Sau3 Α fragment of the seed protein gene Legumin B4 contains the necessary

Sequens pieces. The 3'-flanking region can also be readily isolated from a previously known plasmid pOcs2 / 12 / by means of a BamHI-HindIII Double cleavage can be won. An expression cassette thus prepared allows the associated vector plasmid directly for direct transformation

of cells of barley plants.

It is also possible to use elie seed-specific promoter P30.1, which is present on a plasmid pUC / USPP / 10 /. After linearization by means of the restriction enzyme Bgl II, the procedure described above can be followed to give

also in this way a suitable vector for direct transformation vector plasmid.

In both cases, promoter gene fragments can be obtained in addition to the promoter and for

The 5'-Reglon of the mRNA coding sequence contains parts of the seed protein coding sequence to obtain the correct

To secure channeling and storage of endo-beta-1,3-1,4-glucanase in the barley endosperm. Another possibility is the controls, so the promoters together with the 3 'regions, from the To use seed protein genes of the barley itself or other cereals; for example, a HindIII-BstXI fragment of Barley-Hordeln gene B1 as promoter and an XbaI-HindIII fragment as 3'-region / 13 /. These fragments are put together

with the DNA fragment consisting of 780 base pairs with the glucanase gene In a customary manner into the already mentioned Plasmld pUC 18 and directly transformed, optionally together with a selection marker. Also a

Oat seed protein promoter as BamH 1 -Halnd fragment from a Plasmld pPg 108/14 / is suitable for this purpose. Finally, without leaving the invention, the expression cassette can also be transformed in a Tl plasmid vector

become. In the immediate vicinity of the exproslon cassette, wio already mentions a solektlorbaros marker gene in the barley plants, bolsplelsweiso the npt-gon conferring kanamycin resistance under the control of a constitutional promoter such as otwa CaMV35S.

DIo transformation is carried out as follows. From a Sutponslons cell culture of barley protoplasts are isolated in known Wolse / 15 / and in einom medium

rosuspondiert, Wolchos 0.6MoI mannitol and 60 x 10 "'Mol CaCI ₁ and 10" ¹ mol MES buffer with a pH of 6.6 contains.

The protoplastone wordon was subjected to a heat treatment of 45'C over 5mln and then cooled to room temperature. To

10 * Protoplaston In a Volumon of 0.26 x 10 ^"1 I was 15 x 10" · g vector DNA in circular form in oinem volume of

16 × 10 -5 l, and then 0.1 × 10 -5 l polyethylglycol 6000 (24 ° C. in 0.6 mol mannitol and 10 -6 mol

M £ S-Puffor with a pH of 5.6). After 30 min incubation at room temperature, 2 × 10 -5 KAO-medium / 16 / is embedded in

containing only Vs of the concentration of macro- and micro-salts and as an osmoticum mannitol (total molarity - 0.7 osmol), as hormones 10 ~ ³ g / l Zeatln and 10 ~ ³ g / l 2,4-D and low-melting agarose (final concentration = 0.6%) of BRL / 17 / and as a selective agent 10... 20 × 10 ^-3 g / l G418, Adolescent colonies are tested for activity of the neptincin gene encoding neomycin phospho-transferase and for correct Integration of the expression cassette, (Southern hybridization) tested. CaIIi selected in this way is regenerated into barley plants and monitored for expression of the glucanase gene during seed maturation.

Lherinir

IM Borr! 8t, Rusch Roeder, K.-UZbl.Bokt.ll.Abt., 136 (1S81), S.324-329 / 2 / DD-Patentschrlft 226012/3 / GB Patent 2175590/4 / EP Patent 147 198 / 5 / Cantwell, BAetal., Curr. Genet. 11 (1986), pp. 65-70 / 6 / Hinchliffe, E. / Box, WG, Curr. Genet.8 (1984), pp. 471-475 / 7 / Penttilae, ME et al., Curr. Genet. 12 (1987), p.413-420

IBI DD patent application WPC12N / 3175184

/ 9 / DD patent application WP C12 N / 315 7061/10 / DD patent application WPC12N / 3051366/11 / DD patent 240911/12 / Montagu, M. ν. et al., tab. Genet./Univ. Ghent, unpublished / 13 / Brandt, A. et al., Carlsberg Res. Comm. 50 (1985), pp. 333-345 / 14 / Schubert, R. et al., Central Institute for Genetics and Crop Plant Research of the AdW of the GDR, unpubl. / 15 / Luehrs, R./Loerz, H., Planta (in press) / 16 / Kao, KM / Michayluk, MR, Planta 115 (1974), p.355-367 / 17 / manufacturer: Gribzo / BRL GmbH ( BW)

Table 1 INTERNATIONAL BIOTECHNOLOGIES, INC. IBI Copyright 1982, 83, 84

by: Jim Pustel I

29.8.88TRANSLATION BY BGLMACNSO Page 1

DNA SEQUENCE TRANSLATION PROGRAM VERSION 4.1-J. PUSTELL1982 ZIGuK Gatersleben Version 43- H.-W.Jank 1987

70 80 90 100 110 120 130 140 150

TAAAATCAmrTGGAGGTGTATTATGAAAAAGAAGTCCT ICACTGGTGACCACATTTGCI I ¹ II GI I ICTGTAAGC MetLysLysLysSerCysPheThrLeuValThrThrPheAlaPheSerLeullePheSerValSer

160 170 180 190 200 210 220 230 240

AlaLeuAlaGlySeΓValPheTrpGluProLeuSerTyrPheAsnProSerThrTφGluLysAlaAspGlyTyΓSerAsnGlyGlyVal

250 260 270 280 290 300 310 320 330

PheAsnCysTlirTrpArgAlaAsnAsnValAsnPheThrAsnAspGlyLysLeuLysLeuGlyLeuThrSerSerAlaTyrAsnLysPho

340 350 360 370 380 390 400 410 420

* ♦ ♦ * * ♦ ♦ * ♦

Asp ^ ysAlaGluTyrArgSerThrAsnlleTyrGlyTyrGiyLeuTyrGluValSerMelLysProAlaLysAsnThrGlylleValSer

4X) 440 450 460 470 480 490 500 510

SerPhePheThrTyrThrGlyProAlaHisGlyThrGInTrpAspGlulleAsplleGluPheLeuGlyLysAspThrThrLysValGln

52C 530 540 550 560 570 580 590 600

PheAsnTyrTyrThrAsnGlyValGlyGlyHisGluLysVallleSerLeuGlyPheAspAlaSerLysC'vPheHisThrTyrAlaPhe

610 620 630 640 650 660 670 (380 690

GATTGGCAGCCAGGGTATATTAAATGGTATGTAGACGGTIGAAACATACCGCCACCGCGAATATTCCGAGTACGCCAGGCAAAATT AspTrpGlnProGlyTyrlleLysTrpTyrValAspGlyValLeuLysHisThrAlaThrAlaAsnlleProSerThrProGlyLyslle

700 710 720 730 740 750 760 770 780

790. 800 810 820 830 840 850

· · ♦♦ ♦♦♦

AAATATACGAGCAATTAATATGATTGCAGCTGGGCATGAGCTiTrrAGTCCACTCCAGGCATGC LysTyrThrSerAsn

Translation began with the base 93 (first ATG after base 90) translation at the stop codon (base 804) aborted sequence of Base 70 to base 852 printed sequence numbered starting from base 1.

238 codons total 4 start (ATG) codon (s), 1 stop codon (s), 0 unidentified codon (s)

Claims (1)

Process for the preparation of barley plants, in particular for use in the brewing industry, which are provided with the gene for a thermostable endo-beta-1,3-1,4-glucanase, characterized in that an expression cassette, including the gene for the thermostable endo- beta-1,3-1,4-glucanase is constructed on a vector plasmid that can be propagated in Escherichia coli, that the DNA of this now recombinant plasmid is transformed into cells of barley plants and that after the selection of actually transformed cells complete barley plants are regenerated, wherein the expression cassette is made - a plant promoter region, a transcriptional initiation region followed by a gene coding for the endo-beta-1,3-1,4-glucanase gene, including a translation stop signal, and a 3 'flanking region for correct processing and polyadenylation and thus the expression of the endo-beta-1,3-1,4-glucanase mRNA consists.