CZ20002696A3 - Frostproof protein - Google Patents

Abstract

Describes an antifreeze protein containing at least 40% amino acids S, T or N and exhibiting at least 80% overlap with the following amino acid sequence: D-E-Q-P-N-T-I-S-GS-NN-T-V-R-S-GS-K-N-V-L-A-G-N-D-N-T-V-I-S-G-D-NN-S-VS-GS-NN-T-W-S-G-N-D-N-T-V-T-GS-N-H-W-S-G-T-N-H-I-V-T-D-NN-NN-VS-G-N-D-NN-VS-G-SF-H-T-PS-G-G-H-N-T-VS-GS-NN-T-VS-GS-N-H-V-VS-GS-N-K-W-T-D-A and its modified versions that they do not have affecting the inhibited ice recrystallization property

Description

Technical field

The invention describes antifreeze proteins food products containing AFP.

(AFP) and frozen

BACKGROUND OF THE INVENTION

Antifreeze proteins (AFPs) are used to improve food tolerance to freezing.

The use of AFP for these purposes is well known in the art, particularly those proteins which have an activity to inhibit the growth of ice crystals are particularly suitable (see, for example, US 5,118,792).

WO 90/13571 describes anti-freeze peptides produced chemically or by recombinant DNA methods. AFPs are suitable for use in food products. Example 3B describes a method for modifying the shape of ice crystals when the water-ice mixture is frozen in film in combination with 0.01% (w / w) AFP.

WO 92/22581 discloses plant AFPs that can be used to control ice crystal shapes in ice cream preparation. This document also describes a method of extracting a polypeptide composition from the intercellular space in plants by infiltrating the leaves with an extraction medium without disturbing the plants.

Document 94/03617 describes the production of AFP from yeast and their use in ice cream preparation. WO 96/11586 discloses fish AFPs that produce microbes.

The isolation and / or use of plant proteins in deep freeze protection is also described in several places in the literature. Deep freezing protection proteins have the function of protecting plant membranes against freezing damage. These proteins do not exhibit recrystallization inhibition properties and are therefore not associated with the terms AFP.

Hincha, Journal of Plant Physiology, 1992, 140, 236-240 describes the isolation of proteins used to protect deep-frozen cabbage. Volger, Biochimica et Biophysica Acta, 412 (1975), 335-349 describes the isolation of proteins for protection in deep-freezing spinach. Boothe, Plant Physiol (1995), 108: 759-803 describes the isolation of proteins from Brassica napus. It is believed that proteins have protective properties in deep these freeze rather than AFP. Neven, Plant Molecular Biology 21: 291-305, 1993 describes the characterization of a spinach protein that exhibits deep freeze protective properties. The publication Salzman Abstracts and Reviews of the 18 ^th Annual Meeting of the ASEV / Eastern Section in Am. J. Enol. Vitic., Vol. 44, NO. 4, 1993, discloses the presence in the buds of a vitis plant that are stable at boiling point. Although these proteins are analogues of fish antifreeze peptides, they are proteins that exhibit deep freeze protection but are not AFPs. In Lin, Biochemical and Biophysical research Communication, Vol. 183, No. 3, 1992, p. 1103-1108 and Lin, Plant Physiology (1992) 99, 519-525 discloses a deep-freeze protection polypeptide having a molecular weight of 15,000 from Arabidopsis Hakaira. Houde, The Plant Journal (1995) 8 (4), 583-593 describes cryoprotective proteins from wheat.

So far, AFPs have not been applied to commonly available foods. One reason is the high cost and the complicated way to obtain AFP. Another reason is that AFPs cannot be incorporated into the standard mixture because they show a tendency to destabilize during processing, especially during the pasteurization step. This destabilization is believed to be caused

3 · ♦ · · · den · den · den · den · den · den · den · den · den · atur · AFP. This is a well-known phenomenon commonly seen with peptides and proteins.

PCT / EP97 / 03634 teaches that AFPs can be isolated from natural sources such as low-temperature-acclimated grass in a new relatively simple manner. This method first leads to the identification of AFP, which can conveniently be added to the mixture for the preparation of frozen products prior to pasteurization.

This process of obtaining AFP from grass includes the steps of:

(a) isolation of grass containing AFP from grass;

(b) treating the grass or juice containing AFP at a temperature of at least 60 ° C;

c) removal of insoluble fractions.

The step described in paragraph C) usually proceeds following the steps described in paragraphs a) and b). The step described in a) and b) may be carried out in any desired order. For example, step a) is followed by step b) (in this case the AFP-rich juice is heated) or step b) is followed by step a) (in this case, the natural source is heated) or steps a) and b) run simultaneously.

This process has a number of advantages. First, using this procedure, it is not necessary to prevent grass damage, as is the case in WO 92/22581. This immediately substantially increases the commercial applicability of the process compared to, for example, the process described in WO 92/22581, as high specific processing costs are not necessary. Also, using high temperatures, it is possible to extract from the large group of peptides present in grass AFPs that are very active in inhibiting ice recrystallization. Thirdly, as opposed to high temperature temperatures, not all protein materials are denatured, but only some proteins appear to denature, while the remaining AFP grasses exhibit increased temperature stability. This makes it possible to include isolated AFPs in compositions that are required

exposed to high temperatures, such as pasteurization. This is particularly surprising since the AFP of WO 92/22581 does not appear to be stable when heated.

The process described above includes in step b) heating the grass or AFP rich juice to a temperature of more than 60 ° C. It is preferred that the temperature be in the range 60 to 110 ° C, more preferably the temperature is in the range 80 to 105 ° C. The heating step takes place after the isolation of the protein rich juice (step described in a) or before the isolation of said juice. Any suitable method of heating the juice, heating in the added extraction medium, heating with steam, etc. may be used.

If an extraction medium is used, it may preferably be used in small volumes to avoid necessary dilution of the AFP fraction. Any suitable extraction medium may be used, although the use of water is particularly preferred. If necessary, additives may be added to the water before being used as an extraction medium. Most preferred is the use of water which is free of additives.

It has been found that in this way a very active AFP can be obtained from grass. According to the invention, the term grass includes members of the Gramineae family, which for example include perennial grasses such as Lolium perenne, Parapholis strigosa, Nardus strica, Catapodium loliaceum and Lolium multiflorum, Poa trivialis, Poa pratensis and cereals such as winter rye and winter barley. The amino acid sequence of AFP was determined.

SUMMARY OF THE INVENTION

Surprisingly, it has been found that the highly active AFPs obtained from plants are characterized by a high amount of amino acids: serine (S), theonine (T) and asparagine (N). It has further been found that preferred AFPs of the invention are characterized in that at least 40% of the amino acids in the protein are selected from the group consisting of S, T and N. It is preferred that the AFPs be obtained from grasses, especially the Gramineae family.

• ·

A preferred AFP molecular weight of the invention is 8,000 to 16,000, more preferably 10,000 to 14,000, which molecular weight is determined from the gene sequence or mass spectroscopy of the unmodified form, for example, in a form that is not glycosylated.

The invention further relates to an AFP obtainable from grass, said AFP having an amino acid sequence (from N-terminus):

_d _ _e _q-PNTISGSNNTVRSGSKNVLAG-NDNT-Vj-SGDNNSVSGSNNTVVSGNDNT-VTGSNHV _in _S_G-TNHIVTDNNNNVSGNDNNVS - GSFHTV _with _ _g _ _g _H-NTVSGVNTVSGSN

The invention also encompasses proteins having a sequence with a high degree of similarity to the above sequence. The invention further provides all RI active proteins having an amino acid sequence having at least 80% overlap with the above-described sequence. More than at least 90% overlap is more preferred, more than 95% overlap is preferred, for example, amino acid sequences that either do not differ from the above described sequence or differ only by two amino acids. Such isoforms of the above protein of the invention.

The invention further provides modified versions of the proteins, wherein said modifications do not materially affect the ice recrystallization inhibitory properties. Such a form is, for example, a glycosylated version thereof.

AFP-rich juice can be separated from the grass by any suitable means, for example by compression, filtration, homogenization, as described above β

99 9 9 9 9 9 9 99

9 9 9 9 999 · 9 9 9 9 • 9 ·· ······· 9999 99 ·· ·· ·· Extraction etc. It is preferred that grass be collected before the protein-rich fraction is collected. , cut into small pieces or prepared porridge. Maceration can be carried out in any suitable manner, for example in a blender. The skilled person is able to prepare the grass so that the step of capturing the protein rich juice can simply be carried out.

After capturing said juice and heating (respectively) the protein fraction of the resulting AFP-containing sample can then be processed in an appropriate manner to remove the insoluble fraction leaving only the AFP-rich liquid fraction. The insoluble fraction can, for example, be removed by filtration, precipitation, etc. The AFP-rich liquid can then advantageously be treated by increasing its concentration or isolating the AFP, thereby bringing it into a form suitable for further use. Examples of suitable processing are drying to obtain a powder or paste, concentration of the AFP concentrate, chromatography whereby AFP is separated from the extraction medium, etc. It is easy for the person skilled in the art to determine suitable methods and conditions for proper isolation.

The nucleic acid sequence encoding the AFP described above was also determined. The invention further provides a nucleic acid sequence capable of encoding an AFP of the invention.

Preferably said nucleic acid has the sequence:

GAT GAA CAG CCG AAT ACG ATT TCT GGG AGC AAC AAT ACT GTC AGA TCC GGG AGC AAA AAT GTT CTT GCT GGG AAT GAC AAC ACC GTC ATA TCT GGG GAC AAC AAT AGT GTG TCT GGG AGC AAC AAC ACT GTC GTA AGT GGG AAT GAC AAT ACC GTA ACC GGC AGC AAC CAT GTC GTA TCA GGG ACA AAC CAT ATC GTT ACA GAC AAC AAC AAT AAC GTA TCC GGG AAC GAT AAT AAT GTA TCC GGG AGC TTT CAT ACC GTA TCC GGG GGG CAC AAT ACT GTG TCC GGG AGC AAC AAT ACC GTA TCT GGG AGC AAC

CAC GTT GTA TCT GGA AGC AAC AAA GTC GTG GCA GAC GCT TAA ·· ·· ··· · · · ······ · ·

The invention further provides alleles or other nucleic acid sequences that are capable of encoding the AFPs described above. For example, those nucleic acid sequences wherein one or more codons in the above sequence are replaced by their synonyms (i.e., codons encoding the same amino acid).

The invention further provides vectors comprising a nucleic acid sequence capable of encoding an AFP of the invention.

Based on the above information, it is also possible to genetically modify other natural sources to produce AFPs.

It has also been found that the AFP of the above sequence exhibits improved inhibitory properties of ice recrystallization. The examples describe a suitable assay for determining the inhibitory properties of recrystallization. Includes rapid freezing to -40 ° C followed by storage at -60 ° C. Preferably, the AFPs that are subjected to said test after heat treatment are in the form of ice crystal particles having a size less than 5 µm larger than the ice crystal size of the sample to which the same AFP has been added but the sample has not been heat treated. It is preferred that the difference be less than 3 µm, most preferably the difference is less than 1 µm.

Preferably, those AFPs that exhibit substantial ice recrystallization inhibitory properties are selected. A suitable assay for determining the inhibitory properties of recrystallization is described in the Examples. It is preferred that the AFPs of the invention provide ice particles after an ice recrystallization inhibition assay, as described in the examples, of 15 µm or less. More preferably, the particle size is from 5 to 15 µm.

The AFP of the invention may be advantageously used in food products, with food products that are frozen or intended to be frozen preferred. Particularly preferred is the use of AFPs in the products. 9 9 9 9 9 9 9 4

9999 9999 99 99 99 99 which are heated before freezing, for example during pasteurization, blanching or sterilization. Use in frozen confectionery products is particularly preferred.

Examples of such products are: frozen confectionery mixtures, such as ice cream mixtures, which are pasteurized before freezing. Such mixtures are usually stored at ambient temperature. Suitable product forms are, for example, a powder mixture which is packaged, for example, in sachets or sachets. Said mixture is able to form the basis of the frozen food product, for example after addition of water and other ingredients and after possible aeration.

Another example of a suitable blend is a liquid blend (which can be aerated), which can be frozen after addition of other components and aeration.

The obvious advantage of the above mixtures is that the presence of AFP allows the mixture to be frozen under conditions where mixing is not necessary, for example in a shop or home freezer, without creating unacceptable ice crystal shapes and structures that differ from the structure of quick-freeze products .

It is very advantageous to pack the mixture in containers (for example, boxes, bags, plastic containers, etc.). In the case of a single portion, the package size is generally 10 to 1000 g. In the case of multiple portions, the package size is up to 500 kg. Generally, the package size is 10g to 5,000g.

As mentioned above, the preferred products where AFP is used are frozen confectionery products such as ice cream. The amount of AFP is preferably 0.00001 to 0.5% by weight of the final product. If dry mixtures or concentrates are used, the concentration of AFP must be higher to ensure that the amount of final product is within the above range.

For the purposes of the invention, the term "frozen confectionery product" includes frozen confectionery such as ice cream, frozen yogurt, frozen sherbet, sorbet, milk ice and egg.

Frozen cream, water ice cream and frozen fruit puree. In some cases, use in fermented food products is less preferred.

It is preferred that the amount of solids in the frozen confectionery products (e.g., sugar, fat, flavors) be greater than 4% (w / w). For example, in order for the amount to be greater than 30% (w / w), more preferably from 40 to 70% (w / w).

The frozen confectionery products of the invention may be produced by any method suitable for the production of frozen confectionery products. It is particularly preferred that all ingredients be completely mixed prior to pasteurization and freezing. The freezing process preferably comprises curing, for example, at a temperature of -30 ° C or lower.

DETAILED DESCRIPTION OF THE INVENTION

Example 1:

AFP isolation, when the grass is first heated, then the high AFP juice is isolated and the AFP is isolated from it.

In January, tissue of various grasses (Poa trivialis, Lolium perenne, Holcus lanatus, Bromus sterilis) was cut (average temperature this month is 3.5 ° C to ensure appropriate cold acclimatization of the plants). Grass tissue was quickly transported to the laboratory for further processing. Wash with water to remove impurities.

The 500 g cut grass was placed in a 659 watts microwave oven and heated at full power for 5 minutes, raising the temperature to 85-100 ° C. The cut grass was then cooled to ambient temperature.

Alternatively, the pieces of grass were mixed with 500 g of boiling water and the mixture was reheated to 100 ° C, followed by heating for 10 minutes with stirring, and then cooled to 60 ° C.

φ φ φ φ φ · · · · · · · · ·

Π Φ ΦΦΦΦ Φ Φ φ φ φ Φ

J- '-Ζ · · · Φ φφφφ φφφφ φφ φφ φφ φφ

After heating, AFP-rich juice was separated from the chopped grass by filtration. The mass was continuously stirred for 5 minutes in the presence of an equal volume of water and passed through three layers of gauze.

The supernatant may be freeze-dried to remove water and then stored. Alternatively, the supernatant may be frozen for storage.

Example 2:

The liquid mixture suitable for making ice cream was prepared by mixing:

ingredients % (w / w) skimmed-milk powder 10.00 sucrose 13, 00 maltodextrin (MD40) 4.00 locust bean gum 0.14 butter oil 8.00 monoglyceride (palmitate) 0.30 vanillin 0.01 AFP (described in Example I *) 0.01 or none (control) water balance

* note: AFP is added as a concentrated solution of AFP in a small amount of water, the percentage is related to the amount of AFP.

The ingredients were mixed at ambient temperature, followed by pasteurization for 60 seconds at 89 ° C. The mixture was aseptically filled into 500 ml bags. The bags were sealed and stored at ambient temperature.

The mixture is used to prepare ice cream by whipping it with a suitable home mixer, followed by freezing in the home freezer without mixing.

After two months of storage according to the invention, the composition had a significantly better structure than the control.

Ftft ftft ftft ftft ft ftft ·

Example 3:

AFP ice recrystallisation inhibitory properties can be determined as follows.

A sample of the AFP containing product was adjusted so that the sucrose amount was 30% (w / w) (if the initial sample amount was greater than 30%, then this was done by dilution, if the initial sucrose amount was less than 30% w / w, then sucrose was added to this amount).

A 3 μΐ sample drop was placed on a 22 mm coverslip. The drop was covered with a 16 mm diameter coverslip and placed on a 200 g sample to ensure the same thickness. The edges of the coverslip were sealed with nail polish.

The slide was placed under a Linkham THM 600 temperature controlled microscope. The microscope stage was rapidly cooled (50 ° C per minute) to -40 ° C to form a large population of small crystals. The temperature of the microscope stage then rose rapidly (50 ° C per minute) to -6 ° C and this temperature was maintained.

The ice phase was observed at -6 ° C using a Leica Aristoplan microscope. In order to enhance the contrast of the ice crystals, polarized light was used in conjunction with a lambda plate. The ice phase stage (ice crystal size) was recorded by 35 mm photomicrography at T = 0 and T = 1 hour.

In general, this test can be applied to any suitable composition comprising AFP and water. In general, the amount of AFP in such a test composition is not very critical and may, for example, range from 0.0001 to 0.5% (w / w), more preferably from 0.0005 to 0.1% (w / w), most preferably 0.001 to 0.05% (w / w), for example 0.01% (w / w).

Any suitable composition comprising AFP and water may be used in the assay. In general, however, it is not necessary to isolate the AFP in pure form. In the case of practical use, the titi ti ti ti ti ti ti

it is sufficient to prepare a liquid extract or juice of natural material, which extract or juice can then be tested.

This method can then be applied, for example, to AFP containing extracts obtained in Example I when a concentration step has been applied or not.

The inhibitory properties of recrystallization of several samples were measured. The AFP-containing juice obtained after extraction and heating according to Example I was measured for its recrystallization properties as described above.

Silsoe (UK) obtained grass extract harvested in January that was not heat treated. The extract was centrifuged for one hour to remove soil and insoluble impurities (centrifuge: Sorvall RC3C, rotor: H6000A, temperature: + 5 ° C, speed 5,000 rpm, 7,268 xg).

The extract sample was freeze-dried to determine the total solids content. This value was found to be 11.48 mg / ml. The dry extract was then re-hydrated with a 30% sucrose solution to its original solids concentration. Several solutions were prepared by diluting the extract with a 30% sucrose solution.

The ice crystal recrystallization inhibitory activity was measured using the assay described above.

At time T = 0 and T = 1, recrystallization inhibition tests showed the average ice crystal size measured using a Zeiss TGA 10 analyzer. The ice crystal size (length) was determined by crystal tracing. The maximum length for each individual ice pack of the ice cream pack was transferred to a spreadsheet where the data was analyzed to determine the mean and standard deviation.

The results obtained are given in the table below:

• · ft. · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·

sample overall solids (mg / ml) size of ice crystals (μπι) grow icy of crystals during one hours at temperature -6 ° C T = 0 T = 1 hour at temperature 5 ° C undiluted 11.48 5.2 7.3 2.1 50% extract 5.74 5, 5 7.6 2.1 25% extract 2.87 6, 3 8.9 2.6 12.5% extract 1,435 6, 6 13.1 6.5 6.25% extract 0.7175 8.1 14.7 6, 6 3,125% extract 0.359 7.4 17.0 9.6 1.5625% extract 0.179 9.0 20.3 11.3

These results show differences in final crystal size and crystal size changes over one hour at 6 ° C at various dilutions of grass extract. It can be seen that the amount of solids in the grass extract can vary over a wide range, while still obtaining good recrystallization inhibitory properties. Preferably, those concentrations are selected where their use results in an ice crystal size of 15 microns or less after one hour.

A similar test was performed with grass extract that was subjected to heat treatment (10 minutes at 100 ° C). No significant decrease in the inhibitory properties of the recrystallization could be seen.

In addition, grass extracts of Example I were tested using the same recrystallization inhibition assay. The following results were obtained:

heat treatment size of crystals T = 0 T = 1 60 ° C for 1 clock 9, 6 11.1 10 minutes WHAT 11.3

These results show that even after heating the cold-acclimated grass extract, the ability to inhibit the growth of ice crystals was retained.

Example 4:

Seeds of perennial ryegrass (Lolium perenne) were obtained from Barenbrug (UK) Ltd. These seeds were planted in 22.5 cm diameter pots with Levingston No. 2 compost and after fertilization, which usually occurs between 4 and 7 days after planting. The plants were grown in the greenhouse for a further 7 to 10 days until they reached a size of approximately 15 to 20 cm. The plants were then transferred to a cold room to acclimatize to cold. Acclimatization was carried out for 30 days at +4 ° C at 8-16 hours of light / dark.

The leaves acclimated to the cold were cut and homogenized in 50 mM Tris, 10 mM EDTA while adjusting the pH with concentrated HCl. Homogenization was carried out for 2 x 30 seconds in a Waring mixer with a buffer to leaf ratio of 2.5: 1 (w / w).

The homogenate was then placed in a boiling water bath for minutes and allowed to flow through layers of gauze. Collected • · · · · · · · · · ·

000 xg on rotor 8 x The supernatant was further centrifuged at 50 ml Sorvall centrifuge.

Recrystallisation properties of ice as described in Example 3.

The heat-stable extract (10 to 50 ml) was concentrated approximately ten times on an Amicon using a PM10 membrane. 1 ml aliquots were desalted on a Fast Desalting Column in a FPLC separation system (Pharmacia). The column was run at a flow rate of 1 ml / min in 50 mM Tris / Cl, 10 mM EDTA, pH 8.5. Fraction collection (1 ml volume) was started when the O.D. it started to increase at 280 nm. The active fractions R1 were combined to a volume of 3 ml.

Samples with R1 activity were loaded onto a Mono Q column (HR5 x 5), which was equilibrated with the same Tris pH 8.5 buffer. The output was collected as a single fraction and the column was immediately eluted with a linear gradient of 0 to 0.25 M NaCl over 25 minutes at a flow rate of 1 ml / min. It was found that all activity remained unbound and eluted into the pass-through fraction.

The pH of the through fraction was carefully adjusted to pH 9.5 using one microliter of 4M NaOH and applied to a Mono Q column re-equilibrated with Tris pH 9.5 buffer. The through fraction was collected as a single fraction and then the column was immediately eluted with a linear gradient of NaCl at a concentration of 0 to 0.25 M in 25 minutes. The flow rate is 1 ml / min. Fractions of 1 ml were collected and the R1 assay was performed. It was found that all R1 activity remained bound to the column and no activity was detected in the through fraction. The activity eluted as a single peak between 0.08 and 0.14 M NaCl.

The active fractions obtained from the Mono Q column were pooled and concentrated to a volume of 50 microliters on a PM10

Centricon and loaded onto a Sephadex 75 column in a Smart system (Pharmacia). The column was equilibrated with 50 mM buffer and tested as follows.

Tris / Cl pH 9.5 and the flow rate was 50 μΐ / min. After the 1 μΐ volume was drained from the column to remove the void space of the column, 50 ml fractions were collected. Active fractions were tested on SDS PAGE.

The samples were then tested on 10% Nu Page gels from Novex. Samples and gel buffer were prepared as described in the manufacturer's instructions, and the gels were stained using a Novex silver staining kit. The active fractions contain a single stained band of protein with an apparent molecular weight of 29,000.

Protein samples were also separated by SDS PAGE followed by electroblotting on a PVDF membrane based on the Matsudair method in 10 mM Caps buffer, pH 11.0 and 10% methanol. The membrane was wetted with methanol and then equilibrated with Caps buffer for 10 minutes. Blotting was performed for 16 hours at a constant voltage of 20 volts. After blotting, proteins were visualized by staining the membrane with 0.2% Coomassie Brilliant Blue in 50% methanol, 1% acetic acid for 1 minute. The membrane was then destained with 50% methanol until the protein bands were clearly visible. The membrane was washed with Milia Q defect, air dried and stored at -20 ° C.

The N-terminus of the 29,000 band was sequenced using conventional methods that provide the amino acid sequence.

A protein of 29,000 molecular weight, whose RI activity is considered to be boiling tolerant, was immobilized on a PVDF membrane after separation on SDS PAGE. The N-terminus of this protein was sequenced and the first 15 residues were successfully sequenced. A protein of 27,000 molecular weight isolated from Poa pratensis was also sequenced at its N-terminus (Table 1) and was shown to have the same sequence indicating that it was part of the same protein family. This assumes that there is a single class of AFPs responsible for the tolerance of RI activity to the boiling point of Gramineae.

Table 1

Alignment of the N-terminus RI sequences of an active 2900 molecular weight protein derived from Lolium perenne and a 27,000 molecular weight protein from Poa pretensis.

Lolium -DEQPNTISGXNNTVRXG

Poa -AETPNTISGTNN

Example 5:

Initial

1: 1-phenol increased approximately chambers Amicon extraction was performed with chloroform, followed by extraction with chloroform only. Phenol denatures proteins that expose it to hydrophobic amino acid residues that allow the protein to go into the organic phase. More hydrophilic nucleic acids and carbohydrates form part of the aqueous phase. Proteins with a significant degree of glycosylation form part of the phase interface. Chloroform acts as a protein separation agent more efficiently when two different organic solvents are used and the final chloroform extraction removes the remaining traces of phenol.

A thermally stable extract was prepared from the leaves of Lolium perenne plants and concentrated ten times using an ultrafiltration membrane separating 10,000 molecular weight molecules. The resulting concentrate (0.05 ml) was loaded onto a Superdex 75 PC 3 gel filtration column. , 2/30, which operates on the basis of the Smart Micro Separation System (Pharmacia). The column was eluted with 50 mM Tris / Cl pH 9.5 buffer at a flow rate of 0.05 ml / min and fractions of 0.05 ml were collected. The individual fractions were tested for ice recrystallisation inhibitory activity and the most active fractions were pooled together. These were then loaded onto a Mono Q PC 1.6 / 5 column, which was equilibrated with 50 mM Tris / Cl buffer pH 9.5, which also operates on a Smart system. The flow rate is 0.1 ml / min. After loading and washing, the column • 9 99 • ♦ 9 ·

9 9 ·

9 9 9

9 9 9

9 and eluted with a linear gradient of sodium chloride with a concentration gradient of 0 to 0.4 M and fractions of 0.1 ml were collected. Fractions were assayed and activity eluted as a single peak at an approximate sodium chloride concentration of 0.1 M.

The active fractions were vortexed with an equal volume of phenol: chloroform: isoamyl alcohol (1: 1 (24: 1)) for 1 minute. The aqueous (upper) and organic (lower) phases were collected separately without visible phase interface. The two phases were then precipitated by the addition of ten volumes of cold acetone and stored at -20 ° C for 16 hours. The resulting pellet was resuspended in 50 mM Tris / Cl buffer and the samples tested for RI activity and subjected to SDS PAGE.

The test of resuspended fractions shows that the RI activity is completely in the aqueous phase. The organic phase contained no RI activity even after the fraction had been denatured / renatured with 6M guanidine hydrochloride. This is an unexpected result because the protein should go into the organic phase or the glycoprotein should remain in the phase interface. However, SDS PAGE analysis showed that although most proteins are in the organic phase, there is a single band of protein with an apparent molecular weight of 29,000 in the aqueous active fraction, but no such band is visible in the organic phase. The band, unlike other proteins, stained with a different color and was very diffuse.

Phenol-like: chloroform extraction was carried out with a boiling-tolerant extract prepared from cold-acclimated plant leaves derived from meadow grass (Poa pratensis var Barcelona). The extract also preferentially divides the RI activity into the aqueous phase and a protein of 27,000 molecular weight appeared on SDS PAGE.

N-terminal sequencing of the proteins confirmed that they were identical to the AFPs described in Example 4.

• ·

99 9

Example 6:

The degenerate oligonucleotide primer (Lol 1) was designed and synthesized from the N-terminal sequence of the protein (ASP-GLU-GLN-PROASN-THR-ILE) as GAYGARCARCCIAAYACIAT, where Y = C + T, R = A + G and I is inosine.

The first strand cDNA was prepared from 5 µg of Lolium perenne RNA leaves, which were cold acclimated for 30 days using reverse transcriptase Superscript (Stratagene) and oligonucleotide primer OG1 (GAGAGAGGATCCTCGAG (T) 15) according to the manufacturer's instructions. 1% of the first strand cDNA was used as template together with primers Loll and OG1 in the PCR reaction. Reactions were then performed in a thermal cycler using Tag DNA polymerase (Gibco BRL) at 30 cycles (1 minute, at 94 ° C, 1 minute at 55 ° C, and 1 minute at 72 ° C) after initiating the denaturation step after for 2 minutes at 14 ° C.

A PCR product of approximately 600 bp was amplified and subsequently isolated from a 1% agarose gel and cloned into a pTAg (R and D systems) vector according to the manufacturer's instructions. The cloned PCR product was sequenced on a Perkin Elmer automated DNA sequencer (Applied Biosystems) using primers T3 and T7. This product contained an open reading frame that is essentially similar to the sequence:

GAT GAA CAG TCG GGG AGC

TCT GGG GAC AGT GGG AAT GGG ACA AAC AAC GAT AAT CAC AAT ACT CAC GTT GTA

CCG AAT AAA AAT AAC AAT GAC AAT

ACG ATT TCT GTT TCT GCT AGT GTG TCT ACC GTA ACC GTT ACA GAC

GGG AGC

GGG AAT GGG AGC

AAC AAT ACT GTC AGA GAC AAC ACC GTC ATA AAC AAC ACT GTC GTA AAC CAT GTC GTA TCA AAT AAC GTA TCC GGG ACC GTA TCC GGG GGG GTA TCT GGG AGC AAC ACA GAC GCT TAA

And the deduced amino acid sequence is substantially similar to the sequence:

_d _ _e _q_P_N-TISGSNNTVRSGSKNVLAGND-NT-Vt-sGDNNSVSGSNNTVVSGNDNT-VTGSNHV _v _ _S _ _G -TNHIVTDNNNNVSGNDNNVSG-SFHT-Vs-gghntvsgsnntvssn

The open reading frame encodes a pronein of about 12,000 molecular weight that is less than its apparent molecular weight on SDS PAGE (29,000). It was also observed that the coding sequence also contains six glycosylation sites (ASN-XSER / THR) and a substantial number of SER and THR residues, which can also be glycosylated. This evidence suggests that the natural protein isolated from the Lolium plant is highly glycosylated. If the protein is enzymatically deglycosylated, it still retains the ice recrystallization inhibitory activity, indicating that glycosylation is not essential for the protein to be active.

Example 7:

To demonstrate that the cDNA from the Lolium perenne plant described in Example 6 encodes AFP, the coding region was expressed. A strain of Pichia pastoris, a methylotrophic yeast, containing the Lolium AFP cDNA was created.

The Lolium cDNA was cloned into the pPIC9 vector with the factor a signal sequence to ensure cell secretion and glycosylation. All enzymes were obtained from Boehringer Mannheim and used according to the manufacturer's instructions. Construction of expression vectors, transformation and growth of Pichia yeasts were performed as described in Invitrogen Pichia Expression Kit (Version B) Manual.

The Lolium cDNA was cloned into the pPIC9 vector, as a PCR amplification fragment with compatible restriction ends suitable for ligation into the pPIC9 vector. This was accomplished in • ftftftft · ftftftft ····

2i · ** **:

ftft ·· ftftftft ftft ··· · · · use of Lolium cDNA as template and primers GTAT CT T CGAGAAAAGAGAT G AGC AGGA AGGA AG

TTAATTCGCGGCCGCCTGTAGGAAAAGTATGGTATATC that introduce an XhoI restriction site at the 5 'end of the amplified fragment and a NotI restriction site at its 3' end, thereby ensuring that the Lolium plant cDNA is in frame with the open reading frame secretion signal. Reactions were performed in a thermal cycler using Taq DNA polymerase and Pfu reading enzyme (Boehringer Mannheim) for 30 cycles (1 minute at 94 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C). All subsequent PCR reactions were performed under the same conditions but without Pfu enzyme. The XhoI / NotI fragment of the cDNA was cloned into the phoC9 vector digested with XhoI / NotI and competent E. coli cells (strain XL1-blue) were transformed with the vector. After transformation, cells were plated on LB plates with ampicillin at 50 μρ / πιΐ and grown at 37 ° C for 16 hours. Then, 20 ampicillin resistant transformants were isolated and analyzed for incorporation of Lolium cDNA by PCR using primers 5-0-1 and 3-0-1 which were synthesized as described in Invitrogen Kit Manual.

Plasmid DNA was isolated from the four positive transformants by miniprep and the DNA was linearized by digestion with SalI to transform it into Pichia cells, which were cultured and washed as described in Invitrogen. Linearized DNA was introduced by electroporation into Pichia cells using a GenePulser BioRad. After addition of ice-cooled 1 M sorbitol, cells were plated on MD plates and grown at 30 ° C for 24 hours until visible colonies were formed. Then, 16 transformants were isolated on fresh MM and MD plates and transformants were selected that were grown on MD plates and on MM plates where they grew more slowly. These transformants were then analyzed by PCR using a 5 ' and 3 ' primer. A0X1 and expression was tested in 8 positive transformants.

Colonies were inoculated into BMGY medium and grown at 30 ° C for 24 hours, then cells were centrifuged and transferred to BMMY medium to induce expression and then further incubated for 24 hours at 30 ° C. Methanol was added two more times to give a concentration of 0.5% after 24 and 48 hours to maintain the induction. The cells were then removed by centrifugation and an aliquot of the medium was adjusted to a sucrose concentration of 30% and ice inhibitory recrystallization inhibitory activity was tested. The medium for all transformants contained substantial R1 activity, while the medium produced in the same way from Pichia control cells that did not contain the incorporated Lolium cDNAs showed no activity.

The above example shows that the protein isolated from the Lolium perenne plant and the corresponding cDNA represents R1 active AFP.

Example 8:

The E. coli XL-1 microorganism was used in all cloning steps. The cultures were grown on 2YT culture medium where ampicillin or kanamycin was used as the selection agent. All oligonucleotide primers were synthesized on a Perkin Elmer 381A DNA synthesizer using a phosphoramidite group as recommended by the manufacturer. Culture plates were prepared by plating 2 ml Nicotiana bethiama cell suspension on Petri dishes containing 25 ml MS salts, B5 vitamins (1 mg / l nicotinic acid, 1 mg / l pyridoxine, 10 mg / l thiamine, 100 mg / l inisitol ) + 1 mg / l 2-4D, 0.2 mg / l BAP + 0.8% agar. The cells were swirled to cover the whole agar and then covered with a sterile filter paper disc.

Ftft ft ftft ftft ftft ftft ftft ftft ftft ftft ftftftft

Selection medium: MS base medium + 3% sucrose, 0.2 mg / l IAA, 1 mg / l BAP, 0.9% agar + 500 mg / l cefotaxime + 100 mg / l kanamycin.

The Loll sequences encoding AFP and PR1a and the apoplastic targeting sequence were amplified by PCR with 5 'and 3' oligonucleotide primers designed to create suitable restriction sites that allow them to ligate into the BamH1 restriction site, and the fusion product was then inserted into the plasmid vector pUC opened by restriction enzymes. Ncol and EcoRI (Messing 1983). Loll AFP was incorporated separately into three pUC vectors for different promoter sequences (granule-bound starch synthase, cauliflower ring virus, double 35S cauliflower mosaic virus). These were then further cloned into a plant transformation binary vector and introduced into a tobacco plant using Agrobacterium-mediated transformation.

The PCR reaction mixture contained 5 μΐ 10x Taq reaction buffer, 1 μΐ dNTP, 1 μΐ 5'and 3'primer (50 pmol / μΐ), 1 μΐ Loll templar sequence, 0.5 μΐ Taq polymerase and 0.05 μΐ Pfu enzyme . The mixture tubes were covered with mineral oil and amplification was carried out for 30 minutes for 1 minute at 94 ° C, 1 minute at 55 ° C and 1 minute at 72 ° C after the initial denaturation step, 2 minutes at 94 ° C .

The PCR amplification product was digested with appropriate restriction enzymes in recommended buffer (Boehringer Mannheim) for 16 hours at 37 ° C. The digested mixtures were separated on a 1% agarose gel, and relevant bands were excised and purified using a kit suitable for DNA isolation from Qiagen gel according to the manufacturer's instructions.

The insert and plasmid vector were ligated with T4 ligase using 10x concentrated buffer recommended by Stratagene for 16 hours at 16 ° C. Competent E. coli cells were transformed using a 2 μΐ ligation reaction, plated and allowed to grow at < RTI ID = 0.0 > and < / RTI > · Aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 37 ° C overnight Transformants were identified by PCR using specific 5 'and 5' primers. The plasmid DNA was then isolated as described in Part 1 of the Maniatis manual, and the correct alignment was confirmed by restriction analysis.

HindIII / EcoRI inserts were excised and ligated. as before into the general transfection plant vector (GPTV) digested with HindIII / EcoRI. Competent E. coli cells were transformed and transformants identified by PCR. The accuracy of the subsequently isolated plasmid DNA was confirmed by sequencing.

Three different GPTV vectors were transformed separately into Agrobacterium tumafaciens (strain LBA 4404) using the freeze / thaw method as described in Plant Molecular Biology manual PMAN A3 / 7.

The seeds of Nicotiana tabacum (Petit Havana variety) were surface-sterilized for 10 minutes with 10% sodium hypochlorite solution and after three washes with distilled water were transferred to Murashige and Skoog basic culture medium with 3% sucrose and 0.9% agar. Agrobacterium cells containing the appropriate plasmid were cultured overnight on Lennox (5 g / l NaCl, 10 g / l yeast extract, 10 g / l bacterotryptone and 15 g / l agar), then cells were centrifuged for 10 minutes at 3 000 xg and resuspended in MS master medium with 3% sucrose. Leaves of tobacco plant leaves cut with a sterile cork incisor were infected by incubation with a culture of Agrobacterium for 10 minutes. They were then allowed to dry on sterile filter paper and placed face down on tobacco plant cell culture plates.

The infected tobacco discs were incubated at 26 ° C for 2 days at 2000 lux light intensity and then transferred to the selection medium. There they were incubated at 3000 lux for 26 ° C and 16 hours, followed by an eight hour dark cycle. They were transferred to fresh medium every two weeks. When new shoots appeared at the edge of the disc, they were transferred to the MS base medium with 3% sucrose, 500 mg / l cefotaxime and 100 mg / ml. 1 kanamycin to take root.

After rooting and growing to a 3-4 leaf size, leaves from several lines of each construct plus several untransformed control plants were removed to perform the RI assay. The leaf tissue was crushed into an ependorfka and the liberated juice was obtained by centrifugation. The juice was adjusted with 30% sucrose (w / v) before the test was performed.

Several plant lines from each construct have been shown to have substantial amounts of ice recrystallisation inhibitory activity. Extracts from each control plant showed no activity. This clearly shows that Loll AFP has transformed into tobacco plant cells that do not have their own AFP. This protein is successfully expressed as an active protein and there is no need to acclimatize the plant to cold.

Plants that were selected for further cultivation were placed in pots with 50% perlite / 50% peat mixture and grown to inflorescence at 26 ° C at 16 hours light / 22 ° C at 8 hours of darkness. The flowers were covered to ensure self-pollination and the seeds were harvested and stored at +4 ° C.

Example 9:

To demonstrate that the AFPs of the invention do not require glycosylation for their activity, the coding region was expressed in a prokaryotic system. An E. coli strain was created that contained the Lolium AFP cDNA.

The Lolium cDNA was cloned into Novagen pET32 plasmids containing thioredoxin suitable for expression of the target gene as a fusion protein. All enzymes used are from Boehringer Mannheim and are used according to the manufacturer's recommendations. The expression plasmid construction, transformation and growth of E. coli cells were carried out as described in the Novagen pET system and in the Promega Applications guide.

The Lolium cDNA was cloned into plasmid pET-32, as a fragment generated by PCR amplification with compatible restriction ends suitable for ligation to the multiple cloning site of plasmid pET-32. The fragment was generated using the Lolium cDNA as a template and a 5'-oligonucleotide primer (TTTGCGCTCGAGTTAAGCGTCTGTCACGACTTTG) and a 3'-oligonucleotide primer (TTTGCGCCATGGATGAACAGCCGAATACGATTTC). In this way, the NcoI site was introduced at the 5 'end and XhoI at the 3' end of the amplified fragment. Reactions were performed in a thermal cycler using Taq DNA polymerase for 25 cycles (denaturation at 94 ° C, temperature hybridization at 35 ° C to 60 ° C, expression at 72 ° C). All subsequent PCR reactions were performed under the same conditions. The NcoI / XhoI PCR amplified fragment was then cloned into the plasmid pET-32 digested with NcoI / XhoI and transformed into competent cells of bacteria not expressing E. coli (strain XL1-Blue). After transformation, cells were plated on LB medium and ampicillin plates and cultured at 37 ° C for 16 hours. Ten ampicillin resistant transformants were isolated and the incorporation of Lolium cDNA was analyzed by PCR using the upstream and downstream pET primers from Novagen.

Using a small volume method, plasmid DNA was isolated from three positive transformants and digested with the restriction enzymes XhoI and NcoI for transformation into competent expression cells of E. coli BL21 (DE3), as described in the pET system manual. Transformed cells were plated on LB culture medium with ampicillin and incubated at 37 ° C for 24 hours along with a control prepared from untransformed E. coli cells

BL21 (DE3).

• Φ φ φ φ φ φ • • • • · · · · · · φ φ • • • • * * * *

Three positive transformed colonies were selected and subcultured in LB culture medium with ampicillin and incubated at 37 ° C for 1 hour to achieve an O.D. (λ = 600 nm) 0.6 and the lever was inoculated with a large volume of medium and stirred at 37 ° C. When O.D. reached 0.5, cells were induced with IPTG to express for 3 hours as described in the pET system manual.

The expressed proteins were isolated from the cytoplasm of E. coli cells as described in the pET system manual. Cells were harvested by centrifugation, resuspended in HEPES buffer (25 mM HEPES, 10 mM MgCl 2, 100 mM NaCl, 1 mM DTT, pH7.5) and sonicated for 10 seconds. The cytoplasmic protein fraction was centrifuged and the supernatant collected. An aliquot of the supernatant was treated with 30% sucrose and tested for ice recrystallization inhibitory activity as described in Example 3. The cytoplasmic protein extract shows substantial RI activity, whereas the cytplasmic protein extract produced in the same way from E. coli control cells bearing Lolium integrated cDNAs no activity.

The fusion protein was purified on a column based on metal affinity and the thioredoxin was removed by thrombin digestion. The identity of the cleaved AFP was confirmed by N-terminal sequencing and this cleaved protein was shown to exhibit substantial ice recrystallisation inhibitory activity.

This, as described above, demonstrates that the non-glycosylated anti-freeze protein of Lolium perenne expressed in E. coli retains recrystallisation inhibitory activity, whether in the form of a fusion product with thioredoxin or after thrombin digestion.

Claims (6)

Claims Uro 1. An antifreeze protein which is characterized in that it comprises at least from the group serine, β-eonin and asparagine and has at least 80% overlap with the following amino acid sequence: D-E-Q-P-N-T-I-S-G-S-N-N-T-V-R-S-G-S-K-N-V-L-A-S-N-D-NT-V-I-SG-D-N-N-S-VS-GS-N-N-T-V-VS-G-N-D-N-T-V-T-GS-N-H-V-VS-G-T-N-H-I-V-T-D-N-N-N-N-VS-G-N-D-N-N-V-SG-S-F-H-T-PS-G-G-H-N-T-VS-GS-N-N-T-VS-GS-N-H-V-VS-GS-N-K-V-V-T-D-A as well as modified versions of the protein, said arrangement 'matenalne affect' recrystallisation inhibition properties of ice. The anti-freeze protein of claim 1, which is obtainable from grass. The anti-freeze protein of claim 1, wherein the overlap is at least 95%. The anti-freeze protein of claim 1, wherein the overlap is 100%. The anti-freeze protein of claim 1, wherein the protein has been glycosylated. A nucleic acid sequence capable of encoding the antifreeze protein of claim 1.