CZ352399A3 - Process for preparing pantothenic acid - Google Patents

Abstract

A process for the production and improvement of Dpantoten-producing microorganisms acid by enhancing nucleotide sequences coding for ketopantoate reductase, especially the panE gene, individually or in combination, and optionally complementary to the iIVC gene, these microorganisms the nucleotide sequence and the process for producing D pantothenic acid consisting of the fermentation of these microorganisms, concentrating the pantothenic acid in the medium or in the cells microorganisms and isolation of D-pantothenic acid.

Description

Process for producing pantothenic acid

Technical field

Pantothenic acid is a commercially important vitamin used in cosmetics, medicine, human and animal nutrition.

BACKGROUND OF THE INVENTION

Pantothenic acid can be produced by chemical synthesis or biotechnology by fermentation of suitable microorganisms in suitable nutrient solutions. DL-pantolactone is an important compound in chemical synthesis. It is produced in a multi-stage process from formaldehyde, isobutyraldehyde and cyanide. In further process steps, the racemic mixture is separated and D-pantolactone is condensed with β-alanine to give pantothenic acid.

The advantage of fermentation by microorganisms lies in the direct formation of the desired stereoisomeric D-form.

Pantothenic acid can be produced by a variety of bacteria such as Escherichia coli, Arthrobacter ureafaciens, Corynebacterium erythrogenes, Brevibacterium ammoniagenes and yeasts such as Debaromyces castelli in a nutrient solution containing glucose, DL-pantoic acid and β-alanine. in EPA 0 493 060. EPA 0 493 060 further shows that in Escherichia coli, the amplification of pantothenic acid biosynthesis genes found on pFV3 and PFV5 plasmids in a nutrient solution containing glucose, DL-pantoic acid and β-alanine, improves the formation of D-pantothenic acid.

EPA 0 590 857 and US Patent 5,518,906 disclose mutants derived from the IFO3547 strain of Escherichia coli, such as FV5714, FV525, FV814, FV521, FV221, FV6051 and FV5069, which carry resistance to various antimetabolites such as salicylic acid, β-ket -hydroxyaspartic acid, O-methyltreonine and α-ketoisovaleric acid, and produce D-pantothenic acid in a nutrient solution containing glucose and β-alanine. EPA 0 590 857 and US Patent 5,518,906 further show that after amplification of pantothenic acid biosynthesis genes found on plasmid pFV31, the production of D-pantoic acid and glucose-containing nutrient in the above-mentioned strains is improved in the above strains. and β-alanine improves the production of D-pantothenic acid.

In addition, WO 97/10340 shows that in pantothenic acid generating Escherichia coli strains, the production of pantothenic acid can be further increased by increasing the activity of the acetohydroxyacid synthase II enzyme, valine biosynthesis enzyme.

The inventors have set out to provide new substrates for an improved process for the production of pantothenic acid.

SUMMARY OF THE INVENTION

The pantothenic acid vitamin is a commercially important product that is used in cosmetics, medicine, human and animal nutrition. There is therefore a general interest in providing improved methods for producing pantothenic acid. When D-pantothenic acid or pantothenic acid or pantothenate is mentioned in the following, it is meant not only the free acid but also the salts of D-pantothenic acid, such as calcium, sodium, ammonium or potassium salt. The present invention provides a method for producing and improving pantothenic acid producing microorganisms by amplifying, in particular, overexpressing nucleotide sequences, in particular the panE gene, encoding ketopantoate reductase, individually or in combination with each other and optionally additionally with the ilvC gene.

The term "enhancer" in this context refers to an increase in the intracellular activity of one or more enzymes that are encoded by the DNA of interest by increasing the copy number of the gene (s), using a strong promoter, or using a gene encoding a particular enzyme with high specific activity. and these measures shall be combined where appropriate.

In particular, it has been found that the overexpression of the panE gene together with the panB, panC and panD gene further improves pantothenic acid production. To achieve overexpression, the copy number of the corresponding genes can be increased by plasmid vectors such as pBR322 (Sutcliffe, COLD SPRING HARBOR SYMPOSIA ON QUANTITATIVE BIOLOGY 1979, 43: 77-90) or pUC19 (Viera, Gene 1982 19: 259-268), or a promoter and regulatory region that is upstream of the structural gene can be mutated. A well-known example of this is the mutation of the lac-UV5 lac promoter (Wincker: Gene und Klone,

Eine Einführung in die Gentechnologie (Verlag Chemie, Weinheim, Deutschland, 1990). Expression cassettes which are inserted upstream of the structural gene act in the same way. This method has been used, for example, in LaVallie et al., (BIO / TECHNOLOGY 11, 187-193 (1993) and PCT / US97 (13359).

expressing the respective genes by altering the composition of the media and performing the culture. An example of this is the well-known regulation of lac operon expression by glucose and lactose. In addition, the inventors have found that overexpression of the panE gene is advantageously expressed in strains that exhibit mutations in resistance to metabolites and antimetabolites, such as resistance to L-valine. It has further been found that overexpression of the panE gene is advantageously manifested in strains having defective mutations in metabolic pathway genes, such as the avtA or ilvE gene, which translate pantothenic acid precursors or reduce pantothenic acid production.

The microorganisms of the present invention can produce pantothenic acid from glucose, sucrose, lactose, fructose, maltose, molasses, starch, cellulose or from glycerol and ethanol. These are fungi, yeasts or, in particular, gram-positive bacteria, for example of the genus Corynebacterium, or gram-negative bacteria, for example of Enterobacteriaceae. In the family Enterobacteriaceae, the genus Escherichia with the species Escherichia coli should be mentioned in particular. Within Escherichia coli, so-called K-12 strains such as MG1655 or W3110 strains (Neidhard et al .: Escherichia coli and Salmonella. Cellular and Molecular Biology (ASM Press, Washington DC)) or wild-type IFO3547 Escherichia coli strains should be mentioned. (Fermentation Institute, Osaka, Japan) and mutants derived therefrom. In the genus Corynebacterium, mention may be made in particular of the species Corynebacterium glutamicum, which is known in the art for its ability to form amino acids. This species includes wild-type strains such as Corynebacterium glutamicum ATCC13032, Brevibacterium flavum ATCC14067, Corynebacterium melassecola ATCC17965 and others.

99 9 9 •

To isolate the ilvC gene and the panE gene, for example, an Escherichia coli mutant, which carries a mutation in the ilvC gene and the panE gene, is first generated.

The nucleotide sequence of the ilvC gene of Escherichia coli is known (Wek and Hatfield, Journal of Biological Chemistry 261, 2441-2450 (1986)). Methods for isolating chromosomal DNA are also known (Sambrook et al., Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press).

1989). By selecting suitable primers, the ilvC gene can be amplified by polymerase chain reaction (Innis et al., PCR protocols. A Guide to Methods and Applications, 1990, Academic Press). It is then inserted into a plasmid vector.

Suitable plasmid vectors are those which can replicate in the respective microorganisms. For Escherichia coli, for example, pSClO1 vectors (Vocke and Bastia, Proceedings of the National Academy of Science USA 80 (21), 6557-6561 (1983)) or pKK223-3 (Brosius and Holy, Proceedings of the National) are suitable for the present invention. Academy of Science USA 81, 6929 (1984)), for Corynebacterium glutamicum, for example, the vector pJCl (Cremer et al., Mol. Gen. Genet. 220: 478-480 (1990)) or pEKEx2 (Eikmanns et al., Gene 102: 93-98 (1991)) or pZ8-1 (European Patent 0 375 889) and for Saccharomyces cerevisiae, for example, the vector pBB116 (Berse, Gene 25: 109-117 (1983)) or pDG1 (Buxton et al., Gene 37: 207-214 (1985)). Methods for inserting DNA fragments into plasmid vectors are described in Sambrook et al., Molecular Cloning, A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989). Transformation and electroporation methods are described in Tauch et al. (FEMS Microbiology Letters 123: 343-347 (1994). An example of such a transformed strain is the strain Escherichia coli MG1655 / pFE32. The plasmid pFE32 contains the ilvC gene of MG1655,

4 4 4 4 4

4444 44 • ♦ • 4. 4 which was built into the pBR322 vector. Another example of such a transformed strain is the Corynebacterium glutamicum ATCC13032 / pFE91 strain. Plasmid pFE91 contains the ilvC gene from ATCC13032, which was inserted into the pECm3 vector. Plasmid pECm3 is a derivative of plasmid pECm2 (Tauch, 1994, FEMS Microbiological Letters, 123: 343-348), whose kanamycin resistance gene was removed by restriction with BglII and BamHI followed by religation.

To incorporate a mutation into the ilvC gene that eliminates its function, for example, a deletion or insertion may be incorporated into it. To create the deletion, the internal part of the nucleotide sequence of the structural gene can be removed by appropriate restriction enzymes and subsequent binding of the resulting ends. The mutated ilvC gene is non-functional in this way. In the same way, a second gene can be inserted into the ilvC gene to encode antibiotic resistance. The mutated ilvC gene is also non-functional in this way. The mutated ilvC gene can then be inserted into the microorganism and replaced in its chromosome with a wild-type gene. Methods for performing gene replacement are known in the literature. For Escherichia coli, the method described by Hamilton et al. (Journal of Bacteriology 171, 4617-4622 (1989)), which is based on temperature sensitive replication mutants of plasmid pSCIO1. Such a plasmid is, for example, pMAK705. For Corynebacterium glutamicum, the gene exchange method described by Schwarzer and Puhler (BIO / TECHNOLOGY 9, 84-87 (1991)) using non-replicative plasmid vectors can be used. For Saccharomyces cerevisiae, a targeted gene exchange method is described in Rocca et al. (Nucleic Acid Research 20 (17): 4671-4672 (1992)).

··· · · · · · ·

For example, the mutated ilvC gene may be generated from a wild-type ilvC gene. Plasmid pFE32 consists of pBR322, into which a wild-type ilvC gene has been inserted into its shear restriction site. An aacCl gene that encodes resistance to the antibiotic gentamycin has been inserted at the KpnI cut site of the ilvC pFE32 gene (Schweizer, BioTechniques 15 (5), 831-834 (1993)). The plasmid pFE33 thus obtained contains the ilvC :: aacCl allele, which can no longer form any functional ilvC gene product. The ilvC :: aacCl allele was taken from plasmid pFE33 and inserted into the SphI splice site of plasmid pMAK705, generating plasmid pBD1. Plasmid pDB1 is an allele exchange plasmid vector consisting, first, of pMAK705 and second, of the ilvC :: aacCl allele. Plasmid pDB1 was used according to the method described by Hamilton et al. To replace the wild-type ilvC gene found in MG1655 with the ilvC :: aacCl allele. The strain thus formed was designated as FE4.

To isolate the FE4 mutant carrying the mutation in the panE gene, the FE4 strain was subjected to transposon mutagenesis with transposon Tn5. Transposon Tn5 is described in Auerswald (COLD SPRING HARBOR SYMPOSIA ON QUANTITATIVE BIOLOGY 45, 107-113 (1981)). The method of transposon mutagenesis is described, for example, in Miller's Manual, A: Short Course in Bacterial Genetics, A Laboratory Manual and Handbook for Escherichia coli and Releated Bacteria (Cold Spring Harbor Laboratory Press,

1992). The method is further described in Simon (Gene, 80, 161-169 (1998)) and also in the Hagemann Handbook: Gentechnologische Arbeitsmethoden (Gustav Fischer Verlag, 1990) and in numerous other publications accessible to the public. Further, the mutants may be formed after mutagenesis by ultraviolet light or after treatment of mutation-inducing chemicals such as Nmethyl-N'-nitro-N-nitrosoguanidine. Among the mutants obtained in this manner, the need for growth agents may be

particularly the need for pantothenic acid, to isolate such mutants that carry a mutation in the pantothenic acid biosynthesis gene. Of particular interest are those mutants in need of pantothenic acid which can evaluate as a growth agent not ketopantoate but pantoate and are therefore mutated in the panE gene encoding ketopantoate reductase (EC 1.1.1169). An example of this is the FE5 strain thus obtained, which, in addition to the ilv :: aacCl mutation, carries the panE :: Tn5 mutation.

Microorganisms that carry a defective mutation in the ilvC and panE gene, such as the Escherichia coli FE5 strain, can be used as hosts for cloning to isolate the ilvC gene and a particularly interesting panE gene or nucleotide sequences that encode proteins with ketopantoate reductase activity.

To do this, a gene bank is set up to attract the interest of a catching microorganism. The establishment of gene banks is described in commonly known textbooks and manuals. Examples include Winnacker's textbook: Gene und Klone, Eine Einführung in die Gentechnologie (Verlag Chemie, Weinheim, Deutschland, 1990) or the handbook by Sambrook et al .: Molecular Cloning,

A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989). A known gene bank is the E. coli K-12 strain W13110, which was established by Kohara et al. (Cell 50: 495-508 (1987)). Gene banks of various microorganisms can be obtained so far by purchase, such as the Sp63 Saccharomyces pombe gene bank from Stratagene (Heidelberg, Germany) in the Lambda FIX II plasmid (Elgin, Strategies 4: 6-7 (1991)), the W1485 Escherichia gene bank. coli from CLONTECH (Heidelberg, Germany) in the plasmid pGAD10 (Kitts, CLONTECH (Heidelberg, Germany) Vectors On Disc version 1.3, 1994), whose nucleotide sequence is accessible under GenBank accession number

The gene bank produced by the method described above can then be introduced into the FE5 host described above by transformation. For example, the pGAD10 gene bank W1485 was introduced into strain FE5 by transformation and the transformants obtained were tested for their ability to grow on a culture medium without pantothenic acid. Insertions contained in the plasmid DNA of the obtained pantothenic acid prototrophic transformants can be examined by nucleotide sequence determination. Methods for determining nucleotide sequences can be read, for example, in Sanger et al. (Proceedings of the National Academy of Science, USA 74: 5463-5467 (1977)). Nucleotide sequences can be assigned to genes by homology screening. One possibility for this homology search offers a comparison with the nucleotide sequences of the EMBL database and the gene bank, which can be performed by the BLAST E-mail Service (Altschul, Journal of Molecular Biology 215, 403-410 (1990)). An example of such transformants is the Escherichia coli FE5 / pFEbank16 strain that carries the panE gene of E. coli MG1655 strain.

The panE gene isolated and identified as described herein can then be expressed in the desired microorganism. To this end, it is amplified using plasmid vectors. These, in turn, may be provided with signaling structures which ensure efficient transcription and translation. An overview of expression vectors is found, for example, in the Winnacker textbook: Gene und Klone, Eine Einführung in die Gentechnologie (Verlag Chemie, Weinheim, Deutschland, 1990) or in Sambrook et al .: Molecular Cloning, Laboratory Manual (Cold Spring Harbor Laboratory Press, 1989) ). Furthermore, expression signals such as the tac promoter can be inserted into the chromosome upstream of the panE gene. Such methods are described in WO 98/04715. The panE gene to be expressed may be taken from the cloned chromosomal DNA fragment or in turn amplified by a polymerase chain reaction. The amount of ketopantoate reductase found in the respective microorganism can be determined by the method described by Shimizu et al. (Journal of Biological Chemistry 263: 12077-12084 (1988)). An example of such a strain is the Escherichia coli MG1655 / pFE65 strain. Plasmid pFE65 consists of the vector pKK223-3 in which the Escherichia coli MG1655 panE gene has been inserted into its EcoRI cleavage site.

According to the invention, it has proven advantageous to amplify, in particular overexpress, one or more pantothenic acid biosynthesis genes in addition to the panE gene encoding ketopantoate reductase. These include genes that encode ketopantoate hydroxymethyltransferase (EC 4.1.2.12), aspartate-1-decarboxylase (EC 4.1.1.11) and pantothenate synthetase (EC 6.3.2.1). In Escherichia coli, these genes are designated panB, panD and pan C (Miller, A: Short Course in Bacterial Genetics, A Laboratory Manual and Handbook for Escherichia coli and Releated Bacteria (Cold Spring Harbor Laboratory Press,

1992). To this end, the genes can be inserted into various compatible plasmid vectors. Examples of this are in Bartolome et al. (Gene 102: 75-78 (1991)). Gene expression can be further increased by altering upstream chromosomal signal structures. Furthermore, the respective genes can be arranged one behind the other under the control of a common promoter and inserted into a plasmid vector and introduced into a suitable microorganism. An example of this is the Escherichia coli MG1655 / pFE80 strain. Plasmid pFE80 consists of plasmid pKK223-3 which contains the panB, panD, panC and panE genes, respectively. The tac promoter is located upstream of the panB gene in the pFE80 as an expression signal.

9 9 9 9

9

Furthermore, it has proven advantageous to overexpress the panE gene and an expression unit consisting of the panB, panD, panC and panE genes in host strains containing chromosomal mutations.

Mutations that confer resistance to metabolic products such as L-valine or β-ketoisovaleric acid, or to analogs of metabolic products such as β-hydroxyaspartic acid or O-methyltreonine, may be used singly or together. Such mutants occur spontaneously or may be produced after mutagenesis by ultraviolet light or after treatment with a mutation-inducing chemical, such as N-methyl-N'-nitro-N-nitrosoguanidine, and then selected on agar plates containing the substance. Methods for inducing mutation and selection are generally known and can be read, inter alia, in Miller (A. Short Course in Bacterial Genetics, A Laboratory Manual and Handbook for Escherichia coli and Releated Bacteria (Cold Spring Harbor Laboratory Press, 1992)) or in the " Manual of Methods for General Bacteriology from the American Society for Bacteriology (Washington DC, USA, 1981). An example for such mutants is the FE6 strain of Escherichia coli, which has been isolated as a spontaneously occurring L-valine resistant mutant of strain MG1655.

Furthermore, adverse or disruptive chromosomally encoded metabolic reactions may be specifically excluded. For this purpose, insertions or deletions are inserted into the respective genes and the resulting mutated genes or alleles thus formed are incorporated into the chromosome of the respective host. The methods described above for mutating the ilvC gene can be used. An example of such mutants is the FE7 strain of Escherichia coli that carries the avtA :: aadB mutation in the chromosome. It is a strain MG1655, • »99« · • · 9 ·

9 • 9 9 9 9 9

9 9

9 9 · 9

9 9 «

9 9

9 · · · • 9 99 · 9 ·

9 9 9

9 9 * «•

9 «whose avtA gene has introduced the aadB gene from plasmid ρΗΡ45Ω, which mediates resistance to streptomycin (Prentki and Krisch, Gene 29, 303-313 (1984). The panE gene may then be overexpressed alone or in combination with other genes, examples are strains FE6 / pFE80 and FE7 / pFE80.

The microorganisms produced according to the invention can be cultivated for the purpose of producing pantothenic acid continuously or discontinuously by the backpack method or the fed backpack method (feed system) or the repeated fed backpack method. A summary of the known cultivation methods is described in a textbook by Chmiel (Bioprozesstechnik 1. Einführung in die Bioverfahrenstechnik (Gustav Fischer Verlag, Stuttgart, 1991)) or in a textbook from Storhas (Bioreactor and Periphere Einrichtungen (Viewegh Verlag, Braunschweig / Wiesbaden, 1994)). The culture medium to be used must suitably meet the requirements of the microorganisms in question. Descriptions of the culture media of various microorganisms can be found in the Manual of Methods for General Bacteriology of the American Society for Bacteriology (Washington, D.C., USA, 1981). As carbon sources, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, molasses, starch and cellulose can be used; oils and fats such as soybean oil, sunflower oil, peanut oil and coconut oil, fatty acids such as palmitic acid, stearic acid, linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These may be used as individual components or as a mixture. Nitrogen-containing organic compounds, such as peptones, yeast extract, meat extract, malt extract, soaking water, soy flour and urea, can be used as nitrogen sources. • 9 · 9

ΑΛΚ. ‘AfeWSía ^ wi ^ ifcí **;

Or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate. The nitrogen sources may be used singly or as a mixture. Phosphoric acid, potassium dihydrogen phosphate or potassium hydrogen phosphate or the corresponding sodium-containing salts can be used as phosphorus sources. The culture medium must further contain metal salts, such as magnesium sulfate or iron sulfate, which are needed for growth. Finally, essential growth substances such as amino acids and vitamins may be used in addition to the above-mentioned substances. In addition, suitable pantothenic acid precursors such as β-alanine or ketopantoic acid and its salts may be added to the culture medium. Said substances may be added to the culture in the form of a single feed or may be added in a suitable manner during the cultivation.

Basic compounds such as sodium hydroxide, potassium hydroxide, ammonia, or acidic compounds such as phosphoric acid or sulfuric acid are used to control the pH of the culture. Antifoams, such as polyglycol esters of fatty acids, may be used to control foaming. Suitable selectively acting substances, for example antibiotics, may be added to the medium to maintain plasmid stability. In order to maintain aerobic conditions, oxygen or oxygen-containing mixtures such as air are introduced into the culture. The temperature of the culture is usually about 20 ° C to 50 ° C and especially about 25 ° C to 45 ° C. The culture is maintained until a maximum of pantothenic acid is formed. This goal is usually achieved in 10 hours to 160 hours.

···· «0 0000 00

The concentration of pantothenic acid formed can be determined by known methods (Velisek; Chromatografic Science 60, 515-560 (1992)).

The following microorganisms were deposited in the German Collection of Microorganisms and Cell Cultures (DSMZ, Braunschweig, Germany) under the Budapest Treaty:

Escherichia coli K12 strain FE5 as DSM12378,

Escherichia coli K12 strain MG1655 / pFE32 as DSM12413,

Escherichia coli K12 strain MG1655 / pFE65 as DSM12382,

Escherichia coli K12 strain MG1655 / pFE80 as DSM12414,

Escherichia coli K12 strain FE6 as DSM12379,

Escherichia coli K12 strain FE7 as DSM12380.

With the method of the invention, a new tool is provided to the person skilled in the art to improve the production of pantothenic acid of microorganisms.

DETAILED DESCRIPTION OF THE INVENTION

The present invention is explained in more detail below with reference to exemplary embodiments.

Example 1

Production of mutant ilvC :: aacCl panE :: Tn5 strain MG1655 Escherichia coli K12

1. Preparation of the ilvC :: aacCl mutant

Starting from the nucleotide sequence for the ilvC gene in E. coli K12 MG1655, (EMBL-GenBank: Accession Nr. M87049), PCR primers were synthesized (MWG Biotech (Ebersberg, Germany)). A DNA fragment of approximately 1500 bp could be amplified using these primers using standard PCR methods from Innis et al. (PCR protocols. A Guide to Methods and Applications, 1990, Academic Press). The E. coli K12 MG1655 chromosomal DNA used for PCR was isolated using the NucleoSpin C + T kit (Macherey-Nagel (Durren, Germany), product description NucleoSpin C + T, Art.-Nr. 740952). Size was determined by gel electrophoresis (30 minutes, 10 V / cm) in a 0.8% agarose gel.

Primer PCR for E. coli ilvC gene:

ilvCl 5'- AGAAGCACAACATCACGAGG -3 '

5 '-CTCCAGGAGAAGGCTTGAGT -3'

The ilvC gene PCR product was transformed into plasmid pCR®2.1 and into E. coli K12 TOP10F 'strain (Invitrogen (Leek, The Netherlands), Product Description Original TA Cloning® Kit, Cat. No. KNM2030-01).

The success of cloning was demonstrated by digesting the DNA of pCR® 2.1ilvC with the restriction enzymes Eagl (Pharmacia Biotech (Freiburg, Germany), product description Eagl, Code no. 27-0885-01), EcoRI (Pharmacia Biotech (Freiburg, Germany), product description EcoRI , Code no. 27-0884-03) and Knpl (Pharmacia Biotech (Freiburg, Germany), product description KpnI, Code no. 27-0908-01). K • 9 · · · ·

9

Plasmid DNA was isolated using a QIAprep Spin Plasmid kit (QIAGEN (Hilden, Germany), Cat. No. 27106) and digested in a 0.8% agarose gel (30 min, 10OV / cm). ) was divided.

For the isolation of the ilvC gene from plasmid pCR®2.1ilvC, the isolated plasmid DNA was digested with HindIII (Pharmacia Biotech (Freiburg, Germany), HindIII product description, Code no. 27-0860-01) and XbaI (Pharmacia Biotech (Freiburg, Germany)), product description Xbal, Code no. 27-0948-01), the cleavage was resolved in a 0.8% agarose gel (30 minutes, 10 V / cm) and the 1.5 kbp ilvC fragment was isolated using the GLASSMAX ™ kit (GIBCO BRL) (Eggenstein, Germany), product description GLASSMAX ™ Spin Cartridges, Cat. No. 15590-052). The isolated ilvC fragment was ligated with plasmid pMAK705 also digested with HindIII and XbaI (Hamilton et al., Journal of Bacteriology 1989, 171: 46174622) using T4 DNA ligase (Pharmacia Biotech (Freiburg, Germany), product description T4 DNA ligase). , Code no. 27-0870-03) and the DH5amcr strain of E. coli (Grant, Proceedings of the National Academy of Science 1990, 87: 4645-4649) was electroporated with a ligation batch (Tauch, FEMS Microbiology Letters 1994, 123: 343). -347). Selection of plasmid-bearing cells was performed by spreading an electroporation batch on LB agar (Lennox, Virology 1955, 1: 190), which was mixed with 25 µg / ml chloramphenicol (Sigma (Deisenhofen, Germany), (Deisenhofen, Germany), Code no. C). And incubation for 24 hours at 30 ° C. The plasmid of interest could be identified in one clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm), using the enzymes HindIII, XbaI and KpnI, and designated pFE30.

To isolate the ilvC gene from plasmid pFE30, the isolated plasmid DNA was digested with BamHI (Pharmacia Biotech (Freiburg, Germany), BamHI product description, Code no. 27-086817

. 03), the digestion batch was resolved in a 0.8% agarose gel (30 min, 10 V / cm) and the 1.5 kbp ilvC fragment was isolated using the GLASSMAX ™ kit. The isolated ilvC fragment was ligated with

T4-DNA ligases with the plasmid pBR322 also digested with BamHI (Sutcliffe, COLD SPRING HARBOR ON QUANTITATIVE BIOLOGY 1979, 43: 77-90) and the E. coli DH5amcr strain were electroporated with the ligation batch. Selection of plasmid-bearing cells was performed by spreading the electroporation batch on LB agar, which was mixed with 100 µg / ml ampicillin (Sigma (Deisenhofen, Germany), Code no. A 9518), and incubated for 24 hours at 37 ° C. The colonies obtained were inoculated in parallel on LB + ampicillin and LB + (5 µg / ml) tetracycline agar (Sigma (Deisenhofen, Germany), Code no. T3383). DNA from tetracycline-sensitive colonies was isolated using the QIAprep Spin Plasmid kit and the cloning success was verified by digestion with BamHI and KpnI and subsequent separation in 0.8% agarose gel (30 minutes, 10 V / cm). The constructed plasmid was called pFE32.

/

The aacCl gene was cloned into the KpnI splice site of plasmid pFE32 and the plasmid obtained was designated pFE33. For this, the aacCl gene was isolated from an agarose gel (30 minutes, 10 V / cm) in which the KpnI-restriction batch of plasmid pMS255 was separated (Becker, Gene 1995, 162: 37-39). The ligation was performed _B with T4-DNA ligase. After electroporation of the ligation batch into DH5amcr strain, transformants were selected on PA 'agar (Sambrook, Molecular cloning, 2 ^nd edn, Cold Spring Harbor,

1989), which was mixed with 10 µg / ml gentamycin (Sigma (Deisenhofen, Germany), Code no. G3632). DNA from gentamycin resistant colonies was isolated using the QIAprep Spin Plasmid kit and the cloning success was verified by digestion with BamHI and KpnI and subsequent separation in 0.8% agarose gel (30 minutes, 10 V / cm).

The ilvC: aacCl fragment was excised from plasmid pFE33 by SphI restriction (Pharmacia Biotech (Freiburg, Germany), product description Sphl, Code no. 27-0951-01), separated in 0.8% agarose gel (30 minutes, 10 V / cm) ) and isolated using the GLASSMAX ™ kit. The fragment was ligated with plasmid pMAK705 digested with SphI by T4 DNA ligase, the ligation batch was electroporated into DH5ccmcr strain and transformants were selected by incubation on PA + gentamycin agar for 24 hours at 30 ° C. DNA from gentamycin resistant colonies was isolated using the QIAprep Spin Plasmid kit, and the cloning success was demonstrated by digestion with SphI and EcoRI in a 0.8% agarose gel (30 minutes, 10 V / cm). The constructed plasmid was called pDB1.

Using the plasmid pDB1, the chromosomal ilvC gene was replaced in the E. coli K12 MG1655 strain with an interrupted ilvC: aacCl fragment. A modified method of Hamilton et al. Plasmid pDB1 was electroporated into E. coli strain K12 MG1655 and then transformants were incubated for 24 hours at 42 ° C on LB-chloramphenicol agar for selection of cointegrates. The colonies obtained were re-incubated on the same medium for 24 hours at 42 ° C for unification. To disintegrate the plasmid, individual colonies were incubated in 5 ml of LB liquid medium for 24 hours at 42 ° C, and then the dilution series of the liquid medium was spread on LB-chloramphenicol agar. This dilution series was incubated at 30 ° C for 24 hours. For plasmid treatment, individual colonies obtained from the dilution series were plated in 3 consecutive coatings of individual colonies on LB agar for 24 hours at 42 ° C. For phenotype control, the individual colonies obtained were inoculated in parallel on agar plates with the following media: E medium (Vogel, Journal of Biological Chemistry 1956, 218: 97-106) + glucose (0.4%), E + glucose medium (0.4 %) (Sigma (Deisenhofen, Germany), Code no. G8270) + 50 μg / ml isoleucate19. Nu. »(* Sigma (Deisenhofen, Germany), Code no.17268), medium E + glucose (0.4%) + 50 μρ ketoisovalerate (ICN (Eschwege, Germany)) , Code no. 151395), E + glucose medium (0.4%) + 50 μρ / ml isoleucine + 50 μρ ketoisovalerate, PA + gentamycin + LB medium + chloramphenicol. These media were incubated at 37 ° C for 48 hours. Among the 150 individual colonies tested, there was one whose phenotype indicated replacement of the chromosomal ilvC gene for the ilvCiaacCl fragment. This strain was designated FE4.

2. Production of the double mutant ilvC :: aacCl panE :: Tn5

The FE4 strain was applied to 5 ml of liquid medium LB + 10mM MgSCL + 0.2% maltose (Sigma (Deisenhofen, Germany), Code no. M5885) (LBMgMal) at 37 ° C to an optical density of 0.5. Optical density measurements were made with a Novaspec II Pharmacia photometer (Freiburg, Germany) at a wavelength of 660 nm. 2 ml of the bacteria solution was centrifuged for 5 min at 3000 rpm (Beckmann model J2-21 centrifuge, JA-17 rotor). After extraction of the pellet with 0.5 ml of LBMgMal liquid medium, the suspension was mixed with 30 μΐ of λ :: Tn5 lysate (Simon, Gene 1989, 80 (1): 161169), approximately 10 ⁸ bacteriophages. This lysate was isolated from E. coli strain K12 C600 (Appleyard, Genetics 1954, 39: 440452), according to the Hagemann method (Gentechnologische.Arbeitsmethoden, Gustav Fischer Verlag, 1990: 14-18). The λ :: Τη5 lysate suspension was incubated at 30 ° C for 45 minutes. After centrifugation for 5 minutes at 3000 rpm, the pellet was extracted into 10 ml of PA + 10 mM pyrophosphate and incubated for 3 hours at 37 ° C. The bacterial solution was spread as dilution series on Eagar + Glucose (0.4%) + 25 μρ / ml kanamycin + 50 μρ / ml isoleucine + 50 μρ / ml ketoisovalerate + 50 μρ / ml pantothenate and incubated for 48 hours at 37 ° C . Individual colonies with parallel20

9 9 9 9 9 were inoculated on E-agar + glucose (0.4%) + 25 pg / ml kanamycin + 50 μς / isoleucine + 50 gg / ml ketoisovalerate. + 50 gg / ml pantothenate and on agarE + glucose (0.4%) + 25 gg / ml kanamycin + 50 μg / ml isoleucine + 50 μς / ml ketoisovalerate and incubated at 37 ° C for 48 hours. Among the 14000 inoculated single colonies, one could be identified as one known as FE5 that grew on Eagar + glucose (0.4%) + 25 μς / ml kanamycin + 50 μς / ml isoleucine + 50 μς / ml ketoisovalerate + 50 μς / ml pantothenate but not on E-agar + glucose (0.4%) + 25 μς / ml kanamycin + 50 μς / ml isoleucine + 50 μς / ml ketoisovalerate.

3. Characterization of FE4 and FE5 strains

Along with strains of E. coli SJ2 (Jakowski, Genetic Stock Center, Yale University) carrying a mutation in the panB gene, MW6 (Williams, Genetic Stock Center, Yale University) carrying a mutation in the panC gene, and DV9 (Vallari, Journal of Bacteriology 1985, 164: 136-142), which carries a mutation in the panD gene as well as the wild type, FE4 and FE5 strains were applied to various supplemented basal media (E-agar + glucose (0.4%) + 50 μς / ml of isoleucine + 50 μg / ml ketoisovalerate (at SJ2, DV9 and MW6 additionally 50 μς / ml thiamine) and incubated for 48 hours at 37 ° C. Pantothenate (calcium salt), ketopantoate (sodium salt), β-alanine (Sigma (Deisenhofen, Germany), Code no. A7752) and pantoate (potassium salt) were used as additional supplements. Ketopantoate was prepared from ketopantolactone by reaction with equimolar amounts of NaOH at 60 ° C and subsequent evaporation. Ketopantolactone was synthesized according to Ojim et al. (Organic Synthesis 63: 18 (1985)). The pantoate was prepared from pantoyllactone (Sigma (Deisenhofen, Germany), Code no. P2625) according to the method of Primeran and Burns (Journal of Bacteriology 1983, 153: 2599).

9999 98 99

269). The growth test result (Table 1) showed that the FE4 strain grew on all differently supplemented basal media. The FE5 strain grew only on media supplemented with either pantothenate or pantoate, but not on the basic media that was mixed with ketopantoate.

Table 1

Strain Supplements of basic medium No β-Alanine Ketopantoate Pantoate Pantothenate [50 μg / ml] [50 μg / ml] [50 μg / ml] [50 μg / ml] MG1655 + + + + + SJ2 - - + + + MW6 + DV9 - + - - + FE4 + + + + + FE5 - - - + +

+ = growth

- = no growth

Example 2

Isolation of the panE gene of Escherichia coli K12 strain W1485

99,999 ····

99

9 9 9

9 9 9

9 9 9

9 9 9

99

E. coli K12 W1485 MATCHMAKER (CLONTECH (Heidelberg, Germany), Cat. No XL4001AB) was electroporated into the FE5 strain. The E. coli K12 MATCHMAKER genomic library contains E. coli K12 W1485 chromosomal DNA as inserts with an average size of 1.0 kbp in plasmid pGAD10, the size of the individual inserts varying from 0.5 to 3.0 kbp (CLONTECH ( Heidelberg, Germany)). Transformant selection was performed by spreading on E-agar + glucose (0.4%) + 100 µg / ml ampicillin + 50 µg / ml isoleucine + 50 µg / ml ketoisovalerate. Plasmid DNA was isolated from the 20 colonies obtained using the QIAprep Spin Plasmid kit. Digestion of the plasmid DNA with EcoRI and subsequent separation in a 0.8% agarose gel (30 minutes, 10 V / cm) showed that the plasmids were 20 pGAD10 vectors with different sized inserts. Sequencing (IIT Biotech (Bíelefeld, Germany)) of the inserts showed a comparison of homology with the BLAST program (Altschul, Journal of Molecular Biology 1990,

215: 403-410) that the inserts contained the complete ilvC gene in 7 cases and an open reading grid in 13 cases, which was labeled "similar to Salmonella typhimurium apbA (EMBLGenBank: U82664 accession number)." This open reading grid was designated panE.

Example 3

E. coli ilvC gene overexpression in E. coli strain K12 MG1655

The plasmid pFE32 was used for overexpression of the ilvC gene (see Example 1). The coding region of the ilvC gene is under the control of the tet promoter encoded by plasmid pBR322 in plasmid pFE32. The plasmid pFE32 was electroporated into E. coli strain K12 MG1655 and the transformants were incubated for 24 hours after incubation for 24 hours. 44 44 at 37 ° C were selected on LB agar mixed with 100 µg / ml ampicillin. The strain obtained was designated MG1655 / pFE32.

Example 4

E. coli pan E gene overexpression in E. coli K12 MG1655 strain

Starting from the nucleotide sequence for the panE gene in E. coli K12 MG1655, PCR primers (MWG Biotech (Ebersberg, Germany)) were synthesized. A DNA fragment of approximately 1000 bp could be amplified using these primers using standard PCR methods from E. coli K12 MG1655 chromosomal DNA. The E. coli K12 MG1655 chromosomal DNA used for PCR was isolated using a NucleoSpin C + T kit. Size was determined by gel electrophoresis (30 minutes, 10 V / cm) in a 0.8% agarose gel.

PCR primer for E. coli panE gene.

panEl 5'- AGGAGGACAATGAAAATTAC -3 'panE2 5'-TCAGTCTCTTCACTACCAGG -3'

The panE PCR product was transformed into plasmid pCR®2.1 and into E. coli strain TOP10F '(Invitrogen (Leek, The Netherlands), Product Description Original TA Cloning® Kit, Cat. No. KNM2030-01). The success of cloning was demonstrated by digestion of plasmid pCR®2.1panE with the restriction enzymes EcoRI and HincII (Pharmacia Biotech (Freiburg, Germany), product description HincII, Code no. 27-0858-01). To this end, plasmid DNA was isolated

9999

9 99 9

* 99

9 9 • 9 ·

999

99

9 9 9

It was separated using a QIAprep Spin Plasmid kit and after digestion in a 0.8% agarose gel (30 minutes, 10 V / cm).

To isolate the panE gene from plasmid pCR®2.1panE, the isolated plasmid DNA was digested with EcoRI, the digestion was resolved in a 0.8% agarose gel (30 minutes, 10 V / cm), and the 1.0 kbp panE fragment was isolated using the GLASSMAX kit. ™. The isolated panE fragment was ligated with plasmid pKK223-3, also digested with EcoRI, with T4 DNA ligase and the E. coli strain DH5amcr was electroporated with the ligation batch. Selection of plasmid-bearing cells was performed by spreading the electroporation batch on LB agar, which was mixed with 100 gg / ml ampicillin and incubated for 24 hours at 37 ° C. The plasmid of interest could be identified in a single clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm) in one clone and designated pFE65.

The coding region of the panE gene is under the control of the tac promoter encoded by plasmid pKK223-3 in plasmid pFE65. Plasmid pFE65 was electroporated into E. coli strain K12 MG1655 and transformants were selected after incubation for 24 hours at 37 ° C on LB agar mixed with 100 µg / ml ampicillin. The strain obtained was designated E. coli K12 MG1655 / pFE65.

Example 5

E. coli panE gene overexpression along with E. coli panB, panC and panD in E. coli K16 MG1655 strain

Starting from the nucleotide sequence for the panB gene, panC gene, and panD gene in E. coli K12 MG1655 (EMBL-GenBank: ex25). EM · · · EM EM EM EM EM EM · ··

9 ··· ·· ·· * 9 9 9

9 9 9

PCR primers (MWG Biotech (Ebersberg, Germany)) were synthesized. Using a panB primer, a DNA fragment of approximately 800 bp could be amplified from chromosomal E. coli K12 MG1655, using a panD primer of a DNA fragment of approximately 400 bp using a standard PCR method. Using a panC primer, a DNA fragment of approximately 850 bp in size could be amplified from the chromosomal DNA of E. coli K12 MG1655 by a modified standard PCR method. Taq-polymerase was replaced with Pfu-polymerase and the damping conditions in the PCR batch were modified accordingly (STRATAGENE (Heidelberg, Germany), product description Pfu-polymerase, Code no. 600135). The E. coli K12 MG1655 chromosomal DNA used for PCR was isolated using the NucleoSpin C + T kit. The size of all amplifications was determined by gel electrophoresis (30 minutes, 10 V / cm) in a 0.8% agarose gel.

PCR primer for panB gene from E. coli: panBl 5'- AGGATACGTTATGAAACCGA -3 ' panB2 5'-ACAACGTGACTCCTTAATGG -3 ' Primer PCR for the E. coli panC gene: panCl 5'- AGGAGTCACGTTGTGTTAAT -3 ' panC2 5'-AAGTATTACGCCAGCTCGAC -3 ' Primer PCR for the E. coli panD gene: panDl 5'- AGGTAGAAGTTATGATTCGC -3 ' panD2 5 '-TAACAATCAAGCAACCTGTA -3 '

9999 • 9 9 9 9 9

9 9 99

9 9

9 · 9 99 ·· 99 ♦ * 9 9

9 9 9

9

9 9 9

9 99

The panB PCR product was transformed into the pCR®2.1 plasmid and the TOPIOF 'strain (Invitrogen (Leek, The Netherlands). The successful cloning of the panB PCR product was demonstrated by digestion of the pCR® 2.1panB plasmid DNA with EcoRI, EcoRV restriction enzymes (Pharmacia Biotech (Freiburg, Germany) ), product description EcoRV, Code no. 27-0934-01) and PvuII (Pharmacia Biotech (Freiburg, Germany), product description PvuII, Code no. 27-096001) To this end, plasmid DNA was isolated using the QIAprep Spin Plasmid kit and The panD PCR product was transformed into the plasmid pCR®2.1 and the TOPIOF 'strain (Invitrogen (Leek, The Netherlands). The success of cloning the panD PCR product was determined by digestion in a 0.8% agarose gel (30 minutes, 10OV / cm). The plasmid DNA was isolated using the QIAprep Spin Plasmid kit and cut after digestion in a 0.8% agarose gel (30 minutes, 10OV / cm). The panC gene PCR was electroporated into plasmid pUC19 ( Viera, Gene 1982 19: 259268) and into E. coli strain DH5amcr. The success of cloning the panC PCR product was demonstrated by digesting the plasmid pUC19panC DNA with the restriction enzymes EcoRI, HindIII and SalI (Pharmacia Biotech (Freiburg, Germany), SalI product description, Code no. 27-0882-01). To this end, plasmid DNA was isolated using the QIAprep Spin Plasmid kit and separated after digestion in a 0.8% agarose gel (30 minutes, 10 V / cm). The constructed plasmid was called pFE60.

To isolate the panB gene from plasmid pCR®2.1panB, the isolated plasmid DNA was digested with EcoRI, the digestion was resolved in a 0.8% agarose gel (30 minutes, 10OV / cm), and the panB fragment of 800 bp was isolated using the GLASSMAX ™ kit. The isolated panB fragment was ligated with plasmid pKK223-3, also digested with EcoRI, with T4 DNA ligase, and the E. coli strain DH5amcr was electroporated with a ligation batch. Selection of the plasmid-bearing cells was performed by spreading the electroporation batch onto ····

4 * 44 ··

4 · 4 · ··

4 ·

4 · · ·

4 4

4 · ··· ·· ·· · · ·

4 4 4

4 4

LB agar, which was mixed with 100 Bg / ml ampicillin, followed by incubation for 24 hours at 37 ° C. The plasmid of interest could be identified in a single clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm) in one clone and designated pFE40. The coding region of the panB gene is under the control of the tac promoter encoded by plasmid pKK223-3 in plasmid pFE40.

To isolate the panD gene from plasmid pCR®2.1panD, the isolated plasmid DNA was digested with EcoRI, the digestion was resolved in a 0.8% agarose gel (30 minutes, 10OV / cm), and the 400 bp panD fragment was isolated using the GLASSMAX ™ kit. The isolated panD fragment was ligated with plasmid pKK223-3, also digested with EcoRI, with T4 DNA ligase, and the E. coli DH5amcr strain was electroporated with the ligation batch. Selection of plasmid-bearing cells was performed by spreading the electroporation batch on LB agar, which was mixed with 100 µg / ml ampicillin and then incubated for 24 hours at 37 ° C. The plasmid of interest could be identified in one clone by restriction enzymes EcoRI, EcoRV and HincII after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm) and designated pFE50. The coding region of the panD gene is under the control of the tac promoter encoded by plasmid pKK223-3 in plasmid pFE50.

The panC gene with HindIII-SmaI digest (Pharmacia Biotech (Freiburg, Germany), product description SmaI, Code no. 27-0942-01) was isolated from plasmid pFE60, for which the digestion batch was separated in a 0.8% agarose gel (30). minutes, 10 V / cm) and a 850 bp panB fragment was isolated using the GLASSMAX ™ kit. The isolated panC fragment was ligated with plasmid pFE50, also digested with HindIII and SmaI, and strain E by T4 DNA ligase.

* 9,999 • 9,999

9 9 • 9 9 9 • 9 9 9

9 ·· coli DH5amcr was electroporated with a ligation handpiece. Selection of plasmid-bearing cells was performed by spreading the electroporation batch on LB agar, which was mixed with 100 gg / ml ampicillin and incubated for 24 hours at 37 ° C. The plasmid of interest was identified by restriction enzymes EcoRI, EcoRV, SmaI, HindIII and HincII in a single clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm) and designated as pFE52. The coding regions of the panD gene and the panC gene are under the control of the tac promoter encoded by plasmid pKK223-3 in plasmid pFE52 and form a single operon.

The panB gene was cloned into the EcoRI splice site following the tac promoter of plasmid pFE52 and the plasmid obtained was designated pFE70. For this, the panB gene was isolated from an agarose gel (30 minutes, 10 V / cm) in which the EcoRI restriction batch of plasmid pFE40 was separated. Ligation was performed with T4 DNA ligase. After electroporation of the ligation batch into strain SJ2, transformants were selected on agar medium E, which was mixed with 0.4% glucose, 100 gg / ml thiamine and 100 µg / ml ampicillin. DNA from ampicillin resistant colonies was isolated using the QIAprep Spin Plasmid kit and the cloning success was verified by digestion with EcoRI, EcoRV, SmaI, HindIII and HincII and subsequent separation in 0.8% agarose gel (30 minutes, 10 V / cm). The coding regions of the panB gene, the panD gene, and the panC gene are under the control of the tac promoter encoded by plasmid pKK223-3 in the plasmid pFE70 and form a single operon.

The panE gene with HindIII-SphI digest (Pharmacia Biotech (Freiburg, Germany), product description Sphl, Code no. 27-0951-01) was isolated from plasmid pFE65, for which the digestion batch was separated in a 0.8% agarose gel (30). minutes, 10 V / cm) and the panE fragment was isolated using the GLASSMAX ™ kit. Isolated

• 9 • 9 • 9 • 9 · 9

9 9 9 •

The panE fragment was ligated with TFE DNA ligase to plasmid pFE70, also digested with HindIII and partially SphI, and the FE5 strain was electroporated with the ligation batch. Selection of plasmid-bearing cells was performed by spreading the electroporation batch onto E-agar + glucose (0.4%) + 50 µg / ml isoleucine + 50 gg / ml ketoisovalerate, which was mixed with 100 µg / ml ampicillin followed by incubation for 48 hours at 37 ° C. Deň: 32 ° C. The plasmid of interest was identified by restriction enzymes EcoRI, EcoRV, SphI, HindIII and HincII in one clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm). as pFE80. The coding regions of the panB gene, panD gene, panC gene, and pan E gene are under the control of the tac promoter encoded by plasmid pKK223-3 in plasmid pFE80 and form a single operon.

Plasmid pFE80 was electroporated into E. coli strain K12 MG1655 and transformants were selected on LB agar mixed with 100 μς / ηΐ ampicillin, followed by incubation at 37 ° C for 24 hours. The strain obtained was designated MG1655 / pFE80.

Example 6

E. coli panE gene overexpression along with E. coli panB, panC and panD in a valine-resistant E. coli K12 MG1655 mutant

The E. coli strain K12 MG1655 was plated on E-agar medium, which was mixed with 0.4% glucose and 100 µg / ml valine (Sigma, Deisenhofen, Germany), V0258). After 48 hours incubation at 37 ° C, one colony could be isolated. This strain was designated FE6. Plasmid pFE80 was electroporated into strain FE6 and transformants were selected on LB agar which was < Desc / Clms Page number 3 >

9999 · 9 • 9,999

9 9 9

9 9

999

Mixed with 100 μς / ml ampicillin, followed by incubation for 24 hours at 37 ° C. The strain obtained was designated FE6 / pFE80.

Example 7

E. coli panE gene overexpression along with E. coli panB, panC and panD in E. coli avtA :: aadB mutant K12 MG1655

Starting from the nucleotide sequence for the avtA gene (EMBLGenBank: accession number Y00490) in E. coli K12 MG1655, PCR primers were synthesized (MWG Biotech (Ebersberg, Germany)). Using these primers, a DNA fragment of approximately 1.6 kbp could be amplified by standard PCR from E. coli K12 MG1655 chromosomal DNA. Size was determined by gel electrophoresis (30 min, 10 V / cm) in a 0.8% agarose gel.

PCR primer for E. coli avtA gene:

avtA 5'- TGCTCTCTCTCAACGCCGAA -3 'avtA2 5'-GAAGCCGCCAACCAGGATAA -3'

The avtA gene PCR product was transformed into plasmid pCR®2.1 and TOP10F 'strain (Invitrogen (Leek, The Netherlands). The success of cloning was demonstrated by digestion of the plasmid pCR®2.1avtA with the restriction enzymes EcoRI and SmaI. The plasmid Spin and after digestion in a 0.8% agarose gel (30 minutes, 10 V / cm) were separated, the aadB gene was cloned into the SmaI site of the plasmid pCR®2.1avtA, and the obtained plasmid was named pFE23. from an agarose gel (30 minutes, 10 V / cm) in which the restriction batch was separated SmaI of plasmid ρΗΡ45Ω () · · · · · · · · · · · · · · · · · EMBL-GenBank: Accession No. K02163) Ligation was performed with T4 DNA ligase After electroporation of the ligation batch into DH5amcr strain, transformants were selected on PA agar mixed with 20 μς / π streptomycin (Sigma, Deisenhofen, Germany) , Code No. S6501). DNA from streptomycin-resistant colonies was isolated using the QIAprep Spin Plasmid kit and the cloning success was verified by digestion with EcoRI and SphI followed by separation in a 0.8% agarose gel (30 minutes,

V / cm).

The avtA :: aadB fragment was excised from plasmid pFE23 by restriction with EcoRI, resolved with a 0.8% agarose gel (30 minutes, 10 V / cm) and isolated using the GLASSMAX ™ kit. The fragment was ligated with plasmid pMAK705, partially digested with EcoRI, with T4-DNA ligase, the ligation batch was electroporated into DH5amcr strain and transformants were selected by incubation on LB agar + µg / ml streptomycin + 25 µg / ml chloramphenicol for 24 hours at 30 ° C. DNA from streptomycin and chloramphenicol resistant colonies was isolated using the QIAprep Spin Plasmid kit, and success was cloned by digestion with SphI and EcoRI in a 0.8% agarose gel (30 minutes, 10 V / cm). The constructed plasmid was called pFE24.

The chromosomal avtA gene was replaced with the avtA :: aadB allele in E. coli K12 MG1655 using the plasmid pFE24. A modified method of Hamilton et al. Plasmid pFE24 was electroporated into E. coli strain K12 MG1655 and then transformants were incubated for 24 hours at 42 ° C on LB-chloramphenicol agar for selection of cointegrates. The colonies obtained were re-incubated on the same medium for 24 hours at 42 ° C for unification. To disintegrate the plasmid, individual colonies were incubated in 5 ml of LB liquid medium for 24 hours at 42 ° C, and then the dilution series of the liquid medium was incubated on LB-chloramphenicol agar. This dilution series was incubated at 30 ° C for 24 hours. For plasmid treatment, individual colonies obtained from the dilution series were plated in 3 consecutive coatings of individual colonies on LB agar for 24 hours at 42 ° C. For phenotype control, the individual colonies obtained were inoculated in parallel on agar plates with the following media: LB + 20 gg / ml streptomycin and LB + 25 gg chloramphenicol.

These media were incubated at 37 ° C for 48 hours. Among the 250 individual colonies tested, there was one whose phenotype indicated replacement of the chromosomal avtA gene for the avtA :: aadB fragment. This strain was designated FE7.

Plasmid pFE80 was electroporated into strain FE7 and transformants were selected on LB agar, which was mixed with 100 µg / ml ampicillin, followed by incubation at 37 ° C for 24 hours. The strain obtained was designated FE7 / pFE80.

Example 8

Determination of ketopantoate reductase activity in various strains of Escherichia coli K12

The specific activity of ketopantoate reductase was determined according to the method described by Shimizu et al. (Journal of Biological Chemistry 263: 12077-12084 (1988)). To this end, cell extracts of the individual strains were obtained with Hybaid RiboLyser (Heidelberg, Germany) and RiboLyser Kit Blue. The ketopantoate reductase activity of the extracts was determined based on the consumption of NADPH when ketopantoate was added. The ketopantoate reductase specific activity was determined to be 6.5 mU / mg for the E. coli K12 MG1655 strain, and 22.0 mU / mg for the E. coli K12 MG1655 / pFE65 strain. No activity could be measured for strain FE5.

········································

Example 9

Pantothenate formation by various strains of Escherichia coli K12

Pantothenate formation by strains MG1655, MG1655 / pFE32, MG1655 / pFE65, MG1655 / pFE80, FE6 / pFE80, and FE7 / pFE80 was examined in batch culture. The medium described by Vogel (Journal of Biological Chemistry 1956, 218: 97-106) with glucose (0.4%) as the carbon source was used as the culture medium. The composition of the medium used is shown in Table 2.

Table 2

Compound Concentration MnSO ₄ .7H ₂ O 0.2 g / l Citric acid monohydrate 2.0 g / l K ₂ HPO ₄ 10,0 g NaNH ₄ HPO ₄ .H ₂ O 3.5 g / l

250 ml Erlenmeyer flasks were filled with 20 ml of said nutrient medium and seeded. After incubation for 48 hours at 37 ° C, the optical density and pantothenate concentration were determined. Optical density with a Novaspec II Photometer from Pharmacia (Freiburg, Germany) at a measuring wavelength of 580 nm was used to determine cell density. The pantothenate content was determined in a sterile-filtered culture supernatant. The determination of pantothenate (as calcium salt) was carried out using the strain Lactobacillus plantarum ATCC® 8014 according to the DIFCO MANUAL of DIFCO (Michigan, USA; 10 ^th Edition, 1100-1102 (1984)). The result is summarized in Table 3.

• 4 • 4 • 4

Table 3

Strain Concentration [pg / ml] Cell density [0D580] Productivity [gg / ml / oD ₅₈₀ ] MG1655 0.51 2.8 0.18 MG1665 / pFE32 1.7 2.8 0, 60 MG1655 / pFE65 4.6 2.9 1.6 MG1655 / pFE80 14.0 2.9 4.8 FE6 / pFE80 35.7 3.2 11.2 FE7 / pFE80 41.7 3.0 13.9

Example 10

Pantothenate formation by various strains of Escherichia coli K12 in the presence of ketopantoate

Pantothenate formation with MG1655, MG1655 / pFE32, MG1655 / pFE65 strains with added ketopantoate was examined in batch culture. To this end, the medium described in Example 8 was supplemented with 50 gg / ml ketopantoate. The other experimental conditions are as in Example 8. The result is summarized in Table 4.

Table 4

Strain Concentration [gg / ml] Cell density [0D580] Productivity [pg / ml / oD ₅₈₀ ] MG1655 6.2 2.9 2.1 MG1655 / pFE32 9.0 2.9 3.1 MG1655 / pFE65 12, 6 2.9 4.3

►999 9 9 9 9 ► 9 9 9 9

Example 11

Isolation of the ilvC gene of Corynebacterium glutamicum ATCC13032

Chromosomal DNA from C. glutamicum ATCC13032 was isolated as described in Tauch et al. (Plasmid, 33: 168179) and partially digested with restriction enzymes Sau3A (Pharmacia Biotech (Freiburg, Germany), product description Sau3A,

Code no. 27-0913-02). DNA fragments ranging in size from 7-9 kb were isolated using a Nucleotrap Extraction Kit for Nucleic Acids (Macherey and Nagel, Duen, Germany; Cat. No. 740584) and ligated to the dephosphorylated BamHI shear site of the vector pUC19 (Viera et al., 1982) , Gene, 19: 259-268; MBI Fermentas, Lithuania). Ligation was performed as described in Sambrook et al. (1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor), where the DNA mixture with T4-ligase (Pharmacia Biotech (Freiburg, Germany) was incubated overnight. This ligation mixture was then electroporated into E. coli strain DH5aMCR (Grant, 1990, Proceedings of the National Academy of Sciences, USA, 87: 4645-4649) (Tauch, 1994, FEMS Microbiological Letters, 123: 343-348) and spread on LB agar (Lennox, 1955, Virology, 1: 190) + 100 After incubation for 24 hours at 37 ° C, the C. glutamicum gene bank could be recovered from the transformants by re-isolation of plasmid DNA according to the "alkaline lysis method of Birnboim and Doly" (1997, Nucleic Acids Research, 7: 1513-1523). Competent cells of E. coli F5 strain carrying panE and ilvC mutations were electroporated with this gene bank, and the electroporation batch was sequenced twice following the regeneration phase (Tauch et al., 1994, FEMS Microbiological Letters, 123: 343-348) twice washed with medium E (Vogel and Bonner, 19 56, Journal of Biological Chemistry, 218: 97-106. Transformant selection was performed by trituration onto E-agar + glucose (0.4%) + 100 µg / ml ampicillin + 50 µg / ml isoleucine + 50 µg / ml ketoisovalerate. Plasmid DNA was isolated from the 4 colonies obtained using the QIAprep Spin Plasmid kit. Cleavage of XbaI plasmid DNA followed by separation in 0.8% agarose gel (30 minutes, 10 V / cm) showed that the plasmids were pUC19 vectors with approximately 6.5 kbp large inserts. Sequencing of the inserts followed by homology comparison by the BLAST program (Altschul, Journal of Molecular Biology 1990, 215: 403-410) showed that the inserts in all cases contained the complete C. glutamicum ilvC gene (EMBL-GenBank: Accession No. L09232). One of these plasmids was designated as pFE90.

Example 12

Corynebacterium glutamicum ATCC13032 ilvC gene expression in Corynebacterium glutamicum ATCC13032

The plasmid pECm3 was used to express the C. glutamicum ilvC gene in C. glutamicum ATCC13032. Plasmid pECm3 is a derivative of plasmid pECm2 (Tauch, 1994, FEMS Microbiological Letters, 123: 343-348), whose kanamycin resistance gene was removed by restriction BglII (Pharmacia Biotech (Freiburg, Germany), product description BglII, Code no. 27- 094602) and BamHI followed by religions. Plasmids pECm2 and pECm3 are capable of replication in E. coli as well as in C. glutamicum. To isolate the ilvC gene from plasmid pFE90 (Example 11), the isolated plasmid DNA was digested with XbaI (Pharmacia Biotech (Freiburg, Germany), Xbal product description, Code no. 27-094801), and the digestion was resolved in a 0.8% agarose gel. (30 min, 10 V / cm) and a 6.5 kbp ilvC fragment was isolated using the GLASSMAX ™ kit. The isolated ilvC fragment was ligated using T4 DNA ligase with the plasmid pECm3, also digested with XbaI, and the E. coli FE5 strain was electroporated with the ligation batch.

· O «o o.......

· * ♦ · · · · · · · · ·. ·.. · · · · · ·

Selection of plasmid-bearing cells was performed by spreading the electroporation batch on LB agar, which was mixed with 50 µg / ml chloramphenicol, followed by incubation for 24 hours at 37 ° C. The plasmid of interest could be identified by XbaI in one clone after DNA isolation and control digestion, followed by 0.8% agarose gel electrophoresis (30 minutes, 10 V / cm) and designated pFE91.

Plasmid pFE91 was electroporated into C. glutamicum strain ATCC13032 and transformants were selected on LB agar mixed with 7.5 µg / ml chloramphenicol followed by incubation at 30 ° C for 48 hours. The strain obtained was designated as C. glutamicum ATCC13032 / pFE91.

Example 13

Pantothenate formation by Corynebacterium glutamicum. ATCC13032

Pantothenate formation by C. glutamicum strain ATCC13032 / pFE91 was examined in CGXII medium (Keilhauer et al., 1993, Journal of Bacteriology, 175: 5595-5603) with 10 mg / ml chloramphenicol, hereinafter referred to as C. glutamicum assay medium. . This medium is shown in Table 5. 50 ml freshly seeded C. glutamicum assay medium was inoculated with a 16-hour culture (C. glutamicum assay medium, 30 ° C, 150 Upm) with an o.D.sqo 0.1 cell density. After 48 hours incubation at 30 ° C and 150 U / min, cells were removed by centrifugation at 5000 x g for 10 minutes, the supernatant was sterile filtered and pantothenate concentration was determined. Cell density was determined as described in Example 9.

• 9 9 * 9

1999 99

9999

9 9

9 9 99 · 99 ·

9 9 9

9 9 9

9 9 9

The determination of pantothenate (as calcium salt) was carried out using the strain Lactobacillus plantarum ATCC® 8014 according to the DIFCO MANUAL of DIFCO (Michigan, USA; 10 ^th Edition, 1100-1102 (1984)). The result is shown in Table 6.

Table 5

Substance Concentration on liter Note (NH ₄ ) ₂ SO ₄ 20 g Urea 5 g KH ₂ PO ₄ 1 g k ₂ hpo ₄ 1 g MgSO ₄ .7H ₂ O 0.25 g MOPS 42 g CaCl ₂ 10 mg FeSO ₄ .7H ₂ O 10 mg MnSO ₄ .H ₂ O 10 mg ZnSO ₄ .7H ₂ O 1 mg CuSO ₄ 0.2 mg NiCl ₂ .6H ₂ O 0.02 mg Biotin 0.5 mg Glucose 40 g Separately auto- klávovaná Protokatechová 0.03 mg Sterile acid filtered

99 99

9 9 9 9 9

9,999 9,999

9 9 9 9 9

9 »-» «

9 99 99

Table 6

Strain Concentration [pg / ml] Cell density [0D580] Productivity [μρ / π1 / 58ϋ] ATCC13032 0.2 20 May 0.010 ATCC13032 / pFE91 0.3 20 May 0.015

Example 14

Saccharomyces cerevisiae panE gene expression

1. Amplification of YHR063c reading grid:

Starting from the nucleotide sequence of the YHR063c reading screen of Saccharomyces cerevisiae (accession number U00061, National Center for Biotechnology, Bethesda, MD), the following PCR primers were synthesized (MWGBiotech, Ebersberg, Germany). The beginning or end of the reading grid is indicated by a dot (.):

• OJD539 (5 'EcoRI-Notl START):

5'- GCG CGA ATT CAG ATC GCC GGC CG AAA GAG GAG AAA TTA ACT.ATG ACT GCA CCA CAC AGA AG -3 '

5'- CGC GAC TAG TCT GCA GTC CTC TTC TCC AGT CAC-3 '

The genomic DNA of S. cerevisiae JD242 strain, which was isolated according to a method from C. Guthrie and GR Fink (Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, San Diego), served as a template. ··· · 4 ·· · 4 · 4 4 * 999 φ

4 »9 4 4 4

4 ·· «9.9 φ»

CA, 1991). This strain is a haploid segregant of the diploid strain SC288C (Winston et al., Yeast 11, 53 et seq., (1995)), whose genome was sequenced (Goffeau et al., Science 274, p. 546, (1996)). Tetradene analysis was performed according to the method of C. Guthrie and G. R. Fink (Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, San Diego, CA, 1991). The JD242 strain is auxotrophic for leucine (leu2AII allele) and uracil (ura3-52 allele). A DNA fragment of approximately 1.2 kB could be amplified using the High Fidelity Expand Polymerase kit from Roche (Mannheim) for 28 cycles of PCR under the conditions specified by the manufacturer. Size was determined by electrophoretic separation in a 0.8% agarose gel.

2. Construction of pJD-YHR063c:

To express the YHR063c reading screen in S. cerevisiae, a PCR amplification was inserted into the shuttle vector pJDCEX2 of E. coli - S. cerevisiae (Figure 8 and Dohmen at al., 1995, Journal of Biological Chemistry 270, 18099-18109).

The PCR product was restricted with EcoRI and SpeI (AGS, Heidelberg, Germany). Subsequently, it was mixed with pJDCEX2-DNA, which was treated with EcoRI and XbaI (AGS, Heidelberg, Germany), and ligated with T4-DNA ligase (Roche, Mannheim, Germany). The ligation batch was transformed into XL1-Blue E. coli strain (Bullock et al., 1987, Biotechniques 5, 376). The transformant was obtained by selection on LB agar containing 150 gg / ml ampicillin (Sigma, Diesenhofen, Germany). Plasmid DNA from ampicillin resistant clones was prepared by alkaline lysis (Sambrook et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989). Isolated plasmid DNA was examined by restriction with NotI and PstI and subsequent splicing in 0.8% agarose.

9 * 99

9 99 9 9 gel. The plasmid with the desired structure was named pJD-YHR063c (Figure 9). The sequence of the PCR product cloned in pJD-HYR063c was verified by sequencing with the oligonucleotides oJD105 and OJD106.

OJD105 (T-CYC2):

5 '-GAAGTCATCGAAATAG-3'

0JDIO6 (P-CUP2):

5-TCGTTTCTGTCTTTTTC-3 '

3. Construction pKK-YHR063c:

The plasmid pKK223-3 was used to express the YHR063c reading screen in E. coli (Brosius and Holy, Proceedings of the National Academy of Science USA 81, 6929 (1984)). To this end, plasmid pJD-YHR063c was first restricted with EcoRI and PstI (AGS, Heidelberg, Germany). A 1.2 kb YHR063c fragment was electrophoresed in a 0.8% agarose gel, and the DNA was isolated with the QiaexII Gel Extraktion kit (Qiagen, Hilden, Germany). It was then ligated into plasmid pKK223-3, which was opened with EcoRI and PstI, by T4-DNA ligase (Roche, Mannheim, Germany). The ligation batch was transformed into XL1-Blue E. coli strain (Stratagene, LaJolla, CA, USA.) The transformant was obtained by selection on LB medium containing 150 µg / ml ampicillin (Sigma, Deisenhofen, Germany). Ampicillin was prepared by alkaline lysis (Sambrook et al .: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989) The success of cloning was examined by restriction with EcoRI and PstI and subsequent separation in a 0.8% agarose gel. structure was named pKK-YHR063c.

• 9 · * ··

9 · ····

---- ·· ·· ► 9 * · T · »9 9 9 9 9« «· ¹ · * ♦ 9 9 9» ► · 9 9 9 9 «· · * ♦ 99 9 ··

Example 15

Complementation of the E. coli FE5 mutant

To analyze the panE function of the S. cerevisiae reading screen, it was examined whether expression of this reading screen could complement the need for pantothenic acid of E. coli strain FE5 (Example 1). This strain is mutated to panE and ilvC genlocation. To do this, the strain FE5 was first transformed with plasmid pKK-YHR063c.

Subsequently, growth of strain FE5 / pKK-YHR063c on minimal M9 agar was investigated (Sambrook et al .: Molecular Cloning and Laboratory Manual, Cold Spring Harbor Laboratory Press,

1989), which was supplemented with 50 μς / ml ketoisovalerate (Kiv) and 50 μς / ml isoleucine (Ile), depending on the addition of pantothenate (50 pg / ml). The FE5 / pKK223-3 strain served as a negative control and the FE4 / pFE65 strain as a positive control (Example 4). Table 7 shows the result of the experiment: The S. cerevisiae YHR063c reading screen found in plasmid pKK-YHR063c complements the two-fold mutation of the panE-ilvC strain E. coli FE5. The YHR063c reading screen has the function of the panE gene.

Table 7

Strain M9 + Ki + Ile with pantothenate M9 + Ki + Ile without pantothenate FE5 / pFE65 grow grow FE5 / pKK223-3 grow no growth FE5 / pK-YHR063c grow grow

* 9 • 98 9

999 ·

9 9 9 9 9 • 9 9 * 9 999

9 9 9

9 9

999

9 9 9

9 9 9

9 9 9

9

9 9 9 9

Example 16

Determination of ketopantoate reductase activity in various strains of Saccharomyces cerevisiae

S. cerevisiae JD242 strain (see Example 14) was transformed with plasmids pJDCEX2 and pJD-YHR063c according to the method of Dohmen et al. (Dohmen et al., Yeast 7: 691 (1991)). Transformant selection was performed on minimal medium without leucine with 1.8% agar (see Table 8a, b).

As a nutrient medium, a variant of the minimal medium of Yeast Nitrogen Base (YNB) described in the Difco-Manual (Michigan, USA; 10 ^th Edition, 1100-1102 (1984)), containing no pantothenic acid was used. The medium additionally contained glucose (2%), uracil (40 gg / ml), CuSO ₄ (150 μΜ) to induce the Pcvpi promoter of pJDCEX2 and pJD-YHR-063c, Leu Drop-Out from CLONTECH (Heidelberg, Germany, Cat. No. 8605-1) (650 gg / ml) and supplements ketopantoate (100 µg / ml) and β-alanine (100 µg / ml). The composition of the medium used is shown in Table 8a and b.

• 4,444

4 4> 4 4

4 4

4444 44

4

443 4 4

4

4 444 4 44 4 4 4

4 «4

4 4 4

4 4 4

44

Table 8a:

Compound Quantity per liter (NH ₄ ) ₂ SO ₄ 5 g kh ₂ Mon ₄ ¹ g MgSO ₄ .7H ₂ O 0.5 g NaCl 0.1 g CaCl ₂ 0.1 g H3BO3 500 pg CuSO ₄ 40 gg KI 100 gg FeCl ₃ .6H ₂ O 200 pg MnSO ₄ .H ₂ O 4 00 μg Na ₂ MoO ₄ .2H ₂ O 400 μg ZnSO ₄ .7H ₂ O 200 μg Biotin 2 μg Folic acid 2 μg Inositol 2 mg Niacin 400 μg p-Aminobenzoic acid 200 μg Pyridoxine hydrochloride 400 μg Riboflavin 200 μς Thiamine hydrochloride 400 μg

·· 9999

9

9 9

999 9

9999

99

Table 8b:

Ingredient Quantity per liter Glucose 20 g Uráčil 40 mg CuSO ₄ 24 mg -Leu DO supplement 650 mg Ketopantoate 100 mg β-Alanine 100 mg

250 ml Erlenmeyer flasks were filled with 50 ml of the indicated nutrient medium, seeded with a single column agar plate (see Table 8a, b) and incubated for 72 hours at 30 ° C and 175 rpm. This preculture was seeded with 50 ml of the same nutrient medium in a 250 ml Erlenmeyer flask to have an optical density (580 nm) of 0.5. After 24 hours of cultivation at 30 ° C and 175 rpm, the optical density was measured with a Novaspec II photometer from Pharmacia (Freiburg, Germany) at a measuring wavelength of 580 nm. It was 4.0 for both cultures. The specific ketopantoate reductase activity of S. cerevisiae strains JD242 / pJDCEX2 and pJD242 / pJD-YHR063c was determined according to the method described by Shimizu et al. (Journal of Biological Chemistry 263: 12077-12084 (1988)).

To this end, cell extracts of the individual strains were obtained with Hybaid RiboLyser (Heidelberg, Germany) and RiboLyser Kit Red. The ketopantoate reductase activity of the extracts was determined based on the consumption of NADPH when ketopantoate was added. Protein content was determined according to the Bradfort method (Bradford, Analytical Biochemistry 72, 248 et seq., (1976)). The ketopantoate reductase specific activity of 3 mU / mg protein was determined for the JD242 / pJDCEX2 control strain and the specific activity of 386 mU / mg protein for the JD242 / pJDYHR063c strain.

• 9,999

Example 17

Pantothenate formation by various strains of Saccharomyces cerevisiae

Pantothenate formation by S. cerevisiae strains JD242 / pJDCEX2 and JD242 / pJD-YHR063c was examined in batch culture.

The 250 ml Erlenmeyer flasks were filled with 50 ml of the nutrient medium shown in Tab. 8a, b, the seed was seeded with a single colony agar plate (see Table 8a, b) and incubated for 72 hours at 30 ° C and 175 rpm. This preculture was seeded with 50 ml of the same nutrient medium in a 250 ml Erlenmeyer flask to have an optical density (580 nm) of 0.5. After 24 hours of cultivation at 30 ° C and 175 rpm, the optical density and pantothenate concentration were determined. To determine cell density, the optical density was measured with a Novaspec II photometer from Pharmacia (Freiburg, Germany) at a measuring wavelength of 580 nm. The pantothenate content was determined in a sterile-filtered culture supernatant.

The determination of pantothenate (as a calcium salt) was performed using the Lactobacillus plantarum strain ATCC® 8014 according to the DIFCO MANUAL of DIFCO (Michigan, USA; 10 ^th Edition, 1100-1102 (1984)). The result is summarized in Table 9.

Table 9

S. cerevisiae strain Concentration [pg / ml] Cell density [0D580] Productivity [pg / ml / oD ₅₈₀ ] JD242 / pJDCEX2 0, 93 4.0 0,023 JD242 / pJD-YHR063c 1.12 4.1 0,027

Claims (25)

PATENT CLAIMS A method for producing and improving pantothenic acid producing microorganisms by amplification, in particular by overexpression of ketopantoate reductase encoding nucleotide sequences, in particular the panE gene, individually or in combination, and optionally additionally the ilvC gene. Method according to claim 1, characterized in that the number of copies of genes or nucleotide sequences in microorganisms is increased by insertion of plasmid vectors carrying these genes or nucleotide sequences to achieve overexpression. 3. The method of claim 1 wherein the promoter and regulatory regions upstream of the structural gene are mutated to achieve overexpression. 4. The method of claim 1, wherein, to achieve overexpression, they are incorporated upstream of the structural gene of the expression cassette. The method according to claims 1 to 4, characterized in that nucleotide sequences encoding ketopantoate reductase having one or more mutations in resistance to metabolites and / or antimetabolites are amplified in microorganisms, in particular overexpressing. The method according to claims 2 to 5, characterized in that the culture medium and / or the fermentation is varied in order to achieve amplification or overexpression. 9 «·· • · 9 9 '9 9 • * 9,999 * 9 9 9 9 9 9 9 9 9 9 _e 9999 99 99 999 9 9 9 9 • * 9 9 • 9 9 99 99 Method according to claims 1 to 6, characterized in that metabolic pathways which reduce the production of pantothenate (pantothenic acid) are eliminated in microorganisms. 8. The method of claim 7, wherein the avtA gene is eliminated. The method of claim 7, wherein the ilvE gene is eliminated. Method according to claim 1, characterized in that the C. glutamicum ilvC gene is overexpressed or amplified in microorganisms, in particular corynebacteria or E. coli. The method according to claims 1 to 9, characterized in that, in addition to the nucleotide sequences encoding ketopantoate reductase, it is amplified, in particular overexpressing one or more of the pantothenic acid production pathway genes. Method according to claim 11, characterized in that one or more genes which encode the enzymes ketopantoate hydroxymethyltransferase (EC 4.1.2.12), aspartate-1-decarboxylase (EC 4.1.1.11) and pantothenate synthetase (EC) are additionally amplified, in particular overexpressed. 6.3.2.1). A method according to claims 11 and 12, characterized in that a variety of compatible plasmid vectors containing said genes are used. • 4 · 4 4 4 4 4 4 4 4 «··· 44 4 4 4 44 4 4 4 • 4 4 • 4,444 «· * 4 4 4 4 4 4 4 4 4 4 14. The method of claims 10 and 11, wherein a strain transformed with one or more compatible plasmid vectors is used and the plasmid vector carries one or more of said genes, including the panE gene, in which the genes are arranged one after the other and under the control of one common promoter or arranged separately from each other under the control of different promoters. Plasmid vector pFE80, characterized by the restriction map shown in Figure 6 and deposited in E. coli K12 MG 1655 / pFE80 strain under the designation DSM 12414. Plasmid vector pFE65, characterized by the restriction map shown in Figure 5 and deposited in the strain E. coli K12 MG1655 / pFE65 under the designation DSM 12382. Plasmid vector pFE32, characterized by the restriction map shown in Figure 4 and deposited in the E. coli K12 MG16655 / pFE32 strain under the designation DSM 12413. 18. The E. coli K12 FE6 strain that carries valine resistance. 19. FE7 strain for avtA fragment: E. coli K12, in which the avtA aadB gene, deposited under the designation DSM 12380, is exchanged. A microorganism (host cell) of the genus E. coli or Corynebacterium comprising one of the plasmid vectors according to claims 11 to 14 and optionally one or more resistance to metabolites and / or antimetabolites. 21. C. glutamicum ATCC 13032 / pFE91, which comprises the plasmid vector pFE91 with the C. glutamicum ilvC gene. »MM MM · i j ⁵⁰ i i i i i i i i i i i i i i i i i · 9 9 9 9 9 9 9 9 9 9 9 9 22. A method for producing pantothenic acid, characterized in that the following steps are performed: a) fermentation of microorganisms according to one or more of the preceding claims, (b) concentration of pantothenic acid in the medium or in the cells of micro - organisms; and c) isolating pantothenic acid. 23. The method of claim 22, wherein ketopantoate is added as a precursor. 24. The process of claim 23 wherein in step a) a pantothenic acid precursor selected from the group consisting of β-alanine and ketoisovalerate is added. Method according to one or more of the preceding claims, characterized in that microorganisms of the genus E. coli or Corynebacterium or yeast are used.