CZ20004088A3 - Transgenic plants with modified activity of plastidial ADP/ATP translocator - Google Patents

Abstract

Transgenic plant cells and plants are described compared to wild-type cells and plants increased yield, especially increased oil content and / or starch and preferably synthesize the modified starch. Described plants show increased or decreased activity ADP / ATP plastid transporter.

Description

Transgenic plants with modified ADP / ATP transporter activity

Technical field

The invention relates to transgenic plant cells and plants with increased ATP / ADP transporter activity. Such cells and plants are characterized by a higher yield, preferably an increased oil and / or starch content, and are preferably synthesized starch with an increased amylose content.

Furthermore, the present invention relates to transgenic plant cells and plants with reduced ADP / ATP transporter activity. Such cells and plants synthesize starch with a lower amylose content.

BACKGROUND OF THE INVENTION

In agriculture and forestry, there is an ongoing effort to obtain plants with higher yields, in particular to ensure that the food requirements of an ever-growing population are sufficiently met and that stocks of regenerating raw materials are kept secure. In the traditional concept, such plants are obtained in high yield by breeding. However, this method is expensive and time consuming. In addition, the corresponding breeding programs must be carried out for each plant species of interest.

Progress has been achieved in part by genetic manipulation of plants, i.e. by the efficient introduction and expression of recombinant nucleic acid molecules into plants. The advantage of such processes is generally that they are not limited to one plant species, but can equally be applied to other plant species.

Among other things, in EP-A 0 511 979, increased biomass production caused by the expression of prokaryotic asparagine synthetase in plant cells has been described. As described, for example, in WO 96/21737, the plant yield due to the expression of deregulated or unregulated fructose-1,6-bisphosphatase due to increased photosynthesis rate was increased. However, there is still a need for a generally applicable method to increase yields of plants of interest to agriculture or forestry.

Furthermore, given the fact that compounds contained in plants play an increasingly important role as renewable raw materials, one of the problems of biotechnological research is the adaptation of said plant raw materials to the requirements of the processing industry.

In addition, to enable the use of regenerating raw materials in as many sectors as possible,

• «* ·» ···· 9 · · · · · · · · · · ·

9 · · ·

299999 »9 9 9 9 9 9

999 · ··· «··» · »9 1 · reach a wide range of compounds. In order to increase the efficiency of the production of renewable raw materials from plant sources, it is also necessary to increase the yield of said substances with a vegetable content.

In addition to fats and proteins, polysaccharides and oils are essential renewable vegetable raw materials. In addition to cellulose, starch plays a central role in polysaccharides, which is one of the most important storage substances in higher plants. Of these, potatoes and maize are of particular interest since they are important cultivated plants for starch production.

In addition to the use of starch polysaccharide, which is one of the most important plant substances in the vegetable world, in the food industry, it is widely used as a renewable raw material for the production of industrial products.

The starch processing industry is very interested in plants with a higher starch content, with the rule that these plants have a higher dry weight. The increased dry weight increases the value of industrially processed plants (corn, potatoes, tapioca, wheat, barley, rice, etc.) due to the higher starch content. In addition, plant cells or organs containing higher amounts of starch have the advantage of industrial processing in that they absorb less frying fat or oil. This leads to "healthier" products with lower calorie content. This property is of great importance, for example, in the production of popcorn, corn or potato chips, crisps or potato fryers from potatoes.

In the industrial processing of potatoes, the dry weight (starch content) is a critical value as the cost is determined by this parameter. Increased dry weight (starch content) means that the amount of water in the tuber is reduced while maintaining yield. The reduced water content reduces transportation costs and reduces cooking time.

Thus, it appears necessary to provide plant cells and plants with an increased starch content, similar to methods for preparing such plant cells and plants. Furthermore, it appears desirable to provide starches containing an amount of amylose and amylopectin that meets the requirements of the processing industry. In this connection, both amylose-reduced starch and amylose-increased starch are desirable since each is particularly suitable for certain special uses.

The problem associated with the present invention is therefore to provide plant cells and plants which, compared to the corresponding unaltered cells of wild plants and wild plants and wild plants and wild-type cells. ·· · e · φ φ φ · ^u φφ φφ «φφφ φφφ φ φφφ φφφφ φφ φφ cal plants having an increased content of mainly oil and / or starch and / or synthesize a starch with an altered amylose.

This problem is solved by providing the embodiments indicated in the claims.

SUMMARY OF THE INVENTION

Thus, the present invention relates to transgenic plant cells and plants that are genetically modified. The modification consists in introducing a foreign nucleic acid whose presence or expression leads to an increase in the activity of the plastid transporter of ADP / ATP transgenic cells compared to the corresponding plant cells from wild-type plants that are not genetically modified.

The genetic modification in this context may be any genetic modification leading to an increase in the activity of the ADP / ATP plastid transporter. One possibility is, for example, the so-called "in situ activation" where the genetic modification is a change in the regulatory regions of the endogenous plastid transporter genes ADP / ATP, which leads to increased expression of these genes. This can be achieved, for example, by incorporating a very strong promoter upstream of the corresponding genes, e.g., by homologous recombination.

It is also possible to use the so-called "activation labeling" method (cf. e.g., Walden et al., Plant J. (1991), 281-288; Walden et al., Plant Mol. Biol. 26 (1994), 1521-1528 ). Said method is based on the activation of endogenous promoters by an enhancer, such as a 35S RNA mosaic virus promoter transcription enhancer or an octopine synthase enhancer.

In a preferred embodiment, however, the genetic modification comprises introducing a foreign nucleic acid molecule encoding a plastid transporter ADP / ATP into the genome of a plant cell.

Thus, the term "transgenic" means that the plant cell of the invention comprises at least one foreign nucleic acid molecule encoding a plastid ADP / ATP transporter that is stably integrated into the genome, preferably a nucleic acid molecule.

The term "foreign nucleic acid molecule" refers to a nucleic acid molecule encoding a protein with the biological activity of the plastid transporter ADP / ATP and either not naturally occurring in the corresponding plant cells or not naturally occurring in the plant cells in the correct spatial arrangement, or a place where it does not naturally occur. Preferably, the foreign nucleic acid molecule is a recombinant molecule that is composed of various elements whose combination or specific spatial arrangement does not occur naturally in plant cells. The transgenic plant cells according to the invention comprise at least one foreign nucleic acid molecule encoding a protein having the biological activity of a plastid transporter ADP / ATP, wherein said nucleic acid molecule is associated with DNA regulatory elements ensuring transcription in plant cells, in particular a promoter

In principle, the foreign nucleic acid molecule can be any nucleic acid molecule encoding an ADP / ATP transporter that, when expressed, is located on the inner membrane of plastids. The plastid transporter ADP / ATP is in this context a protein catalysing the transport of ATP into plastids and ADP out of plastids. Such nucleic acid molecules are known, for example, from Arabidopsis thaliana (Kampfenkel et al., FEBS Lett. 374 (1995), 351-355; gene bank accession number X94626 and Z49227) or from potatoes (gene bank accession number Y10821). . Based on a known nucleic acid molecule, one of ordinary skill in the art is able to isolate the corresponding sequence from another organism, particularly from plants, using standard methods such as heterologous screening. In particular, non-plant nucleic acid molecules that encode an ADP / ATP transporter and are linked to a targeting sequence that provides localization to the inner membrane of plastids may be used. In this context, for example, the ADP / ATP carrier is known in Rickettsia prowazekii (Williamson et al., Gene 80 (1989), 269-278) and in Chlamydia trachomatis.

In a preferred embodiment, the foreign nucleic acid molecule encodes the Arabidopsis thaliana plastid ADP / ATP transporter, particularly the AATP1 protein described by Kampfenkel et al. (1995, cited above).

The cells of the invention can be distinguished from naturally occurring plant cells by, inter alia, containing a foreign nucleic acid molecule that does not naturally occur in said cells, or by integrating said molecule into the genome of the cell at a location where it does not naturally occur , i.e., in another genomic environment. In addition, the transgenic cells of the invention can be distinguished from naturally occurring plant cells by containing at least one copy of a foreign nucleic acid molecule stably integrated into their genome, optionally in addition to copies of said naturally occurring cell. If the nucleic acid molecule (s) incorporated into the cells is an additional copy of the molecules naturally occurring in the cells, the plant cells of the present invention can be distinguished from the naturally occurring plant cells, in particular by: 9 9 9 9 9 9 9 9 9 9 9 9 9

999 An old (additional) copy is (are) located in the genome in places where it does not naturally occur. This can be determined, for example, by Southern blot analysis.

Further, the cells of the invention can be distinguished from naturally occurring plant cells based on at least one of the following properties: if the nucleic acid molecule is heterologous to the plant cell, transcripts of the inserted nucleic acid molecule are produced in transgenic plant cells, detectable e.g. blot. Preferably, the plant cells of the invention comprise a protein encoded by the inserted nucleic acid. This can be detected, for example, by immunological methods, in particular by Western blotting.

If the nucleic acid molecule is homologous to the plant cell, the cells of the invention can be distinguished from naturally occurring cells by the additional expression of foreign inserted nucleic acid molecules. Preferably, the transgenic plant cells contain multiple transcripts of foreign nucleic acid molecules. This can be analyzed, for example, by Northern blot analysis.

The term "genetically modified" indicates that the plant cell has modified genetic information by insertion of a foreign nucleic acid molecule and that the presence or expression of the foreign nucleic acid molecule results in a phenotype change. In this context, a phenotypic change is preferably meant a measurable change in one or more cell functions. Thus, for example, the genetically modified plant cells of the invention exhibit an increase in the activity of the plastid transporter ADP / ATP caused by the presence or expression of an inserted foreign nucleic acid molecule.

In the present context, the term " activity increase " means an increase in the expression of a gene encoding an ADP / ATP transporter, an increase in the amount of an ADP / ATP transporter protein, and / or an increase in ADP / ATP transporter activity in cell plastids.

The increase in expression can be determined, for example, by measuring the amount of transcripts encoding the ADP / ATP transporter using Northern blot analysis. An increase in this case means an increase in the amount of transcripts by at least 10%, preferably by 20%, in particular by at least more than 50%, and more preferably by at least 75%, as compared to non-genetically modified cells. The increase in the amount of ADP / ATP transporter protein can be determined, for example, by Western blot analysis. An increase in this case means an increase in the amount of ADP / ATP transporter protein by at least 10%, preferably by at least 20%, in particular by at least 50% and particularly preferably by at least 75% compared to the non-genetically modified cell.

The ADP / ATP plastid vector activity can be determined, for example, by isolating plastids from the corresponding tissue and determining the Vmax values for ATP import using a silicone oil filtration method. The purification of various plastids is described, for example, in Neuhaus et al. (Biochem. J. 296 (1993) 395-401). The silicone oil filtration method is described, for example, in Quick et al. (Plant Physiol. 109 (1995) 113-121).

Surprisingly, it has been found that plants containing said plant cells with increased ADPZATP plastid transporter activity have an increased obsh substance yield and / or an increase in biomass compared to the corresponding unmodified wild-type plants. For example, it has been found that the oil and / or starch content of the plants of the invention has been increased, and / or that the amylose content of the starch has also been increased compared to unmodified wild-type plants.

In this context, the term "wild-type plants" refers to plants which serve as starting material for the production of the described plants, i.e. plants whose genetic information is, except for the inserted genetic modification, identical to the genetic information of the plants of the invention.

The term " increased yield " indicates that the proportion of ingredients, preferably starch or oil, in the plant cells of the invention is increased by at least 10%, preferably by at least 20%, more preferably by at least 30% and very preferably by at least 40% compared to unmodified wild-type plants.

The term "increased starch content" indicates that the starch content of the plant cells of the present invention is increased by at least 10%, preferably by at least 20%, more preferably by at least 30% and very preferably by at least 40% compared to the unmodified wild-type plant cells. type. The determination of the starch content was performed according to the method described in the attached examples.

The term "increased amylose content" indicates that the amylose content of the starch synthesized in the plant cells of the invention is increased by at least 10%, preferably by at least 20%, more preferably by at least 30% and very preferably by at least 40% compared to plant cells in unmodified wild-type plants. The amylose content was determined by the method described in the accompanying examples.

The ADP / ATP plastid transporter is, as mentioned above, a transport protein located on the inner membrane of plastids (Heldt et al., FEBS Lett. 5 (1969) 11-14;

Pozueta-Romero et al., Proc. Nat. Acad. Sci USA 88 (1991) 5769-573; Neuhaus,

Plant Physiol. 101 (1993) 573-578; Schunemann et al., Plant Physiol. 103 (1993),

4 4 4 4 4 • 4 4 4 4 4

4 4 4 4 4

4 4 4 4 4 5

443 9499 «> 44

131-137), which catalyzes the transport of ATP within plastids and ADP out of piastids. Thus, the plastid transporter ADP / ATP supplies stroma with cytosolic ATP.

Kampfenkel et al. (FEBS Lett. 374 (1995), 351-355) were the first to isolate the cDNA encoding the ADP / ATP (AATP1) vector from the European Turtle (Neuhaus et al. Plant J. 11 (1997), 73-82). high similarity (66.2% similarity) to ADP / ATP vector from Gram-negative bacterium Rickettsia prowazekii. The AATP1 cDNA from Arabidopsis thaliana encodes a strongly hydrophobic protein of 589 amino acids that has 12 potential transmembrane spirals (Kamfenkel et al., FEBS Lett. 374 (1995), 351-355). Said cDNA may be functionally expressed in baker's yeast or in E. coli. After protein extraction and reconstitution in proteoliposomes, an increase in ATP transfer rate can be detected (Neuhaus et al. Plant J. 11 (1997), 73-82). Using antibodies against the AATP1 peptide fragment from Arabidopsis thaliana, it is possible to demonstrate the location of the ADP / ATP transporter on the inner chloroplast plastic membrane (Neuhaus et al. Plant J. 11 (1997), 73-82).

So far, it has not been possible to fully elucidate the function of the plastid transporter ADP / ATP in plant metabolism. Various functions have been considered, eg that supplying stroma with cytosolic ATP could affect the import of proteins into plastids, biosynthesis of amino acids, metabolism of fatty acids or starch (Flügge and Hinz, Eur. J. Biochem. 160 (1986), 563-8). 570; Tetlow et al., Planta 194 (1994) 454-460; Hill and Smith, Planta 185 (1991), 91-96; Kleppinger-Sparace et al., Plant Physiol. 98 (1992), 723-727.

However, the fact that the increase in ADP / ATP transporter activity results in an increase in starch content in the corresponding transgenic plants was quite surprising. Similarly, it was surprising to find that an increase in the activity of the plastid transporter ADP / ATP has an effect on the molecular composition of the produced starch. For example, the potato tuber starch according to the invention shows a higher proportion of amylose compared to the starch from untransformed potatoes.

It has hitherto prevailed that the molecular properties of starch are solely determined by the interaction of starch synthesizing enzymes such as amylo- (1,4-1,6) -transglycosylase (EC 2.4.1.18), ADP-glucose-starch glucosyltransferase (EC 2.4.1.21) and ADP-glucosasynthase (EC 2.7.7.27). However, the fact that the expression of the transport protein from plastids affects the starch structure is quite surprising.

The plant cells of the invention may be derived from any plant species, i.e. from both monocotyledonous and dicotyledonous plants. Preferably, the cells are

4

4 9

4944

9 • ** ·· ··

4 9 4 4 4 4 4 * * 4 4 4 4

4 4 4 4 4 5

4 4 4 4 4

449 4494 4 4 4 4 derived from agricultural plants, ie plants grown by humans for nutritional or technical, in particular industrial, purposes. Preferably, the plant cells are from agricultural crops, ie plants grown by humans for nutritional or technical, especially industrial, purposes. Generally preferred are plant cells from oil and / or starch synthesizing plants or from plants with oil and / or starch stores. Thus, the invention preferably relates to plant cells from starch synthesizing plants or from plants with starch stores such as cereals (rye, barley, oats, wheat, millet, sago, etc.), rice, peas, corn, beans, cassava, potatoes , rape, soybeans, hemp, flax, sunflower or vegetables (tomato, chicory, cucumber, salad, etc.). Plant cells from potatoes, sunflowers, soybeans, rice are preferred. Plant cells of maize, wheat, rape and rice are particularly preferred.

The invention further provides transgenic plants comprising the transgenic plant cells described above. Said plants may be produced, for example, by regeneration from the plant cells of the invention. Transgenic plants may in principle be any kind of plant, i.e. both monocotyledonous and dicotyledonous plant. They are preferably crops, i.e. plants grown by humans for nutritional and technical purposes, especially for industrial purposes. These plants may be oil-and / or starch-synthesizing plants, or plants that have oil and / or starch reserves. The invention preferably relates to plants such as cereals (rye, barley, oats, wheat, millet, sago, etc.), rice, peas, corn, beans, cassava, potatoes, rape, soybeans, hemp, flax, sunflowers or vegetables (tomato, chicory, cucumber, salad, etc.). Potatoes, sunflowers, soybeans, rice are preferred. Corn, wheat, rape and rice are particularly preferred.

As mentioned above, it has surprisingly been found that starch stocks containing plant cells of the invention with increased ADP / ATP transporter activity have an increased starch content compared to wild-type plants and / or that the amylose content of these starches in the starch is also increased. comparison with the corresponding unmodified wild-type plants.

Accordingly, a preferred embodiment of the present invention also relates to plants with starch stores containing plant cells of the present invention and having a higher starch content and / or a higher amylose content in said starches as compared to unmodified wild-type plants.

The term 'starch-store plants' covers all starch-bearing plants, such as maize, wheat, rice, potatoes, rye, barley, oats. Rice, barley and potatoes are preferred. Corn and wheat are particularly preferred.

• 9 • 9

9999 • 9 • 999

9 9

9 9

9 9 9

9 ·

As used herein, the terms "increased yield", "increased starch content", "increased amylose content" and "wild-type plant" are used within the meaning of the above definitions and are also used in the following embodiments in the same sense. The term "increased yield" preferably means an increase in the production of constituents and / or biomass, particularly when measuring the fresh weight per plant.

Said yield increase preferably relates to those parts of the plants which can be industrially processed, eg seeds, fruits, stock roots, roots, tubers, flowers, buds, shoots, stems or wood.

According to the invention, the yield increase is at least 3% in terms of biomass and / or content compounds compared to corresponding untransformed plants of the same genotype when said plants are grown under the same culture conditions. It is preferred to increase the yield by at least 10%, more preferably by at least 20% and very preferably by at least 30% or even 40% compared to wild-type plants.

For example, said plants of the present invention have the advantage that they exhibit not reduced levels of amylose content compared to other amylose starch synthesizing plants such as amylose extender and dulli mutants. but even an increased starch content.

Further, the present invention relates to plants which form oil reserves and which comprise plant cells of the invention. These plants have an increased oil content compared to unmodified wild-type plant cells, preferably in the tissue cells that form oil reserves.

The term "oil-producing plant" includes all plants capable of storing oil, such as oilseed rape, canola, soya, sunflower, maize, peanuts, wheat, cotton, oil palm, olive tree and avocado. Corn, wheat and soybean are preferred. Rape and canola are particularly preferred.

The term "increased oil content" means that the oil content of the plant cells of the invention is increased by at least 10%, preferably by at least 20%, more preferably by at least 30% and most preferably by at least 40% compared to plant cells of unmodified wild-type plants. .

Methods for determining oil content are generally known to those skilled in the art and are described, for example, in Matthaeus and Bruehl, GIT Labor-Fachz. 43 (1999), 151-152, 154-155;

Mathaeus, Laborpraxis 22 (1998), 52-55. Determination of oil content can also be performed by non-invasive near-infrared spectroscopy, an analytical method.

0 00 0 0 00 (generally used in breeding) and has been described, for example, by Schulz et al., J. Near Infrared Spectrosc . 6 (1998), A125-A130; Starr et al., J. Agric. Sci. 104 (1985), 317-323.

Plants with increased oil content are of great commercial importance. For example, maize, whose grains are rich in starch but also have an increased oil content as a by-product, is of great importance in industrial wet milling because the by-product has a high value. The feed industry is also very interested in feed plants with an increased oil content, as such plants have an increased nutritional value. In the industrial processing of oil-containing plants, an increased oil content means an increase in the efficiency of the oil extraction process.

The present invention further relates to a method for producing transgenic plants having an increased yield compared to wild-type plants, wherein (a) the plant cell is genetically modified by introducing a foreign nucleic acid molecule and the genetic modification results in a higher plastid ADP / ATP transporter activity; (b) the plant is regenerated from the cell, and optionally (c) other plants are prepared from the plant prepared in (b).

The present invention further relates to a method for producing transgenic plants having an increased starch content compared to wild-type plants and / or wherein amylose is increased compared to corresponding wild-type plants, wherein (a) the plant cell is genetically modified by the introduction of a foreign the nucleic acid molecules and the genetic modification result in a higher activity of the plastid transporter ADP / ATP and (b) the plant is regenerated from the cell, and optionally (c) other plants are prepared from the plant prepared in (b).

Furthermore, the present invention provides a method for producing transgenic plants having an increased oil content compared to wild-type plants, wherein (a) the plant cell is genetically modified by introducing a foreign nucleic acid molecule and the genetic modification results in higher ADP / ATP transporter activity; (b) the plant is regenerated from the cell, and optionally (c) additional plants are prepared from the plant prepared in (b).

• • • fefefe fe • fe • fe fefe • fefefe fe fefefe fe fefe fefefe • fefe · fefefe fefefefe fefe

The modification introduced into the cell of (a) is subject to the same discussion as discussed above in relation to the plant cells and plants of the invention.

The regeneration of plants according to (b) can be carried out according to methods known to those skilled in the art.

Generation of additional plants according to (c) of the methods of the invention can be achieved, e.g., by vegetative propagation (e.g. by cuttings, tubers or callus cultures and whole plant regeneration) or by sexual reproduction. Preferably, sexual reproduction is performed in a controlled manner, i.e., selected plants with specific properties are crossed and reproduced.

The invention also relates to plants obtainable by the methods of the invention.

The present invention also relates to plant propagation material of the invention as well as transgenic plants produced according to the methods of the invention, which material comprises genetically modified cells of the invention. In this context, the promotional material comprises those plant components that are suitable for generating offspring by vegetative or sexual propagation. For vegetative propagation, for example, cuttings, callus cultures, rhizomes or tubers are suitable. Further propagation material may be, for example, fruits, seeds, seedlings, protoplasts, cell cultures, etc. Preferred propagation material is tubers, seeds being particularly suitable.

The present invention further relates to the use of nucleic acid molecules encoding a plastid carrier ADP / ATP in the production of transgenic plants with increased yield compared to wild-type plants.

The present invention also relates to nucleic acids encoding a plastid ADP / ATP carrier used to produce transgenic plants having an increased starch content in tissues where starch is synthesized and / or deposited, or to produce plants in which starch contains a higher amylose content compared to wild-type plants. Preferably, the above-mentioned nucleic acids are used in conjunction with the cells of the invention.

The present invention also relates to nucleic acids encoding a plastid ADP / ATP carrier used to produce transgenic plants with increased oil content compared to wild-type plants.

The present invention also relates to transgenic plant cells that are genetically modified and where the genetic modification results in a decrease in carrier activity

ADP / ATP in plastids present endogenously in plant cell in comparison to • φ φ φ φ φ φ φ φ φ φ φ odpovídající φ odpovídající odpovídající wild-type cells that are not genetically modified.

The term "transgenic" as used herein means that the plant cells of the invention differ in their genetic information from the corresponding unmodified plant cells. This is due to genetic manipulation, particularly the insertion of a foreign nucleic acid molecule.

In this context, the term "genetically modified" means that a plant cell is modified in its genetic information as a result of the introduction of a foreign nucleic acid molecule and that the presence or expression of the foreign nucleic acid molecule results in a phenotypic change. Preferably, the phenotypic change is a measurable change in one or more cell functions. For example, a genetically modified plant cell of the invention may have reduced ADP / ATP transporter activity in a plastid.

The production of said plant cell according to the invention with reduced ADP / ATP transporter activity can be carried out in various ways known to those skilled in the art. For example, they may be methods of inhibiting the expression of endogenous genes encoding the plastid transporter ADP / ATP. These methods include, for example, expression of the corresponding antisense RNA, expression of the anti-coding RNA to produce a cosuppressive effect, expression of a suitably engineered ribozyme that specifically cleaves transcripts encoding the ADP / ATP transporter, or so-called "in vivo mutagenesis".

Preferably, expression of the antisense RNA is used to reduce ADP / ATP carrier activity in the cells of the invention.

Either a DNA molecule that contains the entire ADP / ATP carrier coding sequence, including the overlapping sequences that may be present, or DNA molecules containing only portions of the coding sequence may be used for expression, but these parts must be long enough to lead to antisense effect in cells. Generally, sequences with a minimum length of up to 15 bp (base pairs), preferably 100 to 500 bp, can be used, and sequences longer than 500 bp are particularly suitable for effective antisense inhibition. Usually, sequences shorter than 5000 bp are used, and preferably sequences shorter than 2500 bp are used.

It is also possible to use DNA sequences which show a high degree of homology to sequences that occur endogenously in the plant cell and which encode the plastid ADP / ATP transporter. The minimum homology should be greater than 65%. Preference is then given to using sequences having a homology of between 95 and 100%.

• ·

4 Λ 4 4 4 4 · · ·

4 4 4

7 4 4444 4 4 444444 ¹ J 4 4 44 4 * 4 4

444 4,444 4444 44 44

Alternatively, a decrease in ADP / ATP transporter activity in plant cells of the invention may be achieved by cosuppression effect. This method is known to those skilled in the art and is described, for example, in Jorgensen (Trends Biotechnol. 8 (1990), 340-344); Niebel et al. (Curr. Top. Microbiol. Immunol. 197 (1995), 91-103); Flavell et al. (Curr. Top. Microbiol. Immunol. 197 (1995) 43-46); Palaqui and Vaucheret (Plant. Mol. Biol. 29 (1995), 149-159); Vaucheret et al. (Mol. Gen. Genet. 248 (1995), 311-317); de Borne et al. (Mol. Gen. Genet. 243 (1994), 613-621) and in other sources.

The expression of ribozymes which serve to reduce the activity of specific proteins in cells is also known to those skilled in the art and is described, for example, in EP-B1 0 321 201. The expression of ribozymes in plant cells has been described, for example, in Feyer et al. (Mol. Gen. Genet. 250 (1996) 329-388).

Reduction of ADP / ATP transporter activity in plant cells of the invention can further be achieved by so-called "in vivo mutagenesis" wherein a hybrid oligonucleotide composed of RNA and DNA ("chimeroplast") (Kipp, PB et al., Poster Conference) is introduced into the cells by transformation. 5th International Congress of plant molecular Biology (5 ^th International Congress of plant molecular Biology), 21 to 27 September 1997, Singapore; RA Dixon and Arntzen CJ, paper exit of "Metabolic Engineering in Transgenic Plants", Keystone Symposia, Copper Mountain, CO, USA, TIBTECH 15 (1997), 441-447, International Patent Application WO 95/15972, Horsen et al., Hepatology 25 (1997), 1462-1468, Cole-Strauss et al., Science 273 (1996) 1386-1393).

The DNA portion of the DNA and RNA hybrid oligonucleotide component is homologous to the endogenous ADP / ATP carrier nucleic acid sequence, but has a mutation or a heterologous region flanked by homologous regions as compared to the endogenous ADP / ATP carrier nucleic acid sequence.

By base pairing of the homologous regions of the RNA and DNA oligonucleotide and the endogenous nucleic acid molecule and subsequent homologous recombination, the mutation or heterologous region contained in the DNA component of the RNA oligonucleotide and the DNA may be transferred to the genome of the plant cell. This leads to a decrease in ADP / ATP carrier activity in plastids.

Accordingly, the present invention is primarily directed to transgenic plant cells (a) containing a DNA molecule that can lead to the synthesis of antisense RNA. This, in turn, causes a decrease in the expression of the endogenous genes encoding the plastid transporter ADP / ATP and / or tt ttt ttt ttt

A · ···· · · · tttttttt ·

IH (b) containing a DNA molecule that can lead to cosuppression RNA synthesis. This, in turn, causes a decrease in the expression of the endogenous genes encoding the plastid transporter ADP / ATP and / or (c) containing a DNA molecule that can lead to the synthesis of a ribozyme that can specifically cleave transcripts of endogenous genes encoding the plastid transporter ADP / ATP and / or (d) by "in vivo mutagenesis" they carry a mutation or insertion of a heterologous DNA sequence in at least one endogenous gene encoding a plastid ADP / ATP transporter. The mutation or insertion subsequently causes a decrease in gene expression or synthesis of an inactive transport protein molecule.

The term "decrease in activity" in the present invention refers to a decrease in the expression of endogenous ADP / ATP transporter genes, a decrease in the amount of ADP / ATP transporter protein in cells, and / or a decrease in the biological activity of the ADP / ATP transporter protein in cells.

The decrease in expression can be measured, for example, by determining the amount of transcripts encoding the ADP / ATP transporter, ie, by Northern blot analysis. Preferably, a decrease means that the amount of transcripts is reduced by at least 30%, preferably by at least 50%, more preferably by at least 70%, particularly preferably by at least 85% and very preferably by 95% compared to cells that are not genetically modified .

The decrease in the amount of ADP / ATP transporter protein can be measured by Western blot analysis. Preferably, the decrease means that the amount of ADP / ATP carrier protein is reduced by at least 30%, preferably by at least 50%, more preferably by at least 70%, particularly preferably by at least 85% and most preferably compared to non-genetically modified cells. by at least 95%.

Surprisingly, it was discovered that starch content decreased in plant cells having reduced expression and thus reduced ADP / ATP transporter activity in plastids compared to non-genetically modified wild-type plant cells. Likewise, the amylose content of these starches was lower compared to the corresponding unmodified cells from wild-type plants. It has hitherto prevailed that the molecular properties of starch are solely determined by the interaction of enzymes involved in starch synthesis, such as amylo- (1,4-1,6) -transglycosylase (EC 2.4.1.18) and ADP-glucose-starch glucosyltransferase (EC 2.4.1.21). ), and therefore the fact that the starches from plants according to the invention have a modified structure is particularly surprising. It is quite surprising that the expression of the transport protein from the plastid influences the structure of the starch.

0

0000

0 0 · 0 0 0 0 • 0 · · 0 0

0 00000 0

0 0 0 0 0

0000000 · 0 ··

The term "reduced starch content" in the present invention means that the starch content of the plant cells according to the invention is reduced by at least 15%, preferably by at least%, more preferably by at least 40% and most preferably by 50% compared to plant cells from wild plants. of the type that have not been modified. The starch content is determined by the methods described in the Examples.

The term "reduced amylose content" means that the amylose content of the plant cells of the invention is at least 10% lower, preferably at least 20% lower, preferably at least 30% lower, and most preferably 40% lower than non-genetically modified cells. Amylose content is determined by the methods described in the Examples.

The term "wild-type plant" has the above meaning.

The plant cells of the invention may be derived from any plant species, ie, both monocotyledonous and dicotyledonous. Preferably, these cells are derived from agricultural crops, i.e. plants grown by humans for nutritional or technical, especially industrial purposes. Thus, the invention preferably relates to plant cells from starch synthesizing or storing plants such as cereals (rye, barley, oats, wheat, millet, sago, etc.), rice, peas, corn, beans, cassava, potatoes, tomatoes, rape , soybeans, cannabis, flax, sunflower, bean and cane. Potato plant cells are particularly preferred.

The invention further provides transgenic plants comprising the transgenic cells described above. Said plants may be produced by regeneration from the plant cells of the invention. The transgenic plants may be in principle of any plant species, i.e. both monocotyledonous and dicotyledonous. Preferably, they are plant cells from agricultural crops, i.e. crops grown by humans for nutritional or technical, especially industrial purposes. Thus, the invention preferably relates to starch synthesizing plants or starch storing plants such as cereals (rye, barley, oats, wheat, millet, sago, etc.), rice, peas, corn, beans, cassava, potatoes, tomatoes, rape , soybeans, cannabis, flax, sunflower, bean and cane. Potatoes are particularly preferred.

Said plants of the invention synthesize starch which contains a reduced amylose content compared to starch from the corresponding wild-type plants. The term "reduced amylose content" has been defined above.

In addition, the present invention also relates to a process for the production of transgenic plants whose starch contains a lower amylose content compared to starch from the corresponding wild-type plants and wherein:

9 9 19

11 1 18 111

9111 9 1 119912

1 1111

(A) the plant cell is genetically modified by the introduction of a foreign nucleic acid molecule and wherein the genetic modification results in reduced ADP / ATP transporter activity in plastids present endogenously in plant cells; and (b) the plant is regenerated from a cell produced according to (a), and optionally (c) the other plants are produced from a plant produced according to (b).

The modification introduced into the plant cell of (a) is as discussed above in relation to the plant cells and plants of the invention.

The regeneration of plants according to (b) can be carried out according to methods known to those skilled in the art.

For example, the production of other plants according to (c) of the methods of the invention may be carried out by vegetative propagation (for example by cuttings, tubers or callus cultures and whole plant regeneration) or by sexual propagation. Preferably, sexual propagation takes place in a controlled manner, i.e., selected plants with specific properties are crossed and multiplied.

In a preferred embodiment, the method of the invention is used to produce transgenic potatoes.

The present invention also relates to plants obtainable by the process of the present invention.

The invention also relates to plant propagation material of the invention, as well as to transgenic plants produced according to the methods of the invention, which comprise the genetically modified cells of the invention. In this context, the term propagating material means any part of the plant that is suitable for generating offspring by vegetative or sexual propagation. For vegetative propagation, for example, cuttings, callus cultures, rhizomes or tubers are suitable. Other propagation material can be, for example, fruits, seeds, seedlings, protoplasts, cell cultures, etc. Preferred propagation material is seeds and tubers are particularly preferred.

Furthermore, the present invention relates to the use of nucleic acid molecules encoding a plastid carrier ADP / ATP, supplements thereof or parts of said molecules for the manufacture of starch synthesizing plants having a reduced amylose content compared to starch from wild-type plants. Preferably, the nucleic acid molecules mentioned above are used in conjunction with the plant cells of the invention having increased ADP / ATP carrier activity.

There are many different ways to introduce DNA into a plant cell. These methods include the transformation of plant T-DNA cells using Agrobacterium 9 9 9 9 9 9 9

9 9 9 9 ·

9999999 9 9 99 tumefaciens or Agrobacterium rhizogenes as a transforming agent, protoplast fusion, injection, DNA ecotroporation, DNA insertion by the biolistic method and other possibilities.

The use of plant cell transformation by Agrobacteria has already been analyzed in detail and sufficiently described in EP 120516; Hoekama, v; The Binary Plant Vector System Offsetdrukkerij Kanters B.V., Alblasserdam (1985), Chapter V .; Fraley et al., Crit. Roar. Plant Sci. 4, 1-4, and An et al., EMBO J. 4 (1985) 277-287. Transformation of tomatoes is described, for example, in Rocha-Sosa et al., EMBO J. 8 (1989), 29-33.

Transformation of monocotyledonous plants with Agrobacterium-based vectors has also been described (Chan et al., Plant Mol. Biol. 22 (1993), 491-506; Hiei et al., Plant J. 6 (1994) 271-282; Deng et al. Science in China 33 (1990), 28-34; Wilmink et al., Plant Cell Reports 11 (1992), 76-80; May et al., Bio / Technology 13 (1995), 486-492; Domisse, Int. J. Plant Sci. 153 (1992), 550-555; Ritchie et al., Transgenic Res. 2 (1993), 252-265. An alternative way of transforming monocotyledons is by biolistic transformation (Wan and Lemaux, Plant Physiol. 104 (1994), 37-48; Vasil et al., Bio / Technology 11 (1993), 1553-1558; Ritala et al., Plant Mol Biol. 24 (1994), 317-325; Spencer et al., Theor. Appl. Genet. 79 (1990), 625-631), transformation of protoplasts, ecotroporization of partially permeabilized cells, introduction of DNA by glass fibers. In particular, maize transformation has been described several times in the literature (see, for example, WO 95/06128, EP 0513849, EO 0465875, EP 292435; Fromm et al., Biotechnology 8 (1990), 833-844; Gordon-Kamm et al., Plant Cell 2). (1990), 603-618; Koziel et al., Biotechnology 11 (1993), 194-200; Moroc et al., Theor. Appl. Genet. 80 (1990), 721-726).

Successful transformations of other cereals have also been described, such as barley (Wan and Lemaux, cited above, Ritala et al., Cited above, Krens et al., Nature 296 (1982), 72-74) and others for wheat (Nehra et al. Plant J. 5 (1994), 285-297).

For the expression of nucleic acids encoding ADP / ATP transporters in anticoding or antisense orientation in plant cells, said nucleic acid molecules are linked to DNA regulatory elements which provide for transcription in plant cells. These elements include, in particular, promoters. In general, any promoter active in plant cells is suitable.

The promoter can be selected to be constitutive or only in a particular tissue, at a particular point in time of plant development, or at a point in time. ··· ···· ·· · Φ external factors. The promoter may be homologous or heterologous to both the plant and the nucleic acid molecule.

Suitable promoters for constitutive expression include, for example, the cauliflower mosaic virus 35S RNA promoter and the maize ubiquitin promoter, the patatin gene B33 promoter for specific potato tuber expression (Rocha-Sosa et al., EMBO J. 8 (1989), 23-29) and a promoter for specific expression only in photosynthetically active tissues, such as the ST-LS1 promoter (Stockhaus et al., Proc. Natl. Acad. Sci. USA 84 (1987), 7943-7947; Stockhaus et al. EMBO J. 8 (1989), 2445-2451) or for specific endosperm expression, it may be the wheat HMG promoter, the USP promoter, the phaseolin promoter, the maize zein gene promoters (Pedersen et al., Cell 29 (1982), Quatroccio et al., Plant Mol. Biol. 15 (1990), 81-93), a glutelin promoter (Leisy et al., Plant Mol. Biol. 14 (1990), 41-50; Zheng et al. Plant J. 4 (1993), 357-366; Yoshihara et al., FEBS Lett. 383 (1996), 213-218) or the shrunk-1 (shrunken-1) promoter ( Werr et al., EMBO J. 4 (1985), 1373-1380). However, even romotors that are activated only at a point in time determined by external factors can also be used (see, for example, WO 9307279). In particular, heat shock protein promoters which are easily inducible may be of interest in this regard. Furthermore, seed-specific promoters can be used, e.g., the USP promoter from Vicia faba (vetch), which provides seed-localized expression in Vicia faba and other plants (Fiedler et al., Plant Mol. Biol. 22 (1993), 669 Baumlein et al., Mol. Gen. Genet. 225 (1991), 459-467).

The above embodiments of the present invention with endospecific ("endosperm specific") promoters are particularly useful for increasing the starch content of the endosperm. On the other hand, embryo-specific promoters are of particular interest in terms of increasing the oil content, since the rule is that the oil is mainly stored in embryos.

Accordingly, promoters that provide expression in the embryo or seeds are preferably used according to the invention. Thus, in a preferred embodiment of the invention, the promoter is the globulin-1 (glb 1) promoter from maize (Styer and Cantliffe, Plant Physiol. 76 (1984), 196-200). In another embodiment of the invention, the embryo-specific promoter is from plants, mainly from Cuphea lanceolata, Brassica rapa or Brassica napus. Especially preferred are pCIFatB3 and pCIFatB4 promoters (WO 95/07357). They are the promoters of the CIFatB3 and CIFatB4 genes, which have already been successfully used in transgenic rape for the biosynthesis of medium-chain fatty acids. Thus, they have suitable expression properties to solve the present problem.

· * ««>>>>>>> ·> · · · · ·

In another preferred embodiment of the invention, the pCIGPDH promoter (WO

95/06733, the napin promoter (described, eg, in Kridl, Seed Sci. Res. 1 (1991), 209-219;

Ellerstrom et al., Plant Mol. Biol. 32 (1996), 1019-1027; Stalberg et al., Planta 199 (1996), 515-519), or an oleosin promoter (described, for example, in Keddie, Plant Mol. Biol (1994), 327-340; Plant et al., Plant Mol. Biol. 25 (1994), 193-205).

In addition, a termination sequence may be present that serves to properly terminate transcription and to add a poly-A tail to the corresponding transcript, which tail has the function of stabilizing the transcripts. Said elements are described in the literature (see, eg, Gielen et al., EMBO J. 8 (1989), 23-29) and are interchangeable as necessary.

The transgenic plant cells and plants of the present invention synthesize, preferably due to an increase or decrease in ADP / ATP carrier activity in plastids, a starch whose physicochemical properties differ from starch synthesized by wild-type plants. In particular, they differ in the amylose / amylopectin ratio. In particular, said starch may be modified over wild-type starch in terms of viscosity and / or gel-forming ability of said starch adhesives.

Accordingly, the present invention relates to processes for producing modified starch comprising the step of extracting starch from one of the aforementioned plants and / or starch-storing portions of said plant. Preferably, said method also comprises the step of harvesting the cultivated plants and / or starch-containing parts of said plants prior to starch extraction, and a particularly preferred step of cultivating the plant of the invention prior to harvesting. Methods for extracting starch from plants or from parts of plants containing starch are known to those skilled in the art. In addition, methods for extracting starch from various other starch-containing plants are described, for example, in "Starch: Chemistry and Technology (editors: Whistler, BeMiller and Paschall (1994), 2nd edition, Academic Press Inc. London Ltd; ISBN 0-12- See also, for example, Chapter XII, pages 412 to 468: maize and sorghum starch: production; written by Watson; chapter XIII, pages 469 to 479: starches from tapioca, arrowroot and sago: production; written by Corbishley and Miller; XIV, pages 491 to 506: starch from wheat: production, modification and uses; written by Knight and Oson; and Chapter XVI, pages 507 to 528: starch from rice: production and uses; written by Rohmer and Klem; starch from maize: Eckhoff; Col., Cereal Chem. 73 (1996) 54-57, extraction of starch from maize according to industry standards is usually accomplished by so-called "wet milling." Usually, devices such as centrifuges, decanters, hydro cyclones, spray driers and fluid bed driers.

• 9 • 9 • • • · · ·

7Π · ···· »» ······

Lv · · · «· * · · · · · · ·

Further, the present invention provides a starch obtainable from the transgenic plant cells, plants and propagation material of the present invention and a starch obtainable as described above.

The starches of the invention may be modified by methods known to those skilled in the art and are suitable for various uses in the food or other industries in modified or unmodified form.

In principle, the possibilities of use can be divided into two large areas. One area includes the products of starch hydrolysis, mainly glucose and glucan building blocks, obtained by enzymatic or chemical methods. It serves as a starting material for other chemical modifications and processes such as fermentation. A simple and inexpensive method of hydrolysis is important to reduce costs. At present, it is essentially an enzymatic method using amyloglucosidase. It would be possible to save on costs by reducing the consumption of enzymes. This could be achieved by altering the structure of the starch, for example by increasing the grain surface, by making it easier to digest due to a reduced degree of branching, or by changing the spatial structure limiting the accessibility for the enzymes used.

The second field of application, in which starch is used as a so-called native starch because of its polymeric structure, can be subdivided into two subgroups:

1. Use in food

Starch is a classic additive of various foods in which it essentially serves to bind aqueous additives and / or causes increased viscosity or increased gel formation. Important characteristics are creep and sorption properties, swelling and pasteurisation temperature, viscosity and thickening functions, starch solubility, transparency and pasty structure, resistance to heat, shear and acidic environment, tendency to retrogradation, film forming ability, freeze / thaw resistance, digestibility, as well as the ability to form complexes with, for example, inorganic or organic ions.

2. Non-food uses

The second main field of application is the use of starch as an auxiliary in various manufacturing processes or as additives in technical products. The main field of application for the use of starch as a processing aid is mainly the paper and board industry. In this field, starch is mainly used to retain solids, sizing filler and small particles as a firming agent and to dehydrate. In addition, the advantageous properties of starch with respect to stiffness, hardness, sound, feel, shine, smoothness, tensile strength and surface are utilized.

2.1. Paper and cardboard industry

Four main applications can be distinguished in the paper making process. They are surface, paint, weight and spray.

The requirements for starch in terms of surface treatment are essentially a high degree of brightness, a corresponding viscosity, a high viscosity stability, a good film-forming ability and a low dust-forming ability. When used in coatings, the solids content, the corresponding viscosity, the high binding ability and the high affinity for pigments play an important role. For starch as an additive to the mass, a fast, uniform, loss-free dispersion, high mechanical stability and complete retention in the pulp are important. When using starch for injection, the corresponding solids content, high viscosity and high binding ability are important.

2.2. Adhesive industry

One of the main areas of application is, for example, the adhesive industry. This area is divided into four sub-areas: the use of pure starch adhesive, the use of starch adhesives prepared with specialty chemicals, the use of starch as an additive in synthetic resins and polymer dispersions, and the use of starch as a filler in synthetic adhesives. 90% of all starch based adhesives are used in the manufacture of corrugated cardboard, paper bags and sacks, paper and aluminum composites, boxes and wetting adhesives for envelopes, stamps, etc.

2.3. Textile and textile care products

A further possibility of use as auxiliaries and additives is their use in textile and textile care products. Within the textile industry, the individual applications can be divided into the following four groups: the use of starch as a sizing agent, i.e. as an aid to smooth and strengthen the burr formation to protect against the tensile forces active during weaving, to increase the wear resistance during weaving, to improve textiles mainly after pretreatments that degrade quality, such as bleaching, dyeing, etc., as thickeners in the manufacture of dye pastes to prevent color diffusion and as an additive to the twisting compositions for sewing yarns.

Fefe fefefefe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe fe

2.4. Construction

Starch can also be used as an additive to building materials. One example is the production of gypsum boards. In this case, the starch mixed in the thin gypsum forms a paste with water, spreads on the surface of the gypsum board and thereby binds the cardboard to the board. Other applications include mixing in gypsum and mineral fibers. In ready-mixed concrete, starch can be used to slow down the curing process.

2.5. Soil consolidation

Furthermore, starch is advantageous for the production of soil stabilizers. These are used to temporarily protect soil particles against water during artificial soil movements. According to the present knowledge, mixtures of starch and polymer emulsions can have the same erosion and incrustation protective effect as currently used compositions. However, mixtures of starch and polymer emulsions are considerably cheaper.

2.6. Use in preservatives and fertilizers for plants

Another field of application of starch is in plant protection products to change the specific properties of these preparations. For example, starch is used to improve the wetting of plant preservatives and fertilizers, to release the active ingredients in a dosed manner, to convert liquid, volatile and / or malodorous active ingredients into microcrystalline, stable, deformable substances, to mix incompatible mixtures and to prolong their effect due to Decomposition reduction.

2.7. Medicine, medicine and beauty industry

Starch can also be used in the pharmaceutical, cosmetic and medical industries. In the pharmaceutical industry, starch may be used as a binder in tablets, or to dilute the binder in capsules. The starch is furthermore suitable for breaking tablets because, upon ingestion, it absorbs the solution, absorbing it in a short time so that it releases the active ingredient. For qualitative reasons, there is another area of use in medical lubricants and in backfills for injuries. In the field of cosmetics, starch has found use, for example, as a carrier for powder formulations such as perfumes and salicylic acid. A relatively remote starch application is toothpaste.

9 9 9 9

9

9

999 99 99

2.8. Starch as an addition in coal and briquettes

Starch can also be used as an addition to coal and briquettes. The addition of starch can cause high-quality and quantitative agglomeration of coal and / or briquettes, thereby preventing premature disintegration of the briquettes. Barbecue charcoal contains between 4 and 6% added starch, calorific charcoal between 0.1 and 0.5%. In addition, it is possible to use starch as a binder, since its addition to coal and briquettes can significantly reduce the emission of toxic substances.

2.9. Processing of ores and coal sludge

Further, starch can be used as a flocculating agent in the processing of ore and coal sludge.

2.10. Addition to casting materials

Another field of application is the use as an additive in the processing of casting materials. In various casting processes, channels formed from sands mixed with a binder component are required. At present, bentonite mixed with modified starches, usually swelling starches, is generally used as binder components. The reason for the addition of starch is increased flow resistance and increased binding ability. In addition, swelling starches meet other process conditions such as cold water dispersibility, repeated hydration ability, good sand miscibility and high water binding capacity.

2.11. Rubber industry

In the rubber industry, starch can be used to improve technical and optical quality. This may be due to improved surface gloss, feel and appearance. For this purpose, the starch is dispersed on the sticky surface of the rubberized rubber surfaces prior to cold vulcanization. It can also be used to improve rubber printing.

2.12. Manufacture of leather substitutes

Another field of application of modified starch is the manufacture of leather substitutes.

2.13. Starch in synthetic polymers

The following industries are emerging in the plastics industry: the integration of starch-derived products into the production process (starch is a filler only and does not form a bond with the synthetic polymer) or the integration of starch-derived products into polymer production (starch and polymer form a stable bond).

• ·

ΦΦΦΦ ♦ ♦ · • · · · φ φ • φ • • •

The use of starch as a sole filler cannot compete with other substances such as talc. The difference is that the specific properties of starch are effective and the properties profile of the resulting products is thereby clearly changed. One example is the use of starch products in the processing of thermoplastics such as polyethylene. In this case, the starch is mixed with the synthetic polymer in a 1: 1 ratio by co-expression to form a "base batch" from which various products are produced by conventional methods using granulated polyethylene. The integration of starch into polyethylene films can increase the permeability of substances in hollow spaces, increase water vapor permeability, improve antistatic behavior, and improve printing with water-dilutable dyes.

Another possibility is the use of starch in polyurethane foams. By adapting the starch derivatives and optimizing the processing techniques, it is possible to specifically control the reaction between the synthetic polymers and the hydroxy groups of the starch. The result is polyurethane films having the following characteristics due to the use of starch: reduced thermal expansion coefficient, reduced shrinkage ability, improved compression / stress behavior, increased water vapor permeability without changing water acceptance, reduced flammability and cracking density, no reduction in the amount of combustible parts , none. The disadvantages that have not been overcome so far are the reduced compressive and impact strength.

Developing products in the form of films is not the only option. Also solid plastic products such as pots, plates and bowls can be produced with a starch content of more than 50%. In addition, starch-plastic mixtures offer the advantage of being much more easily biodegradable.

Due to the extreme water-binding capacity, starch grafted polymers are gaining in importance. These products have a starch backbone and grafted side chains of synthetic monomer based on a radical chain mechanism. The currently available starch grafted polymers are characterized by improved ability to bind and retain water up to 1000 g water per g starch at high viscosity. These excellent absorbers are mainly used in the hygiene field, eg in products such as diapers and bed sheets, similarly in the agricultural sector, eg in seed coating.

Structure, water content, protein content, lipid content, fiber content, ash / phosphate content, amylose / amylopectin ratio, relative molecular weight distribution, degree of branching, grain size and shape are critical to the use of new starches modified by recombinant DNA techniques. as well as crystallization, and on the other hand, these are properties which translate into the following properties: such and sorption properties, pasteurization temperature, viscosity, thickening ability, solubility, paste structure, transparency, resistance to heat, shear and acids, tendency to retrogradation, gel formation, freeze / thaw resistance, complexing ability, iodine binding, film formation, adhesion strength, enzyme stability, digestibility and reactivity.

The production of starch modified by genetic manipulation of transgenic plants may alter the properties of starch derived from the plant so that further modifications by chemical and physical methods may be superfluous. On the other hand, the starches modified by recombinant DNA techniques can be subjected to further chemical modifications which will result in further quality improvements for certain of the fields of application described above. Such chemical modifications are known. Especially they are modifications with the help of

- heat treatment

- acid treatment

oxidation, and

- esterifications which lead to the formation of phosphates, nitrates, sulphates, xanthates, acetate and starch citrates. Other organic acids can also be used for esterification:

- manufacture of starch-alkyl ether, O-allyl ether, hydroxyalkyl ether, O-carboxymethyl ether, nitrogen-containing starch ethers, phosphorus-containing starch ethers and sulfur-containing starch ethers.

- manufacture of branched starches

- production of starch grafted polymers.

BRIEF DESCRIPTION OF THE DRAWINGS

Giant. 1 schematically shows plasmid pJT31 (AATP1 (Arabidopsis thaliana) anticoding).

Giant. 2 schematically shows plasmid pJT31 (AATP1 (Solanum tuberosum) antisense).

44 • · 4 · 4 · 4 ·

4 4 4

4 4 4

Giant. 3 shows a comparison of the amino acid sequence of AATP2 from Arabidopsis thaliana with AATPI (A. thaliana) with the homologous protein of Rickettsia prowazekii (Williamson et al., Gene 80 (1989), 269-278).

Giant. 4 is an analysis of AATP2 (A. thaliana), AATP1 (A. thaliana) and Rickettsia ADP / ATP transmitters according to the method of Heijne et al. (Eur. J. Biochem. 180 (1989), 535-545).

Giant. 5 shows an analysis of AATP1 (Solanum tuberosum) expression using

Northern blot in leaves and tubers of plants with ADP / ATP antisense carrier.

Giant. 6 shows an analysis of AATP1 (Arabidopsis thaliana) expression using

Northern blot in leaves and tubers of plants overexpressing the ADP / ATP transporter.

Giant. 7 is a schematic diagram of a pTE200 cassette for specific embryo expression. EcoRI, SmaI, BamHI, XhoI, NotI, XbaI, SacI, KpnI, ApaI, SalI and Sfil indicate restriction endonuclease recognition sites. For practical reasons, Sfil (A) and Sfil (B) differ in the variable nucleotide sequences within the recognition sequence. Abbreviations are as follows: PCIFatB4 = CIFatB4 promoter, tCIFatB4 = CIFatB4 terminator, amp = bacterial ampicillin resistance, ColE1 ori = "origin of replication" from ColE1, f1 (-) ori = "origin of replication" from phage f1.

Giant. 8 is a schematic plan of the ADP / ATP vector expression cassette of pTE208: This pTE200 derivative (Figure 7) carries a cDNA encoding an ADP / ATP vector from Solanum tuberosum in an antisense orientation;

Giant. 9 Schematic map of the binary vector pMH000-0. Sfil, SalI, ClaI, HindIII, EcoRI, NsiI, SmaI, BamHI, SpeI, NotI, KpnI, BglII, ApaI, XhoI, XbaI and BstEII refer to restriction endonuclease recognition sequences. Sfil (A) and Sfil (B) differ from each other as described. This is a reason to prevent back-circularization of the parent vector upon cleavage of Sfil and direct insertion of the expression cassette from the pTE200 derivative is possible. Abbreviations indicate the following: RB, LB = right and left border regions, t35S - CaSV 35S rna termination region, pat = phosphinothricin acetyltransferase gene coding, p35S = CaMV 35S rna promoter, p35S (min) = minimal 35S rna promoter CaMV gene, tp-sul = Sulfonamide resistance transient peptide gene, tnos = nopaline synthase gene termination signal, Sm / Sp = bacterial resistance to streptomycin and spectinomycin, parA, parB and parR = multiplier function of plasmid from plasmid pVS1 with wide the host strain regions of Agrobacterium tumefaciens and Escherichia coli.

* · · ······································································· ·· · · ··

DETAILED DESCRIPTION OF THE INVENTION

The following examples illustrate the invention.

Example 1

Construction of pJT118 bacterial expression vector and E.coli transformation

A "histidine tail" containing 10 amino acid residues was attached to the N-terminus of the AATP2 protein (X94626 gene library) from Arabidopsis thaliana.

Therefore, cDNA encoding the entire AATP2 protein from Arabidopsis thaliana was isolated by PCR. The following oligonucleotide containing an additional restriction endonuclease recognition site XhoI served as the anticoding primer:

cgtgagagatagagagctcgagggtctgattcaaacc (sequence number 1); containing pairs ranging from 66 to 102.

An oligonucleotide containing an additional BamHi restriction endonuclease site: gatacaacaggaatcctggatgaagc (SEQ ID NO: 2) containing base pairs 1863 to 1835 served as antisense primer. The obtained PCR product was purified on an agarose gel, digested with XhoI / BamHI and inserted " into plasmid pET16b (Novagene, Heidelberg, Germany). This resulted in a histidine tail exhibition of 10 amino acids at the N-terminus of the cDNA encoding the entire AATP2 protein from Arabidopsis thaliana (His-AATP2). The vector was named pJT118. The PCR product sequence was determined by sequence analysis of both nucleotide sequences (Eurogentec). Transformation of E. coli C43 (Miroux and Walker, J. Mol. Biol. 260 (1996), 289-298) was performed by standard methods.

The E. coli C43 strain allows heterologous expression of animal (Miroux and Walker, cited above) and vegetable (Tjaden et al., J. Biol. Chem. (1998) (in print) membrane proteins).

After transformation of said strain with the vector pJT118, studies with radiolabeled ADP and ATP were performed. These studies demonstrate that HIS-AATP2 can be functionally expressed in E. coli C43 in the cytoplasmic membrane of E. coli. This showed that AATP2 actually encodes an ADP / ATP carrier. The presence of the N-terminal histidine tail results in an increase (two to three times) of the AATP2 transport activity from A. thaliana to E. coli compared to AATP2 without the N-terminal histidine tail.

·· ··

Example 2

Construction of plasmid pJT31 and insertion of this plasmid into the genome of potato plants

Construction of the vector for plant transformation consisted in ligating the 2230 bp EcoRV / BamHI fragment from AATP1-cDNAz A thaliana (Kampfenkel et al., FEBS Letters 374 (1995), 351-355) to the pBinAR vector digested with SmaI / EcoRV and BamHI (Hofgen and Willmitzer, Plant Sci. 66 (1990), 221-230). By inserting the cDNA fragment, an expression cassette (pJT31) was created, consisting of the following fragments A, B and C (see Fig. 1):

Fragment A (540 bp) contains the cauliflower mosaic virus 35S promoter.

Fragment B contains, in addition to the side regions, a protein encoding the A. thaliana ADP / ATP transporter region (AATP1). The isolation of said region has been described above. Further, the region was linked in anti-coding orientation to the 35S promoter in the pBinAR vector.

Fragment C (215 bp) contains a polyadenylation signal from a gene encoding octopine synthase from Agrobacterium tumefaciens.

The size of the plasmid pJT31 is approximately 14.2 kb (kilopaires).

The plasmid was transferred to potato plants using Agrobacteria according to RochaSos et al. (EMBO J. 8 (1989), 23-29). The result of transformation of potato plants was an increased level of plastid ADP / ATP transporter mRNA. This was detected by Northern blot (see Fig. 6). RNA was isolated from the tissue of leaves and tubers of potato plants by standard methods. 50 µg of RNA was separated on an agarose gel (1.5% agarose, 1X MEN buffer, 16.6% formaldehyde). After electrophoresis, RNA was transferred with 20x SSC capillary blot onto Hybond N nylon membrane (Amersham, UK). RNA was fixed to the membrane by UV radiation. The membrane was prehybridized in phosphate hybridization buffer (Sambrook et al., Cited above) for 2 hours and subsequently hybridized for 10 hours by the addition of a radiolabeled probe.

Example 3

Construction of plasmid pJT32 and insertion of this plasmid into the genome of potato plants

The construction of the vector to transform the plants consisted in ligation of the BamH1 / NdeI fragment from the S. tuberosum AATP1-cDNA coding region (Genbank Y10821) of 1265 bp to the pBinAR vector (Hofgen and Willmitzer, Plant Sci. 66 (1990), 221 až

230) digested with SmaI / NdeI and BamHI.

By inserting the cDNA fragment, an expression cassette was created consisting of the following fragments A, B and C (see Figure 2):

Fragment A (540 bp) contains the cauliflower mosaic virus 35S promoter.

Fragment B contains the 1265 bp ADP / ATP carrier coding region of S. tuberosum (AATP1 S.t.). Said region was further linked in antisense orientation to the 35S promoter in the pBinAR vector.

Fragment C (215 bp) contains a polyadenylation signal from a gene encoding octopine synthase from Agrobacterium tumefaciens.

The size of the plasmids pJT31 is approximately 13.3 kb.

The plasmid was transferred to potato plants using Agrobacteria according to RochaSos et al. (EMBO J. 8 (1989), 23-29).

Transformation of potato plants resulted in a reduced level of plastid ADP / ATP transporter. This was detected by Northern blot (see Fig. 5). RNA was isolated from the tissue of leaves and tubers of potato plants by standard methods. 50 μς RNA was separated on an agarose gel (1.5% agarose, 1x MEN buffer, 16.6% formaldehyde). After electrophoresis, RNA was transferred with 20x SSC capillary blot onto Hybond N nylon membrane (Amersham, UK). RNA was fixed to the membrane by UV radiation. The membrane was prehybridized in phosphate hybridization buffer (Sambrook et al., Cited above) for 2 hours and subsequently hybridized for 10 hours by the addition of a radiolabeled probe.

Example 4

Analysis of starch, amylose and sugar content in transgenic potato plants

The determination of soluble sugars was performed as described by Lowry and Passonneau in "A Flexible System of Enzymatic Analysis", Academic Press, New York, USA (1972). The starch content was determined as described by Batz et al. (Plant Physiol. 100 (1992), 184-190).

• * · · · · · · · · · · · · · · · · · · · · · · · · ·

Table 1:

line / genotype Starch content in (pmol units C6 / g fresh weight) soluble sugar content (pmol / g fresh weight) Desiree / Wild type 1094.0 26.49 654 / antisense-AATP1 S. tuberosum 574.2 42.52 594 / antisense-AATP 1 S. tuberosum 630.2 48.76 595 / antisense-AATP 1 S. tuberosum 531.4 45.92 676 / antisense-AATP 1 (S. tuberosum) 883.0 40.60 62 / anti-coding-AATP 1 (A. thaliana) 1485.0 30.65 98 / anti-coding-AATP1 (A. thaliana) 1269.0 18.28 78 / anti-coding-AATP1 (A. thaliana) 995.0 20.50

The amylose content was determined according to Hovenkamp-Hermelink et al (Potato Res. 31 (1988), 241-246):

Table 2:

line / genotype % amylose Desiree / Wild type 18.8 654 / antisense-AATP 1 (S. tuberosum) 15.5 594 / antisense-AATP 1 (S. tuberosum) 14.3 595 / antisense-AATP1 (S. tuberosum) 18.0 676 / antisense-AATP1 (S. tuberosum) 11.5 62 / anti-coding-AATP 1 (A. thaliana) 27.0 98 / anti-coding-AATP1 (A. thaliana) 22.7 78 / anti-coding-AATP1 (A. thaliana) 24.5

Example 5

Production of expression cassette and transformation of rapeseed plants

The expression cassette pTE200 in the pBluescript derivative (Short et al., Nucl. Acid Res. 16, (1988), 7583-7600) carries the promoter and terminator sequence of the thioesterase CIFatB4 gene (AJ131741 gene bank accession number) from Cuphea lanceolata and the appropriate sequence polylinker used to insert various useful genes. Extreme recognition sequences of Sfi with incompatible nucleotides in the variable recognition regions allow for the controlled transfer of the entire expression cassette, including the useful gene, to the corresponding restriction sites of the pMHOOO-O binary plasmid vector and further development of the pLH9000 vector (Hausmann and Tópfer, (1999); Entwicklung von PlasmidVektoren in Bioengineering Forums Rapssorten nach MaB, D. Brauer, G. Robbelen, and R. Tópfer (editors), Vortráge Forums Planzenzüchtung, Vol. 45, 155-172), and prevent reverse circulation of DNA in the receiving vector.

To produce the expression cassette pTE200, a SalI-Bbv1 fragment carrying an approximately 3.3 kb promoter was first isolated from the genome clone CITEg16 (WO95 / 07357), which carried the complete sequence of the C. lanceolata CIFatB4 gene. To achieve this, the Bpvl restriction site at the 3'-end of the promoter was first opened and modified so that the fragment could be inserted into pBluescript (stratagen) digested with SalI and SmaI. The internal recognition site for the EcoR fragment located at 1211 nucleotides at the 5'-end was deleted by being opened and altered by T4 polymerase and then resealed.

The terminator sequence was increased by a polymerase chain reaction using specific oligonucleotide primers on the CITEg16 matrix (WO95 / 07357) and was provided with various polylinker restriction sites (MCS) via primers. The sequences of the primers used are;

5'GAATTCCTGCAGCCCGGGGGATCCACTAGTCTCGAGAAGTGGCTGGGGGCCTTT CC3 '(SEQ ID NO: 3) = 5'-primer: (MCS: EcoRI, PstI, SmaI, BamHI, Spel XhoI; CIFatB4 terminator: from position 35 to 56) and

5'TCTAGAGGCCAAGGCGGCCGCTTCAACGGACTGCAGTGC3 '(sequence identification number: 4) = 3'-primer: CIFatB4 terminator: from position 22 to 39, MCS: Notl, Style, Sfil,

Xbal. The enlarged product was digested with EcoRV and NotI and inserted into the corresponding restriction sites of the pBlueSfi BA vector (Hausmann and Topfer, supra). The promoter-bearing fragment was opened with BamHI, modified and then digested with SalI to be 0 · 0 · 0 · 0 · 0 · 0 · · 0 0 0 0 · 0 0 0 0 • 0 0 0 0 0 • 0 0 0 0 • 000 00 00 can be inserted into the pBlueSfi BA vector via a SalI restriction site and a modified HindIII site upstream of the terminator. The result is a pTE200 expression cassette (see Figure 7).

The construction of the vector to transform the plants consisted in ligation of the EcoRI fragment of the AATP1 cDNA from Solarium tuberosum (pTM1, Tjaden et al., The Plant Journal 16 (1998) 531-540) of 2270 bp in length to the pTE200 vector that had been opened with EcoRI. Orientation was controlled by restriction digestion. This resulted in plasmid pTE208 (FIG. 8). In the next step, the SfiI fragment from pTE208 was inserted into the polylinker restriction sites of the binary vector pMHOOO-O (Fig. 9) in a controlled manner. The result was pMH 0208.

The binary plasmid vector pMHOOO-O was developed further from pLH9000 (Hausmann and Topfer, supra) with various selection markers for plant transformation. The sulfonamide gene (sul) was isolated together with the signal peptide sequence (tp) for plastidial import into the small subunit of ribulosabisphosphate carboxylase from the precursor plasmid pS001 (Reiss et al., Proc. Natl. Acad. Sci. USA 93, (1996), 3094-3098). ) after modification of Asp718 to XhoI restriction site. The XhoI - SalI fragment was inserted into the XhoI and BamHI-restriction sites of the pBluescript vector derivative upstream of the gene terminator encoding nopaline synthase (pAnos) after treatment with SalI and Bam HI. Subsequent three-fragment ligation, the resulting tpsul-pAnos fragment (XhoI-XbaI), together with the XhoI-HindIII fragment from pRT103pat (Tópfer et al., Methods in Enzymol. 217, (1993), 66-78) were linked to plasmid pK18 (Pridmore, Gene). 56, (1987), 309-312) with open enzymes HindIII and XbaI. As a result, the gene encoding phosphinothricin acetyltransferase with the CaMV35S RNA gene terminator from pRT103pat was placed in the opposite orientation to the tpsul-Anos unit. The dual promoter of the CaMV35S gene as an XhoI fragment from the progeny of pROA93 (Ott et al., Mol. Gen. Genet. 221, (1990), 121-124) was inserted into the XhoI restriction site between sequences of resistance mediating genes to complete said double selection unit (with resistance to herbicide Basta and sulfonamide sulfadiazine). After corresponding changes in the adjacent polylinker, the resulting dual selection cassette was exchanged with the XbaI and HindIII enzymes for the kanamycin cassette in the precursor 1 of plasmid pLH9000 (Hausmann and Topfer, supra). This resulted in the binary plasmid vector pMHOOO-O.

The transformation of the hypocotyl explants of the Drakkar rape variety was carried out as described by De Block (Plant Physioi. 91 (1989), 694-701) using Agrobacteria (strain

GV 3101 (C58C1 Rifr) carrying the binary vector pMH0208 (ADP / ATP anticoding carrier). The shoots were regenerated on a selective nutrient medium (sulfonamide) and cultured in a greenhouse until the seeds were matured. The plants and the transgene were determined by PCR and leaf test (glufosinate ammonium tolerance (Basta®)). The maturing embryos were removed from the plants at various stages of development and stored in liquid nitrogen.

Determination of the oil content of mature seeds of transgenic rapeseed and control lines was performed by non-invasive near-field infrared spectroscopy (described, for example, in Schulz et al., J. Near Infrared Spectrosc. 6, (1998), A125-A130; Starr et al. J. Agric Sci 104 (2), (1985), 317-323).

Claims (16)

PATENT CLAIMS 1. A transgenic plant cell that is genetically modified, characterized in that the genetic modification is the introduction of a foreign nucleic acid molecule whose presence or expression results in an increase in the activity of the plastid ADP / ATP transporter compared to corresponding non-genetically modified plant cell cells from plants wild type. 2. The transgenic plant cell of claim 1, wherein the foreign nucleic acid molecule encodes a plastid ADP / ATP transporter. 3. The transgenic plant cell of claim 2, wherein said foreign nucleic acid molecule encodes an Arabidopsis thaliana plastid ADP / ATP transporter. Transgenic plant cell according to any one of claims 1 to 3, characterized in that it has an increased yield compared to the corresponding non-genetically modified plant cells. Transgenic plant cell according to any one of claims 1 to 4, characterized in that it has an increased content of oil and / or starch compared to corresponding non-genetically modified plant cells. Transgenic plant cell according to any one of claims 1 to 5, characterized in that it synthesizes a starch having an increased proportion of amylose compared to the starch of the corresponding genetically unmodified plant cells. A transgenic plant comprising the transgenic plant cells according to any one of claims 1 to 6. Transgenic plant according to claim 7, characterized in that it stores starch and / or oil. The transgenic plant of claim 8, which is corn, rape, wheat or potato. A method of producing a transgenic plant that exhibits increased yield compared to wild-type plants, wherein (a) the plant cell is genetically modified by introducing a foreign nucleic acid molecule whose presence or expression results in increased activity of the plastid ADP / ATP transporter in the cell; • · · φ · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · regenerated from the cell produced according to step (a); and (c) optionally, the other plants are made from a plant produced according to step (b). The method of claim 10, wherein the transgenic plant has an increased oil and / or starch content compared to wild-type plants and / or whose starch contains an increased amylose content compared to starch from wild-type plants. A transgenic plant obtainable by the method of claims 10 or 11. Plant propagation material according to any one of claims 7 to 9 or 12, characterized in that said propagation material comprises transgenic cells according to any one of claims 1 to 6. Use of nucleic acid molecules encoding a plastid carrier ADP / ATP for producing transgenic plants showing increased yield compared to wild-type plants. Use according to claim 14, characterized in that the transgenic plant has an increased oil and / or starch content and / or synthesizes a starch with an increased amylose content compared to starch from wild-type plants. A method for producing a modified starch comprising extracting starch from a plant according to any one of claims 7 to 9 or according to claim 12.