CZ20004032A3 - Enhanced production of antibodies specific for FAP-alpha - Google Patents

Abstract

Recombinant antibody proteins that specifically bind Fibroblast Activation Protein Alpha (FAPα) and contains adjustments to the underlying structure that lead to improved productivity in host cells. Use of said antibodies for diagnostic and therapeutic purposes and methods production of said antibodies

Description

Improved production of FAP-α-specific antibodies

Technical field

The invention provides antibody proteins that specifically bind to fibroblast activating protein alpha (FAPct). The invention also relates to the use of said antibodies for diagnostic and therapeutic purposes and methods of producing said antibodies.

BACKGROUND OF THE INVENTION

Invasive growth of epithelial malignancy is associated with a number of characteristics of cellular and molecular changes in supporting connective tissue. The highly consistent molecular feature of reactive supportive tissue of many types of epithelial cancer is the induction of fibroblast activating protein alpha (referred to as FAP). It is a cell-surface molecule that reacts with fibroblasts of supporting connective tissue originally identified by monoclonal antibodies F19 (Garin-Chesa P., Old LJ and Retting WJ (1990). Cell surface dlycoprotein of reactive stromal fibroblasts as and potential antibody target in human epithelial cancers. Proc. Natl. Acad. Sci. 87: 7235). Since the FAP antigen is selectively expressed in epithelial cancer connective tissue independent of region and histological type, the concept of FAP targeting has been developed to visualize, diagnose and treat epithelial cancer and certain other disorders. For this purpose, monoclonal antibodies have been developed which have been designated F19 and which specifically bind FAP. They are described in US Patent 5,059,523 and WO

93/05804.

• · · · · · · · · · · · · ·

When non-human antibodies are used in humans for in vivo administration, a human response is generated which decreases the efficacy of the antibodies in patients and interrupts the continuous administration of the antibodies. Humanization of non-human antibodies is commonly achieved by one of two routes: (1) the construction of non-human / human chimeric antibodies, wherein non-human variable regions are associated with human constant regions (Boulianne GL, Hozumi N. and Shulman, MJ (1984) Production of functional chimeric mouse / human antibody Nature 312: 643) or

(2) introducing complementarity determining regions (CDRs) from non-human variable regions into human variable regions and joining said engineered human variable regions to human constant regions (Riechmann L., Clark M., Waldmann H. and Winter G. (1988) Reshaping human antibodies for therapy (Nature 332: 323).

Chimeric antibodies, although substantially better than murine antibodies, can still elicit a human anti-mouse antibody response (LoBuglio A.F., Wheeler R.H., Trang J., Haynes A., Rogers K., Harvey E. B.

Sun L.

Ghrayeb J. and Khazaeli Μ. B. (1989) Mouse / human chimeric monoclonal antibody in man: Kinetics and immune response. Why. Nati. Acad. Sci. 86: 4220). Human antibodies that contain engineered CDRs and are engineered contain little or no portion of the protein sequences that have been derived from murine antibodies. Although antibodies humanized by the introduction of CDRs may still be capable of eliciting some immune responses, such as an anti-allotypic or anti-idiotypic response, as seen with natural human antibodies, CDR-introduced antibodies will be substantially less immunogenic compared to murine antibodies, allowing prolong treatment of patients.

Another serious limitation to the normal use of antibodies in diagnosis, imaging and treatment is their production in large quantities. In many cases, the recombinant expression of natural, chimeric and / or antibodies is recombinant. that may have introduced CDRs in cell culture systems is poor. Factors that contribute to low production include the selection of leader sequences and host cells suitable for production as well as improper packaging and limited secretion. Improper packaging may result in misalignment of the heavy and light chains by a transport incompetent arrangement that does not allow the secretion of one or more chains. It is generally accepted that the L-chain confers the ability to secrete an ordered protein. In some cases, multiple or even single substitutions may result in increased antibody production.

Given the clinical importance of specific immunological targeting of in vitro and in vivo disease-specific antigens suitable for diagnosis and treatment in humans, there is a need to develop antibodies that combine antigen specificity features, low immunogenicity and high production.

Therefore, the main problem of the invention is to obtain antibody proteins that combine specific binding properties to FAP, low immunogenicity in humans and high production in the recombinant system.

SUMMARY OF THE INVENTION

Embodiments of the invention described in the examples solve the technical problem.

The invention relates to novel antibody proteins having complementarity determining regions of F19 monoclonal antibodies (ATCC deposit number HB 8269), wherein the novel antibody proteins specifically bind to fibroblast activation protein (FAP), which is characterized by adjusting the framework, which results in improved production of host cells as compared to chimeric antibodies that exhibit variable regions of F19 and foreign constant regions.

The term "antibody protein" is a protein exhibiting antigen binding specificity for monoclonal antibodies.

The term "complementarity determining monoclonal antibody regions" refers to those amino acid sequences that are involved in specific antigen binding, as described in Kabat EA, Wu Τ. T., Perry Η. Μ. , Gottesman KS and Foeller C. (1991) Sequences of Proteins of Immunological Interest (5 ^th Ed.). NIH Publication No. 91-3242. US Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, MD) in conjunction with Choth and Lesk (1987) J. Mol. Biol. 196: 901-917.

The term "base deletion modification or addition of a single structure" means substitutions, or multiple amino acids, in the variable regions that surround the individual regions determining complementarity. Framework alterations may affect the immunogenicity, production, or binding specificity of an antibody protein.

The term "fibroblast activating protein (FAP), also referred to as fibroblast activating protein alpha (FAPcc) is a membrane-bound glycoprotein that belongs to the family of serine portease genes (WO 97/34927). The secreted form of FAP is not known. FAP can be characterized by its binding to monoclonal antibodies F19 (F19 can be obtained from the hybridoma cell line with deposit number HB 8269 in ATCC).

The term "specific binding of the fibroblast activation protein of an antibody protein" is defined herein as the ability to specifically recognize and bind human cells expressing FAP. The binding specificity of the proteins of the invention can be determined by standard binding specificity evaluation procedures as described in Examples 6, 8 and 12.

The term "chimeric antibodies" refers to an antibody protein that exhibits light and heavy chain variable regions as described in Figures 17 and 18 and foreign constant regions. The term "foreign constant region" is defined as a constant region that differs from constant regions F19. When comparing the antibody protein of the invention with the chimeric antibodies, it is apparent that such chimeric antibodies must contain the same constant regions as said antibody protein. In order to demonstrate and compare the human constant heavy and light chains themselves, as described in Figures 19-22, they are used as described in the Examples.

To produce the antibody proteins of the invention, the nucleic acid sequences of the heavy and light chain genes of the murine F19-labeled murine antibodies were determined from RNA that was extracted from F19 hybridoma cells (ATCC deposit number HB 8260).

One embodiment of the invention describes. antibody proteins that include complementarity determining regions of monoclonal antibodies F19 (ATCC deposit number HB 8269). Said novel antibody proteins specifically bind to fibroblast activating protein (FAP), characterized in that the structural modification results in improved production in host cells, as compared to chimeric antibodies having variable regions of F19 and foreign constant regions, wherein said antibody protein was derived from murine F19-labeled antibodies (ATCC deposit number HB 8269).

In order to produce humanized FAP-specific antibody proteins, chimeric antibodies having F19 light and heavy chain variable regions and human heavy and light constant regions were constructed. The construction and production of chimeric mouse / human antibodies are well known in the art (see Boulianne GL, Hozumi N. and Shulman, MJ (1984) Production of a functional chimeric mouse / human antibody Nature 312: 643) and are described in Examples 1 and 2.

The variable regions of the antibody proteins of the invention are typically linked to at least a portion of an immunoglobulin constant region (F _c ). In a typical example, with a constant portion of a human immunoglobulin. DNA sequences of human constant regions can be isolated by well known procedures from a variety of human cells, but preferably from immortalized B cells (Kabat EA, Wu TT, Perry HM, Gottesman KS and Foeller C. (1991) Sequences of Proteins of Immunological Interest (5 ^th Ed.), NIH Publication No. 91-3242, US Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, MD). Because the antibody proteins of the invention may contain all or only a portion of the constant region if they exhibit specific binding to the FAP antigen. The choice of the type and extent of the constant region depends on whether the effector functions as a complement fixator or antibody dependent cell toxicity and the desired pharmacological properties of the antibody protein are required. The antibody protein of the invention will typically be a tetramer that contains two pairs of light and heavy chains, but may also occur as a dimer, i.e., it contains one pair of light and heavy chains. For example, it is a Fab or Fv fragment.

Therefore, another embodiment of the invention relates to the antibody proteins of the invention characterized in that they have a light and heavy chain variable region, each attached to a human constant region. In particular, the light chain variable region is linked to the kappa constant region and the heavy chain variable region is linked to the human gamma-1 constant region. Other regions are available for humanization of the light and heavy chains.

human constant

Therefore, in one particular embodiment of the invention, the antibody proteins of the invention comprise a human kappa constant region.

Another particular embodiment of the invention provides antibody proteins of the invention that comprise a gamma-1 constant region.

In particular, the F19 chimeric antibody protein comprises the light and heavy chain variable and constant regions described in Figures 17-22. CF19 demonstrates specific binding and high avidity to the FAP antigen. As shown in Example 2, cF19 expression in COS cells (cells obtained from African green monkey kidneys) is weak and ranges from about 10 to 60 ng / ml, which is at least ten times lower than most antibodies.

In order to increase the level of expression of cF19 changed leader sequence of F19 V _L region substitution of proline for leucine at position 9. This single change in amino acid in the leader sequence leads to at least double the amount of the chimeric antibodies produced by COS cells. For the expression of these certain chimeric antibodies in COS cells, the following mutated MDSQAQVLMLLLLWVSGTCG light chain and MGWSWVFLFLLSGTAGVLS heavy chain leader sequences were used.

The term "improved production according to the invention" means a substantial improvement in the expression level and / or yield of purified antibodies in host cells compared to the expression level.

00 0

And / or yield of chimeric antibodies without structural modifications as defined above. Two specific but not limiting examples showing improved production in the COS cell expression system (in Examples 2 and 5) and in the CHO cell expression example (in Examples 10 and 11).

While the mutation leader sequence only leads to a doubling of the expression yield of F19 chimeric antibodies, a substantial improvement as defined by the invention results in an improvement in expression strength and / or purification yield by at least a factor of 10.

In a preferred embodiment of the invention, antibody proteins are characterized characterized in that their expression level in the raw medium samples as determined by ELISA and / or the purified yields exceed the expression level and / or the purification yield of chimeric antibodies without modification of the framework by at least a factor of 10.

In a more preferred embodiment of the invention, antibody proteins are characterized characterized in that their expression in raw medium samples as determined by ELISA and / or the purified yields exceed the expression strength and / or the purification yield of chimeric antibodies without modification of the framework by at least a factor of 20.

The most preferred embodiment of the invention describes antibody proteins characterized in that their expression in raw medium samples as determined by ELISA and / or the purified yields exceed the expression strength and / or the purification yield of chimeric antibodies without modification of the framework by at least a factor of 100.

Improved production of the recombinant antibody proteins of the invention can take place in eukaryotic cells, as shown in COS and CHO eukaryotic cells (Chinese hamster ovary derived cells) (described in Examples 5 and 11).

• · · · · · · · · · · · · · ·

In another embodiment of the invention, recombinant antibody proteins are described characterized in that they exhibit improved production in eukaryotic cells.

In a preferred embodiment of the invention there is provided antibody proteins, wherein said eukaryotic cell is a Chinese hamster ovary cell (CHO cell).

It has unexpectedly been found that certain modifications of the framework of the light chain variable regions result in improved production of the antibody proteins of the invention. Three versions of the altered shape light chain variable regions were prepared. These versions were designated A, B and C and are shown in Figures 1-6. Versions of the light chain variable regions A, B, and C show significantly improved production in CHO cells (described in Example 11). While versions A and C of the light chain variable region differ from version B of the light chain variable region by only two common amino acid residues show a significant improvement in production. There is at least another ten-fold difference in antibody secretion strength between human version B of the F19 light chain, which has a modified shape, and version A or C. The amino acid sequence of versions A and B of the human F19 light chain is. it differs only by two residues at position 36 (Tyr replaced by Phe) and 87 (Tyr replaced by Asp) (Kabat nomenclature). This negative effect on the ability to secrete antibodies containing version B of the light chain variable region could be indirect if Tyr is replaced by Asp and Ty by Phe. Whether mutations are made individually or separately, they cause incorrect packaging of the protein. Antigen-binding assays show that immunoglobulins containing fl9 light chain version B have similar avidity to pairing from the F19 light chain version A or C, suggesting that they are macroscopically improperly packaged.

• ·

Residue 87 in the F19 modified light chain version B of the human light chain is particularly responsible for limiting shedding compared to versions A and C.

In a preferred embodiment of the invention, the antibody proteins of the invention are described wherein the amino acid at position 87 of the Kabat light chain region is not asparagine.

A more preferred embodiment of the invention describes antibody proteins of the invention wherein the amino acid at position 87 of the Kabat light chain region is selected from the group consisting of aromatic or aliphatic amino acids.

The most preferred embodiment of the invention describes antibody proteins of the invention wherein the aromatic amino acid at position 87 of the Kabat light chain region is tyrosine or phenylalanine.

In another embodiment, the invention provides antibody proteins of the invention wherein the amino acid at position 36 of the Kabat light chain region is selected from the group consisting of aromatic amino acids.

Another embodiment of the invention provides specific protein antibodies that can be prepared from individually described light and heavy chain variable region variable regions.

In particular, the light chain variable region versions A and C are particularly suitable for practicing the invention because of their exceptionally high production, while maintaining full binding specificity to FAP and achieving low immunogenicity. This is particularly the case when comparing chimeric antibodies having the variable regions of F19 and the same constant regions, but also when compared to the version B of the light chain.

• 4 • 44

One embodiment of the invention provides antibody proteins comprising a light chain variable region as set forth in SEQ ID NO: 2.

Another embodiment of the invention provides antibody proteins characterized in that the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 1.

Another embodiment of the invention provides antibody proteins comprising the light chain variable region set forth in SEQ ID NO: 6.

Another embodiment of the invention describes antibody proteins characterized in that the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 5.

The invention also discloses several different heavy chain variable regions that function particularly well with the light chain version A and C variable regions in terms of improved production.

Another embodiment of the invention provides antibody proteins that comprise a heavy chain variable region set forth in any of SEQ ID NOs: 8, 10, 12, 14.

Another embodiment of the invention provides antibody proteins that comprise a heavy chain variable region set forth in any of SEQ ID NOs: 7, 9, 11, and 13.

Another embodiment of the invention provides antibody proteins that comprise a light chain variable region set forth in SEQ ID NO: 2 and a heavy chain variable region set forth in SEQ ID NO: 12. Most preferably, this region comprises a light chain constant region set forth in SEQ ID NO. 20 and the heavy chain constant region shown in SEQ ID

NO: 22.

• · · φ ♦

· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Learn more

Further, the invention provides an antibody protein comprising the amino acid sequence set forth in SEQ ID NO: 2. Preferably, such antibody protein further comprises the amino acid sequence set forth in SEQ ID NO: 12, wherein said antibody protein comprises the amino acid sequence set forth in SEQ ID NO. 20 and SEQ ID NO: 22. Further described is an antibody protein as described in this paragraph which has been coupled to a radioisotope, preferably ¹³¹ I, ¹²⁵ I, ¹⁸⁶ Re, or ⁹⁰ Y. Further, the invention provides a DNA molecule encoding the antibody protein as described in this paragraph. Further, the invention provides a host cell that carries such a DNA molecule. The invention further provides a method of producing an antibody protein as described in this paragraph, said method comprising culturing such host cells under conditions wherein said antibody protein is expressed in said host cell, and isolating said protein. The invention further provides antibody proteins characterized in that the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 1 and the heavy chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 11.

Another embodiment of the invention discloses antibody proteins comprising a light chain variable region set forth in SEQ ID NO: 2 and a heavy chain variable region set forth in SEQ ID NO: 8.

The invention further provides antibody proteins characterized in that the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 1 and the heavy chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 7.

Humanization of the variable region of murine antibodies can be achieved using methods known in the art. Document EP 0239400 • 0 • 0 00 • 0 • 0 •

0 000 describes the introduction of CDRs of a mouse variable region into the framework of a human variable region. WO 90/07861 discloses methods for changing the shape of a variable region with a CDR introduced, further introducing framework changes. WO 92/11018 describes methods of producing humanized Ig in combination with a donor CDR, wherein the acceptor framework has a high homology with the donor framework. WO 92/05274 describes the preparation of mutated framework antibodies of murine antibodies. Previous documents describing humanization of murine monoclonal antibodies are EP 0368684, EP 0438310, WO 92/07075 or WO 92/22653. Accordingly, it is possible to produce antibodies of the invention that are derived from commercially available murine F19 monoclonal antibodies and using methods well known in the art. They are described, for example, in WO 92/05274. Of course, DNA molecules encoding antibody molecules can also be obtained by chemical proteins of the invention by synthesis, for example, by synthesis of suitable oligonucleotides and subsequent ligation and amplification (Frank et al., (1987) Methods Enzymol. 154 249).

The invention further provides nucleic acid molecules comprising the coding information of the antibody proteins of the invention as described above. It is preferred that the nucleic acid molecule of the invention comprise a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13 or 15.

The invention further provides a recombinant DNA vector comprising a nucleotide sequence of any of the above-described nucleic acids, particularly when said nucleotide sequence has been operably linked to an expression control sequence, such as in expression vectors. A recombinant DNA vector is preferred, said vector being an expression vector.

Further, the invention provides a host cell carrying a vector as described above, in particular an expression vector. Such a host cell may be a prokaryotic or eukaryotic cell. Preferably, such a host cell is a eukaryotic cell, a yeast cell, or a mammalian cell. More preferably, said host cell is a CHO cell (Chinese hamster ovary cell) or a COS cell.

The invention further provides a method for producing protein antibodies of the invention. Such a method includes

a) culturing a host cell as described above under conditions wherein said antibody protein is expressed in said host cell; and

b) isolating said antibody protein.

Mammalian host cells, such as CHO or COS cells, are preferred. Host cells suitable for the production of the antibody proteins of the invention can be transfected with a single vector containing both light and heavy chain expression units (see, for example, WO 94/11523). One embodiment of the invention provides a method for producing the antibody proteins of the invention in host cells, wherein said host cells are co-transfected with two plasmids carrying light and heavy chain expression units (see, for example, EP 0481790).

of the invention are highly targeting specific FAPs. Therefore, the invention further according to the invention wherein the therapeutic agent is selected from the group consisting of

Antibody proteins according to a specific tool suitable for therapeutic agents for antigen describes antibody proteins antibody protein is associated with Therapeutic agents selected • radioisotopes, toxins, toxoids, inflamatogenic agents, enzymes, antisense molecules, peptides, cytokines and chemotherapeutic agents. Gamma, beta and alpha radiation emitting agents may be used as therapeutic agents. Beta-emitting radioisotopes are preferred as therapeutic radioisotopes. ¹⁸⁶ rhenium, ¹⁸⁸ rhenium, ¹³¹ iodine and ⁹⁰ yttrium have been shown to be particularly useful beta-emitting isotopes to achieve localized irradiation and damage to malignant tumor cells. Particularly preferred as therapeutic agents are radioisotopes selected from the group consisting of ¹⁸⁶ rhenium, ¹⁸⁸ rhenium, ¹³¹ iodine and ⁹⁰ yttrium associated with the antibody proteins of the invention. For example, in the radio-iodination of antibodies of the invention, the method described in WO 93/05804 is used.

The invention further provides antibody proteins of the invention characterized by being labeled. Thus, FAP-specifically labeled antibodies allow localization and / or deletion of FAP antigen in vitro and / or in vivo. A label is defined as a marker that can be detected directly or indirectly. An indirect marker is defined as a marker that cannot be detected by itself, but needs another directly detectable marker specific to the indirect marker. Preferred labels suitable for use in the invention are detectable markers. The detectable marker is selected from the group consisting of enzymes, dyes, radioisotopes, digoxigenins. Most preferred is biotin.

The invention further provides the antibody proteins of the invention characterized in that they associate with an agent that is viewable. A large number of imaging agents, especially radioisotopes, are available. Most preferred isotopes emitting gamma radiation. Most preferred is ¹²⁵ iodine.

The invention provides pharmaceutical compositions comprising an antibody protein of the invention as described above and a pharmaceutically acceptable carrier. Such pharmaceutical ··

4 4 4 4 4 4 • 4 4 4 4 4

4 4 4 4 4

The compositions can be used in the treatment of tumors, wherein said tumors are associated with activated fibroblasts of supporting connective tissue. There are two possible principles of effector action in the case of anti-tumor immunotherapy of supportive connective tissue, which may act synergistically: a) untreated (unrelated, "naked") antibodies of the invention may induce immune damage or inflammatory response in supportive connective tissue; with a therapeutic agent, such as a radioisotope or other toxic agent, localized radiation and destruction of malignant tumor cells can be achieved. The invention further provides the use of an antibody protein as described in the manufacture of a pharmaceutical composition particularly suitable for the treatment of tumors.

In another embodiment of the invention there is provided pharmaceutical compositions comprising an antibody protein of the invention associated with a therapeutic agent as described above and a pharmaceutically acceptable carrier, which is useful in the treatment of tumors, wherein said tumors are associated with activated fibroblasts of supporting connective tissue. The invention provides pharmaceutical compositions comprising an antibody protein of the invention associated with a visible agent as described above, and a pharmaceutically acceptable carrier which is suitable for demonstrating the presence of activated fibroblasts of connective tissue tissue in healing wounds, inflammatory skin or tumor in human patients. The most preferred embodiments of the invention are pharmaceutical compositions as described above, wherein said tumor or tumors are selected from the group consisting of colorectal cancer, cancer other than small lung cell cancer, breast cancer, head and neck cancer , ovarian carcinoma, lung carcinoma, bladder carcinoma, pancreatic carcinoma, and metastatic brain cancer.

€ ···· 19 · · * · * * * * * * * • • • 19 19 19 19 19 19 19 19 19 19 19 19 19 ·· «· ··

In the body of animals or humans, the benefits of administering the pharmaceutical compositions via an intravenous or other route can be demonstrated, for example by systemic and local routes or by application topically to tissue or organ, depending on the type and origin of the disease being treated, such as systemic autoimmune disease. or allergies or transplants of foreign organs or tissues or tumors that are diffuse or difficult to localize. Topical administration is only performed when local manifestations of neoplastic or immunological effects, such as local tumors, are expected.

The antibody proteins of the invention can be administered by a variety of methods well known in the art. It is possible to mention the tissues.

intravenous injection or direct injection into the target

In the case of intravascular, systemic intra-muscular applications, intraarterial, intraperitoneal, oral or intrathecal methods are used. Topical intracutally, intracardially, intracardially, intraloburally, can be administered subcutaneously, intralobally, to the membrane, intrapulmorally or directly to or near the tissue to be treated (connective tissue, bone tissue, muscle tissue, nerve tissue, epithelial tissue). Depending on the time required and the efficacy of the treatment, the pharmaceutical antibody compositions may be administered once or several times a day, for several days, weeks or months, and at various dosages.

Injectable, physiologically acceptable sterile solutions may be used in the preparation of suitable antibody compositions for administration as described above. When preparing solutions for parenteral injection or infusion of aqueous isotonic solutions, such as saline or corresponding plasma protein solutions, they are readily available. The pharmaceutical compositions may be lyophilized or dried, and may be reconstituted with known ingredients.

injectable solutions before being used under sterile conditions, for example, as part of a kit. The final preparation of the antibody compositions of the invention is prepared for injection, infusion or perfusion by mixing the purified antibodies of the invention with a sterile physiologically acceptable solution, which may be supplemented with a known carrier compound and / or excipients (e.g. serum albumin, dextrose, sodium bisulfite, EDTA).

The amount of antibody administered depends on the nature of the disease. For patients with cancer, a dose of between 0.1 and 100 mg / m ² is preferred, preferably between 5 and 50 mg / m ² . For antibodies labeled with iodine-131, for example, it is necessary to determine the maximum tolerated dose (MTD), which should not be exceeded during therapy. Administration of radiolabeled antibodies should be repeated (monthly or weekly) by intravenous infusion of a dose lower than MTD (Welt et al., (1994) J. Clin. Oncol. 12: 1193-1203).

The invention further provides the use of the antibody proteins of the invention suitable for cancer. In a preferred embodiment of the invention there is provided the use of the antibody proteins of the invention conjugated to a therapeutic agent as described above, which are suitable for the treatment of cancer. In another embodiment of the invention, the antibody proteins of the invention are conjugated to an agent useful for displaying activated fibroblasts of connective tissue. In another preferred embodiment of the invention, there is provided the use of the labeled antibody proteins of the invention suitable for detecting the presence of activated fibroblasts of supporting connective tissue in a sample.

The invention provides a method of treating cancer wherein the tumor is associated with activated fibroblasts of supporting connective tissue,

• · ·

which are capable of specifically forming a complex with the antibody proteins of the invention that are present as naked / unmodified antibodies, engineered antibody proteins, such as fusion proteins or antibody proteins associated with a therapeutic agent, comprising tumor contact and an effective amount of said antibody. In a preferred embodiment of the invention, there is provided a method of treating cancer as described above, wherein the tumor comprises cancer cells selected from the group consisting of colorectal cancer cells, cancer other than small lung cell cancer, breast cancer, head and neck cancer , ovarian carcinoma, lung carcinoma, bladder carcinoma, pancreatic carcinoma, and metastatic brain cancer.

The method of treating tumors may be performed in vitro or in vitro

The invention further provides a method for detecting the presence of activated fibroblasts of supporting connective tissue in wound healing, inflammation, or in tumors, characterized in that:

(a) the sample containing activated fibroblasts of the supporting connective tissue is contacted with the antibody protein of the invention under conditions suitable for complexing between said antibodies and the antigen;

b) detecting the presence of said complex, detecting the presence of activated fibroblasts in the supporting connective tissue in wound healing, inflammation, or tumor.

A preferred embodiment of the invention discloses a method for detecting the presence of activated fibroblasts in tumor supporting tissue, wherein the tumor comprises malignant cells selected from the group consisting of colorectal carcinoma cells, carcinoma other than small lung carcinoma. · · 4 · 4 4 4

4 44 4 · · · 4 44 4

4 4 4

4444444 44 44 cells, breast cancer, head and neck cancer, ovarian cancer, lung cancer, bladder cancer, pancreatic cancer, and metastatic brain cancer.

Most preferred are the antibody proteins of the invention, which are labeled as described above.

The invention further provides a method of imaging the presence of activated fibroblasts in supporting connective tissue in wound healing, in inflammatory tissue (rheumatoid arthritis and cirrhosis are also positive) or a tumor in a human patient characterized by:

a) administering an antibody protein of the invention conjugated to a labeling agent is administered to a human patient under conditions suitable for the preparation of the antibody-antigen complex,

(b) depicting any complex formed by said method;

c) depicting the presence of activated fibroblasts in the supporting connective tissue in a human patient.

A preferred embodiment of the invention describes a method of imaging the presence of activated fibroblasts in tumor supporting tissue as described above, wherein the tumor comprises cells selected from the group consisting of: colorectal carcinoma, non-small lung carcinoma, mammary carcinoma, malignant head and neck growth, ovarian cancer, lung cancer, bladder cancer, pancreatic cancer, and metastatic brain cancer.

The invention further provides a method for detecting tumor supporting tissue which is characterized by:

(a) a suitable sample is contacted with the antibody protein of the invention under conditions appropriate to form an antibody-antigen complex;

b) detecting the presence of any formed complex

c) a relationship of said complex to the presence of detection of tumor supporting tissue.

Antibody proteins suitable for practicing the invention are labeled with a detectable marker.

The present invention provides a method for displaying the tumor supporting tissue in a human subject

a) administering to a patient antibodies of the invention that have been coupled to an imaging agent as described above under conditions suitable to form an antibody-antigen complex;

b) imaging any formed complex, thereby also illustrating the presence of tumor supporting tissue in a human.

Overview of the drawings

Figure 1 shows the DNA sequence of the humanized F19 light chain variable region version A (hF19L _A ) of SEQ ID NO: 1.

Figure 2 shows the amino acid sequence of the humanized light chain variable region F19 of the modified version A (hF19L _A ) SEQ ID NO: 2.

Figure 3 shows the DNA sequence of the humanized F19 light chain variable region version B (hF19L _B ) of SEQ ID NO: 3. Nucleotides that differ from version A are underlined and in bold.

Figure 4 shows the amino acid sequence of the humanized F19 light chain variable region version B (hF19L _B ) of SEQ ID NO: 4. Amino acids that differ from version A are underlined and highlighted in bold.

«

0 0 0 ·

Figure 5 depicts the modified version of the human F19 light chain variable region DNA sequence

C (hF19L _c ) SEQ ID NO: 5. Nucleotides that differ from version A are underlined and in bold.

Figure 6 depicts the amino acid sequence of the humanized F19 light chain variable region version B (hF19L _B ) of SEQ ID NO: 6. Amino acids that differ from version A are underlined and highlighted in bold.

Figure 7 human heavy

A (hF19L _A ) of SEQ ID NO: 7.

shows the strands of the modified version F19 variable region DNA sequence

Figure 8 of the human heavy chain shows the modified version of the F19 chain variable region DNA sequence

A (hF19L _A ) of SEQ ID NO: 8.

Figure 9 depicts the humanized F19 heavy chain variable region DNA sequence version B (hF19L _B ) of SEQ ID NO: 9. Nucleotides that differ from version A are underlined and highlighted in bold.

Figure 10 depicts the amino acid sequence of the F19 humanized heavy chain variable region version B (hF19L _B ) of SEQ ID NO: 10. Amino acids that differ from version A are underlined and highlighted in bold.

Figure 11 shows the modified version C human h19 heavy chain variable region DNA sequence (hF19L _c ) of SEQ ID NO: 11. Nucleotides that differ from version A are underlined and highlighted in bold.

Figure 12 depicts the amino acid sequence of the human heavy chain variable region F19 with the modified version C version (hF19L _c ) of SEQ ID NO: 12. Amino acids that differ from version A are underlined and highlighted in bold.

• · · · · · · · · · · · · · · · ·

Figure 13 depicts the modified D version of the human heavy chain variable region DNA version D (hF19L _D ) of SEQ ID NO: 13. Nucleotides that differ from version A are underlined and highlighted in bold.

Figure 14 shows the amino acid sequence of the human F19 heavy chain variable region modified version D version (hF19L _D ) of SEQ ID NO: 14. Amino acids that differ from version A are underlined and highlighted in bold.

Figure 15 depicts the modified E version (hF19L _E ) human heavy chain variable region DNA sequence of SEQ ID NO: 15. Nucleotides that differ from version A are underlined and highlighted in bold.

Figure 16 shows the amino acid sequence of the humanized heavy chain variable region F19 with the modified version E (hF19L _E ) SEQ ID NO: 16. Amino acids that differ from version A are underlined and highlighted in bold.

Figure 17 shows the amino acid sequence of the F19 chimeric light chain variable region (chF19LC) variable region of SEQ ID NO: 17.

Figure 18 depicts the amino acid sequence of the F19 chimeric heavy chain variable region (chF19HC) variable region of SEQ ID NO: 18.

Figure 19 shows the DNA sequence of the constant human kappa light chain of SEQ ID NO: 19.

Figure 20 shows the amino acid sequence of the constant human kappa light chain of SEQ ID NO: 20.

• aa aa aaa aa aa aa aa a aa aa aa aa aa aa aaa aaa aaa aaa

Figure 21 shows the DNA sequence of the constant human heavy chain kappa of SEQ ID NO: 21.

Figure 22 shows the amino acid sequence of the constant human heavy chain kappa of SEQ ID NO: 22

Figure 23 shows mammalian cell expression vectors used in the production of chimeric human antibodies having a modified shape and with human kappa light chains and human gamma-1 heavy chains.

A. Light chain expression vector: pKN100

B. heavy chain expression vector: pG1D105

Figure 24 shows the DNA sequence and amino acid sequence of the murine F19 light chain variable region that has been adapted for use in the construction of the F19 chimeric light chain. Restrictions are indicated in bold. The cossack sequence of CDRs 1-3 and the splice donor site is underlined.

Figure 25 shows the DNA sequence and amino acid sequence of the murine F19 heavy chain variable region that has been adapted for use in the construction of the F19 chimeric light chain. Restrictions are indicated in bold. The cossack sequence of CDRs 1-3 and the splice donor site is underlined.

Figure 26 shows the DNA sequence of F19 chimeric antibodies that was cloned into the mammalian expression vector pKN100. Restriction sites are bold and underlined. The CDRs 1-3 and the splice donor site are underlined. It is the DNA sequence of the murine F19 light chain within the eukaryotic expression vector pKN100. This vector has a cDNA version of the human kappa constant region gene (aleotype Km (3)) terminated by a strong artificial termination region. In addition, the Neo selection gene is also terminated by this artificial sequence and has

Také «» · * · 9 also have the same orientation as the kappa light chain expression cassette.

The essential components of the eukaryotic expression vector pKN100 are:

- 6 = EcoRI restriction site 7 - 1571 = HCMVi promoter / amplifier 583 - 587 = TATAA box

610 = start of transcription

728 - 736 = donor splice site

731 = intron start

1557 = end of intron

1544 - 1558 splice acceptor site 1590 - 1598 = cossack sequence 1599 - 1658 = peptide leader sequence 1659 - 1997 = mouse F19 light chain 1996 - 2004 = splice donor site

2011 - 2657 = copy of human Kappa constant region cDNA gene (Km (3))

2664 - 2880 = spaC2 artificial termination sequence

2887-7845 = DNA fragment of pSV2neo vector containing Amp resistance-bearing gene (in opposite orientation), ColEl and SV40 origin of replication and Neo resistance-bearing gene (in the same orientation as HCMVi-KCT cassette)

7852 - 8068 = spaC2 artificial termination signal

This sequence ends upstream of the EcoRI site (positions 1-6) at the beginning of the sequence. Like the vector, this sequence will be circular.

Figure 27 shows the DNA sequence of F19 chimeric antibodies cloned into the mammalian expression vector pgld105. Restriction sites are bold and are underlined. It is the DNA sequence of the eukaryotic expression vector pG1D105, which contains the murine F19 heavy chain variable region. This vector contains the human gamma-1 constant region cDNA version (Glm allotype (nor a, z -x), also known as the Gml (17) allotype).

The essential components of the structure are:

2501 = pBR322 core sequence comprising the ampicillin resistance gene and ColE1 primer plus the SV40 origin and the degraded SV40 early promoter.

2502-3226 = dhfr gene

3233 - 4073 = SV40 pole 1 sequence etc.

4074 - 4079 = ligated BamHI and BglII restriction sites (BstYl)

4080 - 4302 = instead of SPA plus termination signal C2

4303-5867 = HCMV1 promoter

5879-5857 = a single HindIII restriction site suitable for cloning immunoglobulin variable genes

5886 - 5894 = Cossack sequence

5895 - 5951 = signal peptide

5952 - 6323 = murine F19 heavy chain

6323 - 6330 = donor splice site

6331 - 6336 = single BamHI restriction site suitable for cloning of immunoglobulin variable genes

6337 - 7388 = copy of human gamma-1 constant region cDNA preceded by 62 bp intron

7389 - 7709 = Arnie's termination sequence

The human gamma-1 constant region used in this construction has a Glm (nor a, z, -x), also known as the Gml allotype (17), which is defined as the glutamic acid residue (E) at position 356 (corresponds to Eu numbering) ), a methionine residue (M) at position 358 (according to Eu numbering) and a lysine residue (K) at position 214) according to Eu numbering). These three residues are underlined in the above sequence.

Figure 28 illustrates a method of constructing a modified shape human F19 light chain. This figure shows a ffe diagram of the construction strategy. The dotted lines indicate a complementary sequence of at least 21 bases between the primers.

Figure 29 shows the nucleotide and deduced amino acid sequences of the human F19 light chain variable regions of versions A, B, and C. The nucleotide and amino acid sequences were aligned and compared to version A. The dashes indicate nucleotide identity, dots indicate amino acid sequence identity to this sequence. . Amino acids are numbered as described by Kabat EA, Wu TT, Perry. M., Gottesman, KS and Foeller, C. (1991) Sequences of Proteins of Immunological Interest (5 ^th Ed.). NIH Publication No. 91-3242. US Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, MD). CDR locations are indicated in boxes.

Figure 30 shows the DNA sequence of F19L _A (human version A modified light chain) cloned into the mammalian expression vector pKN100. Restriction sites are bold and are underlined. The CDRs 1-3 and the splice donor site are underlined. It is the F19 version A light chain DNA sequence cloned into the eukaryotic expression vector pKN100. This vector has a cDNA version of the human kappa constant region gene (allotype Km (3)) terminated by a strong artificial termination sequence. In addition, the Neo selection gene also terminates with said artificial sequence and also has the same orientation as the kappa light chain expression cassette.

The components of the vector are:

- 1571 = HCMVi promoter / enhancer

583 - 587 = TATAA box

610 = start of transcription

728 - 736 = donor splice site

731 = the beginning of the intron • 9 9 ···

999999 9 9 9 9 99 9

9 9 9 9 9 9

999 9 999 9999

1557 = end of intron

1544 - 1558 = splice acceptor site

1590 - 1598 = Cossack sequence

1599 - 1658 = peptide leader sequence

1659 - 1997 = light chain F19 version A with modified shape 1996 - 2004 = donor splice site

2011 - 2657 = copy of human kappa constant region gene cDNA (Km (3))

2664 - 2880 = spaC2 artificial termination sequence

2887-7845 = fragment of the pSV2neo DNA vector containing the ampicillin resistance gene (in opposite orientation), the ColE1 and SV40 replication origins, and the Neo resistance gene (in the same orientation as the HCMVi-KCT cassette).

7852 - 8068 = spaC2 artificial termination signal

This sequence ends immediately upstream of the EcoRI restriction site (positions 1 to 6) at the beginning of the sequence below. Like the vector, this DNA sequence is circular.

Figure 31 is a PCR-based method suitable for constructing a modified shape human F19 heavy chain. This figure shows the construction strategy diagram. The dotted lines indicate a complementary sequence of at least 21 bases between the primers.

Figure 32 shows the nucleotide and deduced amino acid sequences of the human heavy chain variable regions of F19 versions a through e. The nucleotide and deduced amino acid sequences were aligned and compared to the version A sequence. in Kabat EA, Wu TT, Perry Η. M. S. and Foeller C. (1991) with this sequence is described

Sequences of

Gottesman K.

Proteins of

Immunological Interest (5 th

Ed.

NIH Publication No. 91-3242.

1 ** 1 1 1 1 1 1 1 1 1 ··

US Department of Health and Human Services, Public Health Service, National Institutes of Health, Bethesda, MD). CDR locations are indicated in boxes.

Figure 33 shows the DNA sequence of F19Ha (human version A modified heavy chain) cloned into the mammalian expression vector pgld105. Restriction sites are bold and are underlined. The CDRs 1-3 and the splice donor site are underlined. It is the F19 version A heavy chain DNA sequence cloned into the eukaryotic expression vector pG1D105. This vector has a cDNA version of the human gamma-1 constant region gene (Glm allotype (nor a, z, -χ), known as the Gml allotype (17)).

The essential components of the vector are:

- 2501 = sequence based on vector pBR322 comprising ampicillin resistance gene and ColE1 origin plus SV40 origin and SV40 early promoter degraded

2502-3226 = dhfr gene

3233 - 4073 = SV40 pole A sequence etc.

4080 - 4302 = instead of SPA plus termination signal C2

4303 -5867 = HCMVi promoter / enhancer

5879 - 5885 = single restriction site for cloning of variable immunoglobulin genes

5886 - 5894 = Kozáková sequence 5895 - 5951 = signaling peptide 5952 - 6323 = donors instead of splicing 6331 - 6336 = single a BamHI restriction site suitable for

cloning of immunoglobulin variable genes

6337 - 7388 = copy of human gamma-1 constant region cDNA preceded by 62 bp intron 7389 - 7709 = Arnie's termination sequence

The human gamma-1 constant region used in this construction has Glm (nor a, z, -χ), which is also known as

·

0

0

The allotype Gml (17), which is defined as the glutamic acid residue (E) at position 356 (corresponds to Eu numbering), the methionine residue (M) at position 358 (according to Eu numbering) and the lysine residue (K) at position 214), Eu numbering). These three residues are underlined in the above sequence.

Figure 34 shows the splicing of heavy (panel A) and light (panel B) RNA during expression of F19 antibodies in mammalian cells - scheme:

A. RNA heavy chain splicing

B. RNA light chain splicing ··

0000

AND

Figure 35 depicts the concentration dependency of CD8-FAP binding supernatant L _A H _C.

Figure 36 showing the binding of biotinated L _A H _C to human FAP.

Figure 37 depicting CD8-FAP carrying an F19 epitope that was detected with cF19.

Examples:

Example 1: Construction of mouse-human chimeric genes

Chimeric antibodies Fl9 (cF19) were designed such that their murine F19V _L and V _H regions are linked to the kappa and gamma-1 constant regions. PCR primers were used to modify the 5'- and 3'-sequences that flank the cDNA sequences encoding regions of murine F19V _L and V _H (Table 1). These adapted murine F19 variable regions were then cloned into mammalian cell expression vectors that contain kappa (pKN100) or gamma-1 (pG1D105) constant regions (Figure 23). These vectors were used with the human cytomegalovirus (HMCV) promoter / enhancer to efficiently transcribe the light and heavy chains. The vectors also contain the SV40 origin of replication to «·:. · :: ::

DNA replication was efficiently followed by protein expression in COS cells. Expression vectors were designed to include variable regions incorporated as Hindi-BamHI DNA fragments. PCR primers were designed by introducing these restriction sites at the 5 '- (HindIII) and 3' - (BamHI) ends of the V region cDNA. In addition, PCR primers were designed by introducing the Kozak sequence (GCCGCCACC) at the 5 'end of the light and heavy chain cDNA to allow efficient translation (Kozak M.: At least six nucleotides prior to AUG initiator codon enhancement translation in mammalian (1987) J. Mol. Biol. 196: 947) and splice donor sites were introduced at the 3 'end of the light and heavy chain cDNAs to be spliced into constant regions. The PCR primers used in the construction of the F19 chimeric light and heavy chain are shown in Table 1. The DNA and amino acid sequences of the murine V _L and V _H regions of F19 adapted for use in the construction of the F19 mouse chimeric light and heavy chain are shown in Figure 24 and 25. The murine F19 light and heavy chain DNA sequences cloned into the eukaryotic expression vectors pKN100 and pG1D105 are shown in Figures 26 and 27.

Table 1: PCR primers suitable for construction of F19 chimeric antibodies.

A. Light chain variable region

1. Primer suitable for 5'-end (37-mer) construction 5'GAGA AAGCTT GCCGCCACC ATG GAT TCA CAG GCC CAG 3 '

HindlII Kozáková S. M D S Q A Q

2. Primer suitable for 3'-end (35-mer) construction 5'CCGA GGATCC ACTCACGTTT CAG CTC CAG CTT GGT 3 '

BamHI donor. instead of splicing

B. Heavy Chain Variable Region

4 4 β »· 44 4 4 44 4 4 | 4 4 4 ······ 4 4 · 9 4 4 4 • 4 · 4444

44 ♦ 444 444 44 44

1. Primer suitable for 5'-end (37-mer) construction

5'CAGA AAGCTT GCCGCCACC ATG GGA TGG

HindlII Kozáková M G W S W V

2. Primer suitable for 3'-end (35-mer) construction

5'CCGA GGATCC ACTCACC GGA GGA GGT GAC TGA 3 '

BamHi donor. instead of splicing

Example 2: Expression and Binding Activity of F19 Chimeric Antibodies

Two plasmid DNAs encoding the F19 chimeric light and heavy chains (described in Example 1) were co-transfected into COS cells to achieve transient expression of the F19 chimeric antibodies as described below. After incubation for 72 hours, culture medium was collected, centrifuged to remove cell debris, and the supernatant was assayed by ELISA to detect the production of human IgG1-like antibodies. COS cell supernatant containing F19 chimeric antibodies were screened for the ability to bind HT 1080 cells (described in Example 13) that express FAP antigen on their surface.

Transfection of COS cells using electroporation

Mammalian expression vectors pgld105 and pKN100 containing chimeric or shape-modified chimeric versions of human heavy or light chains were tested in COS cells to achieve transient expression of F19 antibodies. COS7 cells were routinely passaged into DMEM culture medium (Gibco BRL Cat # 41966) containing penicillin (50 IU / ml), streptomycin (50 μς / πιΐ), L-glutamine and 10% heat-inactivated fetal calf serum without gammaglobulin ( FCS, Harlan Sera-Lab Cat # D0001). DNA was introduced into COS cells by electroporation using a Gene Pulsar (BioRad). DNA (10 μς of each vector) was added to 9 9 «

0.8 ml aliquot with 1x10 ⁷ cells / ml in phosphate buffered saline (PBS, without calcium and magnesium ion). The pulse characteristic is 1,900 V, capacity 25 pF. After 10 minutes at ambient temperature, 8 ml of DMEM culture medium containing 5% FCS was added to the cells after electrophoresis. After incubation at 37 ° C for 72 hours, the culture medium was collected and centrifuged to remove cellular debris and the supernatant was stored under sterile conditions at 4 ° C for a short period of time or at -20 ° C for longer.

ELISA suitable for measuring IgG1 / kappa antibody concentration in COS cell supernatants

Antibody samples produced in transfected COS cells were analyzed by ELISA to determine the amount of chimeric human or reshaped human antibodies produced. For antibody detection, platelets were coated with goat anti-human IgG antibodies (Fc / fragment specific) (Jackson ImmunoResearch Laboratories Inc., # 109-005-098). COS cell samples were serially diluted and added to each well. After incubation for 1 hour at 37 ° C and washing, goat anti-human kappa light chain conjugated with horseradish peroxidase (Sigma, A-7164) was added. After incubation for 30 minutes at 37 ° C and washing, K-blue substrate (a mixture of 3, 3 ', 5, 5'-tetramethylbenzidine and hydrogen peroxide, Bionostics, Limited, # KB175) was added for 30 minutes at room temperature. The reaction was stopped using a Red Stop solution (Bionostics Limited, # RS20) and the optical density was read on a microplate reader at 650 nm. Purified IgG1 / kappa antibodies (Sigma, 1-3889) of known concentrations were used as standard.

9 9 99 9-8

9 9 9 9 9 9 9

9989 9 · «· * ·«>

7/1 ♦ · ···· »· · · 999 9999 99 99

Expression of F19 chimeric antibodies in COS cells was poor (Table 2). It ranged between 10 and 60 ng / ml, which is at least ten times less than most antibodies.

In order to increase the expression power of the F19 chimeric antibodies, the leader sequence of the F19 V _{L region} was altered by the substitution of leucine for proline at position -9. This single amino acid change in the leader sequence resulted in at least a doubling of the amount of chimeric antibodies produced in COS cells.

Cell binding results show that F19 chimeric antibodies bind specifically and with expected avidity to the FAP target.

Table 2: Concentration of F19 chimeric antibodies in CO supetnatant (results of three independent transfections)

Components of transfected antibodies human yl / K heavy chain kappa light chain (Hg / ml) cF19 cF19 (supervisor) sequence F19) 0, 060 cF19 cF19 (mutated leader sequence F19) 0.212 cF19 cF19 (supervisor) sequence F19) 0,056 cF19 cF19 (mutated leader sequence F19) 0,108 CF19 cF19 (supervisor) sequence F19) 0.011 cF19 cF19 (mutated leader sequence F19) 0,087

• φ

9 ·· ·

Example 3: Construction of versions A to C of the human light chain

F19 with modified shape (L _A - L _B )

Construction of the first modified form (L _A ) human F19 V _L region was performed using overlapping PCR fragments in a manner similar to that described by Daugherty BL, DeMartino JA, Law MF, Kawka DW, Singer II and Mark GE (1991). ) Polymerase chain reaction (PCR) facilitates cloning, CDR-grafting and rapid expression of murine monoclonal antobody directed against the CD18 component of leukocyte integrins. Nucl. Acids Res. 19: 2471). Ten oligonucleotides were synthesized, containing five pairs of primers APCR1-vla1, vla2-vla3, vla4-vla5, vla6-vla7 and vla8-APCR4 (Table 3 and Figure 28). These were overlapping sequences containing at least 21 bases between adjacent pairs (Figure 28). APCR1 and APCR4 hybridized to the flanking sequences of the pUC19 vector. The mutagenic primers were designed such that their 5 'end immediately follows the additional codon position. This strategy was used to paralel the addition of a single nucleotide to the 3 'end of the complementary strand with a mutagenic primer by DNA polymerase during PCR (Sharrocks AD and Shaw E.E. (1992). Improved primer design for PCR-based, site-directed mutagenesis) Nucl Acids Res. 20: 1147). Suitable primer pairs (0.2 μΜ of each primer) were combined with 10ng of cDNA of version B of human L25V _L region reshaped and 1 unit of AmpliTaq (Perkin Elmer Cetus) DNA polymerase in 50 μΐ PCR buffer containing 10 mM Tris-HCl (pH 8.3), 50 mM Kel, 200 μΜ dNTP and 1.5 mM MgCl ₂ . The mixture was poured over with mineral oil and PCR was performed at 25 cycles, each cycle comprising a denaturation step at 94 ° C for 1 minute, primer binding at 55 ° C for 1 minute, and an extension step at 72 ° C for 1 minute. 2 minutes. This is followed by a single cycle that includes an additional extension step at 72 ° C for 10 minutes. Then * 9 99 9 9 9 9 9 9 9 9

9 9 9 • 99 · ··· 9999

9 9 9

99 followed by cooling at 4 ° C. The transition time between primer binding and extension is 2.5 minutes. The PCR products of the five reactions (A, B, C, D and E) were then purified by gel electrophoresis. This was followed by elution using Wizard PCR (Promega). PCR products A, B, CD and E were arranged according to their complementarity. In the second set of PCR reactions, PCR products B and C and D and E (50 ng of each product) were added to the 50 μΐ PCR reactions. Each reaction mixture contained 1 unit of AmpliTaq DNA polymerase (PerkinElmer Cetus). The reactions were run for 20 cycles as described above except that the temperature hybridization temperature was raised to 60 ° C. In the third set of PCR reactions, PCR products F and G were amplified by PCR using 1 μΐ of each product and a suitable PCR primer pair (vla2-vla5 or vla6-APCR4). The PCR reactions contained 1 unit of AmpliTaq DNA polymerase in a 50 μΐ PCR reaction (as described above) and were amplified at 25 cycles as a first stage. In the fourth set of PCR reactions, PCR H product was amplified using 1 μΐ of the content of each PCR reaction and the pair of PCR primers vla2-APCR4. Finally, PCR products A and H were arranged based on their own complementarity in a two-step PCR reaction similar to that described above using RSP and UP as terminal primers. The fully assembled fragment representing the entire human F19V _L region comprising the leader sequence was digested with the restriction enzymes HindIII and BamHI and cloned into the pUC19 vector for sequencing. A clone having the correct DNA sequence was designated reshF19La (Figure 29) and subcloned into the eukaryotic vector pKN100. The DNA sequence of reshF19La that was cloned into pKN100 is shown in Figure 30.

A second version of the human F19V _L (L _B ) region was constructed using the same scheme as described for La, but where primers vla4 and vla7 were substituted for vlb4 and vlb7 (Table 2).

3). The DNA sequence L _B is shown in Figure 29.

00 • 0 0 0 • 0 0 0 0 0 0 0 0 0 0 0

00

A third modified shape human F19V _L (L _c ) region was constructed using the QuikChange ™ site-directed mutagenesis kit from Stratagen. The QuickChange site directed mutagenesis method was performed according to the manufacturer's instructions using the double stranded template DNA reshF19La in the vector pKN100. The mutagenic oligonucleotide primers F19Lc-sense and F19Lc-antisense (Table 3) that are suitable for use in this protocol were designed according to the manufacturer's instructions. Both mutagenic primers contained the desired point mutation (the TTT codon at position 49 of the Kabat residue (Phe) was changed to TAT, which encodes Tyr), and ligated not to the same sequence on the opposite L _A strand in the vector pKN100. Point mutation was verified by DNA sequencing of the entire V _{L region} . The DNA sequence of _Lc is displayed in FIG. 29. To eliminate the possibility that random mutations appear in pKNlOO during the PCR reaction, the _VL region was cleaved from the vector pKNlOO as a HindIII / BamHI fragment and re-subcloned into an unmodified vector pKNlOO , which was digested with the same restriction enzymes.

Table 3: PCR primers suitable for construction of F19 humanized light chain variable regions with modified shape.

1. Primers suitable for the synthesis of version "A

Fl9 (36-mer)

5'GTCATCACAATGTCTCCGGAGGAACCTGGAACCCAG 3 '

F19vla1 (29-mer)

5'CTCCGGAGACATTGTGATGACCCAATCTC 3 '

F19vla3 (45-meter):

5'GAATATAAAAGGCTCTGACTGGACTTGCAGTTGATGGTGGCCCTC 3 'f19vla4 (72-mer):

• ·

5 'CAGTCAGAGCCTTTTATATTCTAGAAATCAAAAGAACTACTTGGCCTGGTATCAGCAGAA

ACCAGGACAGCC 3 '

F19vla5 (44-meter)

F19vla6 (67-meter)

F19vla8 (53-mer)

F19vla7 (33-mer)

2. Primers suitable for the synthesis of version "B

F19vlb3 (72-mer)

F19vlb6 (57-mer)

3. Primers suitable for the synthesis of version ,, C

Fl9Lc-Sense (34-mer):

F19Lc-antisense (34-mer)

4. Primers hybridizing to the flanking sequences of the PUC19 vector

APCR1 (17-mer, sense primer 5'TACGCAAACCGCCTCTC 3 '

APCR4 (18-mer, anti-sense primer) 5'GAGTGCACCATATGCGGT 3 '

RSP (-24) (16-mer, sense primer) 5 'AACAGCTATGACCATG 3' (JP (-40) (17-mer, antisense primer): 5'GTTTTCCCAGTCACGAC 3 '

Example 4: Construction of human modified F19 heavy chain with modified form A to E (H _A -H _E )

The modified form A human F19V _H (H _A ) regions were constructed using the same PCR methods as described for the design of the modified form A human F19V _L (L _A ) modified regions (Figure 31). The template DNA is a modified version of the "A 226V _H human region" (Léger, J.J.

P., Yednock, TA, Tenner, L., Horner, HC, Hines, DK, Keen, S., Saldanha, J., Jones, Fritz, LC and Bending Μ. M. (1997). Humanization of murine anti-human integrin alpha-4 antibodies: a potential drug for the treatment of multiple sclerosis (Hum. Antibod. 8: 3). 6 PCR primers were designed and synthesized for construction of the humanized F19V _{H version} with modified shape (Table 4). PCR products A, B, C and D were obtained using PCR primers APCR1-Vhal, Vha2-Vha3, Vha4-Vha5 and Vha6-APCR4. PCR conditions were essentially the same as described in the construction of human field F19V _l reshaped. The clone having the correct DNA sequence was designated reshF19Ha (Figure 32) and then subcloned into the eukaryotic expression vector pG1D105. The reshF19Ha DNA sequence was cloned into pG1D105 as shown in Figure 33.

The third modified shape human shape F19V _L (H _c ) was constructed using the same scheme as described for H _A , but where primer Vha4 was replaced with Vhc4 (Table 3).

4). The DNA sequence of _Hc is shown in Fig. 32. The second (H _{B) of} Fe and Fe • fefefe ·· Fefe Fefe fefefefe • fefefefe Fe Fe Fe Fe Fefe Fefe · • Fe fourth (H _d) version of the human region F19V _H-adjusted shape was constructed based on the PCR mutagenesis method described by Kamman M., Laufs J., Schell J., and Gronenborn B. (1989) Rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR). Nucl. Acids Res. 17: 5404). In the case of H _B and H _d , the mutagenic primer F19Vhbd6 (Tyr91 to Phe. 91, Table 4) was used in pairing with APCR4 in the PCR reactions, where H _A and H _{c were} used as template DNA. The PCR products VHb and Vhd were digested with the restriction enzymes PstI and BamHI and subcloned into reshF19Ha and reshF19Hc, which were digested with the same two restriction enzymes. The DNA sequences H _B and H _D are shown in Figure 32.

The modified form of the humanized F19V _H (H _E ) region was constructed based on the PCR mutagenesis method described by Kamman M., Laufs J., Schell J., and Gronenborn B. (1989) Rapid insertional mutagenesis of DNA by polymerase chain reaction (PCR). Nucl. Acids Res. 17: 5404.

For reshF19He mutagenic primer was used F19MsclHe. (Table 5), paired with primer F19V _H HindIII. (Table 5) in PCR reactions was used as template DNA _Hc cloned into the mammalian expression vector pgldl05. Appropriate primer pairs (0.2 μΜ of each primer) were combined with 10 ng of the 226 V _H human-modified region A cDNA in 100 μΐ PCR buffer containing 10 nM, 10 mM (NH ₄ ) ₂ SO ₄ , 20 mM Tris-HCl (pH 8.8), 2 mM MgSO ₄ , 0.1% Triton X-100, and 200 µΜ dNTP. the reaction mixtures were poured over mineral oil and held at 94 ° C for 5 minutes. One unit of Deep Vent DNA polymerase (New England Biolabs) was then added (hot start PCR, Chou Q., Russell M., Birch).

D., Raymond J. and Bloch W. (1992) Prevention from pre-PCR mispring and primer dimerization improves low-copy-number amplifications. Nucl. Acids Res. 20: 1717) and PCR was performed in 25 cycles on a TRIO-Thermoblock Thermal Cycler 1111 1.

11 11

11 (Biometra, Gottingen, Germany). Each cycle includes a step of denaturation at 94 ° C for 1 minute, primer hybridization at 70 ° C for 1 minute, and extension at 72 ° C for 2 minutes. This is followed by a single cycle involving extension at 72 ° C for 10 minutes, followed by cooling to 4 ° C. PCR products were then extracted and purified from 1.4% standard agar gel in TAE buffer using the QIAquick ™ Gel Extraction Kit according to the manufacturer's recommendations (Qiagen Ltd. UK). The PCR product V _H was then digested with the restriction enzymes MscI and HindIII and ligated into reshF19Hc cloned into pgld105, which had previously been digested with the same two restriction enzymes. The restriction site that recognizes the restriction enzyme Mscl is unique in all shape-modified human F19V _H regions and does not occur in the expression vector pgld105. The HindIII recognition site is the only site in pgld105 for the cloning of immunoglobulin V _H genes. E. coli XL-1 Blue cells suitable for electroporesis were transformed with 1 μΐ of ligated DNA and plated onto ampicillin agar plates. The colonies were then tested for the presence and correct size of the inserts by direct PCR on the colonies (Gussow D. and Clackson T. (1989) Direct screening characterization from plaques and colonies by the polymerase chain reaction. Nucl. Acids Res. 17: 4000). HCMi and primers

Hucyl hybridization with the flanking sequences of vector pgld105 (Table 5). Using the Plasmid Midi kit, DNA was prepared from positive colonies according to the manufacturer's recommended protocol (Qiagen Ltd., UK). DNA sequencing was accomplished by the dideoxy chain termination method (Sanger F., Nicklen S. and Coulson A. (1977) DNA sequencing with chainterminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463) directly from ring vectors. DNA using conventional heat denaturation (Andersen A., Pettersson A. and Kieldsen T. (1992) A fast and simple technique for sequencing plasmid DNA with

4 • 4 • 444

4 4 • 4

4

4

444 4444

44

4 4

4 4

4 4

4 4 ·

44 sequenase using heat denaturatin. Biotechniques 13: 678) and sequencing 2.0 (USB, Cleveland, OH). The DNA sequence of reshF19He is shown in Figure 32.

Table 4: PCR primers suitable for construction of versions A through D of the modified F19 human heavy chain variable region

1. Primers suitable for synthesis of version „A F19vhal (47-mer):

Fl9vha2 (53-mer):

Fl9vha3 (71-mer):

F19vha4 (71-meter):

F19vha5

63-mer):

F19vha6 (48-meter):

2. Primers suitable for synthesis of version „C F19vhc4 (71-mer):

9 9 9 9 9 9 10 11 12 13 14 15 16 17

9 9

9 9

9 ·

9 9

99

3 / Primers suitable for the synthesis of versions "B and" D

F19vhbd6 (27-mer):

4. Primers hybridizing to the flanking sequences of the PUC19 APCR1 vector (17-mer, sense primer): 5'TACGCAAACCGCCTCTC 3 '

APCR (18-mer, anti-sense primer): 5 ^of GAGTGCACCATATGCGGT 3 '

Table 5: PCR primer suitable for the construction of the modified version E version of the F19 heavy chain variable region

1. Primers suitable for the synthesis of version "E

F19MscIHe (65-mer, anti-sense):

2. Primers hubriding with the flanking sequences of the mammalian expression vector pgld105

HCMi (28-mer, sense): 5'GTCACCGTCCTTGACACGCGTCTCGGGA 3 '

Huts (17-mer, anti-sense): 5'TTGGAGGAGGGTGCCAG 3 '

Example 5: Concentration of reshaped human F19 antibodies in COS cell supernatants

COS cells were transformed with a single pair of engineered shape F19 human antibody constructs and human antibody concentration was measured using an IgG1 / Kappa ELISA as described in Example 2.

Table 6: Concentrated shape F19 human antibodies in COS cell supernatants

Transfected antibody components human γί / K

heavy chain kappa light chain concentration (pg / ml) La 2.50 Ha L _b 0.18 h _b La 1,25 H _b Lb 0.10 h _d La 1, 15 h _d l _b 0.18 H _a La 1.50 Ha Lc 1.56 H _c La 1.47 H _c Lc 1, 97 cF19 La 1, 54 cF19 Lb 0.07 cF19 Lc 2.14

Table 7: Concentrated shape modified human F19 antibodies in COS cell supernatants

Transfected antibody components human yl / K heavy chain kappa light chain concentration ^ g / ml) Ha La 2.00 Ha L _c 2.50 H _c La 2.90 H _c Lc 3.00 h _e La 2.80 h _e Lc 3.50

RNA splicing required for expression of immunoglobulin genes in mammalian cells

Mammalian expression vectors pKN100 and pgld105 contain an intron between the variable and constant regions that are removed during the gene expression process to form a mediator RNA. A splice comprising recombination of DNA between the heavy and light chain splice donor sites and the immunoglobulin splice acceptor site is described in Figure 34.

Example 6: Flow cytometric analysis of cF19 binding and human cells that express L _A H _C to FAP

The ability of L _A H _C to bind recombinantly and endogenously expressed FAP on the cell surface was tested.

The example describes the determination of L _A H _C binding to cellular FAP. Human tumor cells naturally expressing FAP MF-SP (Shirasuma, K. et al., Cancer 1985, 55: 2521-32) and FAP-transfected human tumor cell lines were used as cellular targets. L _A H _C was studied by a cytofluorometric assay and evaluated for direct binding to target cells as well as an inhibitory effect on binding of murine F19 antibodies or chimeric cF19 anti-FAP antibodies.

The antibodies and cell lines used were F19 (murine monoclonal anti-human FAP antibodies, IgG1 subclass), mlG (murine immunoglobulin, IgG class), cF19 (chimeric monoclonal anti-human F19 antibodies, IgG1 subclass), L _A H _C (monoclonal anti-human human shape FAP antibodies, IgG1 subclass, hIgG1 (human immunoglobulin, IgG1 subclass), MF-SH (human malignant fiber histiocytoma cell line), HT-1080 (human fibrosarcoma cell line), HT-1080FAP clone 35 (cellular HT-1080 line transfected with cDNA encoding human FAP). Antibodies were labeled with biotin as described in Examples 8 and 12.

Direct binding of L _A H _C to FAP on the surface of human tumor cell lines

5x10 ⁵ cells of the tumor cell line of interest were incubated with a determined concentration of test and control antibodies in a total volume of 0.2 ml phosphate buffered saline (PBS) supplemented with 1% bovine serum albumin. BSA for 30 minutes on ice. • • • • • • • • • • • • • • • • • • • • • • • • • Subsequently, cells were washed twice with 2 ml PBS, resuspended in 0.2 ml PBS supplemented with 1% BSA, then mouse anti-human IgG labeled FITC (Dianova) at 1:20 dilution was added as a secondary reagent and incubated on ice. for 30 minutes.

Alternatively, 5x10 ⁵ cells of the tumor cell line of interest were incubated with the indicated concentration of biotin-labeled cF19 in a total volume of 0.2 ml PBS supplemented with 1% BSA on ice for 30 minutes. The cells were then washed twice with 2 ml PBS, resuspended in 0.2 ml PBS supplemented with 1% BSA and incubated on ice for a further 30 minutes using FITC-labeled streptavidin (Dianova) at a 1:40 dilution as a secondary reagent.

The cells were again washed twice with 2 ml PBS, resuspended in a total volume of 0.5 ml PBS supplemented with 1% paraformaldehyde (PFA) and kept on ice. Single cell fluorescence was determined cytofluorometrically by analyzing cell green fluorescence at 488 nm in a device suitable for measuring fluorescence activated in EPICS XL cells (Coulter).

L _A H _C competition to bind biotin-labeled cF19 to cell surface FAP in a human FAP expressing cell line

5x10 ⁵ cells of the tumor cell line of interest were incubated with labeled amounts of unlabeled test and control antibodies, which were added together with biotin-labeled cF19 antibodies at a concentration of 1 µg / ml. Subsequently, cells were washed twice with 2 ml PBS, resuspended in 0.2 ml PBS supplemented with 1% BSA and FITC-labeled streptavidin (Dianova) was used as a secondary reagent at a 1:40 dilution. The mixture was incubated on ice for 30 minutes.

The cells were then washed twice with 2 ml PBS, resuspended in 0.5 ml PBS and supplemented with 1% PFA and kept on ice. Single cell fluorescence was determined by cytofluorometry by analyzing cell green fluorescence at 488 nm on a cell activated fluorescence assay device

EPICS XL (Coulter).

CF19 and L _A H _C antibodies bind in a concentration-dependent manner specific to human tumor cells HT1080FAP clone 33 transfected with FAP (Table 8). No binding to HT-1080 cells that did not show FAP was detected (Table 9). cF19 and L _A H _C bound in a concentration-dependent manner to MF-SH cells that endogenously express FAP (Table 10).

Biotin-labeled cF19 antibodies bound to human HT-1080FAP clone 33 cells (Table 11) in a concentration-dependent manner. No binding was detected in HT-1080 cells that did not express FAP (Table 12).

Binding of biotin-labeled cF19 antibodies to HT-1080FAP clone 33 is inhibited by both unlabeled cF19 and unlabeled L _A H _C (Table 13).

Chimeric anti-human FAP monoclonal antibodies cF19 as well as shape modified human anti-human FAP monoclonal antibodies L _A H _C (Example 10) are distinguished by binding directly to FAP expressed on a human cell line either endogenously or transfected with cDNA, which encodes said protein. This binding is concentration-dependent. Biotin-labeled cF19 binding can be inhibited by unlabeled cF19 and L _A H _C antibodies.

Using cytofluorometric direct binding technology as well as inhibition of the specific binding agent, it exhibits the specificity of chimeric cF19 and L _A H _C human monoclonal shape-modified FAPs expressed on the cell surface.

Table 8: Binding of anti-FAP antibodies to HT-1080FAP clone 33 cells

concentration average fluorescence intensity antibodies (ng / ml) hlgGl cF19 l _and h _c 500 0.12 6, 65 2.76 100 ALIGN! 0.12 1.63 0.66 20 May 0, 12 0.43 0.22 4.0 0, 12 0, 17 0.15 WHAT O 0.12 0.14 0.13

Table 9: Binding of anti-FAP antibodies to untransfected HT-1080 cells

concentration average fluorescence intensity antibodies (ng / ml) hlgGl cF19 l _and h _c 500 0, 11 0.11 0.12 100 ALIGN! 0, 11 0.11 0.11 20 May 0, 11 0, 11 0.12 4.0 0.11 0.11 0.12 0.8 0, 11 0.11 0.11

Table 10: Binding of anti-FAP antibodies to MF-SH cells

concentration average fluorescence intensity antibodies (ng / ml) hlgGl cF19 l _and h _c 4 000 0, 6 3.6 2.8 2 000 n.d. 3.3 2.5 1 000 n.d. 2.4 1, 9 500 n.d. 1,8 1.3

n.d. means not done

Table 11: Binding of biotin-labeled cF19 antibodies to HT-1080FAP clone 33 cells

concentration antibodies average fluorescence intensity (ng / ml) biotin labeled hlgG1 biotin cF19 labeled 5 000 0.2 36, 5 1 000 0.2 18.1 200 0.2 4,5 40.0 0.2 1.3 8.0 0.2 0.5 1.6 0.3 0.3

Table 12: Binding of biotin-labeled cF19 antibodies to non-transfected HT-1080 cells

concentration antibodies average fluorescence intensity (ng / ml) biotin labeled hlgG1 biotin cF19 labeled 5 000 0.1 0.1 1 000 0.1 0.1 200 0.1 0.1 40.0 0.1 0.1 8.0 0.1 0.1 1.6 i — 1 O 0.1

Table 13: Competition of anti-FAP antibodies with binding of biotin-labeled cF19 antibodies to HT1080FAP clone 33 cells

Concentration competitors antibodies average concentration fluorescence competing antibodies (gg / ml) none 0.00 11.2

hlgGl 1.00 9, 0 hlgGl 3.16 11.3 hlgGl 10.00 00 στ hlgGl 31, 66 10.3 cFl9 1.00 7.5 cF19 3, 16 00 -M ¹ CF19 10.00 1.3 cF19 31, 66 1,2 L _and Hq 1.00 8.00 l _and h _c 3, 16 5.5 l _and h _c 10.00 2.9 LaH _c 31, 66 1.7

Biotin-labeled cF19 was used in all assays at a concentration of 1 µg / ml.

Example 7: In vitro immune effector functions of monoclonal antibodies L _A H _C

This experiment was performed to determine the potential of L _A H _C monoclonal antibody (mAB) with specificity for fibroblast activating antigen (FAP) to lyse targets expressing FAP in the presence of human complement or human single-core leukocytes.

In particular, the ability of L _A H _C antibodies to mediate cytotoxic effects against HT-1080FAP clone 33 cells that express human FAP on their surface was studied. Cytotoxicity was determined in vitro using the following approach: ⁵¹ Cr-labeled target cells were incubated in the presence of L _A H _C with human serum as a source of complement or human MNC (single-core peripheral blood cells) serving as an effector. ⁵¹ Cr release was determined as a measure of lysis of the target cell.

• 9 9 9

• 9 ·

9 9

The antibodies and cell lines used were L _A H _C (reshaped human anti-human FAP IgG1 antibodies), h1G1 (human IgG1 isotype control antibody), 3S193 (mouse monoclonal anti-Lewis ^γ IgG3 antibody), mlgG (mouse IgG control antibody) ), HT-1080 (human fibrosarcoma), HT-1080FAP clone 33, (HT1080 transfected cDNA encoding human FAP), MCF7 (human mammary gland adenocarcinoma cell line).

Target cell lysis with L _A H _C mediated by RPMI 1640 complement with 100 μϋί ⁵¹ Cr (NEN) at 37 ° C for 1 hour. Subsequently, cells were washed twice with ⁵¹ Cr-free medium and resuspended at a concentration of 2x10 ⁵ cells per ml.

Human serum as a source of complement was freshly prepared from blood from various donors. Blood was drawn from a vein in the arm and left at room temperature for one hour to precipitate and hold overnight at 4 ° C. The serum was separated by centrifugation and separated from the sediment.

Study antibodies were diluted from the stock solution and a suitable cell concentration was prepared in RPMI1640 culture medium.

Tumor cells labeled with ^{1 x 10 5} labeled cell line were incubated for 2 hours at 37 ° C in an incubator (95% air and 5% CO ₂ ) in the presence of different concentrations of test and control antibodies and 25% (volume). ) of human serum as a source of human complement. Incubations were performed on 96-well U-plates in a total volume of 200 μΐ of RPMI 1640 culture medium and assayed in triplicate. After the incubation period, the plates were centrifuged and 100 μί of supernatant was collected and the radioactivity intensity was determined on a gamma counter. The total amount of radioactivity incorporated was determined by measuring the target cells at 10 ⁴ . Spontaneous release was defined as the activity released from the target cells in the absence of antibodies and complement during the described incubation period.

The specific ski was calculated as follows:

(sample activity) - (spontaneous release activity) specific lysis (%) = ---------------------------------- -------------------------------- x 100 (maximum activity) - (spontaneous release activity)

Antibody-dependent cellular cytotoxicity (ADCC) L _A H _C

Radiolabeled antibodies were incubated in RPMI 1640 culture medium with 100 μϋί ⁵¹ Cr at 37 ° C for one hour. The cells were then washed twice with ⁵¹ Cr-free culture medium and resuspended at 2x10 ⁵ cells / ml.

MNCs (peripheral blood mononuclear cells) were prepared from peripheral blood taken from the arm of human volunteers. Blood clotting was prevented by the addition of 20% citrate buffer. MNC from 4 ml of this prepared blood was purified by centrifugation (30 minutes at 400xg and room temperature) to 3 ml of lymphocyte-friendly medium (Boehringer Mannheim, Germany). MNCs (peripheral blood mononuclear cells) were separated by gradient, washed three times, and diluted with RPMI 1640 culture medium to the appropriate concentration. K activated lymphocyte (LAK) cells were obtained from MNC (peripheral blood mononuclear cells) by incubating for 5 days at 37 ° C in an incubator under 95% air and 5% CO ₂ at an initial cell count of 1, 3x10 ⁶ cells in one ml in the presence of 100 U recombinant human interleukin-2 (IL-2). Study antibodies were diluted from the stock solution to the appropriate concentration with RPMI 1640 culture medium.

Radiolabeled tumor cells at 1x10 ^{4 of the} determined cell line were incubated for 5 hours at 5 ° C in an atmosphere of 5% CO ₂ in the presence of different concentrations of test and control antibodies and MNC. MNC was added

in an amount to achieve a specified effector: target cell ratio. Incubation was performed on U-well plates in a total volume of 200 μΐ of RPMI1640 culture medium and the experiment was performed in duplicate.

After the incubation period, the plates were centrifuged and 100 μΐ of the supernatant was collected and the radioactivity strength was determined in a gamma counter. The total amount of radioactivity incorporated was determined by measuring 10 ⁴ target cells. Spontaneous release was defined as activity released from target cells in the absence of antibodies and effector cells during the described incubation period.

The specific ski was calculated as follows:

(sample activity) - (spontaneous release activity) specific lysis (%) = ---------------------------------- --------------------------------- x 100 (maximum activity) - (spontaneous release activity)

Antibody-mediated lysis of tumor cell complement

In HT-1080FAP clone 33 cells treated with L _A H _C at concentrations up to 50 μρ / ιηΐ. (Table 14, Table no. 15a) is observed no specific lysis of L _A H _C complement mediated.

The human serum lytic activity, which is used as a source of complement, resulted in lysis of human mammary carcinoma cells MCF-7 in the presence of 12.5 µg / ml 3S193, a murine monoclonal anti-Lewis ^Y antibody with known complement activation ability (Table 1). 15b).

Antibody-mediated cell lysis of tumor cells

No ADCC (antibody-dependent cellular toxicity) mediated by human MNCs (Table 16) or human LAK cells (lymphokine-activated cell K, Table 17) was detected in the presence of L _A H _C at concentrations up to 10 μρ / ιηΐ L _A H _C on HT-1080FAP clone 33 cells, which agrees • · · · ·

with results achieved with isotype control at an effector: target cell ratio of 50: 1.

In suitable in vitro assays with human complement or human MNC to be used as an effector, human anti-FAP monoclonal antibodies L _A H _C show no detectable cytotoxic effects of the above isotype controls on the HT-1080FAP clone 33 expressing tumor cell line expressing FAP.

Table 14: Specific lysis of complement to tumor cell targets HT-1080FAP clone 33 mediated by L _A H _C expressed in (%)

Source of human serum HT-1080 clone 33 concentration antibodies isotype control hlgGl l _and h _c 50 μρ / ιηΐ 5 4 10 μς / πιΐ 5 3 B 50 μ / ιηΐ 7 5 B 10 μ / ιηΐ 6 5 0 μς / πιΐ 0 0

Incubation was carried out for 2 hours at 37 ° C in the presence of 25% serum obtained from human volunteers A or B, which serve as a source of complement

Table no.

Specific ski complement tumor cell targets HT-1080FAP clone 33 mediated human anti-FAP monoclonal antibodies L _A H _C Expressed in (%)

Source of human serum HT-1080 clone 33 concentration hlgGl l _and h _c

• 4 • 4 ·

4 ·

4 4 • 4 · 4

antibodies 10 μ5 / πι1 2 1 A 2,50 μ9 / πι1 2 2 A 0.60 μg / ml 1 1 A 0,00 μ / s 2 2 B 10 μg / ml 2 2 B 2,50 μg / ml 2 2 B 0.60 μg / ml 2 2 B 0.15µg / ml 2 2 B 0.00 μg / ml 2 2 OJ C 10 / 2 2 C 2.50 μg / ml 1 1 C 0.60 μg / ml 1 1 C 0.15µg / ml 2 1 C 0.00 μg / ml 3 3

Incubation was carried out for 2 hours at 37 ° C in the presence of 25% serum obtained from human volunteers A, B or C, which serve as a source of complement.

Table 15b: MCF-7 tumor cell target specific lysis mediated by mouse-Lewis ^Y monoclonal antibodies 3S193 expressed in%

Source of human serum MCF-7 concentration antibodies mlgG 3S193 A 10 μg / ml 0 21 A 2,50 μς / πιΐ 1 21 A 0.60 μ / ιηΐ 0 21 A 0.15 μg / ml 1 18 A 0.00 μg / ml 0 0

4 · 44

4 4 4

4 4 4

4 4 4

44

4

4444 9

998 9 • 4 · 4 9 4 4

B 10 μ / ιπΐ 1 13 B 2,50 μ / ιηΐ 0 17 B 0,60 μ9 / πι1 1 18 B 0.15μ9 / ιη1 1 15 Dec B 0,00 μ / ml 0 0 C 10 μ / ml 1 22nd C 2,50 μ9 / η1 0 23 C 0.60 μς / ml 1 26 C 0.15µρ / πι1 1 20 May C 0,00 μρ / ιηΐ 1 1

Incubation was carried out for 2 hours at 37 ° C in the presence of 25% serum obtained from human volunteers A, B or C, which serve as a source of complement.

Table 16: ADCC (antibody-dependent cellular toxicity) (specific lysis expressed as%) of HT-1080FAP target cells clone 33 by human MNC (peripheral blood mononuclear cells) mediated by L _A H _C.

HT-1080FAP clone 33

concentration antibodies HT-1080 clone 33 (μς / ιηΐ) hlgGl L _and Hc 10 μς / πιΐ 2 1 2.50 μρ / ml 2 2 0.625 μς / ιηΐ 2 2 0.156 3 3 0.00 μ9 / η1 3 3 Incubation is performed) .a for 5 hours at 37 ° C

in the presence of 10 ⁴ target cells and an effector: target cell ratio of 50: 1.

♦ 9

9 9 · · ·

9 9

9 · 9 9 9 9 9 99 99

Example 8: Immunohistochemical analysis of the binding of monoclonal antibodies L _A H _C to normal and neoplastic human tissue

This experiment was performed to determine the binding characteristics of humanized monoclonal antibodies L _A H _C to normal and neoplastic human tissue.

The following antibodies were used: L _A H _C , cF19 and negative hgG1 control were directly labeled with biotin according to the methods described and used at a concentration of 2.5 to 0.25 mg / ml in 2% BSA / PBS (bovine serum albumin in saline) phosphate buffered). Mouse F19 monoclonal antibodies were used as a supernatant of tissue cultures of F19 hybridoma at a 1: 5 to 1:10 dilution in 2% BSA / PBS.

The following reagents were used in the following immunochemical assays: streptavidin-peroxidase complex (Vector Labs, Burlingame, CA, USA), avidin-biotin-peroxidase complex (Vector Labs.), Biotin-labeled equine anti-mice (VectorLabs.), DAB (diaminobenzidine) (Sigma Chemical Co., St. Louis, MO, USA), Harris Hematoxylin.

Fresh frozen test tissue samples include: normal intestine, mammary gland, lungs, stomach, pancreas, skin, larynx, bladder, smooth and skeletal muscles. Among the tumors tested are carcinomas of the mammary gland, intestine, lung, esophagus, uterus, ovary, pancreas, stomach and head and neck.

The indirect aminoperoxidase method was performed according to published methods (Garin-Chesa P, Old L.J., Rettig WJ: Cell surface glycoprotein of reactive stromal fibroblasts and a potential antibody target in human epithelial cancers.

Nati. Acad. Sci USA (1990) 87: 7235-7239) on fresh 99

999 999 ·

9 99 • 9 9 • 9 9 9

9 9 9

9 9 9

99 frozen sections with a thickness of 5 microns. DAB was used as a substrate for the final reaction products. The section was colored

Harris hematoxylin and antigen expression was tested.

Expression of L _A H _C in normal human tissues

Normal tissues tested were negative for L _and H _c expression, except for normal pancreas tissue, where positive endocrine cells (A cells) were determined in the islets of Langerhans using the antibodies L _A H _C , cF19 and F19 (Table 18). No immunoreactivity was observed for hIgG1 (human immunoglobulin IgG1 subclass), which serves as a negative control.

Expression of L _A H _C in tumors

In tumor samples, antibodies L _A H _C , cF19, and F19 exhibit an indistinguishable pattern of expression in tumor fibroblasts of supporting connective tissue. Strong homogeneous expression was found in most of the cases tested, particularly in malignant specimens derived from the mammary gut, intestine, lung, pancreas and squamous cell carcinoma (SQCC) of the head and neck (Table 10). No immunological reactivity was observed when hIgG1 was used as a negative control.

Antibodies L _A H _C , cF19 and F19 exhibit immunological reactivity with fibroblasts of the tumor supporting tissue. No L _{and C} H F19 or immunological reactivity can be seen when using fibrocytes mesenchyme of normal organs or organ parenchymal cells of normal adult. Immunological reactivity against FAP was observed only in a set of endocrine cells in the islets of the pancreas, particularly in glucagon-producing A cells, and in four of the nine uterine samples tested, which represent a set of fibroblasts of supporting connective tissue in these tissues.

·

0

0

0 0 0 human tissue a

FAP show cF19 and mouse •

0

0 0 0 · 0

0

Immunohystochemical analysis of L _A H _C in human cancers that indistinguishable patterns of monoclonal antibody F19 binding.

in normal express i on L _and H _c ,

Table no.

18: Immunological reactivity of antibodies L _A H _C , cF19 and human monoclonal F19 tissue with normal

tissue type C. BIBH1 cF19 F19 mammary gland -cell epithelial cells / gland duct 4 - - -myoepithelial cells - - - - connective tissue - - - -the blood vessels - - - colon -Lieberkuhn. crypts 6 - - - - connective tissue - - - -lymphoid tissue - - - -smooth muscles - - - -the blood vessels - - - -myenteric plexus - - - lung bronchi - bronchial epithelium 4 -hyaline cartilage - - - - - connective tissue - - - - -mucous glands - - - - alveolus -pneumocytes (type I / II) - - - -alveolar phagocytes - - - - -alveolar capillaries - - - - j esophagus - surface epithelium 1 - - connective tissue - - - -

• · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

Small intestine -epith of fibers and crypts - connective tissue -smooth muscles -the blood vessels -lymphoid tissue 1 - - - bladder -urotelium 2 - connective tissue - - - -smooth muscles - - - -the blood vessels - - - pancreas -epithelial vessels 3 - -acinary epithelium - - - -Langerhan Islands: - - - -B-cells - - - -A-cells + (*) + (*) + (*) -D-cells - - - - connective tissue - - -the blood vessels - - - -nerves - - - larynx -paving epithelium 1 -mucous glands - - - - connective tissue - - - -hyaline cartilage - - - -the blood vessels - - - - Skeletal muscles - - - lymph node - lymphoid cells 1 - -lymphatic tissue - - - - connective tissue - - - -the blood vessels - - - spleen 1

• • 99 • 9 9 9 9

9

9

9

999 99 99

-red and white pulp - - - -sinuses - - - - connective tissue - - - j átra 1 -hepatocytes - - - -bile duct - - - -portal trias - - - thyroid glands -follicular epithelium 2 - -parafollicular cells - - - - connective tissue - - - prostatic glands 1 -glandural epithelium - - - -supportive connective tissue - - - testicle 1 - seed-forming tubulus - - - -supportive connective tissue - - - ovaries 3 -follicles - - - -supportive connective tissue - - - cervix -epitel 1 - - -supportive connective tissue - - - Womb 9 -endometrium: glands - - - supporting connective tissue + # + # + # blood vessels - - - -myometrium cerebral cortex 1 -neurons - - - -neuroglial cells - - - -the blood vessels - - - small brain 1

• 0 • 0 0 · 0

0

-molecular layer - - - -granular cell layer - - - -Purkin's cell - - - -the blood vessels - - - skin 3 -paving epithelium - - - -melanocytes - - - - skin organs - - - - connective tissue - - - -the blood vessels - - -

Acetone-fixed frozen sections were tested by the avidin-biotin complex immunoperoxidase procedure.

No. is the number of tissue samples obtained from different test subjects * labeling of A ria cells based on islet morphology and position # positive immunological reactivity in supporting connective tissue in four to nine test samples. Positive samples represent the early (x2) and middle (x2) phases of the proliferative endometrium.

Example 9: Types of L _A H _C binding specificity in tissue sections

This experiment was performed to determine reactivity

L _A H _C with tissues from mice, rats, rabbits and monkeys using immunohistochemical methods.

The monclonal antibodies cF19 and human IgG1 (hIgG1) serve as negative controls in these assays. The agents used for immunological histochemistry were strepatavidin peroxidase complex (Vector Labs., Burlingame, CA), DAB (Sigma Chemical Co., St. hematoxylin).

Louis, MO)

Harrison's

The following fresh frozen tissue samples from mice, rats, rabbits and cynomoigus monkeys were tested: brain, liver, lungs, kidneys, stomach, pancreas, intestine, thymus, skin, muscles. • fefe fe • fefefe • fefe fefe fefe fefe fefe fefe heart, spleen, ovaries, uterus and testes. As a positive control, samples from normal human pancreas and mammary cancer were included in each test.

Immunohistological chemical methods

The indirect immunoperoxidase method was performed as described in the prior art (GarinChesa P., Old LJ, Rettig WJ: Cell surface glycoprotein of reactive stromal fibroblasts as a potentional antibody target in human epithelial cancers. Proc. Natl. Acad. Sci USA (1990) 87: 7235-7239), on fresh frozen sections of five microns thick. Antibodies L _A H _C , cF19 and hIgGl (at a concentration of 1 μρ / ιηΐ) were labeled with biotin as described in the prior art and were detected with streptavidin peroxidase complex. DAB was used as a substrate for the final reaction product. Sections were stained with Harris hematoxylin and tested for antigen expression.

Normal tissues tested did not react with either L _and H _c or cF19 in experiments (Table 19).

The normal human pancreas was used as a positive control, which shows that antibodies L _A H _C and cF19 binding to a set of endocrine cells in the islets of Langerhans, as reported in the publications in the case of F19. Moreover, binding of antibody H _and L _C and cF19 can be seen in fibroblasts of the stroma in a sample of cancerous mammary gland.

Immunohistochemical analysis of normal tissues from mouse, rat, rabbit and cynomolgus monkey did not detect binding of L _A H _C or F19 antibodies in the experiments performed.

64 9 9 99 99 9 · 9 9 9 9,999 99 99 9 •> 9 9 9 «· 9999 99 99 • 9 9 9 9 9 9 99 99 Table no. 20: Linking antibodies L _and H _c per sections weaving inhuman kinds, that was determined

immunohistochemical process

organ / tissue type mouse rat rabbit cynomolgus brain -the crust __ -small brain - - - - j átra -hepatocytes - -. -portal triad - - - - lung -brushes -alveolus - - - - kidneys -glomeruli - -tubular epithelium - - - - stomach -glandular epithelium - -smooth muscles - - - - pancreas -exocrine lobes - - -endocrine islets - - - - intestine -glandural epithelium - - -smooth muscles - - - - sweetbread -lymphocytes - - - - skin -keratinocytes - - - sweat glands - - - - -hair follicle - - - - skeletal muscles - - - - heart - - - -

· · · · · · · · · · · · · · · · · · · · · · · · · ·

spleen -lymphocytes - - - - ovaries -follicular epithelium _ -supportive connective tissue - - - - Womb -myometrium - - - - cervix - - - - testicle tubular epithelium nt nt nt - connective tissue - - -

nt means not tested

Example 10: Construction of cell lines that produce chimeric anti-FAP monoclonal antibodies and modified shape anti-FAP monoclonal antibodies

The invention demonstrates a stable cell line of the invention that expresses L _A H _C , L _A H _A , L _B H _b , L _B H _d , L _b H _d and cF19 in CHO DG44 cells. Stable cell lines transfected with humanized or chimeric F19 antibodies were generated and their identity confirmed by PCR amplification of the heavy chain variable regions using genomic DNA obtained from each transfectant used as template.

CHO DG44 cells were maintained under serum-free conditions in SFM-II culture medium. Lipofectin and SFM-II culture medium was obtained from Gibco / BRL. Geneticin and all restriction enzymes were obtained from Boehringer Mannheim. Pfu polymerase was obtained from Stratagene.

DNA suitable for transfection was purified from E. coli cells using the QiaFilter Maxi kit

Cartridges from Qaigen as recommended by the manufacturer. All prepared DNAs were tested by restriction enzyme digestion.

• 9

The sequences of the variable regions of L _A H _C in their vector were confirmed using the ABI PRISM 310 sequencer (Perkin-Elmer).

Further information on the vectors and DNA sequences used is available in the other examples.

Transfection of CHO DG44 cells

Cells in the logarithmic growth phase were plated on 6-well plates containing 1 ml fresh SFM-II culture medium. Plasmids encoding the heavy and light chains of humanized and chimeric versions of F19 were co-transfected into CHO DG44 cells using liposomal transfection. Liposomes were prepared using 6 µί lipofectin reagent and 0.5 µg of each vector (one vector is suitable for the desired heavy chain and the other for the light chain) as described for lipofectamine transfection except that SFM-II culture medium was used. when diluting all reagents. 24 hours later, cells were diluted 1:10 in SFM-II culture medium containing 300 pg / ml geneticin. After the initial phase (10-14 days), cell death was complete and the concentration of geneticin was reduced to a concentration of 200 mg / ml and methotrexate was added to a final concentration of 5 nM. Methotrexate concentration increased after 10-14 days to a final concentration of 20 nM.

DNA amplification suitable for transfection by PCR

10 ⁷ CHO DG44 cells were centrifuged at full speed briefly in Eppendorf microtubes suitable for centrifugation, washed once in PBS and centrifuged again. Genomic DNA was prepared by ethanol precipitation after SDS lysis and the cell pellet was treated with proteinase K.

A mixture containing one of the following primer pairs, dNTP, buffer, and Pfu polymerase was used to amplify the heavy and light chain variable regions using genomic DNA as a template. The resulting PCR products were digested with the appropriate restriction enzyme and analyzed by agarose gel electrophoresis to confirm their consistency.

Light chain primer set:

5'-GAG ACA TTG TGA CCC AAT CTC C-3

PKN 1690

C-3 PKN.1930.R

Set of primers for heavy chain:

5 'TTG ACA CGC GTC TCG GGAAGC TT-3' PG 5863

5'-GGC GCA GAG GAT CCA CTC ACC T-3 'PG 6332.R

The uncleaved heavy chain PCR amplification product has a predicted size of 469 bp, while the light chain PCR amplification product has a predicted size of 286 bp. Identity verification was performed by restriction enzyme digestion with BstEII (heavy chain) or NaIv (light chain).

The CHO cell line was transfected with the DNA of antibodies L _A H _C , L _a H _a , L _b H _b , L _b H _b , L _b H _d and cF19. Geneticin resistant cells were obtained. These cells were further separated based on methotrexate resistance. PCR amplification and digestion with the restriction enzymes of the light and heavy chain DNA yielded the expected bands and confirmed the correspondence of L _and H _c , L _and H _a , L _b H _b , L _b H _b , L _b H _d .

The cells described are maintained in serum-free conditions and are not treated with products derived from animals such as trypsin.

Production cell lines transfected with the expressing antibodies L _and H _c , L _and H _a , L _b H _b , L _b H _b , L _b H _d and cF19 were produced. Their consistency was confirmed using PCR amplification and restriction enzyme digestion of the resulting PCR product of their heavy and light chain variable regions.

Example 11: Expression of Antibody Proteins in DG44 Chinese Hamster Ovary Cells and Purification

This experiment was performed to express and purify and characterize the monoclonal antibodies L _A H _C , L _A H _A , L _B H _B , L _B H _B , L _B H _D. Other tasks included performing a quantitative ELISA to determine antibody concentrations in crude culture medium samples as well as in pure Ig samples, and to determine the relative expression of various humanized F19 constructs using the assay.

Serum-free CHO DG44 cells and USP-grade metatroxate were obtained from Biotechnical Production Unit, Dr. Karl Thomae GmbH, Biberach, Germany. Both products are commercially available. Cells were maintained at all times in the absence of serum. Serum free SFM-II culture medium was obtained from Gibco / BRL. Protein A agarose was obtained from Pierce Chemical (Indianapolis, human IgG1 antibodies (Cat.

nitrophenyl phosphate tablets (A 2640), bovine serum albumin (BSA) (A7906) and alkaline phosphatase conjugated goat anti-human antibodies (A 3813) were purchased from Sigma Chemical (St alkaline phosphatase specific antibodies)

Jackson Immunoresearch Laboratories Tris-buffered saline (TBS) contained 150 mM NaCl, 50 mM Tris, pH7.5.

IN,

C.

USA). Standards I 3889), p-anti-human conjugated

Louis, MO, USA) for the chain were obtained from

Goat Kappa Companies (Stratech Scientific)

Cell culture conditions suitable for antibody expression

Cells were cultured and maintained in T-175 flasks in serum-free SFM-II culture medium without mixing.

The culture medium contains geneticin at a concentration of 200 μ9 / ω1 and nM methotrexate without antibiotics. Cells were passaged by dilution, not sown and grown in small clusters. When the cells reached the stationary phase of growth, the culture medium was collected and centrifuged to remove the cells and kept frozen at -20 ° C.

with an equal volume of TBS with protein A at

Purification of antibodies L _A H _C

All purification steps were performed at 4 ° C. The C10 / 10 column (Pharmacia Fine Chemicals) was packed with protein A agarose (3 ml volume). The column was washed with TBS and pre-eluted with 0.1 M sodium citrate pH 3.0 to ensure that the loosely bound material remained in the column. The column was immediately equilibrated with TBS and stored at 4 ° C.

Culture supernatants were thawed and centrifuged at 10,000xg for 30 minutes and then loaded onto a protein A chromatography column to remove residues and diluted. This material was applied to the column at a concentration of 0.5 ml / min using a Peristaltic P1 pump. (Pharmacia) and washed with TBS until absorbance at 280 nm was not detectable. The elution of the antibodies was started with 0.1 M sodium citrate pH 3.0 at an approximate rate of 0.2 ml / min. The elution was monitored at 280 nm and one milliliter of eluted material fractions were collected in tubes containing enough Tris base pH9 to neutralize the citrate buffer. The protein containing fractions were pooled and concentrated using an Amicon filter apparatus with a YM-30 filter and dialyzed with PBS. The column was immediately regenerated with TBS. The protein dye binding assay was performed using a BioRad protein assay kit (Hercules, California), according to the manufacturer's instructions, using bovine serum albumin as standard.

Human IgG (gammaimmunoglobulin) ELISA

ELISA plates were coated overnight with 100 μΐ of goat anti-human gamma-chain-specific alkaline phosphatase conjugate at a concentration of 0.4 mg / ml

in coating buffer at 4 ° C. The coating antibodies were removed and the plates were blocked with 2% BSA in PBS for 2 hours. All subsequent steps were performed at 37 ° C. The blocking buffer was replaced with antibody samples or human IgG1 standard diluted in serial dilution in 200 ml dilution buffer. Incubate for 1 hour. Negative controls included dilution buffer and / or culture medium of untransfected cells. The wells were washed and 100 μΐ of alkaline phosphatase-conjugated goat anti-human antibodies conjugated to a 1: 5,000 dilution were added. Incubate for 1 hour. The wells were washed and 100 μΐ reaction buffer was added and incubated for 30 minutes. The reaction was stopped by the addition of 1 M NaOH and the absorbance was read at 405 nm on an ELISA plate reader. The results were analyzed by an iteration curve that meets four parameters.

Amino acid analysis was performed according to methods described in the prior art.

Monoclonal antibodies L _A H _C were produced and purified until homogeneity using protein A affinity chromatography. ELISAs using human IgG1 as standards showed a 70% yield of L _A H _C antibodies. SDS-polyacrylamide gel electrophoresis estimated the material to be > 90% pure. Representative expression data and typical purification yields are shown in Table 21.

Table 21: Expression data and yield of FAP antibody protein purification in CHO cells

antibodies expressing power in patterns raw media yield cleaned antibodies improvement yield (cleaned

• · · · · · · · · · ·

(ELISA) antibodies) l _and h _c 7-10 mg / L «5-7 mg / l 500-700 l _and h _a 5-7 mg / L w 3-4 mg / l 300-400 l _b h _b 0.5-1 mg / L 0.2-0.5 mg / L 20-50 l _b h _b 0.8-1.5 mg / L 0.3-0.8 mg / L 30-60 chimeras. F19 0.02 mg / l <0.01 mg / L 1

Representative expression data for each of the anti-FAP antibodies generated in this study. The yield after protein A affinity chromatography is based on the measurement of the binding of the Ig purified protein dye using BSA as a standard.

Example 12: Binding of monoclonal antibodies L _A H _{C of} isolated recombinant human FAP

The subject of the study is the characterization of the binding of L _A H _C isolated human FAP.

na na

CD8-FAP ELISA

ELISA plates were coated overnight with 100 μΐ mouse anti-rat antibodies (Sigma Chemical R0761) at a dilution of 1: 2,000 in coating buffer at 4 ° C. The coating antibodies were removed and the plates were blocked with 2% BSA in PBS for one hour. All subsequent steps were performed at room temperature. The blocking buffer was replaced with 100 ml rat anti-CD8 antibodies at a concentration of 1 μς / ml (Pharmingen 01041D) and incubated for one hour. Plates were washed and 100 µl of CD8-FAP culture supernatant (described in Example 14) (diluted 1: 2 in PBS) was added, allowed to bind for one hour. Plates were washed and 100 μΐ of antibody samples were added (at 2-fold dilution) and incubated for one hour. Negative controls include human IgG and / or culture medium of untransfected cells. The wells were washed and 100 μΐ of mouse anti-human IgG1 was added

Conjugated to Horseradish Peroxidase (HRP) (Zymed 05-3320) diluted 1: 500 in dilution buffer and incubated for one hour. The wells were washed and 100 μΐ of HRP substrate ((azino-bis (3-ethylbenzthiazoline-6-sulfonic acid, Sigma Chemical A9941)) was added and the mixture incubated for 60 minutes. The reaction was stopped by adding 1M NaOH and absorbance was read at length 405/490 nm on an ELISA plate reader The results were analyzed using an iteration curve with four parameters.

Alternatively, the plates were coated directly with cF19. FAP (recombinant human FAP, described in Example 13) was allowed to bind to these plates as described above, and biotin-labeled L _A H _C antibodies (at a concentration of about 1 µg / ml) were added. Antibody binding was detected with the HRP-streptavidin conjugate as described above.

Solubility of human membrane bound FAP

293FAP 1/2 cells expressing FAP or 293 control cells were washed with PBS and lysed with 1% Triton X-114 in Tris-buffered saline. The nuclei and cell debris were separated by centrifugation at 10,000 x g. The supernatant was phase-segregated (Estreicher A, Wohlend A, Belin D, Scheuning WD, Vasalli JD. Characterization of the cellular binding site for the urokinase-type plasminogen activator). (1989) J. Biol. Chem 264: 1180-1189) to obtain membrane proteins. The detergent phase was collected and diluted in a buffer containing 1% empigen BB (Calbiochem) to prevent re-aggregation of triton X-114. This material was subjected to concanavalin A agarose gel chromatography (Rettig WJ, Garin-Chesa P., Healey JH, Su SL, Eger HL, Schwab, M, Albino AP, Old LJ. Regulation and heteromeric structure of the fibroblast activation protein in • fe

• fefe • · · normal and transformed cells of mesenchymal and neuroectodermal origin. (1993) Cancer Res. 53: 3327-3335).

Labeling of antibodies L _A H _{C by} biotin

Antibodies L _A H _C (1-2 mg) were dialyzed against 50 mM bicarbonate buffer and labeled with biotin in the presence of a 10-fold molar excess of sulfosuccinimidyl-6-biotinamidohexanoate (NHS-LC biotin, Pierce Chemical, Rockford, Illinois, USA) for 2 hours at room temperature. Unreacted product was removed by repeated microcodialysis in a microconcentrator.

Temporary transfection

COS-7 cells (American Type Tissue Culture Collection, Reference Number CRL 1651) were cotransfected by electroporation with heavy and light chain vectors that encode L _A H _C.

Anti-CD8 monoclonal antibodies were immobilized on microtiter plates. CD8-FAP from CD8-FAP baculovirus-infected insect cell culture medium was allowed to bind to these plates. The culture medium used from a culture of COS-7 cells transiently transfected with two separate vectors encoding L _A H _C antibodies was serially diluted and added to wells containing immobilized CD8-FAP. Antibodies L _and H _C bound to the immobilized CD8-FAP protein (FIG. 35). Culture supernatants from COS-7 cells blindly transfected do not show binding.

Recombinant membrane-bound FAP from 293FAP 1/2 cell detergent extracts or control extracts were serially diluted and immobilized via F19 monoclonal antibodies bound to microtiter plates. Biotin-labeled L _A H _C antibodies bind to recombinant human FAP immobilized with cF19 (Figure 36) in a concentration-dependent manner.

• 4 4 4 4

L _A H _C antibodies recognize isolated immobilized recombinant human FAP that carries an epitope suitable for mouse

F19. Antibodies L _A H _C bind to CD8-FAP produced by insect cells as well as to cross-linked FAP produced by 293FAP cells

1/2.

Three days after transfection, culture supernatants were harvested from COS7 cells transfected with heavy or light chain vectors that encode L _A H _C antibodies or without DNA (control). CD8-FAP were immobilized via anti-CD8 antibodies as described herein. Serial dilutions of supernatants of COS7 cells were enchained to bind immobilized CD8-FAP and subsequently detected with anti-human IgG1 antibodies conjugated with HRP.

Detergent extracts of 293FAP 1/2 cells expressing FAP or 293 control cells were serially diluted and added to cF19 coated microtiter plates. Biotin-labeled L _A H _C antibodies were added, and binding of biotin-labeled L _and H _c antibodies was detected by HRP-conjugated streptavidin.

Example 13: Characterization of HT-1080 fibrosarcoma cells and human embryonic kidney 293 cells transfected with human FAP cDNAs.

Fibroblast Activating Protein (FAP) is a membrane-bound cell surface protein that carries the F19 epitope and is expressed on the surface of fibroblasts of the tumor supporting vascular tissue. In order to characterize anti-FAP monoclonal antibodies, cell lines expressing recombinant FAP protein and corresponding controls that do not show FAP were generated.

The HT-1080 cells used (reference number CCL 121) and human embryonic kidney cells 293 (reference number CRL 1573) were obtained from the American Type Culture Collection (Maryland, USA). Transfectam was obtained from Promega (Madison, WI). Geneticin and restriction enzymes were obtained from Boehringer Mannheim. DNA suitable for transfection was purified from E. coli cells using QiaFilter Maxi Cartridges (Qiagen) according to the manufacturer's recommendations. All prepared DNAs were tested by restriction enzyme digestion. Vector sequences were confirmed using the ABI PRISM 310 sequencer.

For more information on the vectors and DNA sequences used, see Scanlan MJ, Raj BK, Calvo B, Garin-Chesa P, Sanz-Moncasi MP, Healey JH, Old LJ, Rettig WJ, Molecular cloning of fibroblast activation protein alpha, and member serine protease family selectively expressed in stromal fibroblasts of epithelial cancers. (1992) Proc. Nati. Acad.

Sci. USA 89: 10832-10836. Sequence in GenBank (deposit number HS09287).

The FAP cDNA was saved

Cell culture and immunoassays

HT-1080 cells were transfected with transfectam mg DNA using the manufacturer's recommendations. Human embryonic kidney 293 cells were transfected by the calcium phosphate transfection method (Brann MR, Buckley NJ, Jones SVP, Bonner TI, Cloned muscarinic receptor expression in A9 L cells. (1987) Mol. Pharmacol 32: 450-455 ) with 10 mg of DNA. 24 hours later, cells were diluted 1:10 with fresh medium containing 200 mg / ml geneticin. Colonies were isolated and tested for immunofluorescence to express FAP as described by Rettig WJ, Garin-Chesa P, Bersford HR, Oettgen HF, Melamed MR, Old LJ, Cell-surface glycoproteins of human sarcomas: differential expression in normal and malignant tissues and cultured cells (1988) Proc. Nati. Acad. Sci. USA 85: 3110-3114).

Immunoprecipitation with cF19 was performed with metabolically labeled cells as described in • 9 «·

9 · · • · * * * * * * ·

Rettig WJ, Garin-Chesa P, Healey JH, Su SL, Oher HL, Schwab, M, Albino AP, Old LJ. Regulation and heteromeric structure of fibroblast activation protein in normal and transformed cells of mesenchymal and neuroectodermal origin. (1993) Cancer Res. 53: 3327-3335.

HT-1080 and 293 cells were tested for FAP antigen expression in anti-FAP immunofluorescence assays and were found not to show antigen. Transfection of said cells with the FAP.38 vector resulted in the formation of geneticin resistant colonies. Isolated colonies were tested by immunofluorescence for FAP expression. Two cell clones were identified. These were designated as HT1080FAP clone 33 and 293FAP 1/2, which express FAP protein on the cell surface, which is recognized by cF19 antibodies. Staining of non-permeabilized HT-1080FAP cells with clone 33 and 293FAP 1/2 by cF19 confirmed cell surface localization of the FAP protein.

Immunoprecipitation of radiolabeled FAP protein with cF19 antibodies from HT-1080FAP cell extracts of clone 33 or 293FAP 1/2 labeled with ³⁵ S-methionine led to the discovery of a 93,000 molecular weight band after autoradiation. or 293.

Two stably transfected cell lines HT-1080FAP clone 33 and 293FAP 1/2 express cell surface FAP as determined by anti-FAP monoclonal antibody immunoassays. Neither the HT-1080 parental cells nor the 293 parental cells express a detectable amount of FAP.

Example 14: Generation and Characterization of CD8FAP Fusion Protein

Soluble form of human FAP (fibroblast activation protein) in the form of FAP fusion protein was produced in insect cells in order to characterize the antibody H _and L _c, which contain the binding site for anti-FAP monoclonal antibodies. Mouse CD8 antibodies were selected to allow protein secretion and provide another epitope tag.

The cDNA encoding the extracellular domain of CD8, which contains the first 189 amino acids of mouse CD8a (Genbank M12825), was fused to the cDNA of the extracellular domain of FAP (amino acids 27-760), essentially as described by Lane P., Brocker T, Hubele S, Padovan E , Lazavecchia A, McConnell. Soluble CD40 ligand can replace the normal T cell-derived CD40 ligand signal to B cells in T cell-dependent activation (1993) J. Exp. Copper. 177: 1209-1213) using standard PCR protocol. The authenticity of all clones was verified by DNA sequencing. The resulting DNA was inserted into vector pVL1393 (Invitrogen) and transfected with Sf9 cells (Invitrogen) with this vector and amplified the resulting recombinant baculovirus as described in Baculovirus Expression Vecotres. A Laboratory Manual. O'Reilly DR, Miller LK, Luckow VA, (Eds.), Oxford University Press: New York, 1994). The used culture medium of High Five ™ cells (Invitrogen) infected with recombinant baculovirus CD8-FAP for four days was harvested and purified by ultracentrifugation.

The CD8-FAP ELISA is described above in the Example.

Insect cell cultures infected with CD8-FAP virus secreted the fusion protein into the culture medium. This fusion protein carries the F19 epitope and is recognized by anti-FAP antibodies (Figure 1). Neither the cell culture medium nor the insect cell medium infected with the CD8-CD40L fusion protein binds anti-FAP antibodies.

Soluble CD8-FAP protein bearing the F19 epitope was secreted into the culture medium of infected insect cell cultures.

Culture supernatant from cells infected with the control construct does not contain the antigen carrying the F19 epitope.

The soluble form of FAP, CD8-FAP, was produced in insect cells and CD8-FAP was shown to carry an epitope recognized by cF19.

Four days after infection, supernatants derived from insect cells infected with recombinant baculovirus encoding either the CD8-FAP or CD8-CD40L fusion protein were collected. Cell-free cell culture medium was used as an additional control (medium). Serial dilutions of these materials were added to anti-CD8 antibody coated microtiter plates and allowed to bind. Subsequently, cF19 antibodies (1 mg / ml) were added and allowed to bind. Bound cF19 antibodies were detected with horseradish peroxidase-conjugated anti-human antibodies.

Claims (9)

PATENT CLAIMS An antibody protein having complementary determining regions of F19 monoclonal antibodies (ATCC deposit number HB 8269), wherein said antibody protein specifically binds to a fibroblast activation protein, characterized by showing framework modifications that result in improved production in host cells , as compared to chimeric antibodies having F19 variable regions and foreign constant regions. The antibody protein characterized in that it has a light chain and heavy chain variable region according to claim 1, wherein each region is linked to a human constant region. The antibody protein of claim 2, wherein said human light chain constant region is a human kappa constant region. The antibody protein of claim 2, wherein said human heavy chain constant region is gamma-1 human constant region. Antibody protein according to any one of claims 1 to 4, characterized in that the expression level in the raw medium samples as determined by ELISA and / or the yield of purified antibodies exceeds the expression level and / or the purification yield of the chimeric antibodies without altering the basic structure by at least factor 10. Antibody protein according to any one of claims 1 to 4, characterized in that the expression level in the raw medium samples as determined by ELISA and / or the yield of purified antibodies exceeds the purification yield of the chimeric antibodies without adjusting the base structure by at least a factor of 20. • · · Antibody protein according to any one of claims 1 to 4, characterized in that its expression level in the raw medium samples as determined by ELISA and / or the yield of purified antibodies exceeds that of the chimeric purification. 151 »« ·· without modification basic structures at least by factor 100 ALIGN! 8. Antibody protein according to any of the claims 1 to 7 characterized by that in eukaryotic cells show e improved production. 9. Antibody protein according to claim 8, where listed The eukaryotic cell is a Chinese hamster ovary cell (CHO cell). The antibody protein of any one of claims 1 to 9, wherein the amino acid at position 87 of the Kabat light chain region is not asparagine. The antibody protein of claim 10, wherein the amino acid at position 87 of the Kabat light chain region is selected from aromatic or aliphatic amino acids. The antibody protein of claim 11, wherein said aromatic amino acid at position 87 of the Kabat light chain region is tyrosine or phenylalanine. The antibody protein of any one of claims 1 to 12, wherein the amino acid at position 36 of the Kabat light chain region is selected from aromatic amino acids. The antibody protein of any one of claims 1 to 13, which comprises a light chain variable region as set forth in SEQ ID NO: 2. 15. The antibody protein of claim 14, wherein the light chain variable region is encoded by a nucleotide sequence as set forth in SEQ ID NO: 1. The antibody protein of any one of claims 1 to 13, which comprises a light chain variable region as set forth in SEQ ID NO: 6. 153 17. The antibody protein of claim 16, wherein the light chain variable region is encoded by the nucleotide sequence as set forth in SEQ ID NO: 5. The antibody protein of any one of claims 1 to 17, which comprises a heavy chain variable region as set forth in any of SEQ ID NOs: 8, 10, 12, 14. The antibody protein of claim 18, wherein the heavy chain variable region is encoded by the nucleotide sequence as set forth in SEQ ID NOs: 7, 9, 11, 13. The antibody protein of any one of claims 1 to 14, which comprises a light chain variable region as set forth in SEQ ID NO: 2 and a heavy chain variable region as set forth in SEQ ID NO: 12. The antibody protein of claim 20, wherein the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 1 and the heavy chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 11. The antibody protein of claim 20 or 21, which comprises a light chain constant region set forth in SEQ ID NO: 20 and a heavy chain constant region set forth in SEQ ID NO: 22. The antibody protein of any one of claims 1 to 13, 18 or 19, which comprises a light chain variable region set forth in SEQ ID NO: 2 and a heavy chain variable region set forth in SEQ ID NO: 8. 24. The antibody protein of claim 23, wherein the light chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 1 and the heavy chain variable region is encoded by the nucleotide sequence set forth in SEQ ID NO: 7. 154 • · ·· 9 A nucleotide sequence encoding the antibody protein of any one of claims 1 to 24. 26. A recombinant DNA vector comprising the nucleotide sequence of claim 25. 27. The recombinant DNA vector of claim 26 which is an expression vector. A host cell carrying the vector of claims 26 or 27. The host cell of claim 28, which is a eukaryotic cell. The host cell of claim 29, which is a mammalian cell. The host cell of claim 30, which is a CHO or COS cell. A method of producing antibody proteins according to any one of claims 1 to 24, comprising: a) culturing a host cell according to any one of claims 28 to 31 under conditions wherein said antibody protein is expressed by said host cell; and b) isolating said antibody protein. 33. The method of claim 32, wherein said host cell is a mammalian cell, wherein a CHO or COS cell is preferred. 34. The method of claim 32 or 33, wherein said host cell is a codon plasmid that carries the light and heavy chain expression units, respectively. The antibody protein of any one of claims 1 to 24, which is conjugated to a therapeutic agent. The antibody protein of claim 35, wherein said therapeutic agent is selected from the group consisting of radioisotopes, toxins, toxoids, inflammatory agents, and chemotherapeutic agents. The antibody protein of claim 36, wherein said isotope is a beta-emitting radioisotope. by being transfected The antibody protein of claim 37, wherein said 155 ·· · 1 · 1 · 1 The radioisotope is selected from the group consisting of 186 rhenium, ¹³¹ iodine and ⁹⁰ yttrium. 39. The antibody protein of any one of claims 1 to 24, wherein the label is characterized by being labeled. The antibody protein of claim 39, wherein the detectable marker. The antibody protein of claim 40, wherein the detectable marker is selected from the group consisting of enzymes, dyes, radioisotopes, digoxygenin, and biotin. An antibody protein according to any one of claims 1 to 24 conjugated to an imaging agent. The antibody protein of claim 42, wherein the imaging agent is a radioisotope. The antibody protein of claim 43, the radioisotope emits gamma radiation. 45. The antibody protein of claim 44, wherein said The 125radioisotope is 46. Pharmaceutical, wherein the composition comprises the antibody protein of any one of claims 1 to 24 and a pharmaceutically acceptable carrier. 47. A pharmaceutical composition comprising the antibody protein of any one of claims 35 to 38 and a pharmaceutically acceptable carrier. 48. A pharmaceutical composition comprising the antibody protein of any one of claims 42 to 45 and a pharmaceutically acceptable carrier. A pharmaceutical composition according to claims 46 to 48, which is suitable for use in the treatment and imaging of tumors, wherein said tumors are associated with activated fibroblasts supporting fibrous tissue. 156 9 9 9 9 9 9 C 9 9 · · 9 9 9 9 9,999 9,999, wherein it is preferred that said tumors be selected from a group of cancer that includes colorectal cancer, cancer other than small lung cell cancer, mammary cancer, head and neck cancer, ovarian cancer, cancer lung cancer, bladder cancer, pancreatic cancer, and metastatic brain cancer. Use of the antibody protein of any one of claims 1 to 24 in the treatment of cancer. Use of the antibody protein of any one of claims 35 to 38 in the treatment of cancer. Use of the antibody protein of any one of claims 42 to 45 in imaging activated fibroblasts of supporting connective tissue. Use of the antibody protein of any one of claims 39 to 41 in detecting the presence of activated fibroblasts of supporting connective tissue in a sample. 54. A method of treating tumors, wherein the tumor is associated with activated connective tissue fibroblasts capable of specifically complexing with the antibody proteins of any one of claims 1 to 24 or 35 to 38, the method comprising contacting the tumor with a plurality of said antibody proteins. that are effective in treating cancer. 55. The method of claim 54, wherein the tumor comprises cancer cells selected from the group consisting of colorectal cancer, cancer other than small lung cell cancer, mammary cancer, head cancer, and cancer. neck cancer, ovarian cancer, lung cancer, bladder cancer, pancreatic cancer, and metastatic brain cancer. 56. The method of claim 54, wherein the contacting is performed in vitro. • · · · · · · · · · · · · · · · · · 157 57. The method of claim 54, wherein the contacting is in vivo. 58. A method for detecting the presence of activated fibroblasts of supporting connective tissue in wound healing, inflammation, or malignancy, comprising: (a) the sample, which is likely to contain activated fibroblasts of the supporting connective tissue, is contacted with the antibody protein of any one of claims 1 to 24 or 39 to 41 under conditions suitable to form a complex between said antibody and antigen; b) detecting the presence of said complex, thereby detecting the presence of activated fibroblasts in the supporting connective tissue in wound healing, inflammation, or tumor. 59. Method according to Claim 58 ..... .mu.Ci are you m that tumor contains malignant cells growth selected from the group consisting of colorectal cancer, carcinoma different from carcinoma z small lung cells, carcinoma dairy glands, malignant head growth a neck, carcinoma ovarian cancer, lung cancer, urinary cancer bladder, carcinoma pancreas and metastatic malignancy growth brain. 60. Method] according to claim 58 or 59 h I mark .mu.Ci are you m that the antibody protein is a protein according to any of claims 39 to 41. 61. A method of imaging the presence of activated fibroblasts of supporting connective tissue in wound healing, inflammatory skin, or tumor in a human patient, comprising: a) the antibody protein of any one of claims 1 to 24 conjugated to a displayable agent is administered to a human patient under conditions suitable to form an antibody-antigen complex; b) displaying any complex formed in this manner. • · 62 158 wherein the tumor comprises cancer cells selected from the group consisting of colorectal cancer, cancer different from small cell lung cancer, mammary gland cancer, head and neck cancer, ovarian cancer, lung cancer, urinary cancer bladder cancer, pancreatic cancer, and metastatic brain cancer. 63. A method for detecting tumor supporting fibrous tissue, characterized in that: a) a suitable sample is contacted with the antibody protein of any one of claims 1 to 24 under conditions suitable to form an antibody-antigen complex; b) detects the presence of any complex thus formed, c) associates the presence of said complex with the presence of tumor connective tissue. 64. The method of claim 62, wherein said antibodies are labeled with a detectable marker. 65. A method of imaging fibrous connective tissue in a human patient, the method comprising: a) administering to the patient the antibody protein of any one of claims 42 to 45 under conditions suitable to form an antibody-antigen complex, b) imaging any complex thus formed, thereby imaging the presence of connective connective tissue in a human patient. 66. An antibody protein comprising the amino acid sequence set forth in SEQ ID NO: 2. The antibody protein of claim 66, further comprising the amino acid sequence set forth in SEQ ID NO: 12. The antibody protein of claim 66 or 67, further comprising the amino acid sequences set forth in SEQ ID NO: 20 and SEQ ID NO: 22. 159 • · 69. A protein antibody DNA molecule according to any one of claims 66 to 68. 70. A host cell containing a stored cell DNA according to claim 69. 71. The method of producing an antibody protein of any one of claims 66 to 68, comprising: e a) culturing the host cell of claim 70 under conditions wherein said antibody protein is expressed in said host cell; and b) isolating said protein. 72. An antibody protein according to any one of claims 66 to 68, which connects with the radioisotope being preferred, ¹³¹ I, 125 _Ir 186 _Re, 188 _{Re nebQ} 90 _y. 73. A pharmaceutical composition comprising the antibody protein of any one of claims 66 to 68 or 72 and a pharmaceutically acceptable carrier.