CZ258799A3 - Potato plant exhibiting enhanced storage characteristics at low temperature and method of improving those characteristics - Google Patents

Abstract

Potato plants that show reduced potato tubers α-glucan type L / GLTP / and tuberous phosphorylase activity α-glucan phosphorylase type H (GHTP). In the tubers they show decreased activity by GLTP and aGHIP, is also attenuated converting starch to sugars, especially when stored at temperature lower than 7 ° C. Potato sludge reduction induced low temperature allows to store lower potato beans temperatures, thereby prolonging dormancy, decreasing possibility of disease occurrence and storage time. Ways producing tuber-producing brarribor plants depleting the activity of GLTP and GHIP enzymes expression of the gene using homologous antisense RNA; the use of co-suppression, regulatory damping sequences, chemical a protein inhibitors or using site-directed mutagenesis or isolating alternative alleles.

Description

Field of the invention

The invention relates to the inhibition of sugar accumulation in potatoes by reducing the enzymatic activity of α-glucan L-type phosphorylase or aglucan H-type tuber phosphorylase in potato plants.

BACKGROUND OF THE INVENTION

Plants are exposed to a number of factors, including disease, environment, and storage conditions of potato tubers (Solanum tuberosum), which represent the main determinants of potato tuber quality. The period of vegetation rest between harvesting and germination is critical for maintaining the quality of potato tubers. Potatoes are usually stored at 7 ° C to 12 ° C. Storage at 2 ° C to 6 ° C, as opposed to 7 ° C to 12 ° C, allows long-term storage by reducing respiration, moisture loss, microbial infections, heating costs and the need for chemical germinating inhibitors (Burton, WG) (1989) The Potato, Longman Scientific and Technical). At low temperatures, potatoes become sweet and result in a high sugar content, contributing to the unacceptable brown or black color of the product (Coffin et al. (1987) J. Food Sci. 52: 639-645; Weaver et al. (1978) Am. Pot. J. 55: 83-93). Sugars that accumulate in tubers are predominantly glucose, fructose and sucrose. When potatoes are heated during various cooking processes, such as frying, they are primarily glucose and fructose (reducing sugars), which react via Maillard reaction with free amino groups, resulting in the formation of brown pigments (Burton, WG (1989) The Potato, Longman Scientific and Technical (Shallenberger et al., (1959) Agric. And Food Chem. 7: 274-277). When caramelized sucrose

9 9 9 9 9 9 9 9 9

9 9 9 9 9 9 9 9 99999 99 99 99 99 produces a black color. The ideal content of reducing sugar is 0.1% by weight of fresh tubers, with an upper limit of 0.33%. Higher amounts of reducing sugars are sufficient to form brown and black pigments that degrade the product (Davies and Viola (1992) Postharvest News and Information 3: 97-100). Although accumulation of reducing sugars can be reduced when stored at a higher temperature (7 ° C to 12 ° C), the possibility of microbial infection is increased and germination inhibitors need to be used. Given the negative environmental effects and the dangers associated with the use of chemicals, the development of pesticide-resistant pathogens, and the fact that the use of current germination inhibitors may soon be banned, it is necessary to create a potato variety that withstands stress and long-term storage. cold, without the use of chemicals and without the accumulation of reducing sugars, and which retains starch.

Sugar metabolism is a complex process in a plant cell. If a number of different enzymatic processes are affected, the accumulation of reducing sugars during storage may also be potentially affected. Inhibition of sugar degradation will limit the formation of free sugar. Other methods can also be used to improve potato storage properties. These are sugar reductions involving the re-synthesis of starch using reducing sugars and removal of sugars by glycolysis and respiration or conversion of sugar to other forms not involved in the Maillard reaction. However, many enzymatic processes are reversible and the role of most enzymes involved in carbohydrate metabolism is not entirely clear. Enzymes need to be established to achieve the desired results and are active at low temperature and to maintain the quality of the potatoes required by producers, processors and consumers.

Phosphofructokinase (PFK) has been shown to play an important role in the low temperature-induced potting process (Kruger, N.J. and Hammond, J.B. (1988) Plant Physiol. 86: 645-648; ap.

Rees et al., (1988) Symp. Soc. Exp. Biol. 42: 377-393; Dixon et al., (1981) Phytochemistry 20: 969-972; Claassen et al., (1991) Plant Physiol. 95: 1243-1249. ApRees et al., (1988) Symp. Soc. Exp. Biol. 42: 377-393, it is reported that cooling has a disproportionate effect on various modes of carbohydrate metabolism in that glycolysis strongly reduces the temperature sensitivity of PFK. By decreasing PFK activity, the availability of hexose phosphates in sucrose production increases. European Patent No. 0438904 (Burrel et al, July 31, 1991) discloses that enhancing PFK enzyme activity during storage reduces sugar accumulation by removing hexoses by glycolysis or other metabolic means. The PFK enzyme, which originated from E. coli, is expressed in potato tubers. The invention claims protection against increasing PFK activity and reduced sucrose content in tubers, which was determined during the harvest period. However, the diphosphate: phosphotranferase fructose-6-phosphate (PFP) ratio has been shown to remain active at low temperature (Claassen et al., (1991) Plant Physiol. 95: 1243-1249). PFP activity can produce fructose-6-phosphate for glycolysis, just as PFK can directly catalyze the same reaction because it is dependent on two enzymes. For these reasons, the effectiveness of this strategy of improving the quality of potatoes during storage at low temperatures is doubtful. Since potatoes lose their valuable dry matter by respiration when sugar is removed by glycolysis and during other metabolisms, this method is not preferred.

Furthermore, the enzyme pyrophosphorylase ADP-glucose (ADPGPP) has been shown to play an important role in the low temperature-induced sweetening process. International Application WO 94/28149 (Barry et al, May 18, 1994) discloses that increasing ADPGPP activity reduces the accumulation of sugars during storage by re-synthesizing starch using reducing sugars. The ADPGPP enzyme derived from E. coli was expressed in potato tubers. Its expression was driven by a low temperature-induced promoter and the application claims protection against the fact that an increase in activity occurs after storage at low temperature. enzyme ADPGPP and to reduce the content of reducing sugar in tubers, which was tested at harvest. However, this strategy does not exclude starch catabolism, but instead increases the rate of starch re-synthesis. This leads to the catabolism of sugars through glycolysis and respiration, and the reintegration of sugars into starch is limited. Increasing ADPGPP activity is not the preferred way to improve the properties of stored potatoes, as the result is the loss of valuable dry potato by respiration. Again, the method of reducing starch catabolism is preferred, while maintaining the dry mass of potato tubers.

Several enzymes are believed to be involved in the degradation of starch, including α-amylase (endoamylase), β-amylase (exoamylase), amyloglucosidase, and α-glucan phosphorylase (starch phosphorylase). The slowing of the starch catabolism process prevents the accumulation of reducing sugars and minimizes the removal of sugars through glycolysis and other metabolisms.

Three different isozymes of α-glucan phosphorylase are described. The L-type α-1,4-glucan phosphorylase isozyme (EC 2.4.1.1) (GLTP) (Nakano, K. and Fukui, T. (1986) J. Biol. Chem. 266: 82308256) has a low affinity for highly branched glucans, such as glycogen, and is found in amyoplasts. The monomer contains 916 amino acids and shows a high homology of 51% and 40% amino acids, respectively, when compared to the phosphorylase from rabbit muscles and E. coli. The nucleotide sequence of the GLTP gene and the amino acid sequence of the GLTP enzyme are shown in SEQ ID NO: 1 and SEQ ID NO: 2. The H-type tuber phosphorylase isozyme H (EC 2.4.1.1) (GHTP) (Moři et al., (1991) J. Biol. Chem. 266: 18446-18453) has a high affinity for glycogen and is found in the cytoplasm. The gene encodes 838 amino acids and exhibits 63% sequence homology to type L phosphorylase. The sequence does not contain an insert containing 78 residues and an N-terminal extension of 50 residues, which is The nucleotide sequence of the GHTP gene and the amino acid sequence of the GHTP enzyme are shown in SEQ ID NO: 3 and SEQ ID NO: 4. It is reported that the third isozyme (Sonnewald) et al., (1995) Plant Molecular Biology 27: 567-576), which contains 974 amino acids, is highly homologous to tuber type L phosphorylase. The entire polypeptide exhibits 81% homology. However, the regions containing the transit peptide and the sequence of the insert are very different. This isozyme has been termed L-type leaf phosphorylase because mRNA accumulates in equal amounts in leaves and tubers, whereas L-type tuber phosphorylase mRNA accumulates largely in potato tubers and only appears in very small amounts in leaf tissue. L-type tuber phosphorylase is mainly present in tubers and L-type leaf phosphorylase is more common in leaves (Sonnewald et al., (1995) Plant Molecular Biology 27: 567576). The nucleotide sequence of the L-type leaf phosphorylase gene and the amino acid sequence of the L-type leaf phosphorylase enzyme are shown in SEQ ID NO: 5 and SEQ ID NO: 6.

The role of various starch decomposing enzymes is unclear and conflicting results appear. For example, decreased expression of L-type leaf phosphorylase (Sonnewald et al., (1995) Plant Molecular Biology 27: 567-576) has no significant effect on starch accumulation. Sonnewald et al., (1995) Plant Molecular Biology 27: 567-576 describes constitutive expression of an antisense RNA that is specific for the L-type leaf phosphorylase gene, resulting in a decrease in α-glucan L-type phosphorylase activity in leaf tissue, but has no effect in the potato tuber tissue. Since inhibition of α-glucan phosphorylase activity does not have a significant effect on starch accumulation in leaves of transgenic potato plants, the author concludes that starch decomposition is not catalyzed by phosphorylase. Taking into account the high sequence homology between the identified α-glucan phosphorylase isozymes, it is expected that the sequence is identified as α-glucan phosphorylase isozymes. A similar negative response for type H isozyme (GHTP) and tuber L type isozyme (GLTP).

It is necessary to create potato plants that produce tubers exhibiting reduced conversion of starches to sugars during growth and storage at ambient and low temperatures, especially when the temperature falls below 7 ° C.

SUMMARY OF THE INVENTION

The invention teaches that attenuation of the enzymatic activity of L-type glucan phosphorylase (GLTP) and H-type glucan phosphorylase (GHTP) in potato tubers leads to a substantial reduction in sugar accumulation during growth and storage compared to wild-type potatoes. These results are particularly evident when stored below 10 ° C and specifically at 4 ° C. Obviously, the metabolism of sugars in the tubers and the decrease in the activity of a single enzyme contribute to reducing the accumulation of sugar in the tuber. In light of the results reported by Sonnewald et al., (1995) Plant Molecular Biology 27: 567-576, it is reported that decreased expression of L-type leaf phosphorylase has no significant effect on starch accumulation in potato plant leaves.

The present invention provides enormous commercial advantages. Tubers where the low temperature-induced sweetening is inhibited or weakened can be stored without producing large amounts of reducing sugars, causing unacceptable darkening of fried potato products. The storage of tubers at low temperatures allows long-term storage, extends the vegetation period by reducing respiration and delaying germination and reducing the incidence of sick potatoes.

Reduction of GLTP and GHTP activity in potato and tuber plants may be accompanied by any number of known methods, including, without limitation, antisense inhibition of GLTP or GHTP mRNA, co-suppression, site-directed mutagenesis of wild-type GLTP or GHTP genes. inhibition or plant breeding programs.

The invention discloses altered potato plants that exhibit reduced tuber α-glucan phosphorylase type L (GLTP) activity or tuber α-glucan phosphorylase type H (GHTP) produced by the plant as compared to potato-produced tubers. In a preferred embodiment, a potato plant transformed with an expression cassette having a plant promoter sequence operably linked to a DNA sequence that, when transcribed in plants, inhibits the expression of an endogenous GLTP gene or a GHTP gene. As discussed below, the DNA sequence may be inserted into an expression cassette in sense or antisense orientation. Potato plants of the invention may have reduced activity of one GLTP or GHTP independently of each other or may exhibit reduced activity of both enzymes.

As mentioned above, it has been found that a decrease in GLTP or GHTP enzyme activity in potato plants results in a reduction in sugar accumulation in potato tubers especially during long-term storage below 10 ° C. The invention further provides methods for reducing sugar production in tubers produced by a potato plant containing reduced GLTP or GHTP activity. In a preferred embodiment of the invention, such methods comprise introducing into the potato plant an expression cassette having a plant promoter operably linked to a DNA sequence which, when transcribed in the plant, inhibits expression of an endogenous GLTP gene or a GHTP gene. As mentioned above, the DNA sequence may be inserted into the expression cassette in either sense or antisense orientation.

As described in the details below in the examples, an improvement in the low temperature storage characteristics was observed in the Desiree potato variety that was transformed by the methods of the invention. Direct measurement of improved low temperature storage characteristics is mediated by a reduction in activity * a · a · aa · aaa ······· · aaaa aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa The GLTP or GHTP enzyme detected in potatoes at harvest and during low temperature storage. Transformed varieties have been developed where the total α-glucan phosphorylase activity expressed as micromoles of NADPH produced per milligram of protein per hour in tubers of plants stored at 4 ° C for 189 days is 70% lower than the total aglucan phosphorylase activity of tubers of untransformed plants stored under the same conditions.

Another relatively direct measurement of improving the low temperature cooling characteristics is the reduction in potato sweetness that is observed after the low temperature storage period. Transformed potato varieties have been developed where the sum of glucose and fructose concentrations in tubers stored at 4 ° C for 91 days is 39% lower than the sum of glucose and fructose concentrations in tubers of untransformed plants stored under the same conditions.

Further measurements of improving the low temperature cooling characteristics demonstrate the practical advantages of the invention. This is to reduce the darkening of potato chips during processing (cooking). As described above, the accumulation of sugars in potatoes during storage at low temperatures causes unacceptable darkening of the fried product. The limited frying darkness can be quantified as a measure of reflectance or fried potato chips score. Methods for measuring flakes score are given below. Transformed potato varieties have been developed where the flare score of the tubers of plants stored at 4 ° C for 124 days is 89% higher than the flare score of the tubers of untransformed plants stored under the same conditions.

By reducing the activity of the GLTP and / or GHTP enzyme in potato tubers, thereby inhibiting the accumulation of sugars during the low temperature storage period, the invention allows the tubers to be stored at a lower temperature than would be possible with wild-type potatoes of the same cultivar. As discussed above in the text of storage * 9 9 9 9 • ·· · · ··

9 9 9 9 9 9

9 9 9 9 9

999 99 99 99 Potatoes at a lower temperature than traditionally used can lead to prolonged storage, prolonged vegetative rest periods by reducing respiration and germination and reducing the incidence of diseases potato plant. It is understood that one skilled in the art can improve the storage characteristics at low temperatures and can measure and quantify them in a variety of known ways.

Potato plants have been shown to have reduced activity of α-glucan L-type phosphorylase (GLTP) and α-glucan H-type phosphorylase (GHTP) in tubers, which is compared to the activity of α-glucan L-type phosphorylase (GLTP) and α-glucan phosphorylase. -glucan type H (GHTP) in tubers producing untransformed potato plants. Reduction of α-glucan phosphorylase activity is accompanied by transformation of the potato plant by an expression cassette, where the plant promoter sequence is operably linked to a DNA sequence which, when transcribed in plants, inhibits expression of the endogenous GLTP gene or GHTP gene. Although the DNA sequence is incorporated into the expression cassette in an antisense orientation, a decrease in α-glucan phosphorylase α-glucan phosphorylase activity can be achieved by incorporating the DNA sequence into the expression cassette in either an antisense or sense orientation.

Suppression of expression depending on homology

Control of gene expression using fragments in sense or antisense orientation is standard laboratory practice and the description can also be found in the literature. Antisense- and sense-suppression is a sequence-dependent method.

Scientific articles published during 1996 show that, in the case of transgenic plants, there are hundreds of descriptions of non-expression of genes depending on homology. The mechanism of non-expression of genes depending on homology is not fully understood, but the characteristics of this phenomenon are:

90 have been studied in many plant genes and the results have been reported (Meyer and Saedler (1996) Annu. Rev. Plant. Physiol. 47: 23-48; Matzke and Matzke (1995) Plant Physiol.

107: 679; Jorgensen, R.A. (1995) Sci. 268: 686-691.

Weintraub (1990) Scientific American 1: 34-40; Van der Krol et al. (1988) Gene 72: 45-50). Non-expression of a gene depending on homology is a general phenomenon that can be used to control the activity of many endogenous genes. Examples of genes showing attenuated expression upon introduction of the homologous sequence include dihydroflavanol reductase (Van der Krol, (1990) Plant Cell 2: 291-299), polygalacturonidase (Smith et al., (1990) Mol.Gen. Genet. 244: 447-481) ), phytoene synthase (Fray and Grierson (1993) Plant Mol. Biol. 22: 589-602), pectinsterase (Seymour et al., (1993) Plant Mol. Biol. 23: 1-9), phenylalanine ammonia lyase (De) Carvalho et al., (1992) EMBO J. 11: 25952602), β-1,3-glucanase (Hart et al., (1992) Mol. Gen. Genetic. 235: 179-188), chitinase (Dorlhac et al. (1994) Mol. Gen

Genetic. 243: 613-621) nitrate reductase (Napoli et al. (1990) Plant Cell 2: 279-289) and chalcone synthase (Muller et al., (1990) Mol. Gen. Genet. 224: 136-146). It has been reported that transforming Russet Burbank potato plants with either sense or antisense constructs of the virus coat protein gene that causes potato leaf scrolling confers resistance to the infection of the virus causing said leaf scrolling (Kawchuk et al. (1991) Mol. Plant Microbe-Inter. 4: 247-253.

The transfer of a homologous sense or antisense sequence usually results in transformants with attenuated endogenous gene expression. As described in the examples in the Examples, transformed potato plants exhibit a phenotype that indicates diminished GLTP or GHTP expression.

In antisense-suppression, a gene construct or expression cassette is constructed which, when incorporated into a plant cell, results in the expression of RNA, which is a complementary sequence to the mRNA produced by the target gene. Theoretically, it is possible that • 9 • 9

998 99 • 9 · 9

9 9 9

9

9 9

99

9 9 9

9 9 9 »

The complementary RNA sequence forms a duplex, thereby inhibiting protein translation. The theory of promoting sense and antisense inhibition is described in the literature including Antisense Research and Applications (CRC Press, 1993), pp. 6-1. 125-148. The complementary sequence may be equivalent in its entire length to the entire sequence of the target gene, but it is preferable and easier to use the fragment in the work. For example, in Cannon et al. (1990) Plant Molecular Biology 15: 39-47 the author describes the coding sequence as a short fragment containing 41 bp that is sufficient to achieve gene inhibition. U.S. Patent No. 5,585,545 (Bennett et al., Dec. 17, 1996) discloses the inhibition of a gene coding sequence that contains only 20 base pairs. Many patents can be found in patent documents that describe and claim protection for a method of suppressing gene expression by introducing a coding sequence into an organism. Such patents include, for example, U.S. Patent No. 5,545,815 (Fisher et al., Aug. 13, 1996) and U.S. Patent No. 5,930,198.

No. 5,387,757 (Bridges et al., Feb. 7, 1995).

Suppression of gene expression dependent on the homology of the anticoding sequence is performed in a manner similar to antisense-suppression, except that the nucleotide sequence is incorporated into the expression cassette in the normal sense orientation. A number of patents including US Patent Nos. 5,034,323, 5,231,020 and 5,238,184 disclose the introduction of an anti-coding sequence, resulting in suppression of gene expression.

Both forms of homology-dependent gene expression suppression, whether in sense- or antisense-suppression, can be used to down-regulate the expression of the GLTP or GHTP enzymes of the invention. For example, both U.S. Patent No. 5,585,545 (Bennet et al., Dec. 17, 1996) and U.S. Patent No. 5,451,514 to Boudet et al.

September 15, 1995) claim protection for methods of inhibiting gene expression or recombination of DNA sequences that can be used to suppress gene expression.

♦ ·· ·· · ♦ 99 '··· ···· · »· ·· · 4 9 9 9 9 ¹ ··· · · · ·« «·« ··

2. Alternative methods for reducing the activity of the GHTP and / or GLTP enzyme in tubers

Although sequence-dependent expression suppression is the preferred method of attenuating GLTP or GHTP enzyme activity in potato plants of the invention, there are a number of commonly used alternative strategies available that attenuate the activity of a specific gene product. When a related gene or promoter is introduced into a plant, rapid conversion of homologous endogenous transcripts can be induced. This process is called co-suppression and is evident to be similar to the mechanism responsible for inhibiting antisense RNA (Jorgensen, RA, (1995) Scienec 268: 686-691; Brusslan and Tobin (1995) Plant Molecular Biology 27: 809-813 ). Various regulatory DNA sequences (promoters, polyadenylation signals, post-transcriptional processing sites) may be altered, or may be used to alter the expression level (enhancer, silencer) of a specific mRNA. Another strategy for attenuating the expression of a gene and its encoded protein is to use ribozymes that are designed to specifically cleave the target mRNA, making it impossible to produce a fully functional protein (Hasselhoff, J. and W.L. Gerlach (1988) Nature 334: 585-591). The identification of naturally occurring alleles or the development of enzyme alleles by genetic engineering methods, which have been found to be important in determining a particular property, may alter the potency of activity and may also be achieved by classical breeding methods (Ortiz and Huaman, Z. (1994) In Bradshaw, JE and Mackay GR (eds.) Site-directed mutagenesis is often used to alter the activity of a particular gene product, mutagenesis of the structural coding sequence of the phosphorylase enzyme may occur in E. coli or other suitable hosts and may occur. Alternatively, naturally occurring phosphorylase alleles with reduced affinity and / or specific activity may be identified.

* φ φ φ φ φ změnit změnit změnit změnit změnit změnit za za za za za za za za za za za za za za za za za za za za za za za za za za za za za za za za za změnit za These procedures are commonly used and described in various protocols such as Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2 ^nd Ed. Cold Spring Harbor Laboratory Press, NY.

3. Variants of GLTP and GHTP enzymes and sequences used to suppress expression dependent on sequence homology

As described in the Background of the Invention and in publications (Nakano, K. and Fukui, T. (1986) J. Biol. Chem. 266: 8230-8256; Sea et al., (1991) J. Biol. Chem. 266: 1844618453; Sonnewald et al., (1995) Plant Molecular Biology 27: 567-576) there are three known isozymes of aglucan phosphorylase in potatoes. The invention discloses attenuating the activity of GLTP and / or GHTP isozymes. While the GLTP and GHTP genes of all known commercial potato varieties appear to be substantially identical, the principles and methods of the invention are expected to be effective in potato plants having different full length polynucleotide sequences or subsequences that encode polypeptides that encode polypeptides that exhibit the enzymatic activity of the disclosed GLTP and GHTP starch catabolizing enzymes. The terms "GLTP and" GHTP include the variants described above. These variants may include GLTP or GHTP nucleotide sequence variants that differ from said sequences but still encode the same polypeptide due to codon degeneration, as well as variants that encode proteins recognized by antibodies against the GLTP and GHTP amino acid sequences set forth in SEQ ID NO. : aa 4.

Similarly, one of ordinary skill in the art will recognize that suppression of gene expression dependent on sequence homology may be accompanied by coding or anticoding sequences other than those exemplified. First, the region of the GHTP or GLTP sequence of the cDNA from which the coding sequence is derived is not essential. Secondly, as mentioned above, the length of the coding sequence used may vary substantially. Furthermore, it is not necessary that

99

9 9 9

9 99 9 9 9 9 9 9 9

9 9 9

9 9 9

9

The 99 anticoding or coding sequences were identical to those of the GLTP or GHTP target gene whose expression is to be suppressed. As described in the examples, it has been observed that transformation of potato plants with DNA encoding sequences derived from the GHTP gene not only causes substantial suppression of GHTP gene activity, but also contributes to suppression of GLTP gene activity. The coding sequences of the GHTP and GLTP genes are 56.8% identical. The sequence identity between the GLTP coding sequence and the corresponding α-glucan leaf phosphorylase sequence described in Sonnewald et al., (1995) Plant Molecular Biology 27: 567-576 is 71.3%. It has been found that to date no cross-fading phenomenon has been observed when potato plants have been transformed with DNA encoding sequences derived from the GLTP gene. These results clearly show that the absolute sequence identity between the target endogenous α-glucan phosphorylase gene and recombinant DNA is not essential. This suggests that GLTP enzyme activity is suppressed by a coding sequence that shows approximately 57% identity to the GLTP target sequence. One skilled in the art will appreciate that anti-coding or coding sequences other than those disclosed herein and those that exhibit absolute identity to the target endogenous GLTP or GHTP gene sequence are effective in suppressing the endogenous GLTP or GHTP gene when incorporated into potato plant cells. Useful anticoding or coding sequences may differ from the examples of coding sequences or other sequences derived from the endogenous GHTP or GLTP gene sequence by conservative amino acid substitutions or differences in percent of paired nucleotides or amino acid differences in sequence regions that are aligned for comparison purposes.

U.S. Patent No. 5,585,545 (Bennett et al., December 17, 1996) discusses methods for comparing polynucleotide and polypeptide sequence identity, conserved amino acid substitutions, and hybridization conditions, indicating the degree of sequence identity. Relevant parts of this discussion are summarized here.

• 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 ·

The percent sequence identity of polynucleotides and polypeptides can be determined by comparing two optimally aligned sequences in the comparison window, where part of the polynucleotide and polypeptide sequences can include additions and deletions. In order to achieve optimal alignment of the two sequences, a comparison is made with the reference sequence. The percent sequence identity is calculated by a) determining the number of positions where the same nucleic acid bases or the same amino acid residues appear in both sequences to obtain the number of matched positions;

(b) the number of matched positions shall be divided by the total number of positions in the comparison window; c) multiply the result by 100 to obtain a sequence match value. Optimal alignment of sequences for comparison can be performed on a computer by a known algorithm (e.g., GAP, BESTFIT, FASTA, and TFASTA) using the Wisconsin Genteics Software Package, Gentics Computer Group (GCG), 575 Science Dr., Madison, WI or BlastN and BlastF may provide the National Center for Biotechnology Information) or sequential scans.

Polypeptides that are substantially similar share sequences as described above. The positions of residues that are not the same can vary by conservative amino acid changes. Conservative amino acid substitutions refer to the internal interchangeability of residues having similar side chains. The group of amino acids having aliphatic side chains includes glycine, alanine, valine, leucine and isoleucine. A group of amino acids having aliphatic hydroxyl side chains include serine and threonine. A group of amino acids having amide-containing side chains include asparagine and glutamine. The group of amino acids having aromatic side chains includes phenylalanine, tyrosine and tryptophan. The group of amino acids containing basic side chains includes lysine, arginine and histidine. A group of amino acids having sulfur in the side chains include cysteine and methionine.

* · · ♦ ♦ · * * * * * * * * * * * ·· • ♦ ·· ··

Another sign of substantial identity of nucleotide sequences is when two substantially identical molecules specifically hybridize to each other under stringent conditions. Stringent conditions depend on the sequence and will vary according to circumstances. Generally, stringent conditions are about 10 ° C below the melting point (T _m ) of a specific sequence at a defined ionic strength of the solution and a defined pH. T _m is the temperature (at a defined ionic strength of the solution and pH) at which 50% of the target sequence hybridizes to the fully matched probe. T _m of the hybrid, which is a function of the length and base composition of the probe, can be calculated in a manner which is described in Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2 ^nd Ed. Cold Spring Harbor Laboratory Press, NY. Typically, stringent conditions in the Southern blot protocol include washing at 65 ° C 0.2 x SSC. Preferred wash conditions for oligonucleotide probes are approximately 42 ° C and 6 x SSC solution.

4. General methods

Various methods are used to introduce and express the foreign DNA sequence into plant cells. Said methods comprise preparing the cDNA encoding the α-glucan phosphorylase enzyme and introducing it into the plant cell. 1) mRNA is isolated from potato plants and cDNA is prepared therefrom; 2) testing the presence of the desired sequence in the cDNA; 3) to express the phosphorylase genes to the desired cDNA, the promoter is joined in the opposite orientation; 4) the host plant cells are transformed with the construct; 5) selecting and regenerating cells that transcribe reverse sequences.

DNA derived from GLTP and GHTP genes from potatoes is used to create expression cassettes that exhibit a plant promoter operably linked to a coding DNA sequence that, when transcribed in a plant, inhibits expression of an endogenous GLTP gene or a GHTP gene. As a transfer tool

-2 · · · ♦ © © © © 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 99 99 999

DNA for stalk explants of potato plant shoots is used by Agrobacterium tumefaciens microorrhagism. The plant resulting from the transformed explants transcribes the coding DNA which inhibits the activity of the enzyme.

The genetic engineering methods described herein are well known in the art and are described in standard publications such as Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2 ^nd Ed. Cold Spring Harbor Laboratory Press, NY. Generally, enzymatic reactions that include DNA ligase, DNA polymerase, restriction endonucleases and the like are performed according to the manufacturer's specifications.

5. Preparation of GLTP and GHTP cDNAs are prepared from isolated mRNA from potato tubers by reverse transcription. The primer binds to the mRNA and the free 3 'end can then be used to extend the sequence with the reverse transcriptase enzyme. The enzyme participates in the usual 5 '-> 3' elongation, which is controlled by complementary pairing of bases with the template mRNA to form a hybrid molecule. This molecule contains a template strand basically RNA paired with a complementary strand of cDNA. After degradation of the original mRNA, DNA polymerase was used to synthesize the complementary DNA strand, thereby converting single stranded cDNA and duplex DNA.

After amplification of the DNA, double stranded cDNA is inserted into the vector to increase the amount of said DNA in E. coli. Typically, clones that carry the desired cDNA are identified by either nucleic acid hybridization or immunological detection of the encoded protein when using an expression vector. This method can be simplified if the DNA sequences of the GLTP and GHTP genes are known, as are the sequences of suitable primers (Brisson et al. (1989) The Plant Cell 1: 559-566; Fukui et al., 1991). The primers used hybridize to the GLTP and GHTP genes. The amplified cDNAs are expected to represent portions of the GLTP and GHTP genes without being 9 9 99 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 9 99

9 * 99

9 9 9

9 9 9 9 • 9

99 further analysis. E. coli transformed pUC19 plasmids carrying a DNA phosphorylase insert were detected by color selection. The correct E. coli transformed plasmids that do not carry inserts grow like blue colonies. Strains transformed with pBluescript plasmids carrying inserts grow as white colonies. To confirm the presence of phosphorylase inserts, plasmids isolated from transformed E. coli bacteria were sequenced.

6. Construction of vector

The prepared cDNA was inserted upstream or downstream into an expression cassette in expression vectors intended for transformation of potato plants to inhibit GLTP and / or GHTP gene expression in potato tubers.

In the case of antisense-suppression, the recombinant vector of interest comprises an expression cassette designed to initiate transcription encoding cDNAs in plants. Additional sequences are included that allow the vector to be cloned in a bacterial or phage host.

Preferably, the vector will contain a prokaryotic origin of replication having a wide host range. A selectable marker may also be used, allowing the selection of bacterial cells that carry the desired construct. Suitable prokaryotic selection markers include resistance to antibiotics such as penicillin.

As is known in the art, other DNA sequences encoding additional functions may also be present in the vector. For example, in the case of Agrobacterium transformations, T-DNA sequences are included for subsequent transfer to plant chromosomes.

For expression in plants by recombination, the expression cassette will contain, in addition to the desired sequences, a plant promoter region, a transcription initiation site (if the sequence to be overwritten does not contain it), and an end sequence transcription. At the 5 ' and 3 ' ends of the cassette there are only restriction enzyme sites that allow for easy insertion into an existing vector. Sequences that direct the expression of a eukaryotic gene are well known in the art.

The transcription of DNA into mRNA is regulated by a region of DNA called the pormotor. The promoter region contains base sequences that signal RNA polymerase to attach to DNA and thereby initiate mRNA transcription, one of the DNA strands being used as a template. A corresponding RNA strand is formed. The promoter sequence elements include a TATA box (TATAAT sequence), which is typically located 20 to 30 bp (bp) upstream (according to the convention of -30 to -20 bp relative to the transcription start site) from the transcript start site. In most cases, the presence of a TATA box is required to properly initiate the transcript. A TATA box is only the promoter element upstream, whose position is relatively stable relative to the start point.

The CAAT box sequence is located at -75, but can operate at different distances from the start point and in any orientation.

Other common promoter elements are the GC box at position -90, which contains the sequence GGGCGG. It can appear in multiple copies and in any orientation.

Other tissue specificity sequences respond to environmental signals, or maximal transcription efficiency can also be found in the promoter region. Such sequences are often 400 bp from the transcriptional start site, but may be up to 2000 bp or more. In heterogeneous promoter / structural gene combinations, the promoter is preferably located at approximately the same distance from the heterogeneous transcriptional start site as it is from the natural transcriptional start site. There may be some variation at this distance without loss of promoter function.

· · · · 44 · 4

4, 4, 4, 4, 4, 4, 4, 4, 4, 44444, 44444 promoters, tissue promoter (Bevan et al., 4638)

The particular promoter used in the expression cassette is not critical to the invention. Any number of promoters that control transcription in plant cells are suitable. The promoter may be either constitutive or inducible.

A number of promoters that are active in plant cells are described in the literature. These include the promoters of nopaline synthase (NOS) and octopine synthase (OCS) (found on Agrobacterium tumefaciens tumor-causing plasmids), caulimovirus promoters such as the Cauliflower mosaic virus (CaMV) 19S and 35S promoters and the 35S mosaic moth virus, induced from the small subunit ribulose-1,5-bis-phosphate carboxylase (ssRUBISCO, a frequently occurring plant polypeptide), the promoter of the chlorophyll a / b binding protein gene, etc. All these promoters are used in the preparation of various types of constructs that are expressed in plants, as described, for example, in PCT publication WO8402913.

The CaMV 35S promoter used herein in the Examples has been shown to be highly active and constitutively expressed in most of the Nucleic Acid Res. 14 (11): 4625 A number of other genes that are potato tuber specific or enhance expression are known. These include ADPGPP genes found in potato tubers, large and small subunits (Muller et al., (1990) Mol. Gen. Genet. 224: 136-146). Other promoters that can be used according to the invention include those that exhibit enhanced or specific expression in potato tubers and which are normally associated with the expression of modified or starch biosynthesis enzyme genes, or that exhibit different expression patterns, or are expressed at different times over time tuber development. Examples of such promoters include granule-bound starch synthase or other forms thereof, promoters of branching enzyme genes (Blennow, et al., (1991) Phytochemistry 30: 437-444; WO 9214827; WO

9211375), disproportionate enzyme genes (Takaha et al., (1993) J.

Biol. Chem. 26 8: 1391-1396), branching-removing enzyme genes, amylase gene, starch phosphorylase gene (Nakano et al., (1989) J. Biochem. 106: 691-695; Moi et al., (1991) J. Biol. Chem. 266: 18446-18453), the pectin esterase gene (Ebbelaar et al., (1993) Int. Symp. On Gen. Manip. Of Plant Metabolism and Growth, 29-31 March, Norwich UK Abstract # 9), the glycoprotein gene. having a molecular weight of 40,000; the ubiquitin gene, the aspart proteinase inhibitor gene (Stukerlj et al., (1990) Nucl. Acids Res. 18: 46050), the carboxypeptidase inhibitor gene, the tuber polyphenol oxidase gene (Shahar et al., (1992) Plant Cell 4: 135-147 GenBank deposit numbers M95196 and M95197), a putative trypsin inhibitor gene or other tuber cDNA (Stiekema et al (1988) Plant Mol. Biol. 11: 255-269) and amylase and sporamine genes (Yoshida et al., (1992) Genegank); 10: 255-259; Ohta et al., (1991) Mol. Gen. Genet. 225: 369-378).

In addition to the promoter sequence, the expression cassette may also include a transcriptional termination region that is located downstream of the structural gene to effect its efficient termination. The transcriptional termination region may be obtained from the same gene as the promoter sequence or may be derived from different genes. In the examples, the 3 'terminal sequence of nopaline synthase NOS is used (Bevan et al., (1983) Nature (London) 304: 184-187).

Polyadenylation sequences are also commonly added to vector constructs if the mRNA encoded by the structural gene is to be translated effectively (Alber and Kawasaki, (1982) Mol. And Appl. Genet. 1: 419-434). Polyadenylation is believed to have an effect on mRNA stabilization. Polyadenylation sequences include, but are not limited to, the octopine synthase signal of Agrobacterium (Gielen et al., (1984) EMBO J. 3: 835-846) or the octopine synthase signal (Depicker et al., (1982) Mol. And Appl. Genet 1: 561-573).

The vector typically also contains a selectable marker gene on the basis of which it can be determined in culture

transformed plant cells. Typically, the marker gene encodes antibiotic resistance. These markers include resistance to G418, hygromycin, bleomycin, kanamycin, and gentamycin. In the examples, a marker gene that confers resistance to kanamycin is used. After transformation of plant cells, these vector-containing cells will be identified by their ability to grow in a culture medium containing certain antibiotics.

7. Transformation of plant cells

Although in the examples the stem explants of potato plant shoots were transformed by inoculation with Agrobacterium tumefaciens carrying a coding sequence associated with a binary vector, direct transformation methods known in the art can also be used to transfer recombinant DNA. The vector can be introduced by microinjection directly into plant cells. Alternatively, the nucleic acids may be introduced into the plant cell by high-speed ballistic penetration in the form of small particles having a nucleic acid embedded in the particle matrix or on its surface. A fusion of protoplasts with a particle having a lipid on its surface, such as minicells, cells or lysosomes carrying DNA, may be used. DNA can also be introduced into plant cells by electroporation, where the protoplasts of the plants are treated by electroporation in the presence of plasmids carrying an expression cassette.

In contrast to direct transformation methods, the examples show vector transformation using Agrobacterium tumefaciens microorganisms. The microorganism Agrobacterium tumefaciens is a gram-negative soil bacterium that causes a neoplastic disease, known in dicotyledonous plants as a crowhead. Tumor induction is caused by plasmids known as Ti plasmids. These plasmids direct opine synthesis in infected plants. Agrobacteria use opines as a carbon source.

Bacteria do not enter the plant, but only transform a portion of the Ti plasmid, called T-DNA, that stably integrates into the plant genome where the functions required for opine synthesis and plant cell transformation are expressed. Virus genes (virulence) on Ti plasmids that are outside the T-DNA region are essential for T-DNA transfer. However, the virus area is not transmitted. In fact, the viral region, although necessary for T-DNA transfer, may not be physically associated with T-DNA and may reside on a separate plasmid.

Tumor-inducing T-DNA portions can be disrupted or deleted without losing the functions that ensure transmission and integration. Therefore, normal and healthy transformed plant cells may arise which have lost all the properties of the tumor cells but still carry and express certain regions of T-DNA, especially the T-DNA border regions. Therefore, modified Ti plasmids from which disease-causing genes have been deleted can be used in potato plants as vectors for the transfer of the anticoding and coding gene constructs of the invention (Winnacker, Ernst L. (1987) From Genes to Clones. VHC Verlagsgesellshaft mbH, Federal Republic) of Germany).

Transformation of plant cells with Agrobacterium microorrhizal and the formation of whole plants typically involves either co-cultivation of Agrobacterium microoragism with cultured isolated protoplasts or transformation of undamaged cells or tissues with Agrobacterium microorrhizal.

In the examples, stem explants from potato sprout cultures are transformed with Agrobacterium microorganism.

Alternatively, cauliflower mosaic virus (CaMV) can be used as a vector to introduce anticoding or coding DNA into plants of the Solanaceae family. US Patent No. 4,407,956 (Howell, Oct. 4, 1983) describes, for example, the use of cauliflower mosaic DNA as a plant tool.

• · · · · · · · · · ···

8. Selection and regeneration of transformed plant cells

After transformation, transformed plant cells or cells carrying coding or anticoding DNA must be selected. Typically, a selection marker such as antibiotic resistance is used. In the examples, transformed cells were selected based on growth on kanamycin-containing culture medium. One skilled in the art will appreciate that other selection markers may be used.

Where plants are transformed with Agrobacterium, opines may be used to determine transformants. The expression of the foreign DNA can be confirmed by detecting RNA encoded by the included DNA using well known methods such as northern blot hybridization. The DNA sequence itself can be determined by Southern blot hybridization or polymerase chain reaction (Sambrook et al. (1989) Molecular Cloning, A Laboratory Manual, 2 ^nd Ed. Cold Spring Harbor Laboratory Press, NY).

Generally, upon finding that the transformed plants carry recombinant DNA, whole plants are regenerated.

In the examples, stem and leaf explants of potato shoot cultures were inoculated with a culture of Agrobacterium tumefaciens which carries the desired coding DNA and kanamycin marker gene. Transformants were selected based on growth on kanamycin-containing culture medium. After transfer to a culture medium suitable for shoot induction, the shoots were transferred to a growth medium suitable for rooting. The plants were then transferred to the soil and hardened. Plants regenerated in culture were transplanted and matured under greenhouse conditions.

9. Analysis of GHTP and GLTP enzyme activity in transformed tubers After regeneration of potato plants transformed with DNA coding sequences derived from the GHTP and GLTP genes, the biochemistry of transformed tuber tissue was examined in several ways. By the method of Steup (Steup, M. (1990) Starch Degrading Enzymes in

"Methods in Plant Biochemistry Vol 3, P.M. Dey and Harborne (eds. Academic Press, London) (Table 1) examined the in vitro phospholytic activity of α-glucan phosphorylase. After electrophoretic separation of enzyme isoforms on a glycogen-containing polyacrylamide gel (Figure 7), the synthetic activity of the enzyme and the amount of enzyme protein were compared. Starch synthesis using L and H isoforms was determined after incubation of glucose-1-phosphate with a starch primer by iodine staining (Steup, M. (1990) Starch Degrading Enzymes in "Methods in Plant Biochemistry Vol. 3 PM Dey and Harborne, eds."). Academic Press, London). Western analysis was performed by transferring protein from the same non-incubated native gel and contacting polyclonal antibodies that are specific for isoforms of H-type and H-type tuber phosphorylase. The amount of reducing sugars (glucose and fructose) in tuber tissue was quantified by HPLC (Table 2). , 3 and 4). The extent of the Maillard reaction, which is proportional to the concentration of reducing sugars in the tubers, was determined by determining the score of the chips after frying (Table 5 and Figure 9).

10. Definitions

The term "about three months," about four months, and "about six months" means a period of three months plus or minus two weeks, a period of four months plus or minus two weeks and a period of six months plus or minus two weeks.

The term "antisense orientation" refers to the orientation of a nucleic acid sequence from a structural gene that is incorporated into an expression cassette in the opposite manner with respect to its natural orientation. When the sequence is double-stranded, the strand, which is a naturally occurring template strand, becomes the coding strand and vice versa.

The term 'tuber flakes score' means measuring the reflection in the center of sliced potato chips fried at 96,1 ° C to

soybean oil for about 3 minutes until no more bubbles are formed. The values are recorded on a Direct Reading Abridged Spectrophotometer model E15-FP from Agtron (Agtron Inc. 1095 Sleep Island Drive # 100, Sparks Nevada 89431).

The term "low temperature storage or variations of said term" means the storage of tubers at a temperature below 10 ° C which can be achieved by cooling or ambient temperature.

The term "endogenous in association with the potato plant phosphorylase genes" refers to a naturally occurring gene that is present in the potato plant genome prior to the introduction of an expression cassette that carries the DNA sequence derived from the α-glucan phosphorylase gene.

The term "expression" means transcription and translation of a structural gene such that protein synthesis occurs.

The term " heterogeneous sequence or " heterogeneous expression cassette is a sequence or cassette originating from a foreign species or, when it originates from the same species, differs substantially from the original form.

The term "improvement in low temperature storage characteristics includes, without limitation, improvements in chip score and reduction in accumulation of sugars in tubers, as measured at harvest or after storage at temperatures below 10 ° C, and further includes improvements and benefits that may may arise when potatoes are stored at temperatures lower than those used in traditional storage methods. These benefits include prolonged potato shelf life, prolonged vegetative rest periods through reduced respiration and potato germination suppression, and reduced disease incidence. If the evaluation is not performed by specific measurement or test, the improvement of the low temperature storage characteristic is the difference of the characteristics described with respect to the control, unaltered potato or wild-type potato plant.

The term "altered or variant of that term is used when potato or tuber plants are used to distinguish a potato or tuber plant that has changed and therefore differs from a naturally occurring tuber or plant by introducing into it a nucleotide sequence from of the same or different species, either in sense or antisense orientation, either by genetic engineering or by traditional plant breeding methods which involve the introduction of an altered structural or regulatory sequence; altering the natural nucleotide sequence by site-directed mutagenesis or otherwise; or treating the potato plant with a chemical or protein inhibitor. The term "unchanged potato plant" means a control, naturally occurring or wild-type or tuber plant that has not been altered as described above.

The term "nucleic acid sequence or nucleic acid segment" is a single-stranded or double-stranded polymer of deoxyribonucleotide or ribonucleotide bases read from the 5 'to the 3' end. Includes self-replicating plasmids, infectious DNA or RNA polymers and non-functional DNA or RNA.

The term "operably linked" refers to a functional link between a promoter and a second sequence, wherein the promoter sequence initiates transcription of the RNA of the corresponding second sequence.

The term "plant" includes the whole plant, plant organs (i.e. leaves, stems, roots, etc.) seeds and plant cells. The term "promoter" refers to a region of DNA from a structural gene upstream and is involved in the recognition and binding of RNA polymerase and other proteins, which initiates transcription. The term "plant promoter" means a promoter capable of initiating transcription in plant cells.

The term "reduced activity or variants thereof" means GLTP or GHTP enzymatic activity in potato tuber, which includes a decrease in GLTP or GHTP activity resulting from attenuated expression of a GLTP or GHTP gene product, reduced by the expression of a GLTP or GHTP gene product. Substrate affinity of GLTP or GHTP and decreased catalytic activity of GLTP or GHTP.

The term "reduced or variants thereof" may be used without limitation in connection with the level of GLTP or GHTP enzyme activity in potato tubers and the darkening of potato chips during frying.

Unless further qualified by a specific measurement or assay, reduced amount or decreased activity means a demonstrable statistically significant difference in the described characteristic relative to that of a control, unmodified potato or wild-type plant.

The term "stress, or variants thereof," is used in conjunction with a stress effect on potato and tuber plants that include environmental effects, fertility, moisture, temperature, processing, disease, atmospheric conditions and aging, which is reflected in plant and tuber quality. These conditions may affect plants at all stages of the plant life cycle and tubers at all stages of growth and development and during subsequent harvesting, transport, storage and processing.

The term "stress resistance or variants thereof" means reducing the effect of temperature, aging, disease, physical processing, moisture, chemical residues, the environment, pesticides and other stresses.

The term "suitable host" means a microorganism or cell that is compatible with a recombinant plasmid, a DNA sequence, or a recombinant expression cassette and allows the plasmid to replicate to be incorporated into its genome or to express it.

The term "uninterrupted" means a DNA sequence (e.g., cDNA) containing an open reading frame that lacks internal untranslated sequences.

Overview of the drawings

44 44 44

4 4 4 4 4 5

4 4 4 4 4

4. ········ · ··· 4 · 44 44 ·· ··

Figure 1 is a schematic representation of the coding sequence of the L-type glucan phosphorylase incorporated into the transformation vector pBI121.

Figure 2 is a schematic representation of the coding sequence of the H-type glucan phosphorylase incorporated into the transformation vector pBI121.

Figure 3 shows the basic structure of the three isolated isoforms of glucan phosphorylase. The transit peptide (TS) and insert sequence is characteristic of L-type phosphorylase and is not found in H-type phosphorylase. Percentages show nucleic acid sequence homology between isoforms.

Figure 4 is a schematic representation of the internal conversion of sugars in potatoes.

Figure 5 shows a comparison of the amino acid sequences of the three phosphorylase isoforms found in potatoes to identify regions to which the antisense GLTP construct used in the examples can be directed. Identical amino acids are shown in bold. The amino acid sequence of α-glucan L-type phosphorylase (GLTP) is shown above (amino acids 21 to 238 of SEQ ID NO: 6), the amino acid sequence of α-glucan L-type phosphorylase (GLTP) is shown in the center (amino acids 49 to 266) SEQ ID NO: 2) and the amino acid sequence of H-type tuber phosphorylase H (GHTP) is at the bottom (amino acids 46 to 264 of SEQ ID NO:

4).

Figures 6A and 6B show the nucleotide sequence alignment of the three phosphorylase isoforms found in potatoes to identify regions to which the antisense GLTP construct used in the examples can be directed. Corresponding nucleotides are indicated in bold. The nucleotide sequence of α-glucan L-type leaf phosphorylase (GLTP) is shown

99

9 9 9

9 (9) at the top (nucleotides 389 to 1045 of SEQ ID NO: 5), the nucleotide sequence of α-glucan L-type phosphorylase (GLTP) is shown in the center (nucleotides 338 to 993 of SEQ ID NO: 5). ID NO: 1) and the nucleotide sequence of the tuber phosphorylase of aglucan type H (GHTP) is at the bottom (nucleotides 147 to 805 of SEQ ID NO: 3).

Figure 7 is a Northern blot of polyadenylated RNA isolated from wild-type potato tubers and lines 3,4,5 and 9 transformed with tuber α-glucan phosphorylase type L (GLTP). The blot hybridized to a radiolabeled probe that is specific for tuber α-glucan phosphorylase type L (GLTP).

Figure 8 shows northern transfer of total RNA isolated from wild-type potato tubers and H-transformed lines 1 and 2. The blot was hybridized with a probe that is specific for H-type α-glucan phosphorylase (GHTP).

Figure 9 is a fried product obtained from (A) wild-type potatoes and transformants by tuber L-type aglucan phosphorylase, (B) ATL1, (C) ATL3, (D) ATL4, (E) ATL5, (F) ATL9 to field growing tubers after 86 days storage at 4 ° C (ATL stands for antisense tuber transformant of Ltype).

Figure 10 shows the gel activity and western blot of the L-type and H-type 1,4-glucan isosymes extracted from wild-type tubers and tubers transformed with the antisense type L isoform construct.

Figure 11 shows the gel activity and western blot and H-α-1,4-glucan phosphorylase of the extracted type and from tubers transformed with α-glucan phosphorylase with radiolabeled L-isozymes from wild-type H isoform constructions.

DETAILED DESCRIPTION OF THE INVENTION Embodiments of the invention

·· ··

Example 1

This example describes reducing the activity of the GHTP and / or GLTP enzyme in potato tubers by transforming it with expression cassettes containing DNA sequences derived from the GLTP and GHTP gene sequences linked to the promoter in an antisense orientation.

A. Isolation of potato tuber mRNA

Total potato RNA was isolated at 4 ° C using autoclaved reagents. It comes from 1 g of tuber tissue pulverized to a fine powder in liquid nitrogen in a pestle with a pestle. The powder was transferred to a 30 ml corex tube and 100 mM Tris-Cl, pH8.0, 100 mM NaCl and 10 mM EDTA (10x TNE) containing 0.2% (w / v) SDS and 0.5% were added. (v / v) 2-mercaptoethanol. An equal volume of phenol chloroform (1: 1) was added to the mixture, and the sample was gently vortexed and then centrifuged at 4 ° C on an SS34 rotor at 8,000 rpm. for 5 minutes. The organic phase was extracted again with 0.5 volumes of 10 x TNE containing 0.2% (w / v) SDS and 0.5% (v / v) 2-mercaptoethanol and the combined aqueous phases were extracted with chloroform. Nucleic acids precipitated from the aqueous phase with sodium acetate and absolute ethanol. A pellet was formed by centrifugation and resuspended in 3 ml 1x TNE. An equal volume of 5 M LiCl was added and the samples were stored at -20 ° C for 4 hours and then centrifuged at 8,000 rpm. on an SS34 rotor at 4 ° C for 10 minutes. The RNA pellet was washed with 70% ethanol, dried and resuspended in DEPC-treated water.

The (A ⁺ ) RNA poles were isolated using oligo (dT) cellulose (Boehringer Mannheim) column chromatography. The (A ⁺ ) RNA poles were isolated from total RNA resuspended in water without the RNase enzyme present. Columns were prepared using a 10 ml autoclaved Bio-Rad Poly-Prep column to which 50 mg of cellulose oligo (dT) in 1 ml of Buffer B was added.

I 4 »<

• 9 »9 99» 9 9 »9 9 4 ·· 99

999 999

9

99 contains 20 mM Tris-Cl, pH7.4, 0.1M NaCl, 1mM EDTA and 0.1% (w / v) SDS. The column was washed with 3 volumes of 0.1 M NaOH with 5 mM EDTA and then with DEPC-treated water so that the pH of the effluent from the column was less than 8. The pH was determined by paper. The column was then washed with 5 volumes of Buffer A containing 40 mM Tris-Cl, pH 7.4, 1 M NaCl, 1 mM EDTA and 0.1% (w / v) SDS.

RNA samples were heated at 65 ° C for 5 minutes. At this time, 400 µl of Buffer A, which had been preheated to 65 ° C, was added. the sample was mixed and allowed to cool to room temperature for 2 minutes and then applied to another column. The eluate was collected and heated to 65 ° C for 5 minutes, cooled to room temperature for 2 minutes, and loaded onto the column again. Then the column was washed with 5 volumes of Buffer A followed by a wash with Buffer B. Poles of (A ⁺ ) RNA were eluted with 3 volumes of 10 mM Tris-Cl, pH7.4, 1 mM EDTA and 0.05% (w / v) SDS. . Fractions were collected and those containing RNA were determined using an ethidium bromide assay. This assay was performed on 1% agarose petri dishes prepared in TAE buffer containing EtBr. RNA was precipitated, resuspended in 10 µl and the amount of RNA in 1 µl was determined by spectrophotometer.

B. Isolation of GLTP and GHTP DNA Sequences

The nucleotide sequences used in the development of the antisense construct were randomly selected from the 5 'sequence of the GLTP enzyme (SEQ ID NO: 1) and GHTP (SEQ ID NO: 3). The DNA sequences used in the development of antisense sequences were obtained by reverse transcriptional polymerase chain reaction. Specific primers for GLTP (SPL1 and SPL2) and GHTP (SPH1 and SPH2) were designed and designed according to published sequences (Brisson et al., (1989) The Plant Cell 1: 559-566; Fukui et al., 1991) with only minor changes to allow restriction enzyme cleavage:

• 9 0

9 0 9 • 09

9

99

Primer SPL 1: 5 'ATTCGAAAAGCTCGAGATTTGCATAGA3' (SEQ ID NO: 7) (in addition, GC forms a site recognized by the restriction enzyme XhoI).

Primer SPL 2: 5'GTGTGCTCTCGAGCATTGAAAGC3 '(SEQ ID NO: 8) (when C was exchanged for G, a Xhol site recognized by the restriction enzyme) was formed.

Primer SPH1: • 5 'GTTTATTTTCCATCGATGGAAGGTGGTG3' (SEQ ID NO: 9) (CGAT sequence added and a restriction enzyme recognition site Cla1 was created).

Primer SPH2: 5 'ATAATATCCTGAATCGATGCACTGC3' (SEQ ID NO: 10) (G was exchanged for T to create a site recognized by the restriction enzyme Cla1).

Reverse transcription was performed in a total reaction volume of 15 µl containing 1x PCR buffer (10 mM Tris-Cl pH 8.2, 50 mM KCl, 0.001% gelatin, 1.5 mM MgCl 2), 670 µM each dNTP, 6 µg total Russet Burbank potato tuber RNA, 1 mM each of SPH1 and SPL2 or SPH1 and SPH2) and 200 units of Maloney murine leukemia virus (BRL) reverse transcriptase. The reaction was carried out at 37 ° C for 30 minutes, quenched by heating to 94 ° C for 5 minutes, and allowed to cool on ice. 2.5 units of Taq DNA polymerase (BRL) were added to 35 (UL 1x concentrated reverse transcription PCR buffer). DNA was amplified on a Perkin Elmer 480 for 30 cycles with a denaturation step at 94 ° C for 1 minute, followed by a primer binding step at 56 ° C for 1 minute (SPL1 and SPL2) or at 58 ° C (SPH1 and SPH2) and then an extension step at 72 ° C for 2 minutes The PCR was terminated with a final extension at 72 ° C ° C for 10 minutes.

C. Construction of SP vectors to inhibit Tiby phosphorylase in plant cells has been expressed by coding constructs, it is necessary to fuse genes to the correct plant regulatory regions. This accompanies the cloning of the coding DNA into a plasmid vector containing the necessary sequences.

• ·· * 9 9 • 99 9 9 9 9 9 9 9 9 9 9 9 9 ·· • e 9 9 ·· • 9 • 9 • 9 9 9 9 9 · 9 9 99 99 99 99 99 99

Blunt-ended amplified DNA was cloned into the pUC19 vector using a SmaI recognition site. The recombinant plasmid was transformed into DH5a E. coli (BRL) cells. The transformed cells were plated on LB culture broth (15 g / l bacterium, 5 g / l yeast extract, 10 g / l NaCl, pH 7.3 and added 1.5% agar) containing ampicillin at 100 µg / ml . Selection of the plasmid-containing bacteria with the incorporated plant phosphorylase sequence was performed based on the color difference. The polylinker and T3 and T7 RNA polymerase promoter sequences are located in the N-terminal region of the lacZ gene fragment. PUC19 plasmids that do not contain inserts in the polylinker grow in suitable bacterial strains, such as E. coli DH5a colonies in the form of blue colonies. Color colony selection was performed by spreading 100 µl of 2% X-gal (prepared in dimethylformamide) on LB plates containing 50 µg / ml ampicillin 30 minutes before the transformants were loaded. Colonies containing plasmids that do not carry the insert will turn blue after 12-18 hours of incubation at 37 ° C and colonies whose plasmid containing inserts will remain white. The isolated plasmid was sequenced to confirm the presence of phosphorylase inserts. Sequences were determined using the ABI Prism Dye Terminator Cycle Sequencing Core Kit (Applied Biosystems, Foster City, CA), M13 universal and reverse primers, and ABI's automated DNA sequencer. The modified plasmids were isolated from 5 ml culture cultured overnight by rapid alkaline extraction (Birnboim et al. (1979) Nucleic Acids Res. 7: 1513-1523). The orientation of SPL and SPH fragments in pUC19 was determined by restriction enzyme digestion. Recombinant pUC19 and binary pBI121 vectors (Clontech) were digested, agarose gel electrophoresed, and fragments purified by gel separation as described by Thuring et al. (1975) Analytical Biochemistry 66: 213-220.

· * * * * * * * * * * * * * * • «·

The coding sequence was fused to the binary vector pBI121 by ligation. The ligation contained the vector pBI121, which had been digested with the restriction enzymes BamHI and SacI, and the SPL or SPH phosphorylase DNA product, produced by digesting the subclone pUC19 with the restriction enzyme BamHI and SacI. The ligated DNA was transformed into E. coli DH5α SCE cells and the transformed cells were plated on LB plates containing ampicillin. The nucleotide sequences encoding SPL and SPH DNA are nucleotides 338-993 of SEQ ID NO: 1 and nucleotides 147-799 of SEQ ID NO: 3. Selection of pBI121, which contains phosphorylase inserts, was performed using CAMV and NOS specific primers.

Samples 1 and 2 represent DNA fragments of L and H phosphorylase were isolated from the plate after overnight culture. These samples were inoculated into 5 ml of LB culture medium and grown overnight at 37 ° C. Plasmids were extracted by rapid alkaline extraction and DNA was introduced by electroporation into Agrobacterium tumefaciens.

The constructs were incorporated into the pBI121 vector containing the CaMV 35S promoter (Kay et al. (1987) Science 236: 1299-1302) and the 3'terminator sequence of NOS (Bevan et al., (1983) Nature 304: 184-). 187). Plasmid pBI121 contains the following well characterized DNA segments. A 0.93 kb fragment isolated from transposon Tn7, which encodes bacterial resistance to spectinomycin / streptomycin and allows selection of E. coli and Agrobacterium tumefaciens (Fling et al., (1985) Nucleic Acids Research 13 no. 19, 7095-7106) ). This fragment is linked to a chimeric kanamycin resistance gene that is expressed in plants and allows selection of transformed tissue. The chimeric gene contains a 0.35 kb cauliflower mosaic virus 35S promoter (P-35S) (Odessa et al., (1985) Nature 313, 810-812), and a neomycin type II phosphotransferase gene (NPTII) of 0, 83 kb and the 3 'untranslated region of the 0.26 kb nopaline synthetase (NOS 3') gene (Fraley et al., (1983) Porc. Natl. Acad. Sci. USA 80, 4803-4807). Another segment is the 0.75 kb large origin of replication from plasmid RK2 (ori-V) (Stalker et al., (1981) Mol. Gen. Genet. 181, 8-12). It is linked to the SalI and Pvul segment of 3.1 kb of plasmid pBR322, which contains an origin of replication suitable for E. coli (ori-322) and a site for conjugation transfer to Agrobacterium tumefaciens cells. Another fragment is the 0.36 kb Pvul fragment from plasmid pTiT37, which contains the right T-DNA border region of nopaline (Fraley et al., (1985) Bio / Technology 3, 629-635). The coding sequence was modified for expression in tubers by the gene being under the control of a constitutive tissue non-specific promoter.

D. Plant transformation / regeneration

The SPL and SPH vectors were transformed into Desiree potato cultivars as described in De Block, M. (1988) Theoretical and Applied Genetics 76: 767-774. To transform Desiree potatoes, sterile shoots of Desiree cultures were maintained in test tubes containing 8 ml of Sl culture medium (Murashige and Skoog (MS) culture medium supplemented with 2% sucrose and 0.5 g / 1 MES pH 5.7 and 6 g / l phytagar). When the plants reached a height of 5 cm, pieces of leaves were cut with one cut around the base and inoculated with a culture of Agrobacterium tumefaciens grown overnight at a 1: 1 dilution. Stem explants were cultured together for 2 days at 20 ° C in S1 culture medium (De Block, M. (1988) Theoretical and Applied Genetics 76: 767-774). The explants were then transferred to S4 culture medium (sucrose-free MS culture medium supplemented with 0.5 g / l MES pH 5, 7, 200 mg / l, 0.5 g / l PVP, 20 g / l mannitol, 20). g / l glucose, 40 mg / l adenine, 1 mg / l trans zeatin, 0.1 mg / l ΝΑΆ, 1 g / l carbenicillin, 50 mg / l kanamycin, 6 g / l phytagar) and cultured for 1 » * · 4 ·· ♦ · week and beyond for two weeks to induce callus formation.

After three weeks, explants were transferred to S6 culture medium (S4 culture medium that does not contain NAA and contains half the concentration (500 mg / l) of carbenicillin). After another two weeks of culture, the explorants were transferred to S8 culture medium (S6 culture medium containing carbenicillin). at a concentration of 250 mg / L and 0.01 mg / L of gibberellic acid (GA3) to promote germination. Sprouts began to form approximately two weeks after transfer to the S8 culture medium, which induces sprout formation. These sprouts were cut and transferred to tubes with culture medium S1 suitable for rooting. After approximately 6 weeks of root multiplication in the seasoning culture medium, the plants were transferred to the soil and gradually hardened.

Desiree plants regenerated in culture were transferred to 3.78 L pots and matured under greenhouse conditions. The tubers were harvested and allowed to be corked at room temperature for two days. All tubers greater than 2 cm in length were collected and stored at 4 ° C at high humidity.

E. Field experiments

Non-transformed controls, plants expressing the SPL construct and plants expressing the SPH construct were propagated in the field in a single replication random mode. All plants were grown side by side in the field and exposed to the same pesticide, fertilizer and irrigation regime. The tubers were harvested and stored at 10 ° C for 2 weeks, then tuber fractions were randomly selected from each line and stored at 4 ° C.

F. Analysis of sugar φφ · · · ·φ · · · «·« · «·« ·

Φ · Φ · · · · · · ·

The tubers were stored at 4 ° C, and immediately after being stored at room temperature, sugars were analyzed. From the central part of each tuber, undamaged slices were cut along the length (1 cm thick, the width was different, corresponding to the outer dimension of the tuber), so that all the tuber tissues are represented. At each harvest, slices from the center of the tuber from four tubers for each clone (3 replicates) were cut into 1 cm cubes and 15 grams of tissue were randomly selected for analysis. Glucane phosphorylase (below) and sugars were extracted with 15 ml Tris buffer (50 mM, pH 7.0) containing 2 mM sodium bisulfite, 2 mM EDTA, 0.5 mM PMSF, and 10% (w / w) glycerol, in a polytron homogenizer at 4 ° C. The extracts were centrifuged at 4 ° C (30,000g for 30 minutes) and the reducing sugars content (glucose and fructose) was measured in 10-fold diluted supernatant using high performance liquid chromatography coupled to a reflection index detector. This separation was performed at 80 ° C on an Aminex HPX 87C column (Borad) of 30 x 0.78 cm, using water at a flow rate of 0.6 mL / min as the mobile phase. Instrument calibration was performed with authentic d-glucose and d-fructose standards.

G. Analysis of α-glucan phosphophrylase activity

The tubers stored at 4 ° C were subjected to α-glucan phosphorylase and isozyme activity analysis without warming to room temperature prior to extraction and analysis. The method described in Steup, M. (1990) Starch Degrading Enzymes in "Methods in Plant Biochemistry Vol 3, P. M. Dey and Harborne, eds. Academic Press, London" was used to test in vitro phospholytic activity of glucan phosphorylase. Extract samples obtained for the analysis of sugars (above) were added to the reaction medium, which combines starch phospholysis with NADP reduction by sequential treatment of phosphoglucomutase and glucose-6-phosphate dehydrogenase.

* # »# # # # # # # # # # # # # # # # # # # # # # # # # # # # # # Stoichiometric from starch double beam length of 340 nm.

The rate of NADP reduction during the reaction is with the rate of glucose-1-phosphate substrate production. NADP reduction was monitored with a Varian Cary spectrophotometer at wavelength

The amount of protein in the extract was determined by the method described in Bradford, Μ. M. (1976) A rapid and sensitive method for quantifying microgram quantities of protein utilizing the principle of protein dye binding. Anal. Biochem. 72: 243-254.

Gels of glucan phosphorylase activity were prepared essentially as described (Steup, M. (1990) Starch Degrading Enzymes in &quot; Methods in Plant Biochemistry Vol. 3, P.M. Dey and Harborne, eds. Academic Press, London). Proteins were separated on natural polyacrylic gels (8.5%) containing 1.5% glycogen. Electrophoresis was then carried out at 80 V for 15 hours at 4 ° C). The gels were incubated for 1-2 hours at 37 ° C in 0.1 M citrate buffer with NaOH (pH 6.0) containing 20 mM glucose-1-phosphate and 0.05% (w / v) hydrolysed potato starch . The gels were washed and analyzed for western electrophoresis of proteins on polyacrylamide gels containing glycogen as described above. Proteins were electroblotted for nitrocellulose and blots were tested using polyclonal antibodies against GJTP and GLTP. Immunoblots developed with anti-rabbit secondary antibodies associated with alkaline phosphatase (Sigma).

stained with iodine solution. transfer was performed

H. Determination of color of chips

Five potato transgenic lines expressing the GLTP coding sequence, two potato transgenic lines expressing the GHTP coding sequence, a Desiree control line, and two transformed T-DNA control lines of the pBI121 vector were grown in a field in Alberta, Canada. The tubers were harvested and stored at 4 Φ · · ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ ΦΦ

ΦΦΦ · φ · · · · · φ

· ·· · · · · · · · · ·

The temperature is 10 ° C and 4 ° C. For all potato lines, the color of the chips was determined by cutting the centers from representative samples from each line and frying in soybean oil at 99.1 ° C for 3 minutes until they no longer formed.

1. Results

All tubers were harvested from plants of the same cultivar (Desiree), of the same age growing side by side under the same growth conditions. Northern analysis of tubers shows a substantial reduction in the GLTP transcript in transgenic plants that express a homologous coding transcript (Figure 5). Glucan phosphorylase assays show that activity decreased (µmol NADPH per mg protein per hour) (Table 1), which persists in transgenic plants expressing GLTP encoding DNA for at least 6 months after harvest. The results shown in Table 1 show that α-glucan phosphorylase activity in tubers stored at 4 ° C for 189 days decreased by approximately 16 to 70% relative to the wild-type control strain, depending on the transformed potato species. Activity gels and western blot analysis show specific reduction in expression for homologous enzymes and less decrease in expression for heterologous enzymes (Figure 8). Specificity to homologous products may result from differences between phosphorylases (Figure 3 and 4).

Harvest tuber analysis (day 0) shows that tubers expressing the antisense GLTP transcript exhibit up to 5 times less reducing sugars than control tubers (Table 2). Further, after 91 days of storage at 4 ° C, transformed tubers contain 28 to 39% lower concentrations of reducing sugars compared to the wild-type control strain. Glucose and fructose concentrations decreased significantly in tubers that express the GLTP coding transcript (Tables 6A and 6B). These results suggest that reduced GLTP activity slows the tubabolic conversion of starch into reducing sugars in tubers,

while the control tubers continue to accumulate sugars. The relationship between total phosphorylase activity and reducing sugar concentration is not straightforward, suggesting that certain isozyme phosphorylase may play a more important role in starch catabolism and that specific downregulation of a particular phosphorylase isozyme may be preferable to that of another isozyme and / or reducing sugars involved yet unspecified interactions.

Transgenic potato plants expressing GLTP or GHTP encoding transcripts were grown in the field and their tubers were stored at 4 ° C. The color of the chips related to the sugar content was determined before low temperature storage and after 86 and 124 days of low temperature storage. There was a significant improvement (lightening) in the color of tuber flakes from all transgenic plants that express the GLTP antisense transcript relative to the control tubers (darker color) stored under the same conditions (Table 5 and Figure 9). Also, the score of chips was improved by at least 4.3 points and 8.9 points, respectively, from desiree potato tubers that express the GLTP transcript. This was determined by measuring on a Direct Reading Abridged Spectrophotometer model E-15-FP from Agtron (Agtron Inc. 1095 Spike Island Drive # 100, Sparks Nevada 89431) following storage at 10 ° C and 4 ° C Form 86 days. GLTP transformer chip scores measured after 124 days of storage at 4 ° C improved by 44% to 89% relative to wild-type plants (Table 5).

Desiree potato cultivar is not required for the production of crisps because it contains a large amount of sugars and rapidly sweetens during storage at low temperature. However, the transformed Desiree potatoes significantly improved the color of fried chips. The greatest lightening is expected to be achieved when the method of the invention is applied to potato varieties used for commercial processing.

Analysis of tubers stored at 10 ° C and 4 ° C shows that these tubers expressing the antisense GHTP transcript give flakes that are lighter after frying than flakes from control tubers, indicating that the production of reducing sugars is lower (Table 5) . Results showing heterologous and homologous reduction of phosphorylase activity (Figures 10 and 11) indicate that the improvement may result from the reduction of one or two tuber phosphorylases. However, these results suggest that L-type phosphorylase plays a more important role in the catabolism of the conversion of starch to reducing sugars.

Furthermore, the results show that differences in the amount of reducing sugars (Table 2) and flakes score (Table 5) in wild-type and antisense RNA phosphorylase-expressing tubers persist during long-term storage. As shown in Table 5, the chip score is approximately the same 86 days and 124 days. After 49 days and 91 days of storage at 4 ° C (Table 2), no further increase in the concentration of reducing sugars is apparent. This sugar concentration equilibrium is probably related to the kinetics of tuber phosphorylases. The ability to maintain lower amounts of sugars will allow the storage period to be extended by at least several months. Currently, potatoes intended for processing are usually stored for a maximum of three to six months at a temperature of 10 ° C to 12 ° C, then the accumulation of sugars reaches a value that adversely affects their quality. The fresh product must then be imported until potatoes are available from the next harvest. The extension of the storage period will make it possible to reduce import costs. Table 6 shows the improvement of the different low temperature storage characteristics of potato tubers that have been transformed with coding DNA relative to control plants that are not transformed. This improvement is expressed as a percentage. Said coding DNA was derived from the GLTP gene sequence (ATL3-ATL9) and the GHTP gene sequence (ATH1 and ATH2). From the results shown in Table 6, it is clear that a significant improvement in the low temperature tuber cooling characteristics is

can be achieved by the method according to the invention. Particularly noteworthy are the percent improvement in chip score compared to wild-type plants achieved by storage at 4 ° C for approximately four months (124 days). There was an 89% improvement in the score of the chips compared to the wild type plants. Improved chip score values indicate a commercial use of the invention. That is, reducing the sweetness of the tubers caused by the low temperature allows storage at a lower temperature without causing unacceptable darkening of the potato products after frying.

Reducing sugar accumulation of transformed potato lines relative to wild-type plants in both tubers just harvested and tubers stored for 91 days also demonstrates the substantial advantages of the invention. Reduced sugar accumulation is related to the observed improvement in crispy scores and also reflects an improvement in tuber specific gravity, another measure of tuber quality. Even at harvest, the transformed plants show an improvement in the crispy score and a decrease in the accumulation of sugars relative to the wild-type plants. Thus, the advantages of the invention are not limited to the improvements that occur after prolonged periods of low temperature storage, but are also evident during the harvest period. In this sense, the invention is not limited to improving the low temperature storage characteristics, but also emphasizes the improvement of tuber quality characteristics such as flakes score or sugar accumulation occurring at the time of harvest, leading to earlier maturation.

In view of the specific improvements shown in Table 6, it can be seen that GLTP type transformants (ATL3-ATL9) show up to 66%, 70% and 69% reduction in α-glucan phosphorylase activity relative to the wild type at harvest and storage for 91 and 189 days. Most also show an improvement of 10 and 30% relative to the wild type when harvested and stored for 91 and 189 days. On storage for 91 and 189 days, GHTP type transformants (ATH1 and ATH2) show up to 28% and 39% improvement in wild-type, and generally at least 10%, improvement over wild type.

GLTP transformants exhibit up to 80% and 39% reduction in sugar accumulation relative to the wild type at harvest and storage for 91 days. At harvest, all GLTP transformants show at least 10% and at least 30% improvement. At day 91, all transformants showed at least 10% improvement and most showed at least 30% improvement.

GLTP-type transformants show up to a 46% improvement in flakes score values at harvest, and the value improves by 89% when stored for 86 days and the value also improves by 89% when stored for 124 days. Almost all transformants show at least 10% and 30% improvement in storage for 86 and 124 days at harvest. At least one of the GHTP-type transformants shows at least 5% improvement over wild type at harvest and 10% improvement on storage for 86 and 124 days. When stored for 124 days, at least one of the GHTP-type transformants exhibits an up to 25% improvement in flakes score.

The results clearly show that substantial improvements in low temperature storage characteristics can easily be achieved by the process of the invention. Results will vary, inter alia, by the position of the recombinant coding and non-coding DNA incorporated in the plant genome and by the number of insertions. It is important to note that, in spite of the variation in the results between the different transformed lines, the results between the samples of one transformed potato line vary very little (shown in Tables 1 to 5). The results obtained for all transformed potato plant lines that were successfully transformed with the GHTP or GLTP coding DNA are shown in Table 6. All transformants show at least a partial improvement of one or more low temperature storage characteristics, such as improved flake score values (lighter color). when processed by cooking) and reducing the accumulation of sugar, and most of them show substantial • ·

I • 4 · 4 4 4 4 4 4 4 4 4 4 4 Due to the fact that there are a large number of positive transformants in the samples, it is expected that potato plants transformed with the method of the invention can be easily tested to identify transformed lines that show a significant improvement in low temperature storage characteristics. Using the method of the invention, it is possible to easily create and select transformants having substantially improved low temperature storage characteristics. These transformants show the highest relative improvement over wild-type controls and can therefore be used for the development of new commercial potato varieties.

Table 1

Effects of antisense transcripts on glucan phosphorylase activity measured in enzymatic extracts from "Desiree" tubers grown in the field.

Glucan phosphorylase activity Shelf life at 4 ° C (days) clone 0 49 91 140 189 / µmol NADPH per mg protein per hour Wť 10, 50 11.83 9, 94 11, 90 13, 04 ATL3 4.90 4.86 4, 49 4.73 4.88 ATL4 11, 45 7.17 8, 09 11.32 10, 99 ATL5 3, 58 3, 56 2.97 4.59 4.79 ATL 9 3, 59 3, 88 3, 84 4.72 3, 98 LSD _{0 05} ^b 1.97 2, 94 1.59 2, 34 2.58 LSDo, et al 2.87 4.28 2.31 3, 41 3, 75 clone ^c 0, 01 ^d WT vs ATL 0, 01 Days NS Clone x days 0.05

WT 11.49 8.90 12, 66 13, 66 ATH-1 10, 40 9, 69 10, 79 10.10 ATH-2 6.46 6, 40 6, 56 8.38 LSDo, os ^b 2, 02 0, 41 3, 00 NS LSDo, 01 4.78 0, 95 NS NS clone ^c 0, 01 WT vs ATL 0, 01 Days 0, 05 Clone x NS days ^and WT, untransformed tubers, a significant difference in the number of storage periods. ^c source significance level in case wild type. ^b LSD, at least 0.05 or 0.01 for each factorial analysis deviation. ^d indicated sources of variation.

Table 2

Effects of GLTP antisense transcript on malting in the cultivated field of low temperature Desiree tubers.

Reducing sugars (glucose and fructose) Shelf life at 4 ° C (days) Clone 0 49 91 µmol NADPH per mg protein for hour Wt ^a 5, 63 31.8 28, 0 ATL3 1, 88 17.3 17.3 ATL4 1.11 14.3 20, 1 ATL 5 1.51 18.3 17.0 ATL9 1.36 17.3 18, 5 WT vs ATL ^b 0, 01 0, 01 0, 05

Clone '99' · 4 »9 · 4

0, 01 ^d

Days 0,01

Clone x days NS ^and WT, netrans-formed wild-type tubers. ^b orthogonal comparison for ANOVA at each storage period. ^c sources of deviations of factorial analysis. ^d significance level for indicated sources of variation.

Table 3

Effects of GLTP antisense transcript on fructose accumulation in the field of low temperature Desiree grown tubers.

Fructose Shelf life at 4 ° C (days) Clone 0 49 91 ^ Umol NADPH on mg protein per hour Wt ^a 3, 53 15.10 12.20 ATL3 1,21 8.40 8.79 ATL4 0, 79 7.22 8, 56 ATL5 0, 61 10, 00 8, 09 ATL9 0, 54 8, 38 8, 72 WT vs ATL ^b 0, 01 0, 01 NS Clone ^c 0, 01 ^d Days 0, 01 Clone x days NS

^and WT, untransformed wild-type tubers. ^b orthogonal comparison for ANOVA at each storage period. ^c sources of deviations of factorial analysis. ^d significance level for indicated sources of variation.

Table 4 • * β ·

Effects of GLTP antisense transcript on glucose accumulation in the cultivated field of low temperature Desiree tubers.

glucose Storage time at 4 ° C (days) Clone 0 49 91 mg na g fresh weight Wt ^a 2, 10 16, 60 15, 90 ATL3 0, 68 8.94 8.49 ATL4 0, 32 7.07 11.06 ATL5 1, 05 8, 33 8.91 ATL9 0, 83 8.87 9.78 WT vs ATL ^b 0, 01 0, 01 0, 05 Clone ^c 0, 01 ^d Days 0, 01 Clone x days NS

^and WT, netrans-formed wild-type tubers. ^b orthogonal comparison for ANOVA at each storage period. ^c sources of deviations of factorial analysis. ^d significance level for indicated sources of variation.

Table 5

Average color of crisps in the 'Desiree. The color range of the chips was determined using an Agtronmeter which

resembles a device fried potatoes. U t numbers lighter index value. used ohoto index product, but in the color measuring industry the higher the value color is not directly proportional Storage temperature and time, and measurement with Agtron ³ Harvest 86 days 8 6 days 124 days Low: 14 ° C Low: 14 ° C Low: 14 ° C wF 26 25, 3 15.4 17.1

99

9 9 9 9 9 9 9 9 9 9 9

9 9 9 9 9 9 9 · * · ♦ ♦ ♦ ·

ATL3 ^C 25 37, 4 26.7 30, 8 ATL4 35 43, 7 29, 1 32.3 ATL5 36 29, 6 24, 7 24, 6 ATL 9 38 38.7 24.3 26, 6 ATHl ^d 26 49, 7 17, 5 21.4 ATH2 29 31.2 15, 6 15, 9 GMP1® 31 15, 7 15.7 GMP2 35 16, 7 16, 6

^and Agtron Inc. 1095 Sleeping Island Drive # 100, Sparks Nevada 89431. Agtron model E -15-FP (limited spectrophotometer for direct subtraction. It measures reflection in two spectrum modes (near infrared and green). Results represent measurements 6 to 8 of three chips randomly selected tubers whose diameter is about 3 to 4 cm.

^b WT, negative control, untransformed wild-type tubers.

^C ATL, tubers transformed by tuber α-glucan phosphorylase

L.

^C ATH, tubers transformed with tuber α-glucan phosphorylase

H.

^e GMP, negative control, tubers transformed with pBI121 T-DNA.

Table 6 Summary of results

sample % decrease in activity % reduction % score improvement phosphorylase and- accumulation of chips due glucan due of sugar to the wild type to the wild type considering to the wild type

► «· I I

At harvest 91 days 189 days At harvest 91 days At harvest 86 days 124 days ATL3 53 55 63 67 38 -4 73 80 ATL4 -9 19 Dec 16 80 28 35 89 89 ATL5 66 70 63 73 39 38 60 44 ATL9 66 61 69 76 34 46 58 56 ATH1 on -9 26 on on 0 14 25 ATH2 on 28 39 on on 12 1 -7

-r

Literature

Ecker and Davis (1986) Proc. Nati. Acad. Sci. 83: 5373-5376. Kawchuk et al. (1990) Molecular Plant-Microbe Interactions 3: 301-307

Laemmli, U.K. (1970) Nature 227: 680-685

Lin et al. (1988) Plant Physiol. 86: 1131-1135

Loiselle et al. (1990) American Potato Journal 67: 633-646

Lynch et al. (1992) Can. J. Plant Sci. 72: 535-543. Smith et al. (1988) Nature 334: 724-726

Sowokinos, J. (1990) In: Molecular and Cellular Biology of the Potato. M.A. Mayo nad W.D. Parks (eds.) 9 9 9 9 9 4 99

9 «9 4

989 94 94 9 «

99

4 9 9

9 4 9

9 • 9 99

Sequence protocol (1) General information:

(and) Applicant: Department of Agriculture and Agri- Food Canada (ii) Title of the Invention: Plant potato reporting improving tuber storage characteristics in the cold. (iii) Number of sequences: 10 (iv) Address:

(A) Address: McKay-Carey and Company (B) Street: 2125 Commerce Crying, 10155-102 ^nd Street (C) City: Edmonton (D) Country: Alberta (E) Country: Canada (F) Code: T5J 4G8 ( (v) Form of registration by computer:

(AND) Tup media : diskette (B) Computer: IBM compatible (C) Operating System: PC-DOS (MS-DOS (D) Software: PatentIn # 1.0, version

(vi) Applicant Information:

(AND) Application Number: WO (B) Filing date: February 10, 1998 (C) Classification: (vil) Previous applicant information: (AND) Application Number: US 60/036, 946 (B) Date lodged: 10 February 1997 (vil) Previous applicant information: (AND) Application Number: US 08 / 868,786 (B) Filing date: June 4, 1997

(viii) Patent Attorney Information:

(A) Name: McKay-Carey, Mary Jane (B) Registration Number: 3790 (C) Reference: 24002WO0 • 99

9 • 99

9 9 • 9 9

9

99 • 9 9 9 • * 99

9 9 9

9 9 9

99

999 ···

9

99 (ix) Telecommunication Information:

(A) Telephone: (403) 424 0222 (B) FAX: (403) 421 0834 (2) Information about SEQ ID NO: 1:

(i) Sequence description:

(A) Length: 3101 pairs (b) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (vi) Original source:

(A) Organism: Solanum tuberosum (ix)

(AND) Name / Key: CDS (B) Position: 44 .. 2944 (C) Other information: The product is potato tuber α-glucan phosphorylase type L

(ix) Characters:

(A) Name / Key: mat_peptid (B) Position: 194 .. 2941 (ix) Characters:

(A) Name / Key: sig_peptid (B) Position: 44 .. 193 (xi) Sequence Description: SEQ ID NO: 1:

ATCACTCTCA TTCGAAAAGC TAGATTTGCA TAGAGAGCAC AAA

Met Ala Thr Ala -50

AAT GGA GCA Asn Gly Ala CAC His TTG Leu TTC AAC CAT TAC AGC TCC AAT TCC AGA TTC ATC 103 Phe Asn -40 His Tyr Ser Ser Asn -35 Ser Arg Phe Ile -45 CAT TTC ACT TCT AGA AAC ACA AGC TCC AAA TTG TTC CTT ACC AAA ACC 151 His Phe Thr Ser Arg Asn Thr Ser Ser Lys Leu Phe Leu Thr Lys Thr -30 -25 -20 -15 TCC CAT TTT CGG AGA CCC AAA CGC TGT TTC CAT GTC AAC AAT ACC TTG 199 Ser His Phe Arg Arg For Lys Arg Cys Phe His Wall Asn Asn Thr Leu -10 -5 1 AGT GAG AAA 'ATT CAC CAT CCC ATT ACT GAA CAA GGT GGT GAG AGC GAC 247 Ser Glu Lys Tle His- His For Ile Thr Glu Gin Gly Gly Glu Ser Asp

10-15 · ♦ 99 • 9 9 9

9 9

9 9 9 9 9 9 9 9 9

999 999

CTG AGT TCT TTT GCT Ala TTC Phe CCT GAT GCC for Asp Ala 25 ACA CCT GTA GCA Ala TTC Phe TCT Ser TCT Ser ATT ACC Ile Thr 30 CCT GAA TCA AGT ATC AAA Lys CTC Leu 50 295 343 Leu TRAY Tyr 35 Ser 20 May CAT His Ser Phe gca 'gaa Ser AGG Arg Ser TTT Phe Ile GAG Glu Ala Glu Thr 40 Pro Val For 45 Glu CCT AAG GCA TTC TTT GCA ACA GCT CAA AGT GTT CGT GAT TCG CTC CTT 391 For Lys Ala Phe Phe Ala Thr Ala Gin Ser Wall Arg Asp Ser Leu Leu 55 60 65 ATT AAT TGG AAT GCT ACG MELT GAT ATT MELT GAA AAG CTG AAC ATG AAG 439 Ile Asn Trp Asn Ala Thr Tyr Asp Ile Tyr Glu Lys Leu Asn Met Lys 70 75 80 CAA GCG TRAY MELT CTA TCC ATG GAA TTT CTG CAG GGT AGA GCA TTG TTA 487 Gin Ala Tyr Tyr Leu Ser Met Glu Phe Leu Gin Gly Arg Ala Leu Leu 85 90 > Λ 95 AAT GCA ATT GGT AAT CTG GAG CTT ACT GGT GCA TTT GCG GAA GCT TTG 535 Asn Ala Ile Gly Asn Leu Glu Leu Thr Gly Ala Phe Ala. Glu Ala Leu 100 ALIGN! 105 110 AAA AAC CTT GGC CAC AAT CTA GAA AAT GTG GCT TCT CAG GAA CCA GAT 583 Lys Asn Leu Gly His Asn Leu Glu Asn Wall Ala Ser Gin Glu For Asp 115 120 125 13 0 GCT GCT CTT GGA AAT GGG GGT TTG GGA CGG CTT GCT TCC TGT TTT CTG 631 Ala Ala Leu Gly Asn Gly Gly Leu Gly Arg Leu Ala Ser Cys Phe Leu 135 140 145 GAC TCT TTG GCA ACA CTA AAC TRAY CCA GCA TGG GGC MELT GGA CTT AGG 679 Asp Ser Leu Ala Thr Leu Asn Tyr For Ala Trp Gly Tyr Gly Leu Arg 150 155 160 TRAY AAG MELT GGT TTA TTT AAG CAA CGG ATT ACA AAA GAT GGT CAG GAG 727 Tyr Lys Tyr Gly Leu Phe Lys Gin Arg Ile Thr Lys Asp Gly Gin Glu 165 170 175 GAG GTG GCT GAA GAT TGG CTT GAA ATT GGC AGT CCA TGG GAA GTT GTG 775 Glu Wall Ala Glu Asp Trp Leu Glu Ile Gly Ser For Trp Glu Wall Wall 180 185 190 AGG AAT GAT GTT TCA MELT CCT ATC AAA TTC MELT GGA AAA GTC TCT ACA 823 Arg Asn Asp Wall Ser Tyr For Ile Lys Phe Tyr Gly Lys Wall Ser Thr 195 200 205 210 GGA TCA GAT GGA AAG AGG MELT TGG ATT GGT GGA GAG GAT ATA AAG GCA 871 Gly Ser Asp Gly Lys Arg Tyr Trp Ile Gly Gly Glu Asp Ile Lys Ala 215. 220 225 GTT GCG MELT GAT GTT CCC ATA CCA GGG MELT AAG ACC AGA ACC ACA ATC 919 Wall Ala Tyr Asp Wall For Ile For Gly Tyr Lys Thr Arg Thr Thr Ile 230 235 240 AGC CTT CGA CTG TGG TCT ACA CAG GTT CCA TCA GCG GAT TTT GAT TTA 967 Ser Leu Arg Leu Trp Ser Thr Gin Wall For Ser Ala Asp Phe Asp Leu 245 250 255

· · · * · · · · · ·

9 9 9 ·· ·

9

9 ♦ 9

99

9 9 9

9 9 9

999 999 ·

99

TCT GTC TTC AAT GCT Ala GGA Gly GAG Glu 265 CAC His ACC Thr AAA GCA TGT GAA GCC 1015 Ser Ala 260 Phe Asn Lys Ala Cys 270 Glu Ala Gin Ala AAC GCT GAG AAG ATA TGT TRAY ATA CTC TRAY CCT GGG GAT GAA TCA GAG 1063 Asn Ala Glu Lys Ile Cys Tyr Ile Leu Tyr For Gly Asp Glu Ser Glu 275 280 285 290 GAG GGA AAG ATC CTT CGG TTG AAG CAA CAA MELT ACC TTA TGC TCG GCT 1111 Glu Gly Lys Ile Leu Arg Leu Lys Gin Gin Tyr Thr Leu Cys Ser Ala 295 300 305 TCT CTC CAA GAT ATT ATT TCT CGA TTT GAG AGG AGA TCA GGT GAT CGT 1159 Ser Leu Gin Asp Ile Ile Ser Arg Phe Glu Arg Arg Ser Gly Asp Arg 310 315 And. 320 ATT AAG TGG GAA GAG TTT CCT GAA AAA GTT GCT GTG CAG ATG AAT GAC 1207 Ile Lys Trp Glu Glu Phe For Glu Lys Wall Ala Wall Gin Met Asn Asp 325 330 335 ' ACT CAC CCT ACA CTT TGT ATC CCT GAG CTG ATG AGA ATA TTG ATA GAT 1255 Thr His For Thr Leu Cys Ile For Glu Leu Met Arg Ile Leu Ile Asp 340 345 350 CTG AAG GGC TTG AAT TGG AAT GAA GCT TGG AAT ATT ACT CAA AGA ACT 1303 Leu Lys Gly Leu Asn Trp Asn Glu Ala Trp Asn Ile Thr Gin Arg Thr 355 360 365 370 GTG GCC TRAY ACA AAC CAT ACT GTT TTG CCT GAG GCA CTG GAG AAA TGG 1351 Wall Ala Tyr Thr Asn His Thr Wall Leu For Glu Ala Leu Glu Lys Trp 375 380 385 AGT MELT GAA TTG ATG CAG AAA CTC CTT CCC AGA CAT GTC GAA ATC ATT 1399 Ser Tyr Glu Leu Met Gin Lys Leu Leu For Arg His Wall Glu Ile Ile 390 395 400 GAG GCG ATT GAC GAG GAG CTG GTA CAT GAA ATT GTA TTA AAA MELT GGT 1447 Glu Ala Ile Asp Glu Glu Leu Wall His Glu Ile Wall Leu Lys Tyr Gly 405 410 415 TCA ATG GAT CTG AAC AAA TTG GAG GAA AAG TTG ACT ACA ATG AGA ATC 1495 Ser Met Asp Leu Asn Lys Leu Glu Glu Lys Leu Thr Thr Met Arg Ile 420 425 430 TTA GAA AAT TTT GAT CTT CCC AGT TCT GTT GCT GAA TTA TTT ATT AAG 1543 Leu Glu Asn Phe Asp Leu For Ser Ser Wall Ala Glu Leu Phe Ile Lys 435 440 445 · 450 CCT GAA ATC TCA GTT GAT GAT GAT ACT GAA ACA GTA GAA GTC CAT GAC 1591 For Glu Ile Ser Wall Asp Asp Asp Thr Glu Thr Wall Glu Wall His Asp 455 460 465 AAA GTT GAA GCT TCC GAT AAA GTT GTG ACT AAT GAT GAA GAT GAC ACT 1639 Lys Wall Glu Ala Ser Asp Lys Wall Wall Thr Asn Asp Glu Asp Asp Thr 470 475 480

56 &

• Φ ·· * · ΦΦ · · · φ φ φφφφφφφφφφφφφφ

ΦΦ · · · · · · · · · ·

ΦΦ ΦΦ

GGT AAG ATA GAA GCA Ile Glu Ala 490 GCT GCA GAA GAC ATT 1687 Gly Lys Lys Thr 485 Ser Wall Lys Ala Ala Glu 495 Lys Asp Ile GAC AAG AAA ACT ccc GTG AGT CCG GAA CCA GCT GTT ATA CCA CCT AAG 1735 Asp Lys Lys Thr For Wall Ser For Glu For Ala Wall Ile For For Lys 500 505 510 AAG GTA CGC ATG GCC AAC TTG TGT GTT GTG GGC GGC CAT GCT GTT AAT 1783 Lys Wall Arg Met Ala Asn Leu Cys Wall Wall Gly Gly His Ala Wall Asn 515 520 525 530 GGA GTT GCT GAG ATC CAT AGT GAA ATT GTG AAG GAG GAG GTT TTC AAT 1831 Gly Wall Ala Glu Ile His Ser Glu Ile Wall Lys Glu Glu Wall Phe Asn 535 540 > A, 545 GAC TTC MELT GAG CTC TGG CCG GAA AAG TTC CAA AAC AAA ACA AAT GGA 1879 Asp Phe Tyr Glu Leu Trp For Glu Lys Phe Gin Asn Lys. Thr Asn Gly 550 555 560 GTG ACT CCA AGA AGA TGG ATT CGT TTC TGC AAT CCT CCT CTT AGT GCC 1927 Wall Thr For Arg Arg Trp Ile Arg Phe Cys Asn For For Leu Ser Ala 565 570 575 ATC ATA ACT AAG TGG ACT GGT ACA GAG GAT TGG GTC CTG AAA ACT GAA 1975 Ile Ile Thr Lys Trp Thr Gly Thr Glu Asp Trp Wall Leu Lys Thr Glu 580 585 590 AAG TTG GCA GAA TTG CAG AAG TTT GCT GAT AAT GAA GAT CTT CAA AAT 2023 Lys Leu Ala Glu Leu Gin Lys Phe Ala Asp Asn Glu Asp Leu Gin Asn 595 600 605 610 GAG TGG AGG GAA GCA AAA AGG AGC AAC AAG ATT AAA GTT GTC TCC TTT 2071 Glu Trp Arg Glu Ala Lys Arg Ser Asn Lys Ile Lys Wall Wall Ser Phe 615 620 625 CTC AAA GAA AAG ACA GGG MELT TCT GTT GTC CCA GAT GCA ATG TTT GAT 2119 Leu Lys Glu Lys Thr Gly Tyr Ser Wall Wall For Asp Ala Met Phe Asp 630 635 640 ATT CAG GTA AAA CGC ATT CAT GAG TRAY AAG CGA CAA CTG TTA AAT ATC 2167 Ile Gin Wall Lys Arg Ile His Glu Tyr Lys Arg Gin Leu Leu Asn Ile 645 650 655 TTC GGC ATC GTT .MELT CGG MELT AAG AAG ATG AAA GAA ATG ACA GCT GCA 2215 Phe Gly Ile Wall Tyr Arg Tyr Lys Lys Met Lys Glu Met Thr Ala Ala 660 - 665 670 GAA AGA AAG ACT AAC TTC GTT CCT CGA GTA TGC ATA TTT GGG GGA AAA 2263 Glu Arg Lys Thr Asn Phe Wall For Arg Wall Cys Ile Phe Gly Gly Lys 675 680 685 690 GCT TTT GCC 'ACA MELT GTG CAA GCC AAG AGG ATT GTA AAA TTT ATC ACA 2311 Ala Phe Ala Thr Tyr Wall Gin Ala Lys Arg Ile Wall Lys Phe Ile Thr 695 700 705

99 99 99

9 9 9 9 9 9 • 9 99 9999

999 99 99 99 99 99

GAT GTT GGT GCT ACT CCA. GAA ATC GGT GAT CTG Leu TTG Leu 2359 Asp Wall Gly Ala 710 Thr Ile Asn His Asp 715 For Glu Ile Gly Asp 720 AAG GTA GTC TTT GTG CCA GAT TAC AAT GTC AGT GTT GCT GAA TTG CTA 2407 Lys Wall Wall Phe Wall For Asp Tyr Asn Wall Ser Wall Ala Glu Leu Leu 725 730 735 ATT CCT GCT AGC GAT CTA TCA GAA CAT ATC AGT ACG GCT GGA ATG GAG 2455 Ile For Ala Ser Asp Leu Ser Glu His Ile Ser Thr Ala Gly Met Glu 740 745 750 GCC AGT GGA ACC AGT AAT ATG AAG TTT GCA ATG AAT GGT TGT ATC CAA 2503 Ala Ser Gly Thr Ser Asn Met Lys Phe Ala Met Asn Gly Cys Ile Gin 755 760 And. 765 with 770 ATT GGT ACA TTG GAT GGC GCT AAT GTT GAA ATA AGG GAA GAG GTT GGA 2551 Ile Gly Thr Leu Asp Gly Ala Asn Wall Glu Ile Arg Glu Glu Wall Gly 775 780 785 GAA GAA AAC TTC TTT CTC TTT GGT GCT CAA GCT CAT GAA ATT GCA GGG 2599 Glu Glu Asn Phe Phe Leu Phe Gly Ala Gin Ala His Glu Ile Ala Gly 790 795 800 CTT AGA AAA GAA AGA GCT GAC GGA AAG TTT GTA CCT GAT GAA CGT TTT 2647 Leu Arg Lys Glu Arg Ala Asp Gly Lys Phe Wall For Asp Glu Arg Phe 805 810 815 GAA GAG GTG AAG GAA TTT GTT AGA AGC GGT GCT TTT GGC TCT MELT AAC 2695 Glu Glu Wall Lys Glu Phe Val Arg Ser Gly Ala Phe Gly Ser Tyr Asn 820 825 830 MELT GAT GAC CTA ATT GGA TCG TTG GAA GGA AAT GAA GGT TTT GGC CGT 2743 Tyr Asp Asp Leu Ile Gly Ser Leu Glu Gly Asn Glu Gly Phe Gly Arg 835 840 845 850 GCT GAC MELT TTC CTT GTG GGC AAG GAC TTC CCC AGT TRAY ATA GAA TGC 2791 Ala Asp Tyr Phe Leu Wall Gly Lys Asp Phe For Ser Tyr Ile Glu Cys 855 860 865 CAA GAG AAA GTT GAT GAG GCA TAT CGC GAC CAG AAA AGG TGG ACA ACG 2839 Gin Glu Lys Wall Asp Glu Ala Tyr Arg Asp Gin Lys Arg Trp Thr Thr 870 875 880 ATG TCA ATC TTG AAT ACA GCG GGA TCG TRAY AAG TTC AGC AGT GAC AGA 2887 Met Ser Ile Leu Asn Thr Ala Gly Ser Tyr Lys Phe Ser Ser Asp Arg 885 - 890 895 ACA ATC CAT GAA MELT GCC AAA GAC ATT TGG AAC ATT GAA GCT GTG GAA 2935 Thr Ile His Glu Tyr Ala Lys Asp Ile Trp Asn Ile Glu Ala Wall Glu 900 905 910 ATA GCA TAA GAGGGGGAAG TGAATGAAAA ATAACAAAGG CACAGTAAGT 2984

Ile Ala *

915

AGTTTCTCTT TTTATCATGT GATGAAGGTA TATAATGTAT GTGTAAGAGG ATGATGTTAT 3044 TACCACATAA TAAGAGATGA AGAGTCTCAT TTTGCTTCAA AAAAAAAAAA AAAAAAA 3101 * 9 • 9

9 9 9 9 9

99,999,999

9

99 99 99 (2) Information about SEQ ID NO: 2:

(i) Sequence description:

(A) Length: 967 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: protein (xi) Description of sequence: SEQ ID NO: 2

Met Ala -50 Thr Ala Asn. Gly -45 Ala His Leu Phe Asn -40 His Tyr Ser Ser Asn -35 Ser Arg Phe Ile His Phe Thr Ser Arg Asn Thr Ser Ser Lys Leu Phe -30 -25 -20 Leu Thr Lys Thr Ser His Phe Arg Arg For Lys Arg Cys Phe His Wall -15 -10 -5 Asn Asn Thr Leu Ser Glu Lys Ile His His For Ile Thr Glu Gin Gly 1 5 10 Gly Glu Ser Asp Leu Ser Ser Phe Ala For Asp Ala Ala Ser Ile Thr 15 Dec 20 May 25 30 Ser Ser Ile Lys Tyr His Ala Glu Phe Thr For Wall Phe Ser For Glu 35 40 45 Arg Phe Glu Leu For Lys Ala Phe Phe Ala Thr Ala Gin Ser Wall Arg 50 55 60 Asp Ser Leu Leu Ile Asn Trp Asn Ala Thr Tyr Asp Ile Tyr Glu Lys 65 70 75 Leu Asn Met Lys Gin Ala Tyr Tyr Leu Ser Met Glu Phe Leu Gin Gly 80 85 90 Arg Ala Leu Leu Asn Ala Ile Gly Asn Leu Glu Leu Thr Gly Ala Phe 95 100 ALIGN! 105 110 Ala Glu Ala Leu Lys- Asn Leu Gly His Asn Leu Glu Asn Wall Ala Ser 115 120 125 Gin Glu For Asp Ala Ala Leu Gly Asn Gly Gly Leu Gly Arg Leu Ala

130

Ser Cys Phe Leu Asp Ser Leu As Th Tyr Pro Ala Trp Gly 145 150 155

4 0 9 9 9 9 · 9 9 ·· 0 9 9 9 0 9 * 9 9 9 9 9 «9 · 990

999900 · · ··· ·

Tyr Gly Leu Arg Phe Lys Gin 170 Arg Ile Thr Lys 160 165 Asp Gly Gin Glu Glu Wall Ala Glu Asp Trp Leu Glu Ile Gly Ser For 175 180 185 190 Trp Glu Wall Wall Arg Asn Asp Wall Ser Tyr For Ile Lys Phe Tyr Gly 195 200 205 Lys Wall Ser Thr Gly Ser Asp Gly Lys Arg Tyr Trp Ile Gly Gly Glu 210 215 220 Asp Ile Lys Ala Wall Ala Tyr Asp Wall For Ile For Gly Tyr Lys Thr 225 230 235 Arg Thr Thr Ile Ser Leu Arg Leu Trp SeY 'Thr Gin Wall For Ser Ala 240 245 250 Asp Phe Asp Leu Ser Ala Phe Asn Ala Gly Glu His Thr Lys Ala Cys 255 260 265 270 Glu Ala Gin Ala Asn Ala Glu Lys Ile Cys Tyr Ile Leu Tyr For Gly 275 280 285 Asp Glu Ser Glu Glu Gly Lys Ile Leu Arg Leu Lys Gin Gin Tyr Thr 290 295 300 Leu Cys Ser Ala Ser Leu Gin Asp Ile Ile Ser Arg Phe Glu Arg Arg 305 310 315 Ser Gly Asp Arg Ile Lys Trp Glu Glu Phe For Glu Lys Wall Ala Wall 320 325 330 Gin Met Asn Asp Thr His For Thr Leu Cys Ile For Glu Leu Met Arg 335 340 345 350 Ile Leu Ile Asp Leu Lys Gly Leu Asn Trp Asn Glu Ala Trp Asn Ile 355 360 365 Thr Gin Arg Thr Wall Ala Tyr Thr Asn His Thr Wall Leu For Glu Ala 370 375 380 Leu Glu Lys Trp Ser Tyr Glu Leu Met Gin Lys Leu Leu For Arg His 385 390 395 Wall Glu Ile Tle Glu Ala Ile Asp Glu Glu Leu Wall His Glu Ile Wall 400 - 405 410 Leu Lys Tyr Gly Ser Met Asp Leu Asn Lys Leu Glu Glu Lys Leu Thr 415 420 425 430 Thr Met Arg Ile Leu Glu Asn Phe Asp Leu For Ser Ser Wall Ala Glu • 435 440 445

·· · · · 99 · 99

9 9 9 9 9

9 9 99

9 9 9 9 9 9 9 999 999

9 9 9 9 9 9

99 99 99 99 99

Leu Phe Ile Lys For Glu Ile Ser Wall Asp Asp Asp Thr Glu Thr Wall 450 455 460 Glu Wall His Asp Lys Wall Glu Ala Ser Asp Lys Wall Wall Thr Asn Asp 465 470 475 Glu Asp Asp Thr Gly Lys Lys Thr Ser Wall Lys Ile Glu Ala Ala Ala 480 485 490 Glu Lys Asp Ile Asp Lys Lys Thr For Wall Ser For Glu For Ala Wall 495 500 505 510 Ile For For Lys Lys Wall Arg Met Ala Asn Leu Cys Wall Wall Gly Gly 515 520 525 His Ala Wall Asn Gly Wall Ala Glu Ile 5 Λ His Ser Glu Ile Wall Lys Glu 530 535 540 Glu Wall Phe Asn Asp Phe Tyr Glu Leu Trp For Glu Lys Phe Gin Asn 545 550 555 Lys Thr Asn Gly Wall Thr For Arg Arg Trp Ile Arg Phe Cys Asn For 560 565 570 For Leu Ser Ala Ile Ile Thr Lys Trp Thr Gly Thr Glu Asp Trp Wall 575 580 585 590 Leu Lys Thr Glu Lys Leu Ala Glu Leu Gin Lys Phe Ala Asp Asn Glu 595 600 605 Asp Leu Gin Asn Glu Trp Arg Glu Ala Lys Arg Ser Asn Lys Ile Lys 610 615 620 Wall Wall Ser Phe Leu Lys Glu Lys Thr Gly Tyr Ser Wall Wall For Asp 625 630 635 Ala Met Phe Asp Ile Gin Wall Lys Arg Ile His Glu Tyr Lys Arg Gin 640 645 650 Leu Leu Asn Ile Phe Gly Ile Wall Tyr Arg Tyr Lys Lys Met Lys Glu 655 660 665 · 670 Met Thr Ala Ala Glu Arg Lys Thr Asn Phe Wall For Arg Wall Cys Ile 675 680 685 Phe Gly Gly Lys Ala Phe Ala Thr Tyr Wall Gin Ala Lys Arg Ile Wall 690 - 695 700 Lys Phe Ile Thr Asp Wall Gly Ala Thr Ile Asn His Asp For Glu Ile 705 710 715 Gly Asp Leu Leu Lys Wall Wall Phe Wall For Asp Tyr Asn Wall Ser Wall 720 * 725 730

44 44 44 • 4 44 4444

4 43 4 4 4 4

4 4 4 4 44 4 495

4 4 4 4 4

44 44 44 4 4

4 4

444 44

Ala 735 Glu Leu Leu Ile For 740 Ala Ser Asp Leu Ser 745 Glu His Ile Ser Thr 750 Ala Gly Met Glu Ala Ser Gly Thr Ser Asn Met Lys Phe Ala Met Asn 755 760 765 Gly Cys Ile Gin Ile Gly Thr Leu Asp Gly Ala Asn Wall Glu Ile Arg 770 775 780 Glu Glu Wall Gly Glu Glu Asn Phe Phe Leu Phe Gly Ala Gin Ala His 785 790 795 Glu Ile Ala Gly Leu Arg Lys Glu Arg Ala Asp Gly Lys Phe Wall For 800 805 810 Asp Glu Arg Phe Glu Glu Wall Lys Glu Pňe ' Wall Arg Ser Gly Ala Phe 815 820 825 830 Gly Ser Tyr Asn Tyr Asp Asp Leu Ile Gly Ser Leu Glu Gly Asn Glu 835 840 845 Gly Phe Gly Arg Ala Asp Tyr Phe Leu Wall Gly Lys Asp Phe For Ser 850 855 860 Tvr Ile Glu Cys Gin Glu Lys Wall Asp Glu Ala Tyr Arg Asp Gin Lys 865 870 875 Arg Trp Thr Thr Met Ser Ile Leu Asn Thr Ala Gly Ser Tyr Lys Phe 880 885 890 Ser Ser Asp Arg Thr Ile His Glu Tyr Ala Lys Asp Ile Trp Asn Ile 895 900 905 910 Glu Ala Wall Glu Ile Ala ir

915 (2) Information ο SEQ ID NO: 3:

(i) Sequence description:

(A) Length: 2655 pairs (B) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (vi) Original source:

(A) Organism: Solanum tuberosum (ix)

(A) Name / Key: CDS (B) Position: 12 ..2528 • · (C) Other information: The product is potato tuber α-glucan phosphorylase type H (ix) Characteristics:

(A) Name / Key: mat_peptid (B) Position: 12 ..2525 (xi) Sequence Description: SEQ ID NO: 3:

GTTTATTTTC C ATG GAA GGT GGT GCA AAA TCG

Met Glu Gly Ala Lys Ser Asn Asp Val Ser Ala Ala

10

CCT ATT GCT GAA GAC CC ACT GAC ATT GCA TCT Ser AAT Asn 98 For Ile 15 Dec Ala Gin Pro Leu Ser 20 May Glu Asp For Thr Asp 25 Ile Ala ATC AAG MELT CAT GCT GAA MELT ACT CCT CAT TTT TCT CCT TTC AAG TTT 146 Ile Lys Tyr His Ala Gin Tyr Thr For His Phe Ser For Phe Lys Phe 30 35 40 45 GAG CCA CTA CAA GCA TRAY MELT GCT GCT ACT GCT GAC AGT GTT CGT GAT 194 Glu For Leu Gin Ala Tyr Tyr Ala Ala Thr Ala Asp Ser Wall Arg Asp 50 55 60 CGC TTG ATC AAA CAA TGG AAT GAC ACC MELT CTT CAT MELT GAC AAA GTT 242 Arg Leu Ile Lys Gin Trp Asn Asp Thr Tyr Leu His Tyr Asp Lys Wall 65 70 75 AAT CCA AAG CAA ACA TRAY TRAY TTA TCA ATG GAG MELT CTC CAG GGG CGA 290 Asn For Lys Gin Thr Tyr Tyr Leu Ser Met Glu Tyr Leu Gin Gly Arg 80 85 90 GCT TTG ACA AAT GCA GTT GGA AAC TTA GAC ATC CAC AAT GCA MELT GCT 338 Ala Leu Thr Asn Ala Wall Gly Asn Leu Asp Ile His Asn Ala Tyr Ala 95 100 ALIGN! 105 GAT GCT TTA AAC AAA CTG GGT CAG CAG CTT GAG GAG GTC GTT GAG CAG 386 Asp Ala Leu Asn Lys Leu Gly Gin Gin Leu Glu · Glu Wall Wall Glu Gin 110 115 120 125 GAA AAA GAT GCA GCA TTA GGA AAT GGT GGT TTA GGA AGG CTC GCT TCA 434 Glu Lys Asp Ala Ala Leu Gly Asn Gly Gly Leu Gly Arg Leu Ala Ser 130 135 140 TGC TTT CTT GAT TCC ATG GCC ACA TTG AAC CTT CCA GCA TGG GGT MELT 482 Cys Phe Leu Asp Ser Met Ala Thr Leu Asn Leu For Ala Trp Gly Tyr 145 150 155 GGC TTG AGG TRAY AGA MELT GGA CTT TTT AAG CAG CTT ATC ACA AAG GCT 530 Gly Leu Arg Tyr Arg Tyr Gly Leu Phe Lys Gin Leu Ile Thr Lys Ala 160 165 170

• · • *

GGG Gly CAA Gin 175 GAA Glu GAA Glu GTT Wall CCT For GAA Glu 180 GAT Asp TGG Trp TTG Leu GAG Glu AAA Lys 185 TTT Phe AGT Ser CCC For TGG Trp 578 GAA ATT GTA AGG CAT GAT GTT GTC TTT CCT ATC AGG TTT TTT GGT CAT 626 Glu Ile Wall Arg His Asp Wall Wall Phe For Ile Arg Phe Phe Gly His 190 195 200 205 GTT GAA GTC CTC CCT TCT GGC TCG CGA AAA TGG GTT GGT GGA GAG GTC 674 Wall Glu Wall Leu For Ser Gly Ser Arg LVS Trp Wall Gly Gly Glu Wall 210 215 220 CTA CAG GCT CTT GCA MELT GAT GTG CCA ATT CCA GGA TRAY AGA ACT AAA 722 Leu Gin Ala Leu Ala Tyr Asp Wall For Ile For Gly Tyr Arg Thr Lys 225 230 ·>> 235 AAC ACT AAT AGT CTT CGT CTC TGG GAA GCC AAA GCA AGC TCT GAG GAT 770 Asn Thr Asn Ser Leu Arg Leu Trp Glu Ala Lys Ala Ser Ser Glu Asp 240 245 250 ' TTC AAC TTG TTT CTG TTT AAT GAT GGA CAG MELT GAT GCT GCT GCA CAG 818 Phe Asn Leu Phe Leu Phe Asn Asp Gly Gin Tyr Asp Ala Ala Ala Gin 255 260 265 CTT CAT TCT AGG GCT CAG CAG ATT TGT GCT GTT CTC TRAY CCT GGG GAT 866 Leu His Ser Arg Ala Gin Gin Ile Cys Ala Wall Leu Tyr For Gly Asp 270 275 280 285 GCT ACA GAG AAT GGA AAA CTC TTA CGG CTA AAG CAA CAA TTT TTT CTG 914 Ala Thr Glu Asn Gly Lys Leu Leu Arg Leu Lys Gin Gin Phe Phe Leu 290 295 300 TGC AGT GCA TCG CTT CAG GAT ATT ATT GCC AGA TTC AAA GAG AGA GAA 962 Cys Ser Ala Ser Leu Gin Asp Ile Ile Ala Arg Phe Lys Glu Arg Glu 305 310 315 GAT GGA AAG GGT TCT CAC CAG TGG TCT GAA TTC CCC AAG AAG GTT GCG 1010 Asp Gly Lvs Gly Ser His Gin Trp Ser Glu Phe For Lys Lys Wall Ala 320 325 IN 330 ATA CAA CTA AAT GAC ACA CAT CCA ACT CTT ACG ATT CCA GAG CTG ATG 1058 Xle Gin Leu Asn Asp Thr His For Thr Leu Thr Ile For Glu Leu Met 335 340 345 CGG TTG CTA ATG GAT GAT GAA GGA CTT GGG TGG GAT GAA TCT TGG AAT 1106 Arg Leu Leu · Met Asp Asp Glu Gly Leu Gly Trp Asp Glu Ser Trp Asn 350 355 360 365 ATC ACT ACT AGG ACA ATT GCC MELT ACG AAT CAT ACA GTC CTA CCT GAA 1154 Xle Thr Thr Arg Thr Ile Ala Tyr Thr Asn His Thr Wall Leu For Glu 370 375 380 GCA CTT GAA. AAA TGG TCT CAG GCA GTC ATG TGG AAG CTC CTT CCT AGA 1202 Ala Leu Glu Lys Trp Ser Gin Ala Wall Met Trp Lys Leu Leu For Arg 385 390 395

T t t φ t t ^{1 1 1 1 1 1 1 1 1 1}

φ ΦΦ · ♦ ··

CAT His ATG GAA ATC Ile ATT GAA ATT Ile 405 GAC Asp AAA CGG TTT GTT GCT Ala ACA Thr ATA Ile 1250 Met Glu 400 Ile Glu Glu Lys Arg Phe Wall 410 ATG TCA GAA AGA CCT GAT CTT GAG AAT AAG ATG CCT AGC ATG CGC ATT 1298 Met Ser Glu Arg For Asp Leu Glu Asn Lys Met For Ser Met Arg Ile 415 420 425 TTG GAT CAC AAC GCC ACA AAA CCT GTT GTG CAT ATG GCT AAC TTG TGT 1346 Leu Asp His Asn Ala Thr Lys For Wall Wall His Met Ala Asn Leu Cys 430 435 440 445 GTT GTC TCT TCA CAT ACG GTA AAT GGT GTT GCC CAG CTG CAT AGT GAC 1394 Wall Wall Ser Ser His Thr Wall Asn Gly Wall Ala Gin Leu His Ser Asp 450 ⁴⁵⁵ 5 _Λ 460 ATC CTG AAG GCT GAG TTA TTT GCT GAT MELT GTC TCT GTA TGG CCC ACC 1442 Ile Leu Lys Ala Glu Leu Phe Ala Asp Tyr Wall Ser Wall Trp For Thr 465 470 475 AAG TTC CAG AAT AAG ACC AAT GGT ATA ACT CCT CGT AGG TGG ATC CGA 1490 Lys Phe Gin Asn Lys Thr Asn Gly Ile Thr For Arg Arg Trp Ile Arg 480 485 490 TTT TGT AGT CCT GAG CTG AGT CAT ATA ATT ACC AAG TGG TTA AAA ACA 1538 Phe Cys Ser For Glu Leu Ser His Ile Ile Thr Lys Trp Leu Lys Thr 495 500 505 GAT CAA TGG GTG ACG AAC CTC GAA CTG CTT GCT AAT CTT CGG GAG TTT 1586 Asp Gin Trp Wall Thr Asn Leu Glu Leu Leu Ala Asn Leu Arg Glu Phe 510 515 520 525 GCT GAT AAT TCG GAG CTC CAT GCT GAA TGG GAA TCA GCC AAG ATG GCC 1634 Ala Asp Asn Ser Glu Leu His Ala Glu Trp Glu Ser Ala Lys Met Ala 530 535 540 AAC AAG CAG CGT TTG GCA CAG MELT ATA CTG CAT GTG ACA GGT GTG AGC 1682 Asn Lys Gin Arg Leu Ala Gin Tyr Ile Leu His Wall Thr Gly Wall Ser 545 550 555 ATC GAT CCA AAT TCC CTT TTT GAC ATA CAA GTC AAA CGT ATC CAT GAA 1730 Ile Asp For Asn Ser Leu Phe Asp Ile Gin Wall Lys Arg Ile His Glu 560 565 570 TRAY AAA AGG CAG CTT CTA AAT ATT CTG GGC GTC ATC MELT AGA TRAY AAG 1778 Tyr Lys Arg Gin Leu Leu Asn Ile Leu G-ly Wall Ile Tyr Arg Tyr Lys 575 580 585 AAG CTT AAG GGA ATG AGC CCT GAA GAA AGG AAA AAT ACA ACT CCT CGC 1826 Lys Leu Lys Gly Met Ser For Glu Glu Arg Lys Asn Thr Thr For Arg 590 595 600 605 ACA GTC ATG ATT GGA GGA AAA GCA TTT GCA ACA TRAY ACA AAT GCA AAA 1874 Thr Wall Met Ile Gly Gly Lys Ala Phe Ala Thr Tyr Thr Asn Ala Lys 610 615 620

• 9 • 9 • 9 • 9 • 9 • 9

CGA Arg ATT GTC Ile Val AAG CTC GTG GAC Asp GTT GTC AAT Asn 635 AGT Ser GAC Asp Lys 625 Leu Wall Thr Asp Wall 630 Gly Wall Wall CCT GAC GTC AAT GAC MELT TTG AAG GTG GTT TTT GTT CCC AAC TRAY AAT For Asp Wall Asn Asp Tyr Leu Lys Wall Wall Phe Wall For Asn Tyr Asn 640 645 650 GTA TCT GTG GCA GAG ATG CTT ATT CCG GGA AGT GAG CTA TCA CAA CAC Wall Ser Wall Ala Glu Met Leu Ile For Gly Ser Glu Leu Ser Gin His 655 660 665 ATC AGT ACT GCA GGC ATG GAA GCA AGT GGA ACA AGC AAC ATG AAA TTT Ile Ser Thr Ala Gly Met Glu Ala Ser Gly Thr Ser Asn Met Lys Phe 670 675 «> 680 · *, 685 GCC CTT AAT GGA TGC CTT ATC ATT GGG ACA CTA GAT GGG GCC AAT GTG Ala Leu Asn Gly Cys Leu Ile Ile Gly Thr Leu Asp Gly , Ala Asn Wall 690 695 700 GAA ATT AGG GAG GAA ATT GGA GAA GAT AAC TTC TTT CTT TTT GGT GCA Glu Ile Arg Glu Glu Ile Gly Glu Asp Asn Phe Phe Leu Phe Gly Ala 705 710 715 ACA GCT GAT GAA GTT CCT CAA CTG CGC AAA GAT CGA GAG AAT GGA CTG Thr Ala Asp Glu Wall For Gin Leu Arg Lys Asp Arg Glu Asn Gly Leu 720 725 730 TTC AAA CCT GAT CCT CGG TTT GAA GAG GCA AAA CAA TTT ATT AGG TCT Phe Lys For Asp For Arg Phe Glu Glu Ala Lys Gin Phe Ile Arg Ser 735 740 745 GGA GCA TTT GGG ACG MELT GAT MELT AAT CCC CTC CTT GAA TCA CTG GAA Gly Ala Phe Gly Thr Tyr Asp Tyr Asn For Leu Leu Glu Ser Leu Glu 750 755 760 765 GGG AAC TCG GGA MELT GGT CGT GGA GAC MELT TTT CTT GTT GGT CAT GAT Gly Asn Ser Gly Tyr Gly Arg Gly Asp Tyr Phe Leu Wall Gly His Asp 770 775 780 TTT CCG AGC TRAY ATG GAT GCT CAG GCA AGG GTT GAT GAA GCT TRAY AAG Phe For Ser Tyr Met Asp Ala Gin Ala Arg Wall Asp Glu Ala Tyr Lys 785 790 795 GAC AGG AAA AGA TGG ATA AAG ATG TCT ATA CTG AGC ACT AGT GGG AGT Asp Arg Lys Arg Trp Ile Lys Met Ser Ile Leu Ser Thr Ser Gly Ser 800 805 810 GGC AAA TTT AGT AGT GAC CGT ACA ATT TCT CAA MELT GCA AAA GAG ATC Gly Lys Phe Ser Ser Asp Arg Thr Ile Ser Gin Tyr Ala Lys Glu Ile 815 820 825 TGG AAC ATT SCC GAG TGT CGC GTG CCT TGA GCACACTTCT GAACCTGGTA Trp Asn Ile Ala Glu Cys Arg Wall For *

830 835

TCTAATAAGG ATCTAATGTT CATTGTTTAC TAGCATATGA ATAATGTAAG TTCAAGCACA acatgctttc ttatttccta

1922

1970

2018

2066

2114

2162

2210

2258

2306

2354

2402

2450

2498

2548

2608

2655 • (2) SEQ ID NO: 4:

(i) Sequence description:

(A) Length: 839 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: protein (xi) Sequence description: SEQ ID NO: 4

Met 1 Glu Gly Gly Ala 5 Lys Ser. Asn Asp Wall 10 Ser Ala Ala For Ile 15 Dec Ala Gin For Leu Ser Glu Asp For Thr Asp Ile Ala Ser Asn Ile Lys Tyr 20 May 25 30 His Ala Gin Tyr Thr For His Phe Ser For Phe Lys Phe Glu For Leu 35 40 45 Gin Ala Tyr Tyr Ala Ala Thr Ala Asp Ser Wall Arg Asp Arg Leu Ile SO 55 60 Lys Gin Trp Asn Asp Thr Tyr Leu His Tyr Asp Lys Wall Asn For Lys 65 70 75 80 Gin Thr Tyr Tyr Leu Ser Met Glu Tyr Leu Gin Gly Arg Ala Leu Thr 85 90 95 Asn Ala Wall Gly Asn Leu Asp Ile His Asn Ala Tyr Ala Asp Ala Leu 100 ALIGN! 105 110 Asn Lys Leu Gly Gin Gin Leu Glu Glu Wall Wall Glu Gin Glu Lys Asp 115 120 125 Ala Ala Leu Gly Asn Gly Gly Leu Gly Arg Leii Ala Ser Cys Phe Leu 130 135 140 Asp Ser Met Ala Thr Leu Asn Leu For Ala Trp Gly Tyr Gly Leu Arg 145 150 155 160 Tyr Arg Tyr Gly Leu ^- Phe Lys Gin Leu Ile Thr Lys Ala Gly Gin Glu 165 170 175 Glu Wall For Glu Asp Trp Leu Glu Lys Phe Ser For Trp Glu Ile Wall

180 185 190

Arg His Asp * Val Val Phe Pro Ile

Leu For 210 Ser Gly Ser Arg Lys 215 Trp Val Gly Gly Glu 220 Wall Leu Gin Ala Leu Ala Tyr Asp Wall For Ile For Gly Tyr Arg Thr Lys Asn Thr Asn 225 230 235 240 Ser Leu Arg Leu Trp Glu Ala Lys Ala Ser Ser Glu Asp Phe Asn Leu 245 250 255 Phe Leu Phe Asn Asp Gly Gin Tyr Asp Ala Ala Ala Gin Leu His Ser 260 265 270 Arg Ala Gin Gin Ile Cys Ala Wall Leu Tyr For Gly Asp Ala Thr Glu 275 280 285 Asn Gly Lys Leu Leu Arg Leu Lys Gin Gin'Phe Phe Leu Cys Ser Ala 290 295 300 Ser Leu Gin Asp Ile Ile Ala Arg Phe Lys Glu Arg Glu Asp Gly Lys 305 310 315 320 Gly Ser His Gin Trp Ser Glu Phe For Lys Lys Wall Ala Ile Gin Leu 325 330 335 Asn Asp Thr His For Thr Leu Thr Ile For Glu Leu Met Arg Leu Leu 340 345 350 Met Asp Asp Glu Gly Leu Gly Trp Asp Glu Ser Trp Asn Ile Thr Thr 355 360 3 65 Arg Thr Ile Ala Tyr Thr Asn His Thr Wall Leu For Glu Ala Leu Glu 370 375 380 Lys Trp Ser Gin Ala Wall Met Trp Lys Leu Leu For Arg His Met Glu 385 390 395 400 Ile Ile Glu Glu Ile Asp Lys Arg Phe Wall Ala Thr Ile Met Ser Glu 405 410 415 Arg For Asp Leu Glu Asn Lys Met For Ser Met Arg Ile Leu Asp His 420 425 430 Asn Ala Thr Lys For Wall Wall His Met Ala Asn Leu Cys Wall Wall Ser 435 440 445 Ser His Thr ' Wall Asn Gly Wall Ala Gin Leu His Ser Asp Ile Leu Lys 450 - 455 '460 Ala Glu Leu Phe Ala Asp Tyr Wall Ser Wall Trp For Thr Lys Phe Gin 465 470 475 480 Asn Lys Thr Asn Gly Ile Thr For Arg Arg Trp Ile Arg Phe Cys Ser * 485 490 495 For Glu Leu Ser His Ile Ile Thr Lys Trp Leu Lys Thr Asp Gin Trp 500 505 510 Wall Thr Asn Leu Glu Leu Leu Ala Asn Leu Arg Glu Phe Ala Asp Asn

515 520 525 4

68 • 9 9 9 9 Ser Glu Leu His Ala Glu Trp Glu Ser Ala Lys Met Ala Asn Lys Gin 530 535 540 Arg Leu Ala Gin Tyr Ile Leu His Wall Thr Gly Wall Ser Ile Asp For 545 550 555 560 Asn Ser Leu Phe Asp Ile Gin Wall Lys Arg Ile His Glu Tyr Lys Arg 565 570 575 Gin Leu Leu Asn Ile Leu Gly Wall Ile Λ Tyr with Arg Tyr Lys Lys Leu Lys 580 585 590 Gly Met Ser For Glu Glu Arg Lys Asn Thr Thr For Arg Thr Wall Met 595 600 605 Ile Gly Gly Lys Ala Phe Ala Thr Tyr Thr Asn Ala Lys Arg Ile Wall 610 615 620 Lys Leu Wall Thr Asp Wall Gly Asp Wall Wall Asn Ser Asp For Asp Wall 625 630 635 640 Asn Asp Tyr Leu Lys Wall Wall Phe Wall For Asn Tyr Asn Wall Ser Wall 645 650 655 Ala Glu Met Leu Ile For Gly Ser Glu Leu Ser Gin His Ile Ser Thr 660 665 670 Ala Gly Met Glu Ala Ser Gly Thr Ser Asn Met Lys Phe Ala Leu Asn 675 680 685 Gly Cys Leu Ile Ile Gly Thr Leu Asp Gly Ala Asn Wall Glu Ile Arg 690 695 700 Glu Glu Ile Gly Glu Asp Asn Phe Phe Leu Phe Gly Ala Thr Ala Asp 705 710 715 ’ 720 Glu Wall For Gin Leu Arg Lys Asp Arg Glu Asn Gly Leu Phe Lys For 725 730 735 Asp For Arg Phe Glu Glu Ala Lys Gin Phe Ile Arg Ser Gly Ala Phe 740 * 745 750 Gly Thr Tyr Asp Tyr Asn For Leu Leu Glu Ser Leu Glu Gly Asn Ser 755 760 765 Gly Tyr Gly Arg Gly Asp Tyr Phe Leu Wall Gly His Asp Phe For Ser 770 775 780 Tyr Met Asp Ala Gin Ala Arg Wall Asp Glu Ala Tyr Lys Asp Arg Lys 785 790 795 800 Arg Trp Ile Lys Met Ser Ile Leu Ser Thr Ser Gly Ser Gly Lys Phe 805 810 81S Ser Ser Asp Arg Thr Ile Ser Gin Tyr Ala Lys Glu Ile Trp Asn Ile 820 825 830

99 49 • · · · · 9 9 9 9

99 «9 9« 9 9

Ala Glu Cys Arg Val Pro 835 • · 9 9 9 9 9

9 9 99 99 9 9 99 9 9 (2) Information about SEQ ID NO: 5:

(i) Sequence description:

(A) Length: 3171 bp (B) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (knows) Original source:

(A) Organism: Solanum tuberosum (ix)

(A) Name / Key: CDS (B) Position: 87 ..3011 (C) Other information: Product is L-type i-glucan potato leaf phosphorylase (ix) Characteristics:

(A) Name / Key: mat_peptid (B) Position: 330 ..3008 (ix) Characters:

(A) Name / Key: sig_peptid (C) Position: 87..329 (xi) Sequence Description: SEQ ID NO: 5:

TTTTTTTTTT CAACATGGAC AACAATTATT TTGATTAAAT TTTGTATCTA AAAATTTAGC

ATTTTGAAAT TCAGTTCAGA GACATC ATG GCA ACT TTT GCT GTC TCT GGA TTG

AAC ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA ACA

161

• · ·

AAC TCA Asn Ser -55 AAC ATT TTG Leu TTG AGT Arg Arg AGG Arg ATT TTA TTT TTC AGT TTT 209 Asn Ile Leu Ser -50 Ile Leu -45 Leu Phe Ser Phe AGA AGA AGA AGA AGA AGT TTC TCT GTT AGC AGT GTT GCT AGT GAT CAA 257 Arg Arg Arg Arg Arg Ser Phe Ser Wall Ser Ser Wall Ala Ser Asp Gin -40 -35 -30 -25 AAG CAG AAG ACA AAG GAT TCT TCC TCT GAT GAA GGA TTT ACA TTA GAT 305 Lys Gin Lys Thr Lys Asp Ser Ser Ser Asp Glu Gly Phe Thr Leu Asp -20 -15 -10 GTT TTT CAG CCG GAC TCC ACG TCT GTT TTA TCA AGT ATA AAG MELT CAC 353 Wall Phe Gin For Asp Ser Thr Ser Wall Leu Ser Ser Ile Lys Tyr His -5 1 -. 5 GCT GAG TTC ACA CCA TCA TTT TCT CCT GAG AAG TTT GAA CTT CCC AAG 401 Ala Glu Phe Thr For Ser Phe Ser For Glu Lys Phe Glu Leu For Lys 10 15 Dec 20 May GCA TRAY MELT GCA ACT GCA GAG AGT GTT CGA GAT ACG CTC ATT ATA AAT 449 Ala Tyr Tyr Ala Thr Ala Glu Ser Wall Arg Asp Thr Leu Ile Ile Asn 25 30 35 40 TGG AAT GCC ACA TRAY GAA TTC MELT GAA AAG ATG AAT GTA AAG CAG GCA 497 Trp Asn Ala Thr Tyr Glu Phe Tyr Glu Lys Met Asn Wall Lys Gin Ala 45 50 55 MELT TRAY TTG TCT ATG GAA TTT CTT CAG GGA AGA GCT TTA CTC AAT GCT 545 Tyr Tyr Leu Ser Met Glu Phe Leu Gin Gly Arg Ala Leu Leu Asn Ala 60 65 70 ATT GGT AAC TTG GGG CTA ACC GGA CCT MELT GCA GAT GCT TTA ACT AAG 593 Ile Gly Asn Leu Gly Leu Thr Gly For Tyr Ala Asp Ala Leu Thr Lys 75 80 85 CTC GGA TRAY AGT TTA GAG GAT GTA GCC AGG CAG GAA CCG GAT GCA GCT 641 - Leu Gly Tyr Ser Leu Glu Asp Wall Ala Arg Gin Glu For Asp Ala Ala 90 95 100 ALIGN! , TTA GGT AAT GGA GGT TTA GGA AGA CTT GCT TCT ’ TGC TTT CTG GAC TCA 689 Leu Gly Asn Gly Gly Leu Gly Arg Leu Ala Ser Cys Phe Leu Asp Ser 105 110 115 120 ATG GCG ACA CTA AAC TRAY CCT GCA TGG GGC MELT GGA CTT AGA TRAY CAA 737 Met Ala Thr Leu Asn Tyr For Ala Trp Gly Tyr Gly Leu Arg Tyr Gin 125 - 130 135 MELT GGC CTT TTC AAA CAG CTT ATT ACA AAA GAT GGA CAG GAG GAA GTT 785 Tyr Gly Leu Phe Lys Gin Leu Ile Thr Lys Asp Gly Gin Glu Glu Wall 140 145 150 GCT GAA AAT TGG CTC GAG ATG GGA AAT CCA TGG GAA ATT GTG AGG AAT 833 Ala Glu Asn Trp Leu Glu Met Gly Asn For Trp Glu Ile Wall Arg Asn 155 160 165

• ·

71 • · • · · · • « 9 9 9 «· ·· • • ♦ GAT ATT TCG MELT CCC GTA AAA TTC MELT GGG AAG GTC ATT GAA GGA GCT 881 Asp Ile Ser Tyr For Wall Lys Phe Tyr Gly Lys Wall Ile Glu Gly Ala 170 175 180 GAT GGG AGG AAG GAA TGG GCT GGC GGA GAA GAT ATA ACT GCT GTT GCC 929 Asp Gly Arg Lys Glu Trp Ala Gly Gly Glu Asp Ile Thr Ala Wall Ala 185 190 195 200 MELT GAT C-TC CCA ATA CCA GGA MELT AAA ACA AAA ACA ACG ATT AAC CTT 977 Tyr Asp Wall For Ile For Gly Tyr Lys Thr Lys Thr Thr Ile Asn Leu 205 210 215 CGA TTG TGG ACA ACA AAG CTA GCT GCA GAA GCT TTT GAT TTA MELT GCT 1025 Arg Leu Trp Thr Thr Lys Leu Ala Ala Glu Ala Phe Asp Leu Tyr Ala 220 225 230 TTT AAC AAT GGA GAC CAT GCC AAA GCA MELT GAG GCC CAG AAA AAG GCT 1073 Phe Asn Asn Gly Asp His Ala Lys Ala Tyr Glu Ala Gin Lys Lys Ala 235 240 245 GAA AAG ATT TGC MELT GTC TTA MELT CCA GGT GAC GAA TCG CTT GAA GGA 1121 Glu Lys Ile Cys Tyr Wall Leu Tyr For Gly Asp Glu Ser Leu Glu Gly 250 255 260 AAG ACG CTT AGG TTA AAG CAG CAA TRAY ACA CTA TGT TCT GCT TCT CTT 1169 Lys Thr Leu Arg Leu Lys Gin Gin Tyr Thr Leu Cys Ser Ala Ser Leu 265 270 275 280 CAG GAC ATT ATT GCA CGG TTC GAG AAG AGA TCA GGG AAT GCA GTA AAC 1217 Gin Asp Ile Ile Ala Arg Phe Glu Lys Arg Ser Gly Asn Ala Wall Asn 285 290 295 TGG GAT CAG TTC CCC GAA AAG GTT GCA GTA CAG ATG AAT GAC ACT CAT 1265 Trp Asp Gin Phe For Glu Lys Wall Ala Wall Gin Met Asn Asp Thr His 300 305 310 CCA ACA CTT TGT ATA CCA GAA CTT TTA AGG ATA TTG ATG GAT GTT AAA 1313 For Thr Leu Cys Ile For Glu Leu Leu Arg Ile Leu Met Asp Wall Lys' 315 320 325 GGT TTG AGC TGG AAG CAG GCA TGG GAA ATT ACT CAA AGA ACG GTC GCA 1361 Gly Leu Ser Trp Lys Gin Ala Trp Glu Ile Thr Gin Arg Thr Wall Ala 330 335 340 TRAY ACT AAC CAC ACT GTT CTA CCT GAG GCT CTT GAG AAA TGG AGC TTC 1409 Tyr Thr Asn His Thr Wall Leu For Glu Ala Leu Glu Lys Trp Ser Phe 345 350 355 360 ACA CTT CTT GGT GAA CTG CTT CCT CGG CAC GTG GAG ATC ' ATA GCA ATG 1457 Thr Leu Leu Gly Glu Leu Leu For Arg His Wall Glu Ile Ile Ala Met 365 370 375 ATA GAT GAG. GAG CTC TTG CAT ACT ATA CTT GCT GAA MELT GGT ACT GAA 1505 Ile Asp Glu Glu Leu Leu His Thr Ile Leu Ala Glu Tyr Gly Thr Glu 380 385 390

GAT Asp CTT Leu GAC Asp 395 TTG Leu TTG Leu CAA GAA AAG Lys 400 CTA Leu AAC Asn CAA Gin ATG Met AGG ATT CTG GAT 1553 Gin Glu Arg 405 Ile Leu Asp AAT GTT GAA ATA CCA AGT TCT GTT TTG GAG TTG CTT ATA AAA GCC GAA 1601 Asn Wall Glu Ile For Ser Ser Wall Leu Glu Leu Leu Ile Lys Ala Glu 410 415 420 GAA AGT GCT GCT GAT GTC GAA AAG GCA GCA GAT GAA GAA CAA GAA GAA 1649 Glu Ser Ala Ala Asp Wall Glu Lys Ala Ala Asp Glu Glu Gin Glu Glu 425 430 435 440 GAA GGT AAG GAT GAC AGT AAA GAT GAG GAA ACT GAG GCT GTA AAG GCA 1697 Glu Gly Lys Asp Asp Ser Lys Asp Glu Glu Thr Glu Ala Wall Lys Ala 445 45ý 455 GAA ACT ACG AAC GAA GAG GAG GAA ACT GAG GTT AAG AAG GTT GAG GTG 1745 Glu Thr Thr Asn Glu Glu Glu Glu Thr Glu Wall Lys Lys Wall Glu Wall 460 465 470 GAG GAT AGT CAA GCA AAA ATA AAA CGT ATA TTC GGG CCA CAT CCA AAT 1793 Glu Asp Ser Gin Ala Lys Ile Lys Arg Ile Phe Gly For His For Asn 475 480 485 AAA CCA CAG GTG GTT CAC ATG GCA AAT CTA TGT GTA GTT AGC GGG CAT 1841 Lys For Gin Wall Wall His Met Ala Asn Leu Cys Wall Wall Ser Gly His 490 495 500 GCA GTT AAC GGT GTT GCT GAG ATT CAT AGT GAA ATA GTT AAG GAT GAA 1889 Ala Wall Asn Gly Wall Ala Glu Ile His Ser Glu Ile Wall Lys Asp Glu 505 510 515 520 GTT TTC AAT GAA TTT TRAY AAG TTA TGG CCA GAG AAA TTC CAA AAC AAG 1937 Wall Phe Asn Glu Phe Tyr Lys Leu Trp For Glu Lys Phe Gin Asn Lys 525 530 535 ACA AAT GGT GTG ACA CCA AGA AGA TGG CTA AGT TTC TGT AAT CCA GAG 1985 Thr Asn Gly Wall Thr For Arg Arg Trp Leu Ser Phe Cys Asn For Glu 540 545 550 TTG AGT GAA ATT ATA ACC AAG TGG ACA GGA TCT GAT GAT TGG TTA GTA 2033 Leu Ser Glu Ile Ile Thr Lys Trp Thr Gly Ser Asp Asp Trp Leu Wall 555 560 565 AAC ACT GAA AAA TTG GCA GAG CTT CGA AAG TTT GCT GAT AAC GAA GAA 2081 Asn Thr Glu Lys Leu Ala Glu Leu Arg Lys Phe Ala Asp Asn Glu Glu 570 575 580 CTC CAG TCT GAG TGG AGG AAG GCA AAA GGA AAT AAC AAA ATG AAG ATT 2129 Leu Gin Ser Glu Trp Arg Lys Ala Lys Gly Asn Asn Lys Met Lys Ile 585 590 595 600 GTC TCT CTC ATT AAA GAA AAA ACA GGA TRAY GTG GTC AGT CCC GAT GCA 2177 Wall Ser Leu Ile Lys Glu Lys Thr Gly Tyr Wall Wall Ser For Asp Ala 605 610 615

ATG TTT GAT Asp GTT Wall 620 CAG Gin ATC Ile AAG Lys CGC Arg ATC Ile 625 CAT His GAG Glu MELT Tyr AAA AGG CAG CTA 2225 Met Phe Lys Arg 630 Gin Leu TTA AAT ATA TTT GGA ATC GTT MELT CGC MELT AAG AAG ATG AAA GAA ATG 2273 Leu Asn Ile Phe Gly Ile Wall Tyr Arg Tyr Lys Lys Met Lys Glu Met 635 640 645 AGC CCT GAA GAA CGA AAA GAA AAG TTT GTC CCT CGA GTT TGC ATA TTT 2321 Ser For Glu Glu Arg Lys Glu Lys Phe Wall For Arg Wall Cys Ile Phe 650 655 660 GGA GGA AAA GCA TTT GCT ACA MELT GTT CAG GCC AAG AGA ATT GTA AAA 2369 Gly Gly Lys Ala Phe Ala Thr Tyr Wall Gin Ala Lys Arg Ile Wall Lys 665 670 675 680 TTT ATC ACT GAT GTA GGG GAA ACA GTC AAC CAT GAT CCC GAG ATT GGT 2417 Phe Ile Thr Asp Wall Gly Glu Thr Wall Asn His Asp For. Glu Ile Gly 685 690 695 GAT CTT TTG AAG GTT GTA TTT GTT CCT GAT TRAY AAT GTC AGT GTA GCA 2465 Asp Leu Leu Lys Wall Wall Phe Wall For Asp Tyr Asn Wall Ser Wall Ala 700 705 710 GAA GTG CTA ATT CCT GGT AGT GAG TTG TCC CAG CAT ATT AGT ACT GCT 2513 Glu Wall Leu Ile For Gly Ser Glu Leu Ser Gin His Ile Ser Thr Ala 715 720 725 GGT ATG GAG GCT AGT GGA ACC AGC AAC ATG AAA TTT TCA ATG AAT GGC 2561 Gly Met Glu Ala Ser Gly Thr Ser Asn Met Lys Phe Ser Met Asn Gly 730 735 740 TGC CTC CTC ATC GGG ACA TTA GAT GGT GCC AAT GTT GAG ATA AGA GAG 2609 Cys Leu Leu Ile Gly Thr Leu Asp Gly Ala Asn Wall Glu Ile Arg Glu 745 750 755 760 GAA GTT GGA GAG GAC AAT TTC TTT CTT TTC GGA GCT CAG GCT CAT GAA 2657 Glu Wall Gly Glu Asp Asn Phe Phe Leu Phe Gly Ala Gin Ala His Glu 765 770 775 ATT GCT GGC CTA CGA AAG GAA AGA GCC GAG GGA AAG TTT GTC CCG GAC 2705 Ile Ala Gly Leu Arg Lys Glu Arg Ala Glu Gly Lys Phe Wall For Asp 780 785 790 CCA ' AGA TTT GAA. GAA GTA AAG GCG TTC ATT AGG ACA GGC GTC TTT GGC 2753 For Arg Phe ’ Glu Glu Wall Lys Ala Phe Ile Arg Thr Gly Wall Phe Gly 795 800 805 ACC TRAY AAC MELT GAA GAA CTC ATG GGA TCC TTG GAA GGA AAC GAA GGC 2801 Thr Tyr Asn Tyr Glu Glu Leu Met Gly Ser Leu Glu Gly Asn Glu Gly 810 815 820 MELT GGT CGT- GCT GAC MELT TTT CTT GTA GGA AAG GAT TTC CCC GAT MELT 2849 Tyr Gly Arg Ala Asp Tyr Phe Leu Wall Gly Lys Asp Phe For Asp Tyr 825 830 835 840

·4 ·· 44

4 4

4 4 4

4 · 4 44

• 4 4 4

4 4 4

• 44

44

ATA GAG TGC CAA GAT AAA GTT GAT GAA GCA TAT CGA GAC CAG AAG AAA 2897 Ile Glu Cys Gin Asp 845 Lys Wall Asp Glu Ala 850 Tyr Arg Asp Gin Lys Lys TGG ACC AAA ATG TCG ATC TTA AAC ACA GCT GGA TCG TTC AAA TTT AGC 2945 Trp Thr Lys Met Ser Ile Leu Asn Thr Ala Gly Ser Phe Lys Phe Ser 860 865 870 AGT GAT CGA ACA ATT CAT CAA MELT GCA AGA GAT ATA TGG AGA ATT GAA 2993 Ser Asp Arg Thr Ile His Gin Tyr Ala Arg Asp Ile Trp Arg Ile Glu 875 880 885 CCT GTT GAA TTA CCT TAA AAGTTAGCCA GTTAAAGGAT GAAAGCCAAT 3041 For Val Glu Leu For ★

890.

TTTTTCCCCC TGAGGTTCTC CCATACTGTT TATTAGTACA TATATTGTCA ATTGTTGCTA 3101

CTGAAATGAT AGAAGTTTTG AATATTTACT GTCAATAAAA TACAGTTGAT TCCATTTGAA 3161

AAAAAAAAAA

3171

• · · φ · · · · 14

1 Φ • 4

11 1 4 4 ·

4 4 4

444 ··· • Φ

(2) Information ο SEQ ID ΝΟ: 6:

(i) Sequence description:

(A) Length: 975 amino acids (B) Type: amino acid (D) Topology: linear (ii) Molecule type: protein (xi) Sequence description: SEQ ID NO: 6

Met Ala Thr Phe Ala Wall Ser -75 Gly Leu Asn Ser Ile -70 Ser Ser Ile Ser -81 -80 Ser Phe Asn Asn Asn Phe Arg Ser Lys Asn Ser Asn Ile Leu Leu Ser -65 -60 -55 -50 Arg Arg Arg Ile Leu Leu Phe Ser Phe Arg Arg. Arg Arg Arg Ser Phe -45 -40 -35 Ser Wall Ser Ser Wall Ala Ser Asp Gin Lys Gin Lys Thr Lys Asp Ser -30 -25 -20 Ser Ser Asp Glu Gly. Phe Thr Leu Asp Wall Phe Gin For Asp Ser Thr -15 -10 -5 Ser Wall Leu Ser Ser Ile Lys Tyr His Ala Glu Phe Thr For Ser Phe 1 5 10 15 Dec

Ser Pro Glu Lys Phe Glu Leu Pro Lys Ala Tyr Tyr Ala Thr Ala Glu 20 25 30 4 5 9 9 9 · · »

99 »* · ··· ···

Ser Wall Arg Asp Thr Leu Ile Ile Asn Trp Asn Ala Thr Tyr Glu Phe 35 40 45 Tyr Glu Lys Met Asn Wall Lys Gin Ala Tyr Tyr Leu Ser Met Glu Phe 50 55 60 Leu Gin Gly Arg Ala Leu Leu Asn Ala Ile Gly Asn Leu Gly Leu Thr 65 70 75 Gly For Tyr Ala Asp Ala Leu Thr Lys Leu Gly Tyr Ser Leu Glu Asp 80 85 90 95 Wall Ala Arg Gin Glu For Asp Ala Ala Leu Gly Asn Gly Gly Leu Gly 100 ALIGN! 105 110 Arg Leu Ala Ser Cys Phe Leu Asp Ser Met ^ Ala Thr Leu Asn Tyr For 115 120 125 Ala Trp Gly Tyr Gly Leu Arg Tyr Gin Tyr Gly Leu Phe Lys Gin Leu 130 135 140 Ile Thr Lys Asp Gly Gin Glu Glu Wall Ala Glu Asn Trp Leu Glu Met 145 150 155 Gly Asn For Trp Glu Ile Wall Arg Asn Asp Ile Ser Tyr For Wall Lys 160 165 170 175 Phe Tyr Gly Lys Wall Ile Glu Gly Ala Asp Gly Arg Lys Glu Trp Ala 180 185 190 Gly Gly Glu Asp Ile Thr Ala Wall Ala Tyr Asp Wall For Ile For Gly 195 200 205 Tyr Lys Thr Lys Thr Thr Ile Asn Leu Arg Leu Trp Thr Thr Lys Leu 210 215 220 Ala Ala Glu Ala Phe Asp Leu Tyr Ala Phe Asn Asn Gly Asp His Ala 225 230 235 Lys Ala Tyr Glu Ala Gin Lys Lys Ala Glu Lys Ile Cys Tyr Wall Leu 240 245 250 255 Tyr For Gly Asp Glu Ser Leu Glu Gly Lys Thr Leu Arg Leu Lys Gin 260 265 270 Gin Tyr Thr Leu Cys Ser Ala Ser Leu Gin Asp Ile Ile Ala Arg Phe 275 - 280 - 285 Glu Lys Arg Ser Gly Asn Ala Wall Asn Trp Asp Gin Phe For Glu Lys

295

300

290

Val Ala Val Gin Mn Asn Asp Thr His Pro Thr Leu Cys 310 315

• «· 4 • 4 4 9

4 94 4

4 • 4 99

Leu Leu Arg

Trp Glu I Thr Gin Arg Thr Val 340

For Glu Ala Leu Glu Lys Trp Ser 355

Pro Arg His Val Glu Ile Ile Ala 370 375

Thr Ile Leu Ala Glu Thr 385 390

Lys Leu Asn Gin Met Arg

Val Leu Glu Leu Ile Lys Ala 420

Lys Ala Ala Glu Glu Glu 435

Asp Glu Glu Thr Glu Ala Val Lys 450,455

Glu Thr Glu Val Lys Val Glu 465 470

Lys Arg Ile Phe Gly For His Pro 480 485

Ala Asn Leu Cys Val Val Ser Gly 500

Ile His Ser Glu

Leu Trp Pro Glu Lys Phe Gin Asn 530,535

Arg Trp Leu Ser Phe Cys Asn Pro 545,550

Trp Thr Gly Ser Asp Asp Trp Leu 560-556

Leu Arg Lys

Ala Lys Gly Asn Asn Lys Met Lys' 595

Lys Gly Leu Ser Trp

Ala Thr Thr Asn His Thr Val Leu 345 350

Phe Thr Leu Glu Glu Leu Leu 360 365

Met Ile Asp Glu Leu Leu His 380

Glu Asp Leu Glu Glu 395

Asp Asn 'Val Glu Pro Ser Ser 410 415

Glu Glu Ser Ala Ala Val Val Glu 425 430

Glu Glu Lys Asp Asp Ser Lys 440 445

Ala Glu Thr Thr Asn Glu Glu Glu 460

Val Glu Asp Ser Gin Ala Lys Ile

Asn Lys Gin Val Val His Met 490 495

His Ala Val Asn Gly Val Ala Glu 505 510

Glu Val Phe Asn Glu Phe Tyr Lys 520

Lys Thr Asn Gly Val Thr For Arg 540

Glu Leu Ser Glu Ile Thr Lys 555

Val Asn Thr Glu Lys Leu Ala Glu 570 575

Glu Leu Gin Ser Glu Trp Arg Lys 585,590

Ile Val Ser Leu Ile Lys Glu Lys 600 605 · · · · · · ··· ··· · ···

For

Arg

630

Lys

Cys

Ile

Glu

Ser

710

Ser

Met

Ile

Ala

Wall

790

Wall

Asn

For

Gin

Lys

870

Arg

Asp Ala Met Phe Asp 615

Gin Leu Leu Asn Ile 644

Glu Met Ser Pro Glu 650

Ile Phe Gly Gly Lys 666

Val Lys Phe Ile Thr 680

Ile Gly Asp'Leu Leu 696

Val Ala Glu Val Leu 716

Thr Ala Gly Met Glu 730

Asn Gly Cys Leu Leu 744

Arg Glu Glu Val Gly 769

His Glu Ile Ala Gly 776

For Asp Pro Arg Phe 795

Phe Gly Thr Tyr Asn 810

Glu Gly Tyr Gly Arg 825

Asp Tyr Ile Glu Cys 840

Lys Lys Trp Thr Lys 854

Phe Ser Ser Asp Arg 875

Ile Glu Pro Val Glu 890. »·» »» »» »» »» »» * *

Val Gin Ile Lys 620

Phe Gly Val

Glu Arg Lys Glu 655

Ala Phe Ala Thr 670

Asp Val Gly Glu

Lys Val Val Phe 700

Ile Pro Gly Ser

Ala Ser Gly Thr 736

Ile Gly Thr Leu 750

Glu Asp Asn Phe 764

Leu Arg Lys Glu 780

Glu Glu Val Lys

Tyr Glu Glu Leu 815

Ala Asp Tyr Phe 831

Gin Asp Lys Val 844

Met Ser Ile Leu 861

Thr Ile His Gin

Leu Pro 9 * ((((((© ) Information about SEQ ID NO: 7:

(and) Sequence description: (A) Length: 27 pairs (B) Type: nucleic acid (C) Chain type: double-stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (IN) Fragment type: internal (Ví) Original source: (A) Organism: Solanum tuberosum (ix) Characters:

(A) Name / Key: CDS (B) Position: 1 ..27 (C) Other Information: Function = primer / label = SPL1 (xi) Sequence Description: SEQ ID NO: 7:

ATTCGAAAAG CTCGAGATTT GCATAGA 27 (2) Information about SEQ ID NO: 8:

(i) Sequence description:

(A) Length: 27 pairs (b) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear

(ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (IN) Fragment type: internal (Vi) Original source: (A) Organism: Solanum tuberosum (ix) Characters: (A) Name / key: misc_rys (B) Position: 1 .. 27

99 99 99 99 (C) Other information: function = primer / label = SPL2 (xi) Description of sequence: SEQ ID NO: 8:

GTTTATTTTC CATCGATGGA AGGTGGT 27 (2) Information about SEQ ID NO: 9:

(i) Sequence description:

(A) Length: 23 pairs (B) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (v) Fragment type: internal (vi) Original source:

(A) Organism: Solanum tuberosum (ix)

(A) Name / Key: misc_rys (B) Position: 1 ..23 (C) Other Information: ^ primer / label = SPH1 (xi) Sequence Description: SEQ ID NO: 9:

GTGTGCTCTC GAGCATTGAA AGC 23 (2) Information about SEQ ID NO: 10:

(i) Sequence description:

(A) Length: 25 pairs (B) Type: nucleic acid (C) Chain type: double stranded (D) Topology: linear (ii) Molecule type: DNA (genomic) (iii) Hypothetical: no (iv) Positive: no (v) Fragment type: internal (vi) Original source:

• ·· · © ·· ···· »» 9 9 9 9 9 9 9 99 9 9 99 9 9 9 9

9 9 9 9 9 9 9 9 999 999

9 9 9 9 9

999 99 99 99 99 99 (A) Organism: Solanum tuberosum (ix)

(A) Name / Key: misc_rys (B) Position: 1 .. 25 (C) Other Information: function = primer / label = SPH2 (xi) Sequence Description: SEQ ID NO: 10:

ATAATATCCT GAATCGATGC ACTGA

Claims (52)

CLAIMS 1. A potato plant having improved low temperature storage characteristics comprising a modified potato plant which exhibits a reduced activity of an α-glucan phosphorylase enzyme selected from the group consisting of tuber produced in a tuber produced by the plant relative to tubers produced by an untreated potato plant. α-glucan phosphorylase type L (GLTP) and tuber α-glucan phosphorylase type H (GHTP). Potato plant according to claim 1, characterized in that it has been transformed with an expression cassette having a plant promoter sequence operably linked to a DNA sequence which, when transcribed in the plant, inhibits expression of an endogenous α-glucan phosphorylase gene selected from the group including the GLTP gene and GHTP. 3. A potato plant having improved low temperature storage characteristics, comprising a potato plant transformed with an expression cassette, wherein the plant promoter sequence is operably linked to a DNA sequence comprising at least 20 nucleotides of the α-glucan phosphorylase gene selected from the group of including L-type α-glucan phosphorylase (GLTP) and H-type α-glucan phosphorylase (GHTP). The potato plant of claim 3, wherein the encoded α-glucan phosphorylase is GLTP. 5. The potato plant of claim 1, wherein the α-glucan is GHTP. 6. Plant 9 9 I 99 99 99 99 99 9 9 9 9 A modified sheet of claim 3, the encoded phosphorylase of claim 3, the encoded phosphorylase of a potato according to wherein the α-glucan comprises the amino acid sequence shown in SEQ ID NO: 2. The potato plant of claim 3, wherein the DNA sequence comprises at least 20 nucleotides of the α-glucan phosphorylase gene, as shown in SEQ ID NO: 1. The potato plant of claim 3, wherein the encoded α-glucan phosphorylase comprises the amino acid sequence shown in SEQ ID NO: 4. The potato plant of claim 3, wherein the DNA sequence comprises at least 20 nucleotides of the α-glucan phosphorylase gene as shown in SEQ ID NO: 3. 10. The potato plant of claim 3, wherein the DNA sequence comprises nucleotides 338-993 of SEQ ID NO: 1. 11. The potato plant of claim 3, wherein the DNA sequence comprises nucleotides 147 to 799 of SEQ ID NO: 3. • ·· ·· • 44 * · 4 4 • 4 4 4 «π <(· 4 · 4 4 444 44 ·· The potato plant of any one of claims 2 to 11, wherein the DNA sequence is linked to the promoter sequence in an antisense orientation. 13. The potato plant of claim 4, wherein the sum of the glucose and fructose concentration in the tubers of the plant measured at harvest is at least 10% lower than the sum of the glucose and fructose concentration in the tubers of the untransformed plant, also measured at harvest. 14. Plant potato according to claim 4, characterized by i like you m, the sum of the concentration glucose and fructose in tubers plants measured at harvest Yippee at least 30% less than sum of glucose concentration and fructose in tubers non-transformed plants, which is measured also at harvest. 15. Plant potato according to claim 4, characterized by i like you m, the sum of the concentration glucose and fructose in tubers plants measured at harvest Yippee at least 80% less than sum of glucose concentration and fructose in tubers non-transformed plants, which is measured also at harvest. 16. Plant potato according to claim 4, characterized by Three m, the sum of the concentration glucose and fructose in the tubers of a plant stored at 4 ° C for approximately 3 months is at least 10% lower than the sum of the glucose and fructose concentration in the tubers of the untransformed plant that are stored under the same conditions. ΦΦ ► «·· φφ« φ: · .. :: ”φφ φφ» 17. The potato plant of claim 4, wherein the sum of the glucose and fructose concentrations in the tubers of the plant stored at 4 DEG C. for about 3 months is at least 30% lower than the sum of the glucose and fructose concentrations in the tubers of the untransformed plant. which are stored under the same conditions. The potato plant of claim 4, wherein the sum of the glucose and fructose concentration in the tubers of the plant stored at 4 ° C for about 3 months is at least 39% lower than the sum of the glucose and fructose concentration in the tubers of the untransformed plant. which are stored under the same conditions. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the plant tubers at harvest, expressed as pmol NADPH per mg protein per hour, is at least 10% lower than the total α-glucan phosphorylase activity measured in tubers, untransformed plants at harvest. 20. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the plant tubers at harvest, expressed as pmol NADPH per mg protein per hour, is at least 30% lower than the total α-glucan phosphorylase activity measured in tubers, untransformed plants at harvest. 21. A potato plant according to claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant at harvesting. 9 9 9 < J 9 9 », no. . ·· · ♦ · Λ The NIPH expressed as μπιοί NADPH per mg protein per hour is at least 66% lower than the total α-glucan phosphorylase activity measured in the tubers of the untransformed plant at harvest. 22. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 3 months and expressed as μAD of NADPH per milligram of protein per hour is at least 10% lower than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. A potato plant according to claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for approximately 3 months, expressed as μAD of NADPH per milligram of protein per hour, is at least 30% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 3 months, expressed as μAD of NADPH per milligram of protein per hour, is at least 70% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. 25. The potato plant of claim 5, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 3 months, expressed as μπιοί. * · · 1 · 1 1 1 1 1 1 1 1 ui NADPH per milligram of protein per hour is at least 10% lower than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 5, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 3 months, expressed as pmol of NADPH per milligram of protein per hour, is at least 28% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 6 months, expressed as ymol NADPH per milligram of protein per hour, is at least 10% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 6 months, expressed as pmol of NADPH per milligram of protein per hour, is at least 30% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 4, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 6 months, expressed as pmol. SHEET at least 69% lower, NADPH per milligram of protein per hour is greater than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 5, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 6 months, expressed as pmol of NADPH per milligram of protein per hour, is at least 10% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 5, wherein the total α-glucan phosphorylase activity measured in the tubers of the plant stored at 4 ° C for about 6 months, expressed as pmol of NADPH per milligram of protein per hour, is at least 39% lower, than the total α-glucan phosphorylase activity measured in the tubers of a untransformed plant stored under the same conditions. The potato plant of claim 4, wherein the tuber flakes score measured at harvest is at least 5% higher than the tuber flakes score of the untransformed plant also measured at harvest. 33. The potato plant of claim 4, wherein the tuber chip score measured at harvest is at least 30% higher than the tuber chip score of the untransformed plant also measured at harvest. · • 4 4 4 4 4 4 4 4 4 4 4 34. A plant indicating the plants measured at the tuber crops score of the harvest. potato according to the claim that the harvest score is at least 46 untransformed plants of claim 4, tuber flakes% higher than measured also at The potato plant of claim 5, wherein the tuber flakes score measured at harvest is at least 5% higher than the tuber flakes score of the untransformed plant also measured at harvest. 36. The potato plant of claim 5, wherein the tuber flakes score measured at harvest is at least 10% higher than the tuber flakes score of the untransformed plant measured also at harvest. 37. The potato plant of claim 4, wherein the tuber flare score of the plant stored at 4 ° C for about 3 months is at least 5% higher than the tuber flare score of the untransformed plant stored under the same conditions. 38. The potato plant of claim 4, wherein the tuber flare score of the plant stored at 4 ° C for about 3 months is at least 30% higher than the tuber flare score of the untransformed plant stored under the same conditions. 39. A potato plant characterized in that the plants stored at the temperature of claim 4, wherein the tuber flakes score of 4 ° C for about 3 months is at least 89% higher than the tuber flakes score of the untransformed plant stored under the same conditions. The potato plant of claim 5, wherein the tuber flare score of the plant stored at 4 ° C for about 3 months is at least 5% higher than the tuber flare score of the untransformed plant stored under the same conditions. 41. The potato plant of claim 5, wherein the tuber flare score of the plant stored at 4 ° C for about 3 months is at least 10% higher than the tuber flare score of the untransformed plant stored under the same conditions. 42. The potato plant of claim 4, wherein the tuber flare score of the plant stored at 4 ° C for about 4 months is at least 5% higher than the tuber flare score of the untransformed plant stored under the same conditions. 43. The potato plant of claim 4, wherein the tuber flare score of the plant stored at 4 ° C for about 4 months is at least 30% higher than the tuber flare score of the untransformed plant stored under the same conditions. 44. The potato plant of claim 4, wherein the tuber flare score of the plant stored at 4 ° C for about 4 months is at least 89% higher than the tuber flare score of the untransformed plant stored under the same conditions. «9« • 9 • · · • 9 9 • 9 9 9 « 9 9 9 9 9 9 • 9 fl 99 99 • * i.h Softened by ÚST 45. A potato plant characterized in that the plants stored at the temperature of the moons are at least 5% higher, according to claim 5, that the tuber flare score of 4 ° C for about 4 is the tuber flare score of the untransformed plant stored under the same conditions. 46. The potato plant of claim 5, wherein the tuber flakes score of the plant stored at 4 ° C for about 4 months is at least 25% higher than the tuber flakes score of the untransformed plant stored under the same conditions. 47. A method of improving potato tuber storage characteristics at low temperature, comprising providing a potato plant that has been modified to reduce activity in the tubers by α-glucan phosphorylase enzymes selected from the group consisting of L-type α-glucan phosphorylase enzymes ( GLTP) and tuber α-glucan phosphorylase type H (GHTP). 48. The method of claim 47, comprising introducing an expression cassette into the potato plant, wherein the plant promoter sequence is operably linked to a DNA sequence that, when transcribed in the plant, inhibits expression of the endogenous α-glucan phosphorylase gene selected from the group comprising the GLTP gene and GHTP. 49. A method for improving low temperature storage characteristics of potato tubers, comprising introducing an expression cassette into a potato plant, wherein the plant promoter sequence is operably linked to a DNA sequence comprising at least 20 nucleotides of the α-glucan phosphorylase gene selected from the group • ·· 44 • 4 · • · »» • ·· 4 · 4 4 4 • · «5 44 44 • 4 More USP including α-glucan tuber phosphorylase type H-glucan phosphorylase (GHTP) type L (GLTP) 50. The method of claim 49, wherein the encoded alpha-glucan phosphorylase is GLTP. 51. The method of claim 49, wherein the encoded alpha-glucan phosphorylase is GHTP. 52. The method of claim 49, wherein the encoded α-glucan phosphorylase comprises the amino acid sequence shown in SEQ ID NO: 2. 53. The method of claim 49, wherein the DNA sequence comprises at least 20 nucleotides of the gene encoding α-glucan phosphorylase shown in SEQ ID NO: 1. 54. The method of claim 49, wherein the encoded alpha-glucan phosphorylase comprises the amino acid sequence shown in SEQ ID NO: 4. 55. The method of claim 49, wherein the DNA sequence comprises at least 20 nucleotides gene encoding 3. α-glucan phosphorylase shown in SEQ ID NO: 56. Way cf claim 49 her c í s e that the DNA sequence comprises nucleotides 338 to 993 SEQ ID NO: 1. . “Í ^ ĚN ^ ý us? • · ·· · 57. Way of cop claim 49, confess C ují c i s e in that the DNA sequence comprises nucleotides 147 až 799 SEQ ID NO: 3. 58. Method according to any of claims 48 to 57, v y marking with that sequence DNA Yippee linked to a promoter sequence in an antisense orientation.