CZ2015764A3 - An expression system and the method of expression of proteins in plants - Google Patents

Abstract

The solution provides an expression system for the biologically safe expression of at least one recombinant protein in plants, comprising a) an expression cassette for producing an RNA dependent RNA polymerase of tobamovirus, wherein the coding region of the RdRp gene is not flanked by authentic 5 ' and 3 ' NTR regions derived from the same virus as RdRp, but NTR regions from another virus or plant gene; b) an expression cassette for producing P19 gene silent repressor from tombusvirus; and c) at least one production cassette for producing mRNA comprising the following elements, respectively; Tobamovirus 5, a subgenomic promoter of the tobamovirus coat protein, at least one gene encoding the recombinant protein to be expressed in the plant, 3NTR tobamovirus, and a ribozyme for proper splicing of the mRNA at the end of the tobamovirus.

Description

Field of technology

The present invention relates to an expression system, vectors and method for biologically safe expression of recombinant proteins in plants.

Prior art

Expression vectors based on plant viruses are very often used today for the expression of recombinant proteins with high added value in plants, both on a laboratory scale and, increasingly, on a pilot or commercial scale. The advantage of using replicating viral vectors is in particular the high yield of expressed protein and the relatively high rate at which the produced protein can be isolated from the plant, which ranges from a few days to several weeks. However, current methods have a number of shortcomings. These include, for example, the need to infect a plant with either a complete recombinant plant virus or viral RNA. Recently, the use of a binary plasmid inserted into A. tumefaciens has been popular. A. tumefaciens is then infiltrated into a leaf, root, or suspension cell culture, and viral infection is initiated from the transcribed RNA. The advantage of using A. tumefaciens to initiate viral infection is that even viruses or viral vectors that do not form complete viral particles can be easily used. Such vectors occur or propagate in the plant only as free RNA and are therefore not easily transferable either mechanically or by a natural vector. This ensures biological safety.

However, replicating viral vectors also have some disadvantages, including instability of the inserted DNA / RNA regions, which limits the size of the expressed gene to about 1.5 kb. Another major limitation is the inability to use a replicating viral vector to simultaneously express multiple proteins in a single plant cell. Last but not least, in some cases it is technically difficult to insert additional DNA sequences into the binary vector containing the complete infectious cDNA of the plant virus, ensuring the expression of the desired recombinant protein.

Object of the invention

The present invention provides an expression system for the biologically safe expression of at least one recombinant protein in plants which it contains

a) an expression cassette producing RNA-dependent RNA polymerase (RdRp) of tobamovirus, wherein the coding region of the RdRp gene is not flanked by authentic 5 ‘and 3‘ NTR regions derived from the same virus as RdRp, but by NTR regions from another virus or plant gene;

..... * ..... * · -. *.: .. .. * χ

b) an expression cassette producing the P19 gene silencing repressor from tombusvirus; and

c) at least one production cassette that produces mRNA containing the following elements in that order: tobamovirus 5'NTR, tobamovirus envelope protein subgenomic promoter, at least one gene encoding recombinant protein to be expressed in the plant, tobamovirus 3'NTR and ribozyme for proper mRNA splicing at the 3'NTR end of tobamovirus.

In a preferred embodiment, these expression and production cassettes are located in the T-DNA regions of binary vectors capable of replication in E. coli and Agrobacterium sp. Preferably, both constant expression cassettes are located in the T-DNA of a single binary plasmid. Alternatively, however, they may each be located in a separate binary plasmid. Preferably, in the invention, the gene to be expressed in the plant is inserted into a small production plasmid without the need to interfere with the supporting functions necessary to achieve a high level of expression, i.e. the viral replicase and the gene silencing suppressor.

A cloning method based on the GoldenGate technique can be used to generate plasmids carrying expression cassettes.

An advantage of the invention is that it is based on the replication mechanism of tobamovirus. The invention takes advantage of the fact that the viral RnRp is able to specifically recognize RNA structures located at the 5 'and 3' ends of the viral RNA and to replicate the recognized RNA containing these structures. Thus, the replicase gene can be placed on a separate gene construct, which contract is modified so that the mRNA for RdRp polymerase does not contain terminal structures recognized by this polymerase, and simultaneously express in the plant cell additional mRNA from another separate plasmid containing structures recognized at its ends. viral RdRp and is thus enhanced by the activity of the RdRp enzyme. Because none of the gene constructs contain the viral envelope protein gene or the RNA structure required for encapsidation of viral particles, such RNA is not able to spread systemically in a plant, nor can it be mechanically transferred to another plant.

Preferably, plasmids capable of replication in both E. coli and Agrobacterium sp (e.g. A. tumefaciens or A. rhizogenes) are used as vectors.

In addition, the plasmid may contain genes that facilitate selection in bacteria and / or in the plant host, such as antibiotic resistance genes, herbicides, and other genes known to those skilled in the art.

In a preferred embodiment, the tobamovirus is tobacco mosaic virus (TMV). TMV is a plant virus with a 6.5 kb ssRNA positive genome producing rod-shaped particles 300 nm long and 18 nm in diameter.

Preferably, the RNA-dependent RNA polymerase (RdRp) -producing cassette comprises a 5 'NTR sequence of an etched tobacco mosaic virus (TEV).

Preferred vectors of the invention allow significantly easier cloning of gene constructs for expression, as most of the genes and functions necessary to achieve high levels of expression are located on a constant helper plasmid that does not need to be altered or modified in any way between experiments. All necessary changes take place on a smaller binary plasmid, the size of which does not exceed

4.1 kB (excluding the size of the inserted gene for expression in plants). Due to the small size of the vector and the derived RNA, the vectors of the invention can also be used to express larger genes than is possible with a vector based on replicating complete viral RNA. It has also been surprisingly observed that the vectors of the invention allow the simultaneous expression of multiple proteins in the same plant cell.

In a preferred embodiment, the invention further provides a helper constant plasmid comprising two expression cassettes. The first cassette contains the Tobamovirus RNA-dependent RNA polymerase gene, in a preferred embodiment it is the RdRp of the Tobacco Mosaic Virus.

Preferably, one or both of the constant expression cassettes are inserted into the plasmid under the control of suitable regulatory sequences that allow for the production of mRNA in the plant cell, such as the CaMV35S, actin, ubiquitin, and NOS terminator promoters.

RdRp may advantageously contain one or more introns that improve plasmid stability in E. coli and transport of RdRp mRNA from the cell nucleus to the cytoplasm (Marillonnet, et al. Systemic Agrobacterium tumefaciens-mediated transfection of viral replicons for efficient transient expression in plants. biotechnology 23.6 (2005): pp. 718-723).

Furthermore, the present invention relates to a method for obtaining proteins in plants by expression using an expression system according to the invention, wherein the following are introduced into a plant cell:

a) an expression cassette producing RNA-dependent RNA polymerase (RdRp) of tobamovirus, wherein the coding region of the RdRp gene is not flanked by authentic 5 ‘and 3‘ NTR regions derived from the same virus as RdRp, but by NTR regions from another virus or plant gene;

b) an expression cassette producing the P1 gene silencing repressor from tombusvirus; a ·· <* '.......

c) at least one production cassette that produces mRNA containing the following elements in that order: tobamovirus 5'NTR, tobamovirus envelope protein subgenomic promoter, at least one gene encoding recombinant protein to be expressed in the plant, tobamovirus 3'NTR and ribozyme for proper mRNA splicing at the 3'NTR end of tobamovirus.

Expression and production cassettes can be introduced into a plant by any known method, for example, by in-vitro transcription RNA infection, mechanically by plasmid DNA or viral particles, biolistically or by agroinfiltration.

If agroinfiltration is used, it is advantageous to select plants in which high agroinfiltration efficiency is achieved, for example Nicotiana benthamiana plants.

In infiltrated plants, only RNA corresponding to a variable production gene construct replicates, in which there is no gene for the envelope protein or a signal for RNA encapsidation. These sequences also do not contain an auxiliary constant gene construct. Thus, RNA is not able to spread systemically in these plants and is also prevented from being transmitted mechanically or by a natural vector, such as an insect, in the event of a concomitant unintentional infection with a complete wild-type virus.

After expression of the protein, the recombinant proteins formed can be obtained from the plant, for example by extraction.

The invention is further described by means of the appended examples, which, however, do not limit the claimed scope in any way.

Description of the picture

Figure 1: The figure schematically shows the structure of the genome of the tobacco mosaic virus, a type representative of the genus Tobamovirus. The genome consists of the following parts: the 5 'untranslated region (5'NTR), a gene for RNA-dependent RNA polymerase (126/183 kDa protein), which is translated in two forms by stop codon suppression, a gene for viral movement protein (MP) virus envelope protein (CP) gene and 3 'untranslated region (3'NTR). The viral RNA has a cap structure at the 5 'end and does not contain a poly-A 3' end. The figure shows the MP and CP subgenomic promoters.

Figure 2. The figure schematically shows two plasmids for the expression of proteins in plants according to the invention. The constant plasmid contains an expression cassette producing RNA-dependent RNA polymerase (RdRp) of tobamovirus under a strong promoter. The ORF for RdRp is not flanked by NTR regions from tobamovirus, but contains heterologous 5 'and 3' NTR regions. The second expression cassette produces the P19 gene silencing repressor of ztombus virus. The second variable production plasmid contains an mRNA-producing expression cassette comprising the following parts: the 5'NTR of tobamovirus, the subgenomic promoter of the tobamovirus envelope protein, the protein encoding the region of the gene to be expressed in the plant (GOI), the 3 'NTR of tobamovirus and the ribozyme.

Figure 3: Figure shows a binary plasmid map for TobRovir RdRp expression in pDBlal: 35S-Rep plants. The plasmid contains a strong 35S promoter from Cauliflower Mosaic Virus (CaMV), a 5 'translation enhancer from etched tobacco mosaic virus, a tobacco mosaic virus RdRp gene in which a tobacco acid peroxidase intron is inserted, and a Nos transcription terminator. The vector carries a kanamycin resistance marker for selection in E. coli and A. tumefaciens and origins of replication for both microorganisms.

Figure 4: The figure shows a map of the constant helper binary vector pDB1021: Rep-P19. In addition to the tobamovirus RdRp expression cassette, which is identical to that in the pDBlal: 35S-Rep vector shown in Figure 3, it further contains a ztombusvirus P19 gene silencing suppressor expression cassette. This cassette contains the 35S promoter from CaMV, the P19 suppressor gene and the Nos terminator.

Figure 5: The figure shows a map of the variable production plasmid pDBlal: VV-GFP, in which there is an expression cassette for the expression of a green fluorescent protein. The plasmid contains the functional parts of the 35S promoter from the mosaic virus, 5 NTR region from the tobacco mosaic virus (TMV), the TMV envelope protein subgenomic promoter, the green fluorescent protein gene, the 3 NTR region of TMV, the ribozyme allowing cleavage of the resulting mRNA at the 3NTR end of TMV and a nose terminator. The vector carries a kanamycin resistance marker for selection in E. coli and A. tumefaciens and origins of replication for both microorganisms.

Examples of embodiments of the invention

Example 1: Preparation of a constant binary plasmid

A constant binary plasmid is prepared using recombinant DNA techniques well known to those skilled in the art. The vector is in the form of a plasmid containing a cDNA copy of the RdRp plant virus of the genus Tobamovirus. In a preferred embodiment, the production plasmid contains a cDNA copy of the RdRp of the tobacco mosaic virus TMV. For use in the present invention, it is important that the coding region of the RdRp gene is not delimited by authentic 5 ‘and 3‘ NTR regions derived from the same virus as RdRp, but by NTR regions from another virus or plant gene. In addition, this plasmid contains a second expression cassette producing the P19 gene silencing suppressor from Tombusvirus. Both gene cassettes are under the transcriptional control of suitable regulatory sequences, such as the promoters of CaMV35S, actin, ubiquitin, and transcription terminators such as the Nos terminator derived from A. tumefaciens and the like. These two expression cassettes can advantageously be placed in the T-DNA of the same plasmid, or they can be delivered to a plant cell on two isolated plasmids. Plasmids are capable of replication in both E. coli and Agrobacterium sp (e.g., A. tumefaciens or A. rhizogenes). In addition, such a plasmid may contain genes that facilitate selection in bacteria and / or in the plant host, such as antibiotic or herbicide resistance genes.

In this example, plasmid pGR2i-dCP: GFP, GenBank: KF981446.1 was used as the starting vector.

An infectious cDNA copy of TMV under the control of the CaMV35S promoter is inserted into this plasmid, and the ribozyme and NOS transcription terminator are located at the 3 'end of the viral cDNA. An intron from tobacco acid peroxidase is inserted into the replicase gene, which increases the stability of the gene in E. coli and facilitates the translocation of mRNA from the nucleus to the cytoplasm of the plant cell. The whole cassette is placed on T-DNA, the antibiotic kanamycin can be used for selection in bacteria. The TMR RdRp gene was amplified from the plasmid using primers

RdRplF: GCGCCGTCTCGCTCGAATGATGGCATACACACAGACAGC

RdRp 1R: GCGCCGTCTCGCTCGAAGCTTAACAACTAGAGCCGTCTATAAA

Phusion Taq Polymerase, (Thermo) and the following program were used for amplification:

initial denaturation 98 ° C 30 seconds 30 cycles 98 ° C 15 seconds 60 ° C 15 seconds 72 ° C 2.5 minutes

Amplification yields a 4.9 kb PCR product, which is purified by QIAquick PCR cleanup column (Qiagen) and inserted into the domestication plasmid pUPD1 by restriction ligation (see SarrionPerdigones, et al. GoldenBraid 2.0: A Comprehensive DNA Assembly Framework for Plant Synthetic Biology ”, Plant Physiology (2013)). 75 ng of PCR product, 75 ng of plasmid pUPD1, 1 μl of 10 x Promega ligation buffer, 1 μΙ of Promega T4 ligase, 1 μΐ of BsmBI enzyme (LifeTechnologies) and water to 10 μΐ are added to the reaction. The reaction is allowed to proceed for 25 cycles in the following program. 25 cycles 37 ° C 2 minutes ° C 5 minutes

After cycling, the following steps are added:

37 ° C 5 minutes ° C 15 minutes

The resulting recombinant plasmid was transformed into competent E. coli TOP10 cells and plated on LB plates containing 100 pg / ml carbenicillin and 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Xgal). After 18 hours of incubation at 37 ° C, white colonies were picked and used to isolate plasmid DNA, and the correct recombinant clones were verified by restriction digestion and sequencing.

The entire expression cassette is then ligated into the binary vector pDBlalfal (Sarrion-Perdigones et al. (2013)) together with the CaMV35S promoter and NOS terminator by restriction ligation reaction and the enzyme Bsal. Briefly, 75 ng of each of the plasmids, 1 μΐ of 10 x Promega ligation buffer, 1 μΐ of Promega T4 ligase, 1 μΐ of Bsal enzyme (LifeTechnologies) and water to 10 μΐ are placed in a 0.2 ml microtube. The reaction is allowed to proceed for 25 cycles in the following program.

cycles 37 ° C 2 minutes ° C 5 minutes

After cycling, add the following steps

37 ° C 5 minutes ° C 15 minutes

The resulting recombinant plasmid was transformed into competent E. coli TOP10 cells and plated on LB plates containing 100 pg / ml kanamycin and 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (Xgal). After 18 hours of incubation at 37 ° C, white colonies were picked and used to isolate plasmid DNA, and the correct recombinant clones were verified by restriction digestion and sequencing. A map of the resulting plasmid called pDBla1: 35S-Rep is shown in Figure 3. A cassette for the expression of the P1 gene suppressor of P19 tombusvirus was prepared in a similar manner to give a plasmid called pDBla2: 35S-P19, or an already prepared cassette can be used (GB0108, https database: //gbcloning.upv.es/). The resulting plasmids can be combined by restriction-ligation reaction with the enzyme BsmBI into one vector called pDB102: Rep-P19, which is shown in the figure

4.

Example 2: Preparation of a variable binary expression vector for GFP expression

In a similar way as in the preparation of a constant binary expression vector, the procedure for the preparation of the variable part will be followed. First, a) the promoter region and the 5’NTR of the tobacco mosaic virus and b) the 3’NTR, ribozyme and Nos-Terminator region must be obtained by PCR amplification from the vector pGR2idCP-GFP, GenBank: KF981446.1, by PCR amplification. The following primers are used for this:

GB2-35S-F: GCGCCGTCTCGCTCGGGAGACACGCTTGTCTACTCCAAAA

GB2-OmegaR GCGCCGTCTCGCTCGCATTGGTGATGTAATTGTAAATAGTAATTG A 507 bp amplicon with primers is generated

GB2-3 'NTR-F: GCGCCGTCTCGCTCGGCTTTGACCTCTGGTCCTGCAACT

GB2-NOS-R: GCGCCGTCTCGCTCGAGCGATCAGGCGCCATTCGCCATT produces an 890 bp amplicon. The PCR products were purified on a column and inserted into the starting plasmid pUPD1 in the same manner as in Example 1 by restriction ligation with the enzyme BsmBI to give plasmids pUPD1: 35S-5’NTR and pUPD1: 3’NTR-NosT. The correct recombinant plasmids are verified by restriction digestion and sequencing. The variable expression cassette for use in plants is then assembled by a reticative ligation reaction with the enzyme Bsal. 75 ng of each plasmid (pDBla2, pUPD1: 35S-5'NTR, pUPD1: 3'NTR-NosT and pUPDLGFP (GB0059), 1 μΐ 10 x Promega ligation buffer, 1 μΐ Promega T4 ligase, 1 μΐ T4 ligase, is added to a 0.2 ml microtube. 1 μΐ Bsal enzyme (LifeTechnologies) and water up to 10 μΐ The reaction is allowed to proceed for 25 cycles in the following program.

cycles 37 ° C 2 minutes ° C 5 minutes

After cycling, add the following steps

37 ° C 5 minutes ° C 15 minutes

The bacteria are then selected on LB plates with kanamycin and X-gal, and the correct recombinant clones are verified by restriction digestion and sequencing. A map of the resulting plasmid named pDBlal: VV-GFP is shown in Figure 5.

Example 3: Transient expression of a model GFP protein in N. benthamiana plants

The validated recombinant plasmids according to Examples 1 and 2 are transformed into competent cells of A. tumefaciens strain GV3101 according to the method of Hofgen and Willimitzer (Hofgen, R. & Willmitzer, L. (1988). Storage of competent cells for Agrobacterium transformation. Nucleic acids research 16, 9877 ).

Stock glycerol cultures were prepared from isolated kanamycin-resistant colonies and stored at -78 ° C. 5 ml of LB medium with the selection antibiotic is inoculated with A. tumefaciens from a stock culture carrying the production variable plasmid and at the same time another 5 ml of LB medium is inoculated with A. tumefaciens with an auxiliary constant plasmid. The cultures are incubated on a shaker at 28 ° C for 36 hours. The medium used is then removed by centrifugation for 10 minutes at 5000x g and the bacterial pellet is resuspended in infiltration medium (10 mM MgCl 2; 10 mM MES and 100 μΜ acetosyringone, (see Bazzini, AA, Mongelli, VC, Hopp, E., del. Vas, M. & Asurmendi, S. (2007), A practical approach to the understanding and teaching of RNA silencing in plants (Electronic Journal of Biotechnology 10, 179-190) so that the resulting optical density is OD ₆₀ o = 0, 3. The bacterial suspension is allowed to stand for a further 2 to 4 hours at room temperature, infiltrating itself by applying the bacterial suspension using a 1 ml syringe without a needle to the underside of the leaves of N. benthamiana plants about 3-4 weeks old. spread of GFP in infected plants using a portable UV-lamp and a yellow filter The amount of recombinant protein produced can be measured by any suitable method well known to those skilled in the art, for example by ELISA, immunoblotting or, in the case of GFP, by direct fluorescence measurement. using a fluorometer. Table 1 shows the results of an experiment in which plants were first inoculated with each of the viral vectors individually and then with a combination thereof. Only when the viral replicase, the P19 gene silencing suppressor, and the variable expression cassette flanked by the NTR regions of tobamovirus are co-expressed in the plant cell does GFP gene be strongly expressed.

Table 1: Fluorescence values of the plant extracts from Example 3

Agrobacterium used for infiltration GFP fluorescence (RFI) ± SEM (460/10 nm exc, 530/20 em) none 2532 ± 650 blank vector 4523 ± 721 pDBIO2: 35S-Rep; 35S-P19 4361 ± 675 pDBlal: W-GFP 12326 ± 1020 pDB102: 35S-Rep; 35S-P19 + pDBlal: VV-GFP 41550 ± -2530

Example 4: Simultaneous transient expression of two proteins in N. benthamiana plants

Simultaneous expression of two fluorescent proteins with different emission characteristics can be used to verify the simultaneous expression of two viral vectors in the same cell. For example, the green fluorescent protein gene (480 nm excitation, 525 nm emission) and the mCherry protein gene (587 nm excitation, 610 nm emission) can be used simultaneously. In a manner similar to that described in Example 2, the variable binary expression vector pDBlal: VV-mCherry was generated. The sequence-validated plasmid is used to transform A. tumefaciens GV3101. In this example, the leaves of N. benthamiana plants are infiltrated simultaneously with three cultures of A. tumefaciens - the first culture carries the helper constant construct pDB102: 35S-Rep: P19 with cassettes for RdRp and for the P19 suppressor, the second carries the variable expression plasmid pDBlal: VV-GFP and the third is pDBIal: VV-mCherry. 5 days after infiltration, protoplasts were prepared from the infiltrated leaves, as described by Giritch et al. Rapid high-yield expression of fullsize IgG antibodies in plants coinfected with noncompeting viral vectors. Proceedings of the National Academy of Sciences 103.40 (2006): 14701-14706. The leaves were cut with a razor blade into approximately 1 mm thick strips and then macerated overnight in 0.4% Onozuka R-10 cellulase solution and 0.4% R-10 macerozyme (both Duchefa). The released protoplasts were filtered through a fine nylon cloth and observed under a fluorescence microscope (Leica) equipped with appropriate filters. In cells from leaves infiltrated with all three constructs, the signal of both fluorescent proteins was observed.

Example 5: Mechanical transfer of a vector according to the invention

For the biosafety of plant virus-based vectors, their ability to spread beyond plants intended for recombinant protein expression is important. It is advantageous if the ability of these vectors to spread outside the desired plant is reduced or completely prevented, even if the experimental plants are contaminated with a related wild-type virus.

N. benthamiana plants were co-infiltrated with A. tumefaciens with the following vectors pDB102: 35SRep: 35S-P19 and pDBlal: W-GFP in the same manner as Example 3.

days after infiltration, GFP fluorescence was observed in the inoculated leaves. The leaves were then mechanically inoculated with a 20 μΐ virus suspension containing 10 pg / ml wild-type tobacco mosaic virus (wt TMV) in 20 mM phosphate buffer, pH 7.5. After another 4 days, the leaves clearly showed signs of viral infection, yellowing of the leaves, incipient necrosis of the conductive tissues, and a tendency to grow. Sectors showing GFP fluorescence were excised from the leaf with a cork borer and homogenized in 20 mM phosphate buffer, pH 7.5. Plant tissue residues were removed by centrifugation and the clear extract was used as an inoculum (1/100 dilution) for mechanical transfer to N. benthamiana leaves. Three days for secondary transfer, the leaves were observed under a fluorescence microscope and cells showing GFP fluorescence were searched. QPCR was used as the second independent method to determine the potential for inadvertent spread of the viral vector. The clear extract from the infected leaves was left at room temperature for 2 hours. During this time, most cytoplasmic mRNAs are partially or completely degraded. However, the RNA that is hidden inside the viral particles remains intact. After two hours, RNA was isolated from the extract using RNAzol reagent (MRC, Ohio, USA) according to the manufacturer's recommendations. The primer 3NTR-TMV was used for cDNA synthesis, which is complementary to both viral RNA and kRNA derived from the viral vector pDBlal: VV-GFP. The transcribed cDNA was diluted 1:20 and then analyzed by qPCR on a Light Cycler 2.0 instrument (Roche) using the DyNAmo-Capillary SYBR® Green qPCR Kit (Thermo) according to the manufacturer's recommendations. While detection of envelope protein (CP-TMV), which occurs only in genomic RNA of wt virus, was successful as early as 19 cycles +/- 1 cycle, detection with GFP-specific primers was at the background level (N. benthamiana infected only with wt TMV virus, without vector pDBlal: VV-GFP) i.e. 33rd cycle +/- 2 cycles. Both independent methods indicate that the RNA derived from the variable production plasmid of the invention is not effectively protected by the envelope protein of the virus in the viral particles, which significantly reduces the risk of its accidental transfer to the non-citrine plant.

Table 2: Primers used for qPCR detection of GFP / CP-TMV in virus particles

Name Sequence 3NTR-TMV gcaccacgtgtgattacggacacaatc qGFP-S TTTCTGTCAGTGGAGAGGGT qGFP-AS CGTGTCTTGTAGTTCCCGTC qCPTMV-S CACTACTCCATCTCAGTTCGT qCPTMV-AS AACAGTTACTTGTGGTGAAGG

Claims (10)

PATENT CLAIMS An expression system for the biologically safe expression of at least one recombinant protein in plants, characterized in that it comprises a) an expression cassette for the production of tobamovirus RNA-dependent RNA polymerase, wherein the coding region of the RdRp gene is not flanked by authentic 5 ‘and 3‘ NTR regions derived from the same virus as RdRp, but by NTR regions from another virus or plant gene; b) an expression cassette for the production of the P19 gene silencing repressor from tombusvirus; and c) at least one production cassette for mRNA production comprising the following elements in that order: 5'NTR of tobamovirus, subgenomic promoter of tobamovirus envelope protein, at least one gene encoding recombinant protein to be expressed in the plant, 3'NTR of tobamovirus and ribozyme for correct splicing mRNA at the 3'NTR of tobamovirus. Expression system according to claim 1, characterized in that it comprises plasmids carrying the expression and / or production cassettes according to claim 1, wherein the expression and / or production cassettes are located in the T-DNA regions of the binary vectors. The expression system of claim 2, wherein both expression cassettes are located in the T-DNA of a single binary plasmid and the production cassette is located in the T-DNA of another plasmid. Expression system according to claim 2 or 3, characterized in that the plasmids contain genes for selection in bacteria and / or in a plant host, preferably selected from antibiotic and herbicide resistance genes. Expression system according to any one of the preceding claims, characterized in that the tobamovirus is a tobacco mosaic virus, and preferably comprises a cassette for producing RNA-dependent RNA polymerase 5 'NTR sequence of an etched tobacco mosaic virus. Expression system according to any one of claims 2 to 5, characterized in that one or both expression cassettes are placed in a plasmid under the control of regulatory sequences selected from the promoters CaMV35S, actin, ubiquitin and NOS terminator. Expression system according to any one of the preceding claims, characterized in that the cassette for the production of RNA-dependent RNA polymerase contains one or more introns improving the stability of the plasmid in E. coli and the transport of RdRp mRNA from the cell nucleus to the cytoplasm. A method for obtaining proteins in plants by expression using an expression system according to any one of the preceding claims, characterized in that the following are introduced into the plant cell: a) an expression cassette producing RNA-dependent RNA polymerase (RdRp) of tobamovirus, wherein the coding region of the RdRp gene is not flanked by authentic 5 ‘and 3‘ NTR regions derived from the same virus as RdRp, but by NTR regions from another virus or plant gene; b) an expression cassette producing the P19 gene silencing repressor from tombusvirus; and c) at least one production cassette that produces mRNA containing the following elements in that order: tobamovirus 5'NTR, tobamovirus envelope protein subgenomic promoter, at least one gene encoding recombinant protein to be expressed in the plant, tobamovirus 3'NTR and ribozyme for proper mRNA splicing at the 3'NTR end of tobamovirus. The method according to claim 8, characterized in that the cassettes are introduced into the plant cell by a method selected from in-vitro infection by transcribed RNA, mechanically by means of plasmid DNA or viral particles, biolistically or by agroinfiltration. The method according to claim 8 or 9, characterized in that the plants are Nicotiana benthamiana plants.