CZ20002214A3 - DNA molecule encoding mutant prepro-neuropeptide Y, mutant signal peptide and their use - Google Patents

Abstract

A DNA sequence that contains a nucleotide sequence encoding prepro-neuropeptide Y (preproNPY), where the amino acid leucine at position 7 of the signal peptide that is part of said preproNPY, is replaced by proline. The mutated signal peptide, as such, or associated with any other preproNPY cleavage product, methods determining said DNA sequence or said protein in biological samples. Use in the diagnosis of predisposition human subjects to elevated serum cholesterol levels or LDL cholesterol and in treating a human subject with diagnosis of predisposition to elevated serum levels cholesterol or LDL cholesterol. Transgenic animals carrying either mutated or normal sequences.

Description

A DNA molecule encoding a mutant prepro-neuropeptide Y, a mutant signal peptide, and uses thereof

Technical field

The invention relates to a DNA sequence encoding a prepro-neuropeptide Y (preproNPY), a mutant signal peptide as such or associated with any other preproNPY cleavage product, as well as a method for determining said DNA sequence or said protein in biological samples. The invention also relates to a method for diagnosing a human being predisposed to elevated serum cholesterol or LDL cholesterol levels and a method of treating a human subject diagnosed with predisposition to elevated serum cholesterol or LDL cholesterol levels. Transgenic animals carrying either a mutated or a normal sequence are also within the scope of the invention.

BACKGROUND OF THE INVENTION

The publications and other material used herein to illustrate the prior art, and in particular cases providing additional details with respect to practice, are incorporated by reference.

Neuropeptide Y (NPY) is a 36 amino acid peptide hormone abundantly expressed in both the central and peripheral nervous systems. NPY plays a central role in the hypothalamic regulation of food intake and energy expenditure. Central administration of NPY significantly stimulates food intake, chronic infusions lead to obesity, hyperinsulinemia and insulin resistance in experimental animals. Relatively little is known about the role of NPY in human obesity or metabolic disorders.

Neuropeptide Y (NPY), a peptide, is a neurotransmitter that is abundantly expressed in both the central and peripheral nervous systems ^1,2 . NPYs have been shown to have some regulatory functions including ³ ' ⁴ ' ⁵ food intake, ⁶ ' ⁷ anxiolysis, ^8.91 ° pituitary hormone release, thermogenesis ^11, and insulin ¹² release.

In animals, NPY plays an important role in the hypothalamic regulation of energy balance.

NPY significantly stimulates food intake following central administration ¹³ . It also reduces energy expenditure by decreasing thermogenesis in brown adipose tissue and favors energy storage by increasing lipoprotein lipase activity in white adipose tissue ¹⁴ . Chronic intracerebroventricular infusions of NPY cause obesity and insulin resistance ¹³ .

Restricting food intake significantly increases the hypothalamic activity of NPY while re-feeding reduces activity. Hypothalamic NPY neurons are driven by peripheral feedback hormone signals such as insulin and leptin ^14,15,16 .

Hypothalamic expression of mRNA encoding preproNPY and NPY level is increased in obese fa / fa Zucker ¹⁷ , which have impaired leptin signaling due to a point mutation in the leptin receptor ¹⁸ gene. In humans, NPY concentrations in cerebrospinal fluid are increased in anorexic patients ¹⁹ , this is consistent with the predicted activation compensation of the NPY mechanism. Importantly, anorexic patients also show elevated cholesterol levels in the 20.2 µy literature, but there is no mention linking the NPY or NPY gene as such to cholesterol metabolism or serum cholesterol levels.

Links

1. Gray TS, Morley J.E., Neuropeptide Y: anatomical distribution and possible function in the mammalian nervous system. Nature 1986 Feb 3; 38 (5): 389-401

2. Lundberg JM, Terenius L, Hokfelt T, Martling CR, Tatemoto K, Mutt V, Polák J, Bloom S, Goldstein M. Neuropeptide Y (NPY) -like immunoreactivity in peripheral noradrenergic neurons and effects on sympathetic function. Acta Physiol Scand 1982 Dec; 116 (4) .- 477-480

3. Clark JT, Kaira PS and Kaira SP. Neuropeptide Y stimulates feeding but inhibits sexual behavior inrats. Endocrinology 1985 Dec; 17 (6): 2435-2442

4. Levine AS, Morley JE Neuropeptide Y; a potent inducer of consumer behavior in rats. Peptides 1984 Nov; 5 (6): 1025-1029

5. Stanley EG, Leibowitz SF Neuropeptide Y injected in the paraventricular hypothalamus; A powerful stimulant of feeding behavior. Proc Natl Acad Sci USA 1985 Jun; 82 (11): 39403943

6. Heilig M, McLeod S, Brot M, Hsinrichs SC, Menzaghi F, Gob Koob, Britton KT. Anxiolytic-like action of neuropeptide Y: mediation by Yl receptors in amygdala, and dissociation from food intake effects. Neuropsychopharmacology 1993 Jun; 8 (4): 357-363

7. Wahlestedt C, EM Pich, GF Koob, Yee F, Heilig M. Modulation of anxiety and neuropeptide Y-Y1 receptors by ant is ense oligodeoxynucleotides. Science 1993 Jan 22; 259 (5094): 528-531

8. Wahlestedt C, Skagerberg G / Ekman R, Heiiig M, Sundler F, Hakanson R. Neuropeptide Y (NPY) in the area of the hypothalamic paraventricular nucleus activates the pituitaryadrenocorticai axis in the rat. Brain Res 1987 Aug 4; 417 (1): 33-38

9. McDonald JK, Lumpkin MD, Samson WK, McCann SM. Neuropeptide Y affects the secretion of luteinizing hormone and growth hormone in ovariectomized rats. Proc Natl Acad Sci U S A 1985 Jan; 82 (2): 561-564

10. Saha A, SP Kaira, Crowley WR, SP Kaira. Testosterone raises neuropeptide-Y concentration in selected hypothalamic sites and in vitro release from the medial basal hypothalamus of castrated male rats. Endocrinology 1989 Jan; 124 (1): 410-414

11. Menendez JA, McGregor IS, Healey PA, Atrens DM, Leibowitz SF. Metabolic effects of neuropeptide Y injections into the paraventriculamucleus of the hypothaiamus. Brain Res 1990 May 14; 516 (1): 8-14

12. Moltz JH, McDonald JK. Neuropeptide Y: direct and indirect action on insulin secretion in the rat. Peptides 1985 Nov; 6 (6): 1155-1159

13. ZrejevskiN, Cusin I, Vettor R, Rohner-Jeanrenaud F., Jeanrenaud B. Chronic intracerebroventricular NPY admission to normal rats mimics hormonal and metabolic changes of obesity. Endocrinology 133: 1753-1758

14. Saha A, Sninsky CA, Kaira PS, Kaira SP. Neuropeptide-Y concentration in microdissected hypothalamic regions and in vitro release from the medial basal hypothalamus-preoptic area of streptozotocin-diabetic rats with and without insulin substitution therapy. Endocrinology 1990 Jan; 126 (1): 192-198

15. Stephens TW, Basinski M, Bristow PK, Bue-Valleskey JM, SG Burgett, Craft L, Hale J, Hoffmann J, Hsiung HM, Kriauciunas A, et al. The role of neuropeptide Y in the antiobesity action of the obese geneproduct. Nature 1995 Oct 12; 377 (6549): 530-532

16. Schwartz MW, DG Baskin, Bukowski TR, Kuijper JL, Foster D, Lasser G, Prunkard DE, Porte D Jr., Woods SC, Seeley RJ, Wei-gle DS. Specificity of Leptin Action on Elevated Blood Glucose Levels and Hypothalamic Neuropeptide Y gene expression in ob / ob mice. Diabetes 1996 Apr; 45 (4): 531-535

17. Pesonen U, Huupponen R, Rouru J, Koulu M. Hypothalamic neuropeptide expression after food restriction in Zucker rats: evidence of neuropeptide Y gene activation. Brain Res Mol Brain Res 1992 Dec; 16 (3-4): 255-260

18. Chua SC Jr., White DW, Wu-Peng XS, Liu SM, Okada N, Kershaw EE, Chung WK, Power-Kehoe L, Chua M, Tartaglia LA, Leibel RL. Phenotype of fatty due to Gln269Pro mutation in the leptin receptor (Lepr). Diabetes 1996 Aug; 45 (8): 1141-1143

19. Kaye WH, Berrettini W, Gwirtsman H, George D.T.1990 Altered cerebrospinal fluid neuropeptide Y and peptide YY immunoreactivity in anorexia and bulimia nervosa. ArchGen. Psychiatry 47: 548-556.

20. Mordasini R, Klose G, Greten H. Secondary type II hyperlipoproteinemia in patients with anorexia nervosa. Metabolism 1978 Jan; 27 (1): 71-79

21. Sanchez-Muniz FJ, Marcos A, Varela P. Serum lipids and apolipoprotein B values, blood pressure and pulse rate in anorexia nervosa. Eur J Clin Nutr 1991 Jan; 45 (1): 33-36

4 4 • • ·

4 44 • 4

22. Uusitupa MI, Karhunen L, Rissanen A, Franssila-Kallunki A, Niskanen L, Kervinen K, Kesaniemi YA. Apolipoprotein E phenotype modifies metabolic and hemodynaniicabnormal titles related to central obesity in women. Am J Clin Nutr 1996 Aug; 64 (2): 131-136

23. Sipiiainen R, Uusitupa M, MeiKKinen b, Kissanen A, Laakso M. Polymorphism of the (3-adrenergic receptor gene affects basal metabolic rate in obese Finns. 1997. Diabetes 46: 77-80

24. Uusitupa M, Siitonen 0, Aro A, Pyorala K. Prevalence of coronary heart disease, left ventricular failure and hypertension in middle-aged, newly diagnosed type 2 (non-insufficient) diabetic subjects. Diabetologia 1995 Jan; 28 (1); 22-27

25. Minth CD, Andrews PC, Dixon JE. Characterization, sequence, and expression of the cloned human neuropeptide Y gene. J Biol Chem 1986 Sep 15,261 (26): 11974-11979

26. Roschlau P, Bemt E and Gruber W. Enzymatische Bestimniung des Gesamtchoiester, des im Serum. From Chern Biochem 1974,12: 403-407

27. Wahlenfield AW. Triglycerides. Determination after enzymatic hydrolysis. In; Bergmeyer HU (ed) Methods in enzymatic analysis. Academie Press. New York. pp 1831-1835

28. Uusitupa M, Siitonen 0, Penttia I, Aro A, Pyorala K. Proteinuria in newly diagnosed type II diabetic patients. Diabetes Care 1987 Mar; 10 (2): 191-194

29. Karhunen L, Franssila-Kallunki A, Rissanen A, Kervinen K, Kesaniemi YA and Uusitupa M. Determinants of resting energy expenditure in non-diabetic Caucasian women. Int J Obes Relat Metab Disord 1997 Mar; 21 (3): 197-202

30. Ehnholm C, Lukka M, Kuusi T, Nikkila E, Utermann G. Apolipoprotein E polymorphism in the Finnish population: gene frequencies and relation to lipoprotein concentrations. J Lipid Res 1985 Mar; 27 (3): 227-235

31. Lundberg JM, Terenius L, Hokfelt T, Goldstein M. High levels of neuropeptide Y in peripheral noradrenergic neurons in various mammals including man. Neurosci Lett 1983 Dec 2; 42 (2): 167-172

32. Wang YN, McDonald JK, Wyatt RJ, Immunocytochemical localization of neuropeptide Y-like immunoreactivity in adrenergic and non-adrenergic neurons of the rat gastrointestinal tract. Peptides 1987 Jan; 8 (1): 145-151

33. Roche C, Boutin P, Dina C, Gyapay G, Basdevant A, Hager J, Guy-Grand B,

Clement K, Froguel P. Genetic studies of neuropeptide Y and neuropeptide Y receptors Y1 and Y5 regions in morbid obesity. Diabetologia 1997 Jun; 40 (6): 671-675.

• • •

SUMMARY OF THE INVENTION

The present invention provides a DNA sequence comprising a nucleotide sequence encoding a prepro-neuropeptide Y (preproNPY), wherein the amino acid leucine at position 7 of the signal portion of the peptide that is part of said preproNPY is replaced by proline.

Another aspect of the invention is a method of screening an individual to determine if the individual is carrying a mutant NPY gene, the method comprising the step of processing a biological sample of the subject of interest and performing an assay to detect the presence of i) normal or ii) mutated NPY gene in the biological sample .

Yet another aspect of the invention is a signal peptide which comprises at position 7 the replacement of the amino acid leucine with the amino acid proline, and said signal peptide is associated with any other preproNPY cleavage product.

Another aspect of the invention are antibodies capable of recognizing said signal peptide or said signal peptide associated with any other preproNPY cleavage product, and immunodetection methods for determining said peptide in a biological sample.

Another aspect of the invention is a method of diagnosing a predisposition for elevated serum cholesterol or LDL cholesterol levels in a human. The method of the invention comprises determining whether a subject has a polymorphism in the signal portion of said preproNPY peptide, whether said polymorphism represents a substitution of leucine for proline at position 7 of the signal portion of the peptide, and whether said polymorphism is decisive

Another aspect of the invention is a method of treating a human subject diagnosed with elevated serum cholesterol or LDL cholesterol and preventing elevated serum cholesterol or LDL cholesterol in the subject; the method comprising administering to a human subject an effective amount of a substance that compensates for the effect of the mutated NPY gene.

Another aspect of the invention is a method of treating a human subject diagnosed with elevated serum cholesterol or LDL cholesterol and preventing elevated serum cholesterol or LDL cholesterol in the subject; The method of the invention comprises exposing the subject to specific gene therapy aimed at repairing the mutated NPY sequence.

The invention further relates to transgenic animals carrying a human DNA sequence comprising a nucleotide sequence encoding a prepro-neuropeptide Y (preproNPY), wherein the leucine at position 7 of the signal portion of said preproNPY peptide is i) either replaced with proline or ii) unchanged.

* 4

I fl • 4

The invention also relates to transgenic animals carrying a DNA sequence comprising a nucleotide sequence encoding an otherwise normal murine NPY sequence or a portion thereof encoding a final murine NPY peptide, but wherein the nucleotide sequence encoding the murine signal peptide is replaced by a human signal peptide sequence that encodes either normal , or a mutated human signal peptide.

In another aspect, the invention also relates to a cell line expressing a mutated human NPY gene or a portion thereof.

The invention is part of the inventor's program of research into genetic background, energy metabolism, and obesity. Identification of a relatively common polymorphism in the signal peptide region of the NPY gene is presented. Surprisingly, it has been discovered that the Leu7 / Pro7 polymorphism correlates with a significant increase in both total and LDLcholesterol levels in normal and obese, non-diabetic individuals, although it has not been associated with energy metabolism or obesity. The DNA sequence of both the mutated signal peptide and the given peptide associated with any other preproNPY cleavage product can be used to screen individuals to determine if the individual is carrying a mutated NPY gene.

The assay can be performed not only by DNA analysis by generally known methods, which include direct DNA sequencing of the normal and mutated NPY gene, allele-specific amplification using PCR (polymerase chain reaction) allowing detection of both normal and mutated NPY sequences, as well as indirect detection of normal or a mutated NPY gene using a variety of molecular biological methods, including, for example, single stranded conformational polymorphism (SSCP) PCR or denaturing gel gradient electrophoresis (DGGE). The determination of the normal or mutated NPY gene can also be performed using the restriction fragment length polymorphism (RFLP) method, which is particularly suitable for genotyping multiple samples.

The assay can also be performed at the level of RNA detection by analyzing the expressed RNA at the tissue level using various methods. Allele-specific probes for hybridization can be designed, hybridization can be performed using, for example, Northern blotting, RNAse protection assay, or in situ hybridization methods. RNA derived from the normal or mutated NPY gene can also be analyzed by first converting the tissue RNA into cDNA and then amplifying the cDNA using an allele-specific PCR method.

• φ

ΦΦΦΦ · · φ • • • · · · • • • • • • φ φ

In addition, the assay may be performed as an immunoassay, wherein the sample is in contact with an antibody capable of interacting with a signal peptide or a given peptide associated with any preproNPY cleavage product.

Antibodies may be specific for the normal or mutated preproNPY or more specific for the normal or mutated portion of the NPY signal peptide. Antibodies can be obtained in vivo from experimental animals in the form of polyclonal antibodies or in vitro using cell lines as monoclonal antibodies.

A human subject diagnosed with a predisposition to elevated serum cholesterol or LDL-cholesterol may be treated preventively against elevated serum cholesterol or LDL-cholesterol by administering an effective amount of a compensating agent relative to the mutated NPY gene of the subject. This can be accomplished by specific gene therapy seeking to repair a mutated NPY gene sequence or by undergoing pharmacotherapy to affect the synthesis, release or metabolism of endogenous NPY, or to interact with specific actions with NPY sites of action to modulate the effect of NPY using specific NPY receptor proteins. Five different NPY receptor subtypes (Y1-Y5 receptors) were cloned and characterized, and molecules with therapeutic effect that specifically interact with these NPY receptors were synthesized. The described pharmacotherapy is not limited to the mentioned receptors or mechanism, but also applies to other NPY receptors and related mechanisms discovered.

The effect of the mutated NPY sequence on NPY gene function can be studied in transgenic animals. Transgenic animals can be obtained using a targeted homologous recombination method. Both the normal and mutated human signal peptide sequence of NPY (or any DNA sequence comprising the nucleotide sequence encoding the prepro-neuropeptide Y (preproNPY) or a portion thereof encoding the amino acid sequence of the final mouse or human NPY peptide, where either (ii) the amino acid leucine at position 7 of the signal peptide portion of said preproNPY is replaced by proline; or (ii) the amino acid leucine at position 7 of the signal peptide portion of said preproNPY is unchanged) to replace the endogenous signal peptide sequence. Under these conditions, the endogenous NPY gene functions normally normally, but the synthesis of preproNPY is regulated by either the normal or mutated human NPY signal peptide gene sequence. This transgenic model can be used to study the physiological importance of a mutated NPY gene in a very specific way. An ideal preclinical model for research and screening of new drug compounds designed to modify the effect of the mutated NPY gene will also be prepared.

• ·

The invention is described in more detail in the following examples.

DETAILED DESCRIPTION OF THE INVENTION

Methods

The coding regions of the NPY gene were screened for possible sequence variants in 90 obese individuals of Finnish nationality by single-stranded conformation polymorphism (SSCP).

Allelic associations of the identified Leu7-Pro7 polymorphism with obesity-related and metabolic parameters were analyzed in two independent population studies following the genotyping of 141 obese, non-diabetic objects (study 1) and 64 normal weight objects (study 2) by restriction lenght polymorphism (RFLP) .

Subjects subject to SSCP screening for NPY gene

DNA samples of ninety randomly selected obese Fins from population study 1 were used to screen exon sequence variants in the NPY gene.

Subjects subject to association and genotypic frequency analysis

Study 1

In an association study of sequence variants of the NPY gene with phenotypic parameters, 141 (29 male and 112 female) obese subjects from the weight reduction study (Uusitupa et al., 1996) with normal liver, kidney and thyroid functions were included. None of these individuals had diabetes, reported excessive intake of alcohol or drugs known to affect basal metabolic rate (BMR), cholesterol metabolism (except for one individual who used beta blockers), or glucose. Their age was 43 ± 8 years (mean ± SD) and mean body mass index 34.7 in the interval 28 - 43 kg / m ² . All phenotypic assays were performed in the morning after 12-hour starvation by standard methods. The assays included weight, BMI, fat percentage, respiratory coefficient (RQ), BMR, waist-hip circumference (WHR), fasting serum levels of leptin, glucose, insulin, cholesterol, and triglycerides. The main characteristics of Study 1 subjects are shown in Table 1. Analytical methods were previously described ^22.23 . A diet calendar was available for all obese individuals with detailed data on daily intake of some nutritional substances including carbohydrates, proteins, fat and cholesterol.

Study 2

The original randomized control population aged 45-64 was selected from 1979 to 1981 from a population registered in the Kuopio district of Finland using random number tables included in the distribution data of the population living in agricultural and industrial areas. Of the 183 initially contacted subjects, 144 subjects were obtained for the study. Subjects of normal weight (BMI <27 kg / m ² ) were selected from control subjects in this study (Study 2) and were followed for 10 years. A total of 64 (26 men and 38 women) normoglycemic, non-diabetic healthy Finns were tested. Control subjects were tested five and ten years after the first test in 1985-1986 and 1991-1992, respectively. The main characteristics of subjects in population study 2 at these time intervals are shown in Table 2. The protocol was approved by the Ethics Commitees of Kuopio and Helsinki University. Population for study 2 was described in detail earlier ²⁴ .

PCR-SSCP analysis

The human NPY gene is divided into four exons, the first exon contains the untranslated region, the second encodes the signal peptide (amino acids 1 to 28) and the final NPY (amino acids 29 to 63), the third exon encodes amino acid residues 64 to 90 and the fourth exon contains the carboxyl terminal heptapeptide for NPY and untranslated 3'-end (Fig. 1a) ²⁵ . The PCR primer pairs and the corresponding condensation temperatures to amplify the four exon stretches of the NPY gene were as follows: pair 1: 5 'TTGGGGTGTGGGTGGCTC (SEQ ID NO: 7) and 5' CCTAGACAGACGGGTCGTAGCA (SEQ ID NO: 8), Ta = 65 ° C, pair 2: 5 '

CCCGTCCGTTGAGCC TTCTG (SEQ ID NO: 9) and 5 'CGGTCCCGCGGTCCC (SEQ ID NO: 10), Ta = 67 ° C, 3: 5' AAAAGACTTTTTTT TTTCCAG (SEQ ID NO: 11) and 5 'AATGTCCCATCACAAG (SEQ ID NO: 12), Ta = 51 ° C, pair 4: 5 'CCTTACAT GCTTTGCTTCTTA (SEQ ID NO: 13) and 5' GATTTTTCATTGAGGAGGAT (SEQ ID NO: 14), Ta = 51 ° C. The PCR reaction mixture (total volume 5μ1) contained 100 ng of genomic DNA (isolated from either whole blood or from stable cell lymphoblast lines), 1.0 mM dNTPs, 30 nM ³³ P-dCTP, 2.5 mM each primer, 0, 25 U Taq polymerase (Perkin Elmer Cetus, Norwalk, CT). PCR reaction conditions were optimized using the PCR Optimizer ^(tm) (Invitrogen, San Diego, CA). Samples were amplified using the Gene Amp PCR System 9600 (Perkin Elmer Cetus, Norwalk, CT), 30 cycles consisting of 30 sec at 94 ° C, 30 sec at optimal temperature for template-condensation (Ta) and 30 sec at temperature 72 ° C. Finally, a step of 7 minutes at 72 ° C was included. The amplified samples were mixed with SSCP buffer containing 95% formamide, 10 mM NaOH, 0.05% am · · · · · · · φ φ φ φ φ φ φ φ φ φ φ φ φ xylene cyanide and 0.05% bromophenol blue (total volume 25μ1). Samples were denatured at 95 ° C for 5 minutes and left on ice for 5 minutes prior to gel loading. Three µl of these treated samples were loaded onto MDE ™ gel (FMC, BioProduct, Rockland, MA). SSCP gel electrophoresis was performed in two different ways: 6% MDE gel at 4 ° C and 3% MDE gel with 10% glycerol at room temperature. Electrophoresis was carried out at constant current and power of 5W for 20 hours. The gel was dried and evaluated by autoradiography by exposure to Kodak BIO MAX MR film for 24 hours at room temperature. Sequencing

Abnormally migrating fractions in SSCP were sequenced using a Thermo Cycia Sequenase (tm) kit (Amersham Life Science, Inc. Cleveland, OH).

Genotyping

The primers used for genotyping the objects in Studies 1 and 2 were those used for PCR amplification of exon 2. In exon 2, substitution T (1128) for C (1128) creates a Bsi Ε I restriction site (New England Biolabs, Inc.). , MA). The grafts were analyzed by 2% agarose gel electrophoresis.

Determination of fasting serum and anthropometric parameters

Blood glucose was determined by the glucose oxidase method (Glox: Kabi Ab,

Stockholm, Sweden). Serum insulin was determined by radioimmunodetection (antibody M 8309: Novo Industries, Copenhagen, Denmark). The coefficient of variation was 5.4%, the sensitivity was 2 mU per liter. Serum and lipoprotein lipids were determined in serum after 12 hours of fasting. Lipoproteins were separated by ultracentrifugation at a density of 1006 to remove VLDL, followed by precipitation of the infranatant fraction with dextran sulfate and magnesium chloride. Enzyme reactions were used to determine cholesterol and triglycerides in full serum, in the upper layer after ultracentrifugation of VLDL and supernatant after LDL precipitation. LDL was calculated as the difference between total serum content and the sum of VLDL and HDL. The variation in the total cholesterol, HDL cholesterol and triglyceride assay was 1.3%, 0.95% and 3.1%, respectively, the variation between the assays was 3.3%, 1.9% and 5.2%, respectively. Standing height was measured without shoes to within 0.5 cm. Weight was measured by electric scales (Model 707: Seca. Hamburg, Germany), individuals were barefoot and dressed in underwear. BMI (body mass index) was calculated by weight (kg) / height squared (m ² ). The waist circumference for calculating the waist-to-hip ratio was measured at a level midway between the lower lateral edge of the rib arch and the upper edge.

0 0 0 0 • 0 0 0

0 0 <0 0

00 0000 0000 «··· ·· 00 ·· ·· ·· hip bones. The circumference of the hips was measured at the level of the greater trochanter through the symiysis of the pubic bones. Resting energy expenditure was measured by indirect calorimetry (Deltatrac, TM Datex,

Helsinki, Finland) using a computerized analysis of the gas flow through the gas tent for gas analysis, calibration was performed prior to each measurement with a gas mixture of precise composition. The method has been previously described in detail.

Statistical analysis

Gene frequency distribution was tested for Hardy-Weinberg equilibrium by X ² -analysis. All association analysis calculations were performed using SPSS / WIN version 6.0 (SPSS, Chicago, IL). Statistical differences in phenotypic parameters between groups were evaluated using Student's test. In study 1, multiple comparisons were made between genotype and phenotypic parameters without formal correction for multiple testing. Study 2 was based on the hypothesis that polymorphism associates with serum cholesterol levels, therefore no more static comparisons were made than fasting serum levels of total, LDL, HDL and VLDL cholesterol.

Conclusion

SSCP screening results in the detection of the substitution of thymidine (1128) for cytosine, resulting in the replacement of the amino acid leucine with proline at position 7 of the amino acid chain of the hydrophobic portion of the preproNPY signal peptide. The allele frequency of the Leu7 pro Pro polymorphism was 0.08 for both the normal and obese groups. Obese subjects with the Pro7 allele had significantly higher serum levels taken from fasting, LDL and VLDL cholesterol and lower HDL cholesterol levels compared to corresponding values in subjects with the Leu // Leu7 genotype. Corresponding values were 6.2 ± 1.1 versus 5.3 ± 0.9 mmol / L (P = 0.0001), 4.2 ± 1.0 versus 3.5 ±

0.8 mmol / l (P = 0.0003), 0.9 ± 0.6 vs 0.7 ± 0.5 mmoVl (P = 0.042) and 1.1 ± 0.3 vs 1.2 ± 0, 3 mmol / L (P = 0.041). These differences cannot be explained by factors that could cause a mistake such as age, sex, smoking, parallel treatment or apoE phenotype. Leu7 za Pro polymorphism in NPY gene does not associate with any obesity related parameter including weight, BMI, waist / hip ratio, fat levels, basal metabolic rate or other metabolic parameters such as fasting serum glucose, insulin, leptin or triglycerides in obese individuals. The significance of the association of the pro7 allele with higher serum total cholesterol (p = 0.035) and LDL-cholesterol (p = 0.036) was confirmed in subjects of normal weight in study 2.

SSCP screening of exon stretches of NPY gene ·

4 4 4

4 4 «

• 4 4 4

44

4 «· ·

4444 44

4 4 ·

44

44

4 4 · · · · · · ·

4 4 4

44

Individual exons contained in the entire coding region of the NPY gene were screened for mutation by SSCP. The polymorphisms identified were 1) T (1128) for C (1128), 2) A (1258) for G (1258), 3) T (5671) for C (5671), and 4) T (8233) for A (8233) ). Numbering is governed by polymorphisms work Minth et al., 1986, which were presented polymorphisms 2 and 3 ^{on the 25th}

Genotypic frequencies

Allelic frequencies showed Hardy-Weinberg equilibrium. The allele frequency of T (1128) to C (1128) polymorphisms found was 0.078 for obese (n = 141) and 0.077 for Finns from the normal weight control group (n = 64). There was no further difference in the allelic distribution between the two populations.

Association analyzes

Study 1:

Homozygosity with the Pro7 / Pro7 genotype was found in only one case that was included in the heterozygous group. Association analysis between individuals with the Pro7 / Leu7 genotype (with the inclusion of the Pro7 / Pro7 genotype) and the wild-type Leu7 / Leu7 genotype gave highly significant differences in total fasted serum cholesterol levels of 6.2 ± 1.1 versus 5.3 ± 0, 9 mmol / l (P = 0.0001), LDL cholesterol 4.2 ± 1.0 vs. 3.5 ± 0.8 mmol / l (P = 0.0003), VLDL cholesterol 0.9 ± 0, 6 versus 0.7 ± 0.5 mmol / L (P = 0.042) and HDL cholesterol 1.1 ± 0.3 versus 1.2 ± 0.3 mmol / L (P = 0.041) (Figure 2). The differences remained highly significant when the analysis was performed separately in obese men (total cholesterol, LDL cholesterol, VLDL cholesterol and HDL cholesterol) and in obese women (total cholesterol and LDL cholesterol). The intake of total fat, saturated fatty acids, unsaturated fatty acids, or dietary cholesterol did not differ between the two genotypic groups. The degree of obesity did not explain these findings. There was no difference in the distribution of the apolipoprotein E phenotype parameter between the different groups (data not shown).

Study 2:

One individual was a Pro7 / Pro7 homozygote and was classified as a heterozygote. In normal weight subjects, fasting serum total and LDL cholesterol levels were significantly higher in subjects containing the Pro7 allele than subjects with the Leu7 / Leu7 genotype in all three measurements. Total serum cholesterol in the fasted serum was 7.4 ± 0.6 vs. 6.7 ± 0.9 mmol / L (P = 0.035), and LDL cholesterol 5.2 ± 0.6 vs. 4.5 ± 0, 9 mmol / L (P = 0.036). There were no statistically significant differences in VLDL cholesterol 0.8 + 0.5 versus 0.7 ± 0.4 mmol / L or HDL cholesterol 1.3 + 0.4 versus 1.5 ± 0.3 mmol / L (Fig. 3).

ΒΒ ΒΒ

Β · Β Β

Β Β Β Β

Β · Β Β

Β Β Β Β

BB ΒΒ ·· ·· • »BB

Β · · · Β Β Β Β

The study presents the first facts to show that the Leu7 Pro polymorphism of the NPY gene correlates with the levels of clinically unfavorable serum cholesterol and LDL cholesterol in both normal weight and obese individuals. This could suggest that NPY has a previously unknown role in regulating cholesterol metabolism in humans and is one of the more potent genetic factors identified as affecting serum cholesterol levels.

The main observation of the study is that the identified Leu7-Pro polymorphism in the signal portion of the NPY gene peptide is significantly associated with elevated total and LDL cholesterol levels in the Finns. In addition, VLDL cholesterol levels were significantly increased in obese subjects and HDL cholesterol levels were reduced in subjects with the Pro7 allele. This main fact was first found in obese non-diabetic individuals and was subsequently repeated in individuals of normal weight. The allele frequency of these sequence variants was about 8% in the Finnish population. The observed association cannot be explained by other factors known to affect cholesterol metabolism, such as age, obesity, gender, smoking, medication, or the apoE phenotype. It is also highly unlikely that the association could be caused by a stratification error in the individuals studied since all individuals were of Finnish origin with a similar genetic background. Leu7's Pro Pro polymorphism in the NPY gene can be considered an important new genetic trait for high levels of total and LDL cholesterol.

The Leu7 behind Pro polymorphism is located in the signal portion of preproNPY. The signal peptide, which is cleaved from the final NPY, plays an important role in guiding the folding and packaging of the peptide in the endoplasmic reticulum during synthesis and transport to secretory vesicles. Usually, the signal peptide consists of a hydrophobic motif, as in the case of preproNPY. Leucine is known as the α-helix-forming amino acid, while proline usually introduces breaks and folds into the α-helical portion of the peptide backbone. Although we do not have biochemical data on how the Leu7 for Pro polymorphism modifies preproNPY synthesis, it can be assumed that the intracellular process of preproNPY synthesis is impaired, which may subsequently lead to altered NPY activity. Further experiments are needed to confirm this mechanism in detail.

Serum total and LDL cholesterol levels were, on average, 0.9 and 0.7 mmoFl, respectively, higher in obese and non-obese Finnish subjects with the Pro7 allele compared to individuals with the Leu7 / leu7 genotype. In these subjects, a trend towards higher VLDL cholesterol levels and lower HDL cholesterol levels was found. The effect of this genetic abnormality on o and serum cholesterol levels is greater than that of the apo E allele and is of the same size (14%) that could best be obtained with low cholesterol diet therapy in Finnish individuals.

Φ · · · · · φ φ »• φ φ φ φ φ φ φ φ · · · · · · · · φ φ φ φ φ φ φ φ φ

What is the reason for increasing serum total and LDL cholesterol in these individuals, which represent 8% of the Finnish population? Due to the fact that the gastrointestinal tract is heavily innervated by nerves containing NPY ^{31, 32,} it can be speculated that NPY may be involved in cholesterol absorption in the ingested diet and individuals with the Pro7 allele may have increased cholesterol absorption. This, in turn, may result in regulation of decreasing B / E (LDL) receptor activity in the liver and an increase in the level of LDL and its precursors in serum, such as VLDL. Since there are no abnormalities in the amount of VLDL cholesterol or triglycerides in the affected individuals, we assume that the primary defect is not in the synthesis or catabolism of VLDL. Interestingly, central NPY increases apolipoprotein lipase mRNA expression and increases enzyme activity in white adipose tissue favoring lipid deposition. The role of the lipoprotein lipase enzyme activity cannot be excluded. The most acceptable possible explanation for increasing serum cholesterol is to reduce the amount or activity of LDL receptors, which are known to regulate serum LDL concentration and, to a lesser extent, IDL and VLDL particle levels. Obesity does not appear to be affected by the Leu7-Pro polymorphism at the serum lipid level, since the differences between mutated and normal gene species were similar in normal weight and obese individuals. It should be noted that there is no experimental confirmation of any of these mechanisms discussed above that may in particular associate a genetic abnormality with cholesterol metabolism.

As mentioned earlier, ApoE phenotype 4 is also known to be associated with higher serum cholesterol levels, as shown previously in our study subjects ²² . ApoE phenotype 4 was evenly distributed in both NPY groups and did not affect the association of polymorphisms in the signal portion of the NPY peptide with differences in serum cholesterol levels.

From this study, it appears that the identified Leu7 pro pro polymorphism in the NPY gene is not associated with any obesity parameter such as weight, BMI, WHR, BMR or RQ. Accordingly, the allele frequency of the mutated allele was similar in normal weight controls and obese non-diabetic subjects. This conclusion is also in line with the most recent study in the French population, in which the side features of the NPY gene were not related to any feature of obesity.

The study presents the first facts to show that the Leu7 Pro polymorphism of the NPY gene correlates with the levels of clinically unfavorable serum lipoprotein cholesterol in both normal weight and non-diabetic obese individuals. This might indicate that NPY has a previously unknown role in regulating cholesterol metabolism in humans and is one of the more potent genetic factors identified as affecting levels of blood. • 9 9 * 99 99

9 9 9

9 9 9

9 9 9 9 9

9999 99 99 99

9 9 9

99 serum cholesterol. The NPY mechanism could offer a potential target for the action of newly developed drugs.

It is contemplated that the methods of the invention may be included in many embodiments, only some of which are described herein. It will be apparent to those skilled in the art that other possible embodiments do not depart from the scope of the invention. The described embodiments are illustrative and should not be construed as exhaustive.

Table 1: Demographic and clinical characteristics of 141 obese individuals according to the presence or absence of Leu (7) to the Pro (7) mutation in the NPY gene. Values are mean ± standard deviation (SD)

characteristics without mutation with mutation P value Age, years 40.7 ± 6.2 41.2 ± 8.1 unspecified Gender, woman / man 95/25 17/4 unspecified BMI, kg / m ² 34.7 ± 3.8 35.7 ± 3.3 unspecified WHR 0.93 ± 0.08 0.94 ± 0.08 unspecified BMR, sludge / d * 1635 ± 142 1639 ± 131 unspecified fs-insulin, pmol / L 94.8 ± 45.3 97.7 ± 53.5 unspecified fs-glucose, mmol / l 5.5 ± 0.7 5.5 ± 0.8 unspecified fs-leptin, ng / l ** 32.9 ± 12.8 26.3 ± 4.9 unspecified Systolic blood pressure, mmHg 130.7 ± 14.8 128.6 ± 13.6 unspecified Diastolic blood pressure, mmHg 87.4 ± 10.8 84.7 ± 6.6 unspecified

* Adjusted for free fat and age ** Leptin levels were available from 69 individuals.

Table 2: Demographic and clinical characteristics of 64 subjects of normal weight and the start of the following study (during 1979-1981) according to the presence or absence of Leu (7) on the Pro (7) mutation in the NPY gene. Values are mean ± standard deviation (SD)

characteristics without mutation with mutation Age, years 55.8 ± 2.0 55.1 ± 1.8 Gender, woman / man 31/25 71 BMI, kg / m ² 24.3 ± 2.0 24.9 ± 1.8 WHR 0.87 ± 0.08 0.85 ± 0.05

φ · · φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ φ

fs-insulin, pmol / l 65.4 ± 44.4 84.0 ± 42.6 fs-glucose, mmol / l 4.9 ± 0.63 4.5 ± 0.57 Systolic blood pressure, mmHg 142.4 ± 17.6 151.1 ± 16.1 Diastolic blood pressure, mmHg 86.9 ± 9.0 91.1 ± 8.4

Overview of pictures

Giant. Ia shows schematically the molecular structure of the human NPY gene, the preproNPY peptide, and the final NPY peptide.

Giant. 1b shows the nucleotide sequence of the human NPY gene. Capital letters denote regions of exon sequences, lowercase letters intron sequences. The sequence number in the gene bank is indicated in parentheses. The arrow indicates the position at which T is replaced by C in the normal gene to form a mutant gene. The underlined sequence in exon 2 is a sequence that encodes a 28 amino acid signal peptide (Exon 1 is SEQ ID NO: 1, Exon 2 is SEQ ID NO: 2, Exon 3 is SEQ ID NO: 3, Exon 4 is SEQ ID NO : 4).

Giant. 1c shows the nucleotide sequence of the human mRNA encoding preproNPY (SEQ ID NO: 5, with the protein sequence shown in SEQ ID NO: 6). The arrow indicates the position at which T in normal mRNA is replaced by C to produce mutant mRNA.

Giant. 2 depicts the fasting serum concentration (sl) of a) total cholesterol, b) LDL-cholesterol, c) HDL-cholesterol, and d) VLDL-cholesterol in obese individuals, where the solid bars represent the Leu7 / Leu7 homozygotes in the preproNPY signal peptide (n). = 120), and the empty bars represent the heterozygotes Leu7 / Pro7 (n = 21) or homozygotes Pro7 / Pro7 in the preproNPY signal peptide.

Giant. 3 shows fasting serum concentrations (sl) a) total cholesterol, b) LDLcholesterol, c) HDL-cholesterol, and d) VLDL-cholesterol in normal individuals, where the solid bars represent the Leu7 / Leu7 homozygotes in the preproNPY signal peptide (n = 56 1, and the empty column represent the Leu7 / Pro7 heterozygotes (n = 8) or the Pro7 / Pro7 homozygotes in the preproNPY signal peptide.

• 99 • 9 «9» 9 • 9 9 9 9

9 9 *

9 9 9 9 9 9 9 9 9

9999 99 9

Sequencing Sheet (I) GENERAL INFORMATION:

(i) APPLICANT: Ball, Markku

Karvonen, Matti

Pesonen, Ullamari Uusitupa, Matti (ii) APPLICATION NAME: DNA molecule encoding mutant prepro-neuropeptide Y, mutant signal peptide, and uses thereof (iii) NUMBER OF SEQUENCES: 14 (iv) CORRESPONDENCE ADDRESS (A) ADDRESS: Rothwell, Figg, Ernst & Kurz. P.C.

(B) STREET: 555 13th Street NW, Suite 701-E (C) CITY: Washington (D) COUNTRY: D.C (E) COUNTRY: USA (F) ZIP Code: 20004 (v) AVAILABLE COMPUTER FORM:

(A) MEDIA TYPE: floppy disk (B) COMPUTER: IBM PC compatible (C) OPERATING SYSTEM: PC-DOS / MS-DOS (D) SOFTWARE: Patenln Release # 1.0, Verse # 1.30 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: US 08 / 994,946 (B) filing date: 19.12.1997 (C) CLASSIFICATION:

(viii) REPRESENTATIVE / REPRESENTATIVE INFORMATION:

(A) NAME: Ihnen, Jefrey L.

(B) REGISTRATION NUMBER: 28.957 (C) REFERENCE / REGISTER NUMBER: 2328-110 (ix) TELECOMMUNICATION INFORMATION:

(A) PHONE: 202-783-6040 (Β) (B) TELEFAX: 202-7B3-6031 • · 9 Λ 4 4 4 4 · ·········· 4 · 4 · • 44 4 ··· 4 ·· · ΐ8::: :::: :::

(2) INFORMATION Ο SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 325 baffles (B) TYPE: nucleic acid (C) STRINGNESS: double (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ IDN0.1:

CCGCTTCTTC AGGCAGTGC TGGGGCGGGA GGGTTGGGGT GTGGGTGGCT CCCTAAGTCG 60

ACACTCGTGC GGCTGCGGTT CCAGCCCCCT CCCCCCGCCA CTCAGGGGCG GGAAGTGGCG 120 GGTGGGAGTC ACCCAAGCGT GACTGCCCGA GGCCCCTCCT GCCGCGGCGA GGAAGCTCCA 180 TAAAAGCTCCT GTCGCG

CGCTCGCCCG ACAGCATAGT ACTTGCCGCC CAGCCACGCC CGCGCGCCAG CCACCGTGAG 300 TGCTACSAC; CSTCTGTCTA GGGGT 325 (2) SEQ ID NO: 2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 247 baffles (B) TYPE: nucleic acid (C) STRINGNESS: double (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2:

CCCGTCCGTT GAGCCTTCTG TGCCTGCAGA TGCTAGSTAA CAAGCGACTG GGGCTGTCCG 60

GACTGACCCT CGCCCTGTCC CTGCTCGTGT GCCTGGGTGC GCTGGCCGAG GCGTACCCCT 120

CCAAGCCGGA CAACCCGGGC GAGGACGCAC CAGCGGAGGA CATGGCCAGA TACTACTCAG 180 CGCTGGGACA CTACATCAAC CTCATCACCA GGCAGAGGTG GGTGGGACCG CGGGACCGAT 240

TCCGGGA 247 (2) SEQ ID NO: 3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 142 baffles (B) TYPE: nucleic acid (C) STRINGNESS: double (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION SEQ ID NO: 3

ACTTGCTTTA AAAGACTTTT TTTTTTCCAG ATATGGAAAA CGATCTAGCC CAGAGACACT 60

GATTTCAGAC CTCTTGATGA GAGAAAGCAC AGAAAATGTT CCCAGAACTC GGTATGACAA 120 GGCTTGTGAT C-GSGACATTG TT 142 (2) SEQ ID NO: 4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 300 baffles (B) TYPE: nucleic acid (C) STRINGNESS: double (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4:

CCTTACATGC TTTGCTTCTT ATGTTTTACA GGCTTGAAGA CCCTGCAATG TGGTGATGGG 60

AAATGAGACT TGCTCTCTGG CCTTTTCCTA TTTTCAGCCC ATATTTCATC GTGTAAAACG 120

AGAATCCACC CATCCTACCA ATGCATGCAG CCACTGTGCT GAATTCTGCA ATGTTTTCCT 180 TTGTCATCAT TGTATATATG TGTGTTTAAA TAAAGTATCA TGCATTCAAA AGTGTATCCT 240

CCTCAATGAA AAATCTATTA CAATAGTGAG GATTATTTTC GTTAAACTTA TTATTAACAA 300 (2) SEQ ID NO: 5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 551 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: mRNA (ix) DESCRIPTION:

(A) NAME / KEY: signal peptide • (Β) LOCATION: 87..170 (ix) DESCRIPTION:

(A) NAME / KEY: CDS (B) LOCATION: 87..377 (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5:

ACCCCATCCG CTGGCTCTCA CCCCTCGGAG ACGCTCGCCC GACAGCATAG TACTTC-CCGC 60 CCAGCCACGC CCGCGCGCCA GCCACC ATG CTA GGT AAC CAG CTG GGG CTG 113

Met Leu Gly Asn Lys Arg

TCC GGA CTG CTC GCC CTG TCC CTG CTC GTG

Ser Glu Leu Thr Leu Ala Leu Ser Leu Leu Val Cys Leu Gly Ala Leu 10 15 20 25

GCC GAG GAC GCA GCA GCA GCA GCA GCA GCA GCA GCA GCA GCA GCA CCA 209

Ala Glu Ala Tyr Pro

35 40

GCG GAG GAC ATG GCC AGA TAC TAC TCG

Ala Glu Asp Met Arg Arg Ty Arg Tyr Tyr Ser Le Ala Leu Arg His Tyr Ile Asn

50 55

CTC ATC ACC AGG CAG AGA TAT GGA AAA CGA TCC AGC

Leu Ile Thr Arg

65 70

ATT TCA GAC CTC TTG ATG AGA GAA AGC ACA GAA AAT GTT CCC AGA ACT 353

Ile Ser Asp Leu Leu Arg Arg Glu Ser Thr Glu Asn Val Prs Arg Thr

80 85

CGG CTT GAA GAC ATG TGG TGATGGGAAA TGAGACTTGC TCTCTGGCCT 407

Arg Leu Glu Asp Pro Met Met Trp 90 95

TTTCCTATTT TCAGCCCATA TTTCATCGTG TAAAACGAGA ATCCACCCAT CCTACCAATG 467

CATGCAGCCA CTGTGCTGAA TTCTGCAATG TTTTCCTTTG TCATCATTGT ATATATGTGT 527

GTTTAAATAA AGTATCATGC ATTC 551 (2) SEQ ID NO: 6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 98 amino acids (B) TYPE: amino acid (C) TOPOLOGY: linear (ii) MOLECULAR TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6:

Met Leu Gly Asn Lys Arg Leu Gly Leu Ser Gly Leu Thr Leu Ala Leu 15 10 15

Ser Leu Le Cly Leu Gly Ala Leu Ala Glu Ala Tyr Pro Ser Lys 20 25 30

For Asp Asn For Gly Glu Asp Ala For Ala Glu Asp Met Ala Arg Tyr 35 40 45

Tyr Ser Ala Leu Arg His Tyr is Asn Leu is Thr Arg Gin Arg Tyr 50 55 60

Gly Lys Arg Ser Ser Glu Thr Leu He Ser Asp Leu Leu Met Arg 65 70 75 80

Glu Ser Thr, Glu Asn Val Pro, Arg Thr Arg, Leu Glu, Asp Pro, Ala Met Trp

(2) SEQ ID NO: 7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7:

TTGGGGTGTG GGTGGCTC

(2) INFORMATION Ο SEQUENCE OF SEQ ID NO: 8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8:

CCTAGACAGA CGGGTCGTAG CA 22 (2) SEQ ID NO: 9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9:

CCCGTCCGTT GAGCCTTCTG 20 (2) SEQ ID NO: 10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 baffles (B) TYPE: nucleic acid (C) STRINGNESS: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc -'primer '(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10:

flflflfl flfl

CGGTCCCGCG GTCCC 15 (2) SEQ ID NO: 11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11:

AAAAGACTTT TTTTTTTCCA G 21 (2) SEQ ID NO: 12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12:

AATGTCCCCA TCACAAG 17 (2) SEQ ID NO: 13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid • ·· (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13:

CCTTAC ATGC TTTGCTTCTT A 21 (2) SEQ ID NO: 14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 baffles (B) TYPE: nucleic acid (C) STRINGENCY: simple (D) TOPOLOGY: linear (ii) MOLECULAR TYPE: other nucleic acid (A) DESCRIPTION: / desc = “primer” (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14:

GATTTTTCAT TGAGGAGGAT • ·· · ··

Pl / 2w0- W ·· ·· · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · · ·· ··

Revised patent claims - for full reconnaissance

Claims (19)

A DNA sequence comprising a nucleotide sequence encoding a prepro-neuropeptide Y, wherein the amino acid leucine at position 7 of the prepro-neuropeptide Y signal peptide portion is replaced by the proline amino acid. DNA sequence according to claim 1, comprising the genomic nucleotide sequence as shown in Fig. 1b. The DNA sequence of claim 1, wherein the DNA sequence is cDNA. An RNA sequence comprising an RNA sequence corresponding to the DNA sequence of claim 1. 5. A method of screening an individual to determine if the individual is carrying a mutated gene comprising a nucleotide sequence encoding a prepro-neuropeptide Y, wherein the leucine at position 7 of the prepro-neuropeptide Y signal peptide portion is replaced with proline, thereby preparing a biological sample derived from the individual. which is tested and then tested to detect the presence of the normal or mutated preproneuropeptide Y gene in the biological sample. The method of claim 5, wherein the assay is any assay processing DNA sequence information of claim 1. 7. A signal peptide having leucine at position 7 replaced by proline. A peptide comprising the signal peptide of claim 7 associated with any other prepro-neuropeptide Y cleavage product. The antibody capable of binding to a signal peptide of claim 7. The antibody capable of binding to a signal peptide of claim 8. An immunodetection method for determining a peptide according to claim 7 or 8, characterized in that the biological sample is exposed to an antibody capable of binding to the peptide. 12. A method of diagnosing a predisposition for elevated levels of serum cholesterol or LDL cholesterol in a human, comprising determining whether the individual is a carrier of a polymorphism in the signal peptide portion of human prepro-neuropeptide Y, wherein the polymorphism comprises a in the signal portion of preproneuropeptide Y, and is an indicator of predisposition to elevated serum cholesterol or LDL cholesterol. 13. A method of treating a human subject diagnosed with a predisposition to elevated serum cholesterol or LDL cholesterol levels according to claim 12, wherein the method comprises: 44 · 4 • 4 4 44 • 4 4 4 4 4 4 4 4 4444 preventing an elevated level of serum cholesterol or LDL cholesterol in an individual, administers to the individual an effective amount of an agent to counteract the effect of the mutated preproneuropeptide Y gene. 14. The method of claim 13, wherein the agent is pharmaceutically intended to affect the synthesis, release or metabolism of endogenous preproneuropeptide Y, or to interact specifically with the target sites of action of the prepro-neuropeptide Y to modulate the action of the prepro-neuropeptide Y with a specific protein receptor of the prepro-neuropeptide Y. 15. The method of claim 13, wherein the agent is pharmaceutically intended to affect expression of the normal or mutated prepro-neuropeptide Y gene. 16. A method of treating a human subject diagnosed with a predisposition to elevated serum cholesterol or LDL cholesterol according to claim 12, wherein the subject is subjected to specific gene therapy intended to repair the mutated preproneuropeptide Y sequence to prevent elevated serum cholesterol or LDL cholesterol levels in the subject. . 17. A transgenic animal carrying a human DNA sequence comprising a nucleotide sequence encoding a prepro-neuropeptide Y or a portion thereof encoding a terminal human NPY peptide, wherein the amino acid leucine at position 7 of the signal portion of said preproNPY peptide is replaced by proline. 18. A transgenic animal carrying a DNA sequence comprising a nucleotide sequence encoding an otherwise normal murine prepro-neuropeptide Y sequence or a portion thereof encoding a final murine prepro-neuropeptide Y, but wherein the nucleotide sequence encoding the mouse signal peptide is replaced by a sequence encoding a human signal peptide as normal, so mutated. 19. A cell line expressing a mutated human NPY gene or a portion thereof.