CN2899927Y - Reactor - Google Patents

Abstract

The utility model discloses a reactor for that the reaction medium is the liquid, which comprises at least a reaction tank; wherein the reaction tank comprises a tank body, a rotatable shaft arranged in the tank body and a container fixed on the rotatable shaft, the container has an outer wall, and a hole which can make the reaction liquid and the gas pass through is distributed on the whole outer wall. The reactor provided by the utility model can prevent the vitality of the catalyst from declining and prolong the service life of the catalyst, and have the advantages of the high exchange efficiency, full reaction and wide application range.

Description

Reactor

Technical field

The utility model relates to a kind of reactor, and particularly a kind of reaction medium is the reactor of liquid.

Background technology

In fields such as medical industry, food industry, environmental protection, agricultural, light and textile industries, chemical industry, often carry out various reactions by means of reactor, wherein said various reactions mostly need catalyst to react.For the reaction of carrying out in liquid medium, in order to improve reaction efficiency, reactant must effectively contact with catalyst.It is particularly like this when catalyst is solid.

In fields such as biology, medical industry, food industry, environmental protection, agricultural, enzyme or the cell that contains enzyme are more noticeable class catalyst in numerous catalyst.And, present enzyme or contain that the cell etc. of enzyme is many to be used with immobilized form, this is because immobilised enzymes/immobilization born of the same parents stablize than solution enzyme usually and can separate recovery, repeated use (living things catalysis technology from product, the Sun Zhihao chief editor, Chemical Industry Press, Beijing, 2005), thereby its cost can significantly reduce.But great majority comprise that the then corresponding solution enzyme of catalysis activity of solid-phase catalyst of immobilised enzymes and/or immobilized cell is low.

At present, use the reactor of solid-phase catalyst to mainly contain two kinds: i.e. packed bed reactor and stirring reactor.Generally speaking, the packed bed reactor operation is comparatively simple, its working method is: in advance graininess or sheet solid-phase catalyst are filled in the packed bed reactor, substrate solution is flowed through packed bed and is made solid-phase catalyst mix so that reactant effectively contacts with catalyst with substrate during reaction.Stirring reactor contains retort, this retort comprise in the tank body, tank body rotating shaft and such as agitators such as paddles.The working method of this stirring reactor is: earlier graininess or block solid-phase catalyst are suspended in the substrate solution in the retort, stir by agitator when reaction then or flow by means of bubble solid-phase catalyst is fully mixed so that reactant effectively contacts with catalyst with substrate.

Although above-mentioned two kinds of reactors can realize that all solid-phase catalyst makes reactant effectively contact with catalyst with the mixing of substrate, exist following problems in actual applications inevitably:

With regard to packed bed reactor, the problem of its existence is: the exchange efficiency between [1] substrate and the solid-phase catalyst is lower; [2] course of reaction is difficult for feed supplement and ventilation body, also is difficult for regulating pH value and temperature etc.; [3] be unsuitable for viscosity or insoluble substrate; When [4] using the less solid-phase catalyst of particle, bed pressure drop is big, and this causes occurring easily blocking.

With regard to stirring reactor, although it can regulate various reaction conditions as required, but in the process that agitator stirs, because solid-phase catalyst is suspended in the interior substrate solution of retort, therefore between the solid-phase catalyst particle, between solid-phase catalyst particle and the agitator and strong collision (zymetology, Chen Shigen and Zhou Runqi volume, publishing house of Fudan University all can take place between solid-phase catalyst particle and the retort tank skin, Shanghai, calendar year 2001; The biological respinse engineering, relative with the Xia Jiebian that has stable political situation, Chemical Industry Press, Beijing, 2004), thereby cause the solid-phase catalyst particle because of collision cracked and wearing and tearing, thereby make that the solid-phase catalyst vigor descends, shorten service life, and solid-phase catalyst can produce fragment or granulated slag because of cracked and wearing and tearing, and these fragments or granulated slag can run off with the carrying out of reaction, this can hinder the subsequent treatment of reactant liquor, as the filtration of product and purifying etc.And well-known, the density that is suspended in the solid-phase catalyst particle in the solution is big more, motion (rotating speed) is fast more, and the efficient of reaction is just high more; But meanwhile, the intensity that particle is collided also increases thereupon, and solid-phase catalyst is also just easy more cracked, and the decline of its vigor is also fast more.Thereby the range of application of stirring reactor is limited to, and particularly is not suitable for itself with regard to frangible solid-phase catalyst particle.

Summary of the invention

For overcoming the above-mentioned defective that pre-existing reactors exists, the utility model provides a kind of like this reactor: it can prevent that the catalyst vigor from descending, prolonging the service life of catalyst, and has the characteristics of exchange efficiency height, sufficient reacting and applied range.

The technical scheme that the utility model provides is: a kind of reactor is provided, comprise at least one retort, described retort comprises tank body, is installed on rotating rotating shaft in the tank body, described retort comprises that also being fixed on being used in the described rotating shaft holds the container of solid-phase catalyst, described container has outer wall, and being distributed with on whole outer wall can penetrating reactant liquor and gas but the hole of penetrating described solid-phase catalyst not.

In a specific embodiment, the perisporium that described outer wall has first end face, second end face and extends between first end face and second end face.First end face of described outer wall and second end face are provided with the hole that is used for interspersed rotating shaft, and the shape in described hole and size are complementary with rotating shaft.Described hole is arranged on first end face of described container and the central position on second end face.

Solid-phase catalyst in container directly contacts with rotating shaft or is installed in the rotating shaft for the ease of container, and described container can also comprise inner core, and the internal diameter of described inner core and the external diameter of rotating shaft are complementary.In addition, can also be provided with in the described rotating shaft with tank body in the duct that is used to carry liquid and/or gas that is interlinked to the outside.

The mounting means of described retort can be vertical type, also can be horizontal or alternate manner.In retort, can adopt bolt fixed mode between described container and the rotating shaft, perhaps can adopt the clip fixed form, perhaps adopt singly-bound or spline fixed form etc.According to the needs of reaction, the ratio of the volume of described container and the volume of retort can be between 1% to 95%.The ratio of this volume be decided with needing because of different catalytic reactions.Generally speaking, the ratio of this volume is high more, and reaction is carried out soon more, so the substrate and/or the product of the instability of being applicable to or easily degraded.But the too high catalytic efficiency that then can cause of the ratio of this volume descends; On the other hand, the ratio of this volume too small (as being less than 5%) then reduces stirring efficiency, thereby influences reaction rate.

In reaction method of the present utility model, described solid-phase catalyst can be various immobilised enzymes.The concrete example of a solid-phase catalyst is immobilised enzymes or immobilized cell.The shape of this immobilised enzymes and cell is not particularly limited, and can be graininess, and sheet perhaps is a monoblock, can also be the cylinder that is wound into by whole piece.In specific embodiment of the present utility model, adopted the solid-phase catalyst of monoblock, the solid-phase catalyst of this monoblock is by enzyme or expresses the cell of enzyme and the porous organic foam material of perforate is made that described organic foam material comprises wood pulp sponge, polyvinylalcohol sponge and melamine sponge.

According to the requirement of the reaction of the performance of used solid-phase catalyst and institute's catalysis thereof, the rotating speed of described rotating shaft can for example can be 20～20,000rpm in very wide scope.When rotating speed is lower than 20rpm, reactant liquor can not contact with catalyst fully effectively, and reaction efficiency is not high, and when rotating speed is higher than 20000rpm, the energy of consumption is bigger, and cost is unfavorable for saving.General preferred range is 50～10,000rpm, and more preferred range is 100～1,000rpm.

With respect to prior art, the beneficial effects of the utility model are:

The first, reactor of the present utility model need not to use independent agitator.In the reactor that uses solid-phase catalyst, because being housed, the container of solid-phase catalyst has centrifugal agitating function, so-called centrifugal stirring is that reactant liquor is contacted with the interior solid-phase catalyst of gas and container, thus, its effect is similar to the effect that the stirring action of agitators such as paddle is produced, so the reactor that the utility model provides need not to adopt agitator.

Second, since do not exist in the reactor that provides of the utility model solid-phase catalyst each other, between solid-phase catalyst and the agitator and the collision between solid-phase catalyst and the retort tank skin, thereby, can avoid solid-phase catalyst cracked and wearing and tearing, thereby can avoid solid-phase catalyst to cause the problem that vigor descends and its life-span reduces of enzyme because of cracked and wearing and tearing because of collision.

The 3rd, the reactor that the utility model provides can also avoid solid-phase catalyst because of cracked and wearing and tearing produce fragment or granulated slag, so also just can not influence the subsequent treatment of reactant liquor because of having fragment or granulated slag.

The 4th, the having wide range of applications of reactor of the present utility model.The reactor that the utility model provides can be applicable to the various reactions carried out in liquid medium.And since do not exist in the reactor that provides of the utility model solid-phase catalyst each other, between solid-phase catalyst and the agitator and the collision between solid-phase catalyst and the retort tank skin, therefore the reactor that provides of the utility model is not only applicable to the comparatively solid situation of solid-phase catalyst particle, is applicable to that too solid-phase catalyst particle itself is with regard to frangible situation.In addition, according to different application scenarios, reactor of the present utility model and container wherein can be taked all styles of, and its profile can be regular shapes such as for example cylindric, spherical, prism-shaped, square shape, also can be helical forms, stepped etc. irregularly shaped.The mounting means of the container in the reactor also can be decided according to the actual requirements, and for example can be various forms such as horizontal, vertical type and inclination.

The 5th, when the container that accommodates solid-phase catalyst rotates with rotating shaft, the reactant liquor that enters in the container throws away after centrifugal direction runs through solid-phase catalyst under the action of the centrifugal, in solid-phase catalyst, cause simultaneously negative pressure, and the reactant liquor that is thrown out of follows vacuum flow through solid-phase catalyst thereupon again, so form circulating reflux, thereby improved exchange efficiency.In addition, since all porose on the whole outer wall of container in the reactor, thereby the efficient of reactant liquor turnover container is higher, and then also improved exchange efficiency.

The 6th, the size in the hole on the container outer wall is not particularly limited, can decide on the situations such as size of the solid-phase catalyst that held in the container,, and need not it is limited as the less micropore in aperture as long as this hole can penetrating reactant liquor and gas and not penetrating solid-phase catalyst.Thus, reactant liquor and gas can be swimmingly contact with solid-phase catalyst in the container, thereby can improve reaction efficiency, make reaction to carry out more fully.

The 7th, reactor of the present utility model is convenient to the operations such as feed supplement, ventilation, pH adjusting and adjustment in the course of reaction, thereby has overcome packed bed reactor defective and application obstacle in this regard.

Description of drawings

Below in conjunction with accompanying drawing, the specific embodiment and application example the utility model is elaborated.

Fig. 1 is the schematic diagram of a kind of structure of reactor of the present utility model;

Fig. 2 is the schematic diagram of the another kind of structure of reactor of the present utility model;

Fig. 3 is the structural representation of reactor user mode shown in Figure 1; And

Fig. 4 is the structural representation of the specific embodiment of reactor shown in Figure 1.

What Fig. 5 showed is the nucleotide sequence of expression vector pRSET-lac-MGI4-35-kan.

What Fig. 6 showed is the nucleotide sequence of expression vector expression vector pHS-GHA.

What Fig. 7 showed is the nucleotide sequence of expression vector pT7-kan-ACY.

The specific embodiment

See also Fig. 1, reactor of the present utility model comprises at least one retort, and this retort comprises tank body 51, rotating shaft 21 and container 53.Rotating shaft 21 is installed in the tank body 51, its under the drive of motor or other transmission device (not icon) with certain rotational speed.As shown in the figure, when container 53 when being cylindric, it has such outer wall: promptly, comprise top (also can be described as first end face) 531, bottom (also can be described as second end face) 532 and the perisporium 533 that extends between top 531 and bottom 532.All can offer on top 531, bottom 532 and perisporium 533 can penetrating reactant liquor and the hole of penetrating gas.At the top 531 and the central position of bottom 532 offer porosely, be provided with at this bore edges place and be used for container 53 is fixed on fixture 54 in the rotating shaft 21, this fixture 54 for example can be the steel loop of strap bolt etc.

During use, the solid matter of packing in the container 53 for example, comprises solid matters such as solid-phase catalyst, in the tank body 51 reactant liquor etc. is housed, and reactant liquor can be by the turnover of the hole on container 53 outer walls container 53.When the container 53 that accommodates solid matter together rotates with rotating shaft 21, enter reactant liquor in the container 53 runs through solid-phase catalyst etc. under the action of the centrifugal along centrifugal direction solid matter, enzyme in the interior solid matter of reactant liquor and gas and container 53 etc. is fully contacted.As can be seen, the container 53 in the reactor of the present utility model had both played container,, was used for the holding solid material that is; Also play agitator, that is, enzyme that is used for making reactant and solid matter etc. fully contacts.Among the application, agitator comprises various forms of mixing components such as paddle, as long as it stirs action and effect is similar to paddle.

Specify each part of reactor of the present utility model below.

Tank body 51 is generally made with stainless steel material, and also available certainly other material is made, and its profile is relevant with arrangement with the quantity of jar interior rotating shaft 21 and container 53, and for example, when having only a rotating shaft 21 in the jar, the profile of tank body 51 can be cylindrical and two ends are circular-arc; When many rotating shafts 21 were arranged in the jar, the profile of tank body 51 can be flat cylindricality, wave cylindricality or other shape.And tank body 51 has one or more tubing ports and the dismountable cover and/or jar end (not icon).The retort of installation can be vertical type (that is, rotating shaft 21 is perpendicular at the bottom of the jar), also can be horizontal (that is, at the bottom of rotating shaft 21 is parallel to jar), also can be other forms such as inclination form certainly.As for the detection and the regulative mode of heating, insulation and the temperature of the tank body in the reactor of the present utility model 51, pH, gas etc., can be identical with existing reactors.

Rotating shaft 21 can have with tank body 51 in the longitudinal holes that is interlinked to the outside, thereby it has the transfusion function concurrently.Rotating shaft 21 is indulged and is worn tank body 51, and the one end is connected with motor or other transmission device, and the other end connects a jar outer liquid-transport pipe-line.The fulcrum of rotating shaft 21 is positioned on the tank body 51 two ends tank skins, and when a rotating shaft 21 was only arranged in the jar, its position of the fulcrum was preferably located in the central position of two ends tank skin; When many rotating shafts 21 are arranged in the jar, determine the position of the fulcrum of rotating shaft 21 according to actual needs.Rotating shaft 21 is equipped with bearing with the crosslinked place of tank skin and is prevented the device (as oil sealing) of leakage.

In actual applications, the rotating speed of rotating shaft 21 is 20～20,000rpm, preferably 50～10,000rpm, more preferably 100～1,000rpm.

Container 53 can be made by plastics, stainless steel or other material, and has at least a part can dismantle or have the opening of the solid matter of packing into, thereby can pack solid matter in it into.The ratio of the volume of container 53 and entire reaction jar can be between 1% to 95%.And its profile can be common regular shape, and for example columnar disk, drum are spherical, prism-shaped, square shape etc.; Also can be for irregularly shaped, for example helical form, different shape such as stepped; Perhaps also can be containers such as the string bag,, and can be fixed in the rotating shaft 21 and and together rotate with rotating shaft 21 as long as it can hold aforesaid solid catalyst.Concrete shape according to container 53 profiles determines whether that needs are divided into container top 531, container bottom 532 and perisporium 533 with outer wall, and their shapes separately.And, be the intensity of Reinforced container 53, one or more dead rings can be set on the outer wall of container 53.And, the hole offer position and distribution form, for example whether need even distribution, can decide according to the profile and the actual needs of container 53.For example, when container 53 is disk, can on its whole outer wall, offer the hole, also can only on top 531 and perisporium 533, offer the hole according to actual needs, perhaps other open-cellular form; And, can on whole outer wall, offer the hole when container 53 when being spherical, perhaps only offer the hole in some localized positions.As for the size in hole, can decide according to the actual conditions such as size of solid matter, as long as guarantee container 53 can penetrating reactant liquor, penetrating gas and not penetrating solid matter.And Kong Yue is many, the aperture is big more, and then the gross area in container 53 lip-deep holes is big more, the backflow when also just helping reacting more.

In addition, container 53 can be that solid wall also can be the double walled structure.With regard to the container 53 of single-wall structure, the central position of its top 531 and bottom 532 offers the hole that is complementary with rotating shaft 21, in order to intert rotating shaft 21.During use, earlier top 531 is opened, in container 53, load solid matters such as solid-phase catalyst; Then container 53 is inserted in rotating shaft 21, the top 531 of closing; Again container 53 is fixed in the rotating shaft 21; The rotating shaft 21 that will be fixed with container 53 is subsequently inserted in the retort.With regard to the container 53 of double-wall structure, its outer wall layer and top 531 are identical with top 531 with the outer wall of solid wall, and its inner wall layer is at one of the bottom center of solid wall container 53 protuberance and the cylindrical shell of outer wall layer with high upper and lower opening, in order to be inserted in rotating shaft 21 and to be fixed.Double walled container 53 earlier fills in solid-phase catalyst in the cavity between the two layers of walls of container 53 in use, closes and fixed top 531, is inserted in rotating shaft 21 then and is fixed.The advantage of the container 53 of double-wall structure is to be convenient at a plurality of containers 53 of rotating shaft 21 upper sleeve throughs.For further strengthening the intensity of double walled container 53, several or a series of fastening frames can be set also between inside and outside wall.In addition, no matter solid wall still is the container 53 of double-wall structure, is distributed with the hole on its outer wall.

Be not limited to the steel loop of strap bolt as for fixture 54, can be the fixture that has bolt or pin of other form, also can be the clip fixture, can also be for adopting singly-bound or spline fixed form, perhaps adopt machine made fixtures such as interference fit, certainly can also adopt such fixed form: promptly, when container 53 is yielding, in container 53, be added in expandable material in the liquid, after reactant liquor enters container 53, thereby this material expands rapidly and makes container 53 and content thereof tightly push rotating shaft 21, and the frictional force that produces by means of extruding is fixed in container 53 in the rotating shaft 21; When container 53 is not yielding, caulked material or be added in expandable material in the liquid between container 53 and rotating shaft 21, so that container 53 tightly pushes by means of this material and rotating shaft 21, the frictional force of Chan Shenging just can be fixed in container 53 in the rotating shaft 21 like this.

It is pointed out that in a retort of reactor of the present utility model, can dispose a container 53 or a plurality of container 53 as required.But a plurality of container 53 serial or parallel connections also can be connected in parallel in the different rotating shaft 21 in same rotating shaft 21, and the container 53 of a plurality of series connection can be installed in the same retort side by side.And, in reactor of the present utility model, can have a plurality of retort.According to actual needs, these retort can be in series or in parallel with each other, and wherein a part of retort is not limited only to also can be used for other purposes as retort, for example is used as preheating can etc.

See also Fig. 2, structure shown in the figure is similar to the structure among Fig. 1, wherein the structure of various piece, function and connection interactively each other are similar to reactor shown in Figure 1, no longer repeat specification to this, and the part identical with Fig. 1 adopts identical reference number.

As can be seen, the difference of structure illustrated in figures 1 and 2 only is: among Fig. 1, container 53 is fixed on the both sides of rotating shaft 21 or rotating shaft 21 is enclosed in wherein; Among Fig. 2, container 53 only is fixed on the side of rotating shaft 21.Except container 53 and rotating shaft 21 tightly being fixed together this mode in the frictional force of adding material between container 53 and the rotating shaft 21 or in container 53 and producing by container 53 and rotating shaft 21 extruding, the fixed form between container 53 and the rotating shaft 21 can adopt foregoing various fixture and fixed form.

Be appreciated that in a retort of reactor shown in Figure 2, also can dispose a container 53 or a plurality of container 53 as required.But a plurality of container 53 serial or parallel connections also can be connected in parallel in the different rotating shaft 21 in same rotating shaft 21, and the container 53 of a plurality of series connection can be installed in the same retort side by side.

Consulting Fig. 3 below is that example is further described the utility model with the solid-phase catalyst (solid matter) that comprises immobilised enzymes/immobilized cell.The structure of reactor shown in Figure 3 is identical with Fig. 1, does not repeat them here.

During use, the container 53 of at first solid-phase catalyst (61) of previously prepared graininess, sheet or monoblock being packed into, behind the loam cake of closed container 53 (top 531) container 53 is fixed in the rotating shaft 21 in the retort, the hole of offering on the container 53 can penetrating reactant liquor, penetrating gas and can not penetrating monoblock solid-phase catalyst or solid-phase catalyst particle (61).Then,, close cover, in tank body 51, inject the reactant liquor of proper temperature and volume container 53 retort of packing into.Afterwards, starter motor or other transmission device are to drive rotating shaft 21 centrifugal rotations.Like this, when the container 53 that accommodates monoblock solid-phase catalyst or solid-phase catalyst particle (61) rotates with rotating shaft 21, the reactant liquors that enter in the container 53 run through monoblock solid-phase catalyst or solid-phase catalyst particle (61) along centrifugal direction under the action of the centrifugal, thereby reactant liquor and gas and container 53 interior solid-phase catalysts are contacted.Progressively adjust rotating speed to optimum response efficient, generally speaking, rotating speed is fast more, and above-mentioned backflow is fast more, and substrate contacts frequent more with the enzyme molecule, and substrate/product is also just fast more with the exchange that contains enzyme molecule etc., and reaction speed is also accelerated thereupon.

Above-mentioned reaction can be in batches, half semicontinuous in batches or carry out continuously.So-called batch reaction refers to and discharges total overall reaction liquid after reaction is finished, and injects new substrate solution then and carries out the next round reaction; So-called half is semicontinuous in batches, refer in course of reaction that substrate adds continuously or in batches and product in batches or disposable discharge; So-called successive reaction refers to reaction and carries out in the process reactant liquor and constantly import in the jar, and pot liquid is also exported continuously with same flow velocity, and reaction continues to carry out.In actual use, also a plurality of retort can be together in series and carry out successive reaction to improve general reaction efficient.And when gas participated in reaction, the retort place was provided with special gas exhausting device, and the pressure of gas in the regulating tank whereby.

Explanation in passing, above-mentioned monoblock solid-phase catalyst can be made like this: promptly, adopt perforate, porous organic foam material such as wood pulp sponge, polyvinylalcohol sponge and melamine sponge etc. as fixation support, porous organic foam material with perforate is prefabricated into particle, sheet band shape earlier, honeycomb is block or other integrally-built carrier, again with polyaldehyde and protein wad a quilt with cotton with fixed attention agent enzyme or cell are wadded a quilt with cotton with fixed attention crosslinked on the three dimensional network wall of carrier, thereby obtain the monoblock solid-phase catalyst.Certainly, also can use similar method to make other solid matter in actual applications.

See also Fig. 4, be further described by the structure of a specific embodiment to the utility model reactor.

In the present embodiment, reactor comprises a retort.The tank body 51 of this retort is made by stainless steel material, is shaped as cylindrical shape, and its internal diameter is 11cm, and interior height is 6.4cm; Tank skin is a double-decker, is recirculated water channel 1 between the two-layer tank skin, and the skin of tank skin offers recirculated water input port 2 and the recirculated water delivery outlet 3 that links to each other with this channel 1, and input port 2 is connected water bath with thermostatic control with delivery outlet 3.

Tank body 51 bottoms offer four holes, lead to drain hole 40, sample tap 5, infusion port 6 and blow vent 7 respectively.Wherein, drain hole 40 places are provided with baiting valve 4; Blow vent 7 ecto-entads lead to be embedded in jar at the bottom of in the circulating line 8 of table.There is numerous pores to lead in the jar on this circulating line 8.The central position of tank body 51 bottoms is provided with oil sealing 9 and the lower bearing 10 that is complementary with rotating shaft 21.

Tank body 51 tops are circular cover 11, and the central uplift of cover 11 forms protuberance top 12.The inner surface at protuberance top 12 is provided with the upper bearing (metal) 13 that connects rotating shaft 21.Offer three apertures on the cover 11, lead to leakage fluid dram 14, fluid infusion mouth 15 and exhaust outlet 16 respectively.Exhaust outlet 16 is positioned at the central position at protuberance top 12.Two holes are arranged on the cover 11 in addition, be respectively applied for pH and temperature exploring electrode 17 and charging aperture screw lid 18 are installed.Cover 11 closes fixing through four screws 19 and a jar tone, jar mouth has a ring-shaped rubber sealing ring (not icon) with the matching surface of cover 11.

In jar net dish 20 and rotating shaft 21 are arranged.Rotating shaft 21 diameters are about 2cm.Net dish 20 is made by the stainless steel web plate, and diameter is 10cm, and height is 5.1cm, and it is net disk cover 22 that net coils 20 upper ends.The net Pan Bi, net is tried to get to the heart of a matter and net disk cover 22 all is covered with the hole, bore dia is 2mm, pore size distribution density is 9/cm ²Central position at net dish 20 is inserted rotating shaft 21, and net disk cover 22 and net are tried to get to the heart of a matter fixing with set bolt 23 with the joint of rotating shaft 21; Longitudinal holes 24 is arranged in the rotating shaft 21, and the top in this duct 24, upper end 25 and middle lower end 26 are led to exhaust outlet 16, the inner chamber of cover 11 protuberances and the inner chamber of net dish 20 respectively.Explanation in passing, net dish 20 is a kind of form of expression of aforementioned container 53 in the present embodiment.

Speed-regulated DC motor (for example, the DC direct current generator, 200 watts, VEM MOTORS CO. LTD.HK) is positioned at tank body 51 bottom center, and motor shaft is connected with rotating shaft 21 in the jar through turning joint.

The reactor that it is pointed out that present embodiment can utilize basic principle of the present utility model the stirring reactor of existing routine is transformed and to be obtained.Stirring reactor with existing routine is compared, and the solid-phase catalyst in the present embodiment is a catalyst, is again the agitator (rotor) of the centrifugal agitating function of tool; Centrifugal force that solid-phase catalyst stir to produce and negative pressure and then strengthen the catalytic action that it has.And in the catalytic reaction in existing stirring reactor, the direction of rotation and the speed of solid-phase catalyst and substrate (reactant liquor) are basic identical; And in reactor of the present utility model, reactant liquor is different with the direction of rotation and the speed of solid-phase catalyst, and the negative pressure of the centrifugal force of solid-phase catalyst stirring generation and formation helps the backflow of substrate mass transfer and product mass transfer.In addition, reaction is constantly the mixing system of circulation, so easily implement operations such as feed supplement, ventilation, adjustment, pH adjusting.

Below, come principle, structure and beneficial effect to do more detailed explanation by a plurality of application examples to the utility model reactor.

The damage to fixed enzyme vector is stirred in example 1. suspensions

Adopt reactor shown in Figure 4, with present widely used graininess immobilised enzymes resin carrier Sepabeads EC-EP (Grazu V, Abian O, Mateo C, Batista-Viera F, Fernandez-Lafuente R, Guisan JM.Biotechnol Bioeng.2005,90:597-605; Grazu V, Abian O, Mateo C, Batista-Viera F, Fernandez-LafuenteR, Guisan JM.Biomacromolecules.2003,4:1495-1501) and the graininess fixed glucose isomerase net dish respectively and stir (promptly, as mentioned above graininess immobilised enzymes resin carrier and fixed glucose isomerase are respectively charged in the container 53, container 53 follows that centrifugal rotation is done in rotating shaft 21 and the stirring action that obtains) and suspension stirring test, the relatively degree of injury of resin carrier.Sepabeads EC-EP is available from Italian Resindion S.R.L company.The graininess fixed glucose isomerase available from Sigma (St.Louis, MO).

The suspension stirring test adopts the agitating type reactor of existing conventional to realize, its shaft diameter is about 2cm, this rotating shaft has stainless steel blade and (the long 26mm of four symmetries, the rectangular paddle of wide 20mm, thick 2.4mm is arranged in the rotating shaft, the blade face is parallel to rotating shaft, blade corner slyness), and retort can not have drain hole, blow vent, sample tap and infusion port, and detailed process is: Sepabeads EC-EP or the graininess fixed glucose isomerase with varying number directly adds retort respectively; With the retort topping-up, stirred 1 hour then with the airtight rotation of different rotating speeds; At last, Sepabeads EC-EP or fixed glucose isomerase after collection is stirred.

Net dish stirring test adopts reactor of the present utility model to realize, used reactor is the same substantially with above-mentioned suspension stirring reactor, is that the be fixed rotating shaft of net dish of blade-carrying rotating shaft replaces.Rotating shaft 21 diameters of the utility model reactor are about 2cm.Net dish 20 is made by the stainless steel web plate, and diameter is 10cm, and height is 5.1cm, and it is net disk cover 22 that net coils 20 upper ends, and the lower end is that net is tried to get to the heart of a matter.The net Pan Bi, net is tried to get to the heart of a matter and net disk cover 22 all is covered with the hole, bore dia is 2mm, pore size distribution density is 9/cm ², comprise that at all inner surfaces of this dish being lined with the aperture on the inner surface of the end, lid and perisporium is 200 purpose filter clothes.Net dish 20 central authorities insert rotating shaft 21, and net disk cover 22 and net are tried to get to the heart of a matter and the joint of rotating shaft 21 is fixed with set bolt.The detailed process of experiment is: at first, Sepabeads EC-EP or the graininess fixed glucose isomerase with varying number loads the net dish respectively; Then, with sponge net being coiled surplus sky after the filling tamps; Again, behind the retort topping-up, stirred 1 hour with the airtight rotation of different rotating speeds; At last, the resin particle after collection is stirred.

Will be through the Sepabeads EC-EP after net coils stirring test and the stirring of suspension stirring test or fixed glucose isomerase and in contrast Sepabeads EC-EP or fixed glucose isomerase oven dry without stirring, with laser particle size determination instrument (LS13320, LaserDiffraction Particle Size Analyzer, LS13320 Beckman) tests the diameter of its particle.The result is as shown in table 1, and compares without the Sepabeads EC-EP resin carrier that stirs, and its granular size after stirring of the resin carrier in the net dish is constant substantially; And the resin carrier that directly adds retort has obvious breakage to cause its particle diameter to diminish after stirring in 1 hour, and damaged degree increases with the increase of resin carrier density and the quickening of mixing speed, for example when Sepabeads EC-EP consumption be 100 the gram, when mixing speed is 800rpm, only through 1 hour stirring, its particle diameter (on average) just significantly reduces, the amplitude of reducing reaches 13.6% more than, if by volume, then its volume reduces 35% (V=4/3 π R ³).So existing industrial stirring reaction in fact all can't adopt the high density immobilised enzymes.And from this example as seen, rotation (being similar to vigorous stirring) is opposite to almost not damaged of the interior highdensity resin carrier of net dish at a high speed.And directly the damage of stirring fixed glucose isomerase also is far longer than the immobilised enzymes that is seated in the net dish.

Table 1. stirs the damage to fixed enzyme vector

The resin title	Quantity (gram)	Experiment type	Rotating speed (rpm)	Particle diameter (micron um) average D (3,2) d10 d25
					Sepabeads EC-EP (before handling)				167.5 163.4 134.7 147.4
Sepabeads EC-EP	50	The net dish stirs	800	169.2 164.2 134.7 147.7
					Sepabeads EC-EP	100	The net dish stirs	800	166.6 162.3 133.9 145.7
Sepabeads EC-EP	100	Suspend and stir	800	146.5 130.0 80.87 122.3
					Sepabeads EC-EP	50	Suspend and stir	800	163.8 153.8 120.5 137.2
					Fixed glucose isomerase (Sigma) (before handling)				834.5 784.5 588.9 679.8
Fixed glucose isomerase (Sigma)	50	The net dish stirs	800	780.1 755.1 548.7 633.1
					Fixed glucose isomerase (Sigma)	50	Suspend and stir	800	726.7 618.2 448.5 580.8

This shows, adopt that reactor of the present utility model can reduce between the solid-phase catalyst particle, the collision between solid-phase catalyst particle and the agitator, between solid-phase catalyst particle and the retort tank skin, thoroughly solve existing conventional stirring reactor the common fault of intrinsic immobilization particle is cracked, wearing and tearing.

Example 2. monoblock perforate immobilized cells are as paddle continuous stirring prepared in reaction high fructose syrup [1]

The glucose isomerase enzymatic becomes conversion of glucose the reaction of fructose.Being prepared as follows of the carrier pRSET-lac-MGI4-35-kan of expression glucose isomerase is described.Sequences Design PCR primer according to pGEMT-Easy (Promega) is specially: upstream primer RBS-NdeI:5 '-CATATGTATATCTCCTTCTTGTGTGAAATTG-3 '; Downstream primer RBS-AlwNI:

5’-CAGTGGCTGCTGCCAGTGGCGATAAGTC-3’。With pGEMT-Easy (Promega) is template, carries out PCR with above-mentioned primer, and amplification obtains a 755bp product.The PCR condition is: 50ng pGEMT-Easy (Promega), 0.4 μ M RBS-NdeI, 0.4 μ M RBS-AlwNI, 50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ MdGTP, 20mM Tris-HCl (pH is 8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,2.5 U Pfu archaeal dna polymerases (Promega) transfer to 50 μ L with sterilized water with reaction volume.The pcr amplification reaction program is: 94 ℃, and 5 minutes; 94 ℃, 1 minute; 50 ℃, 1 minute; 72 ℃, 4 minutes; Circulate 35 times; 72 ℃, 10 minutes.This PCR product (755bp) contains NdeI restriction enzyme site and ribosome binding site and contains the AlwNI restriction enzyme site at 3 ' end at 5 ' end.Purify with 0.8% agarose electrophoresis, after NdeI and AlwNI enzyme are cut, and is connected with the pRSETA (Invitrogen) that the AlwNI enzyme is cut through NdeI, must pRSET-lac.Cut pRSET-lac and pRSET-kan (publication No. is the Chinese patent application of CN1680558) with AlwNI and EcoRI enzyme, with purify each dna fragmentation and connect of 0.8% agarose electrophoresis, pRSET-lac-kan.

According to publication number is the disclosed method for preparing glucose isomerase mutant of Chinese patent application of CN1702172, with pGEMT-MGI-4 is template, be that primer is to (all seeing Table 2) with T1 and 87LR, 87LF and 217GR, 217GF and 260AR, 260AF and T2 respectively, it is synthetic to carry out PCR, obtains encoding containing F87L, W139F, R182A, F187S, V217G, D260A and the T299Q gene M GI4-35 of the glucose isomerase mutant of totally seven point mutation.After cutting MGI4-35 with NdeI and EcoRI enzyme, and be connected with the pRSET-lac-kan that the EcoRI enzyme is cut, obtain pRSET-lac-MGI4-35-kan through NdeI.The complete nucleotide sequence of gained carrier pRSET-lac-MGI4-35-kan is listed among Fig. 5.

Table 2

Primer is right
	T1： 5’AGCCTAGGTTAATTAACTTTAAGAAGGAGATATACATATGAATA AATATTTTGAGA3’ 87LR：5’AAAAACTCCAGTGCTGCTTCTACCCTTGCTTTC 3’
87LF：5’GAAGCAGCACTGGAGTTTTTTGATAAGATAA 3’ 217GR：5’GCATAGTCGCCAGCCATGTGCAAAAATCTT 3’
	217GF：5’ACATGGCTGGCGACTATGCAAAGGAAATCG 3’ 260AR：5’AAATATTTCGCAAGGTCGTATTTTCTCAAG 3’
260AF：5’ACGACCTTGCGAAATATTTCAAAGTAAATA 3’ T2：5’ATAAGCTCAGCGGCGCGCCTTATTCTGCAAACAAATAC 3’

Then with pRSET-lac-MGI4-35-kan transformed into escherichia coli BL21 (DE3) pLysS.Be seeded in the LB fluid nutrient medium (containing the 50mg/L kanamycins) in 1% ratio, cultivate the Escherichia coli 36 hours that this contains glucose isomerase mutant MGI4-35 for 37 ℃.Centrifugal wet thallus, and be suspended in the distilled water of 5 times of thalline weight.

Melamine sponge (the extraordinary sponge of Zhuhai rainbow factory) is cut into the sheet band (weighing 2.9 grams) of 0.5 * 5.5 * 130cm.Express the immobilization Bacillus coli cells of glucose isomerase by following operating sequence preparation: a) the sponge sheet band is immersed in the cell suspension, the extruding sponge evenly distributes bacterium liquid in sponge, sponge is passed through roller bearing, extruding is to remove the bacterium liquid that is not adsorbed on the sponge, and the gap of regulating two pairs of roller bearings makes bacterium liquid adsorbed on the sponge be about 100 g; B) add 250ml to sponge and contain 1mM CoCl ₂, pH be 7.0 0.1% polymine (PEI, available from Sigma, St.Luis, USA) solution, the extruding sponge is evenly distributed polymine, sponge once more by to roller bearing to remove the liquid that is not adsorbed; C) add 0.1% glutaraldehyde (available from the Shantou Xilong Chemical Factory, the Guangdong) solution of 250ml to sponge, the extruding sponge evenly distributes glutaraldehyde and removes the liquid that is not adsorbed, and leaves standstill 5 minutes; D) repeating step is a) to c) 5 times, each repeating step is a) time, regulate the bacterium liquid measure that the gap between two pairs of roller bearings adsorbs sponge once more and be about 50g, then with distilled water extruding washing 1 time, after the liquid that is not adsorbed is removed in extruding, placed the dry 5-10 of moving air hour, and must express glucose isomerase enzyme immobilization Bacillus coli cells sheet band 25g.Clip small amount of sample from the prepared expression glucose isomerase enzyme immobilization Bacillus coli cells sheet band is that the glucose isomerase that embodiment 11 described methods are measured immobilized cells in the Chinese patent application of CN1702172 compares vigor with reference to publication number.Be specially: accurately take by weighing the expression glucose isomerase enzyme immobilization Bacillus coli cells that 0.5-2mg prepares as stated above, the glucose solution that adds 36% (W/V) (contains 0.25 mM cobalt chloride, the 5mM magnesium chloride, 20mM phosphate, pH is 6.5) 1ml, 75 ℃ of jolting reactions 10 minutes, place ice bath and cessation reaction.Per minute catalysis 1 micromole's conversion of glucose is that the required enzyme amount of fructose is defined as a glucose isomerase enzyme activity unit with this understanding.The specific activity of enzyme that records the immobilization Bacillus coli cells of this example is 6,069 units/gram.

Prepared expression glucose isomerase enzyme immobilization Bacillus coli cells sheet band 25g is wound into the spool shape and inserts net dish 20, again with fine rule with the sheet band through the hole of net dish and net travelling expenses around fixing, net disk cover 22 closes, insert rotating shaft 21, tighten that net is tried to get to the heart of a matter and net disk cover 22 and rotating shaft 21 between set bolt 23, the net dish 20 that the glucose isomerase immobilized cell is housed that is fixed to like this in the rotating shaft 21 promptly can be used as the paddle that rotates with rotating shaft 21; The net dish that the glucose isomerase immobilized cell is housed 20 that will be fixed to then in the rotating shaft 21 inserts in the jar, the cover 11 that closes and have sealing ring, the rotating shaft 21 that net is coiled expose at 20 two ends respectively with at the bottom of the jar and the groove of cover 11 good fit, tighten fixed screw 19 then and make cover 11 and tank body 51 fluid-tight engagement; Again, but the electrode 17 precession covers 11 of the PHS-3D type pH meter (Shanghai three letter instrucment and meter plants) of indicated temperature will connected, transfusion/gas ports that tank body 51 is all up and down put silicone tube, sample tap 5, blow vent 7 at the bottom of being positioned at jar with the metal clip clamp and be positioned at the exhaust outlet 16 and the fluid infusion mouth 15 of cover 11 closed baiting valve 4; The inlet tube and outlet tube that temperature is set at 76 ℃ accurate circulator bath (THD-0506 type, sky, Ningbo permanent instrument plant) is connected with delivery outlet 3 with tank body 51 recirculated water input ports 2 respectively and starts water and circulates; Afterwards, (HL-1S type, west, Shanghai, Qingpu, Shanghai instrument plant) pumps into 50% (W/V) glucose solution (contain 1mM magnesium chloride and 0.2g/L sodium sulfite, pH is 7.5, the flowing nitrogen deoxidation) in the jar from infusion port 6 with constant flow pump, to leakage fluid dram 14 outflows.Starter motor, regulating rotating speed is 600 rev/mins.When the pH meter temperature is shown as 75 ℃, with the fructose content of polarimeter (the digital automatic polarimeter of wzz-2s, Shanghai Precision Scientific Apparatus Co., Ltd) monitoring stream fluid; After this optical value (22 ℃) of syrup is once flowed out in monitoring in every 4-6 hour.When recording initial flow rate and being 6.8 gram/minute, optical value (22 ℃) is-10.126 (being equivalent to the fructose conversion ratio is 50.3%).Reaction continues 98 hours, and flow velocity maintains the 6.0-6.5 gram/minute therebetween.When reacting the 98th hour, flow velocity is 6.18 gram/minute, and optical value (22 ℃) is-9.323 (being equivalent to the fructose conversion ratio is 49.17%).Observation sees that the product high fructose syrup is limpid, monoblock perforate immobilized cell profile and volume are complete, through washing and to dry its weight of back be 24.8 to restrain.

Example 3. monoblock perforate immobilized cells are as paddle series connection continuous stirring prepared in reaction high fructose syrup

The operations of the preparation of glucose isomerase immobilized cell sheet band and vitality test, its installation, isomerization reaction and retort on retort etc. are basically with reference to example 2.This examples preparation glucose isomerase immobilized cell sheet band 50 grams, enzyme activity is 5,298 units/gram.Adopt 2 retort as shown in Figure 4, retort I and retort II, respectively loading 23.5 grams respectively in net dish 20 is the immobilized cell sheet band of 5,298 units/gram than vigor, reaction separately respectively, its operation is identical with example 2.When recording retort I flow velocity and being 7.1 gram/minute, optical value (22 ℃) is-8.68 (being equivalent to the fructose conversion ratio is 48.68%); When the flow velocity that records retort II was 7.3 gram/minute, optical value (22 ℃) was-8.689 (being equivalent to the fructose conversion ratio is 48.30%).With retort I and retort II series connection, promptly the outflow liquid of retort I flows into retort II then, and the leakage fluid dram 14 from retort II after continuing to react in retort II flows out, and flow velocity strengthens.When the cascade reaction flow velocity was 14.27 gram/minute, optical value (22 ℃) was-11.28 (being equivalent to the fructose conversion ratio is 51.88%); When the cascade reaction flow velocity was 18.24 gram/minute, optical value (22 ℃) was-10.623 (being equivalent to the fructose conversion ratio is 50.97%); When the cascade reaction flow velocity was 24.0 gram/minute, optical value (22 ℃) was-8.86 (being equivalent to the fructose conversion ratio is 48.53%).Compare with example 2, this sample result shows that cascade reaction significantly improves reaction efficiency.

Example 4. monoblock perforate immobilized cells prepare high fructose syrup as paddle batch stirring reaction

The operations of the preparation of the glucose isomerase immobilized cell sheet band in this example and vitality test, its installation, isomerization reaction and retort on retort etc. are basically with reference to example 2.This examples preparation glucose isomerase immobilized cell sheet band 35 grams, enzyme activity is 6,775 units/gram.Adopt 2 retort as shown in Figure 4, one as retort, and another is as the substrate preheating can.Exceed the cover 10cm of retort at the bottom of the preheating can jar, triple valve of series connection between two jars the baiting valve 4, be connected with silicone tube between the recirculated water delivery outlet 3 of the recirculated water input port 2 of retort lower end and preheating can upper end, the inlet tube and outlet tube of water bath with thermostatic control is connected and starts water with the recirculated water delivery outlet 3 of the recirculated water input port 2 of preheating can lower end and retort upper end respectively and circulates, and the setting circulating water temperature is 76.9 ℃; Installing than vigor in retort is glucose isomerase immobilized cell sheet band 35 grams of 6,775 units/gram, and preheating can does not add immobilized cell, and two jars blow vent 7 all connects nitrogen cylinder, and preheating can remains exhaust outlet 16 open and lasting logical nitrogen.Before reinforced, the blow vent 7 and the exhaust outlet 16 of all sample taps 5 of clamp, infusion port 6, leakage fluid dram 14 and retort, close valves all between two jars, the glucose solution of 500g 50% (W/V) (is contained 1mM magnesium chloride and 0.2g/L sodium sulfite, pH is 7.5) pour into from the charging aperture of preheating can, cover and tighten charging aperture blind nut 18 then, start preheating can motor (speed setting is 900 rev/mins).When temperature is designated as 75 ℃ on the preheating can pH meter; the exhaust outlet 16 and the blow vent 7 of open retort; under having nitrogen protection, retort opens two jars baiting valve 4; at this moment; glucose solution in the preheating can flows to retort; close all valves between two jars and the blow vent 7 and the exhaust outlet 16 of retort after liquid glucose drains, start retort motor (speed setting is 600 rev/mins), and timing.After starting retort, load the 500g glucose solution once more, rotate preheating simultaneously to preheating can.After reaction is finished, open the baiting valve 4 and the blow vent 7 of triple valve, retort, discharge reactant liquor (high fructose syrup).After draining liquid, close triple valve, transferring the retort rotating speed is zero, opens two jars the baiting valve 4 and the exhaust outlet 16 of retort, and the glucose solution that has been preheated to 75 ℃ in the preheating can flows into retort once more.So cycling, 129 batches of coreactions, wherein 3 batch reaction times were 30 minutes, and 5 batch reaction times were 10 minutes, and the remaining reaction time is 20 minutes.Measure its fructose conversion ratio with the optical activity method.The optical value (22 ℃) that records preceding 58 batches of products (every batch reaction time is 20 minutes) is not less than-11.82 (being equivalent to the fructose conversion ratio is more than 52.69%); The optical value (22 ℃) that records last 10 batches of products (every batch reaction time is 20 minutes) is not less than-5.688 (being equivalent to the fructose conversion ratio is more than 44.1%).Observe that visible high fructose oar product is limpid, monoblock perforate immobilized cell profile and volume be complete, wash and dry its weight of back not become, still be 35 grams.

By this example and example 2 as can be known, can be prolonged the service life of solid-phase catalyst, and the also corresponding saving of production cost.In addition, the container 53 in the reactor of the present utility model can shield to above-mentioned monoblock solid-phase catalyst, avoids or slows down monoblock solid-phase catalyst tearing in centrifugal stirring.

Example 5. monoblock perforate immobilized cells prepare high fructose syrup as the semicontinuous stirring reaction of paddle half batch

After finishing example 3, take out the immobilized cell among the retort II, retort II as preheating can, to load the 23.5 retort I that restrain the glucose isomerase immobilized cells as retort, is pressed the method operation of example 4.But different is: reactant liquor is not discharged fully after each reaction is finished, but only discharge 200 grams; Each simultaneously preheating, fresh glucose solution 200 grams of loading.Carry out 4 times half semicontinuous reactions in batches, each reaction time is 10 minutes, records optical value (22 ℃) between-3.850 (being equivalent to the fructose conversion ratio is 39.8%) and-3.709 (being equivalent to the fructose conversion ratio is 39.6%).

Example 6. monoblock perforate wood pulp sponge immobilized cells prepare high fructose syrup as paddle batch stirring reaction

Press example 2 described method preparations and express glucose isomerase Escherichia coli wet thallus, cell is suspended in 5 times of distilled water.Wood pulp sponge (the extraordinary sponge of Zhuhai rainbow factory) is cut into the sheet band of 0.3 * 5.5 * 150cm (12 gram), with the distillation washing, after the drying, operation in the following order: a) the sponge sheet band is immersed in the cell suspension, the extruding sponge evenly distributes bacterium liquid in sponge, make bacterium liquid adsorbed on the sponge be about 50g; B) to the polyethyleneimine: amine aqueous solution (pH is 7.0) of sponge adding 150ml0.1%, the extruding sponge evenly distributes polymine and removes the liquid that is not adsorbed; C) to the glutaraldehyde solution of sponge adding 150ml 0.1%, extruding evenly distributes glutaraldehyde and removes the liquid that is not adsorbed; D) repeating step is a) to c) 5 times, the bacterium liquid measure that each repeating step adsorbs sponge a) time once more is about 20g.After the liquid that is not adsorbed was removed in extruding at last, drying was 10 hours in moving air, promptly obtains glucose isomerase immobilized cell sheet band 18.47g.The glucose isomerase of measuring immobilized cell by example 2 described methods compares vigor.The specific activity of enzyme that records the immobilization Bacillus coli cells of this example is 2,281 units/gram.

Adopt retort as shown in Figure 4, will than vigor be fixed glucose isomerase cell sheet band 18.47 grams of 2,281 units/gram by the example 2 described methods net dish of packing into, and carry out batch reaction by example 4 described methods.Drop into glucose solution 500g, when reacting 30 minutes, product optical value (22 ℃) is 2.19 (being equivalent to the fructose conversion ratio is 33.1%); When reacting 60 minutes, optical value (22 ℃) is-6.70 (being equivalent to the fructose conversion ratio is 45.5%); When reacting 90 minutes, optical value (22 ℃) is-10.383 (being equivalent to the fructose conversion ratio is 50.6%).Product is limpid.

Example 7. perforate polyvinylalcohol sponge particle immobilized cells prepare high fructose syrup as paddle batch stirring reaction

Press example 2 described method preparations and express glucose isomerase Escherichia coli wet thallus, cell is suspended in 5 times of body distilled water.The perforate polyvinylalcohol sponge (available from the good assistant of Ninghai County, Zhejiang Province commodity Co., Ltd) of drying is cut into about 8mm ³Particle, get polyvinylalcohol sponge particle 20g and place the nylon yarn mesh bag, again mesh bag is placed polybag, 40ml bacterium liquid is added in the sponge particle, extruding mixed 3 minutes at least repeatedly, made bacterium liquid evenly distribute on particle; Add 0.5% (W/V) pH and be 7.0 polymine (PEI) solution 40ml, extruding mixed 3 minutes at least repeatedly; The glutaraldehyde solution 40ml that adds 0.5% (V/V), extruding mixed 5 minutes at least repeatedly, then mesh bag is taken out from polybag, liquid is removed in extruding, with distilled water extruding washing 3 times, after removing the liquid that is not adsorbed, in moving air dry 5-10 hour, promptly obtain expressing glucose isomerase enzyme immobilization Bacillus coli cells particle 25.4g.The glucose isomerase of measuring immobilized cell by example 2 described methods compares vigor.The specific activity of enzyme that records the immobilization Bacillus coli cells of this example is 1,402 units/gram.

Adopt retort as shown in Figure 4, the dried particle packing net dish with the prepared perforate polyvinylalcohol sponge particle immobilized cell of 25g carries out batch reaction by example 4 described methods.Drop into glucose solution 500g, when reacting 30 minutes, product optical value (22 ℃) is 9.564 (being equivalent to the fructose conversion ratio is 22.9%); When reacting 60 minutes, optical value (22 ℃) is-0.31 (being equivalent to the fructose conversion ratio is 37.7%); When reacting 90 minutes, optical value (22 ℃) is-6.291 (being equivalent to the fructose conversion ratio is 44.9%).Product is limpid.

Example 8. particle immobilized cells prepare high fructose syrup as paddle batch stirring reaction

Adopt retort as shown in Figure 4, the ratio vigor of producing with U.S. Genencor company is the dried particle 160g filling net dish of the fixed glucose isomerase Spezyme IGI (Shandong Baolingbao Biotechnology Co., Ltd. provides) of 485 units/gram, the catalysis stirring operation is with example 4, and different is that centrifugal rotational speed is 600RMP in this example.Reactant liquor 300g reacted 20 minutes, and optical value (22 ℃) is-8.097 (being equivalent to the fructose conversion ratio is 47.48%).Product is limpid.

Example 9. monoblock perforate D-amino acid oxidase immobilised enzymes prepare Glularyl-7-amino cephalosporinic acid (GL-7-ACA) as paddle batch stirring reaction

The D-amino acid oxidase changes into Glularyl-7-amino cephalosporinic acid (GL-7-ACA) with cephalosporin.Prepare E.coli BL21 (DE3) pLysS that BL-HS-GHA[contains recommbined D-amino acid oxidase GHA by following method] coli somatic.

The source of BL-HS-GHA:

According to known Thermoanaerobacterium saccharolyticum glucoseisomerase dna sequence dna (GenBank L09699), design PCR primer is specially:

Upstream primer GI-NdeI:

5’-AGCCTAGGTTAATTAACTTTAAGAAGGAGATATACATATGAATAAATATTTTGAGA

Downstream primer GI-EcoRI:

5’-ATAAGCTCAGCGGCGCGCCTTATTCTGCAAACAAATAC

(available from ATCC, USA) DNA is a template, carries out PCR with above-mentioned primer, and amplification obtains 1, the 376bp product with Thermoanaerobacterium saccharolyticum.The PCR condition is: 50 ng T.saccharolyticum DNA, 0.4 μ M GI-NdeI, 0.4 μ MGI-EcoRI, 50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 20mM Tris-HCl (pH is 8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄, 0.1%Triton X-100,2.5 U Platinum Taq High Fidelity archaeal dna polymerases (Invitrogen) transfer to 50 μ L with sterilized water with reaction volume.The pcr amplification reaction program is: 95 ℃, and 5 minutes; 94 ℃, 1 minute, 50 ℃, 1 minute, 72 ℃, 3 minutes, circulate 35 times; 72 ℃, 10 minutes.The PCR product is purified through 0.8% agarose electrophoresis, utilizes the TA cloning process, is connected with pGEMT-Easy (Promega), gets pGEMT-Easy-GI.Cut pGEMT-Easy-GI with NdeI and EcoRI enzyme, purify, and is connected with the pRSET-lac-kan that the EcoRI enzyme is cut through NdeI through 0.8% agarose electrophoresis, must pRSET-lac-GI-kan.According to known hok/sok gene fragment order (GenBank X05813) design 10 primers (seeing Table 3).Pcr gene is constructed according to Kikuchi, M.et al., and 1999, Gene236:159-167 is described, and only concrete steps have change.The PCR condition is: each primer of 20ng, 50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 20mMTris-HCl (pH is 8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mM MgSO ₄, 0.1%Triton X-100,2.5U Pfu archaeal dna polymerase (Promega) transfers to 50 μ L with sterilized water with reaction volume.The pcr amplification reaction program is: 95 ℃, and 4 minutes; 94 ℃, 1.5 minutes, 50 ℃, 1.5 minutes, 72 ℃, 5 minutes, circulate 30 times; 72 ℃, 10 minutes.Get pcr amplification reaction mixture 5 μ L and make template, primer 1 and 10 is complied with above-mentioned condition pcr amplification once more, gets the long 580bp of being of PCR product, contains AscI and EcoRI restriction enzyme site respectively at its 5 ' and 3 ' end.The PCR product is purified through 0.8% agarose electrophoresis, after AscI and EcoRI enzyme are cut, be connected with the pRSET-lac-GI-kan that cuts through AscI and EcoRI enzyme, pRSET-lac-GI-hok/sok-kan.

Table 3

Sequence number	Primer sequence
		1	5’-ttggcgcgccttaagatatcaacaaactccgggaggcagc gtgatgcggcaacaatcacacggatttcccgtgaa-3’
2	5’-catatacctgcacgctgaccacactcactttccctgaaaa taatccgctcattcagaccgttcacgggaaatccgtgtga-3’
		3	5’-ggtcagcgtgcaggtatatgggctatgatgtgcccggcgc ttgaggctttctgcctcatgacgtgaaggtggtttgttgc-3’

4	5’-cgtggtggttaatgaaaattaacttactacggggctatct tctttctgccacacaacacggcaacaaaccaccttcacgt-3’
		5	5’-aattttcattaaccaccacgaggcatccctatgtctagtc cacatcaggatagcctcttaccgcgctttgcgcaaggaga-3’
6	5’-tgagacacacgatcaacacacaccagacaagggaacttcg tggtagtttcatggccttcttctccttgcgcaaagcgcgg-3’
		7	5’-tgtgttgatcgtgtgtctcacactgttgatattcacttat ctgacacgaaaatcgctgtgcgagattcgttacagagacg-3’
8	5’-cgcctccaggttgctacttaccggattcgtaagccatgaa agccgccacctccctgtgtccgtctctgtaacgaatctcg-3’
		9	5’-taagtagcaacctggaggcgggcgcaggcccgccttttca ggactgatgctggtctgactactgaagcgcctttataaag-3’
10	5’-cggaattcacaacatcagcaaggagaaaggggctaccggc gaaccagcagcccctttataaaggcgcttcagt-3’

With NdeI and BglII digested plasmid pRSET-kan-DAOGHA (publication number is the Chinese patent application of CN1680558), get 1,074bp genetic fragment (including D-amino acid oxidase mutant GHA gene), purify through 0.8% agarose electrophoresis, the lengthy motion picture disconnection that obtains with the pRSET-lac-GI-hok/sok-kan that cuts through NdeI and BglII enzyme connects, get pHS-GHA, its complete nucleotide sequence is listed among Fig. 6.With pHS-GHA transformed competence colibacillus e. coli bl21 (DE3) pLysS (Novagen), get bacterial strain BL-HS-GHA.

Preparation BL-HS-GHA[contains E.coliBL21 (DE3) pLysS of recommbined D-amino acid oxidase GHA] method of thalline is as described below.

Picking list bacterium colony Escherichia coli BL-HS-GHA from kanamycins (50 μ g/mL) the LB agar plate, be inoculated into 2 * 5 mL and contain the liquid LB culture medium of kanamycins (50 μ g/mL), cultivate 8 hours (shaking speed is 250 rev/mins) at 37 ℃, inoculate the seed culture medium that contains kanamycins (100g/mL) and chloramphenicol (40 μ g/mL) to 2 * 50mL, cultivate 16 hours (shaking speed is 400 rev/mins) at 30 ℃.

The preparation of corn steep liquor 1:

(available from North China pharmacy Kang Xin Co., Ltd) is dissolved in the distilled water of 300mL with the 300g corn steep liquor, stirs back centrifugal (5,000g, 8 minutes), and supernatant is corn steep liquor 1.Sediment is continued to employ.

The preparation of corn steep liquor 2:

Above-mentioned sediment is dissolved in the distilled water of 600mL again, stirs back centrifugal (5,000g, 8 minutes), supernatant is corn steep liquor 2.

Each composition weight is as follows in the 50mL seed culture medium:

Corn steep liquor 14mL

Corn steep liquor 24mL

Yeast extract 0.2g

Ammonium sulfate 0.075g

Sodium hydrogen phosphate 0.25g

Potassium dihydrogen phosphate 0.04g

Sodium chloride 0.075g

Each composition is dissolved in the distilled water of 50mL, with 10N NaOH the pH value is transferred to 7.15, high-temperature sterilization.

Seed spends the night after the fermentation, with the seed of whole 100mL be seeded to the 2L fermentation tank that contains kanamycins (50 μ g/mL) (BIOENGINEERING, Benchtop Fermentor, KLF2000).

Each composition weight is as follows in the 2L fermentation medium:

Corn steep liquor 1 160mL

Corn steep liquor 2 160mL

Yeast extract 8g

Ammonium sulfate 3g

Sodium hydrogen phosphate 10g

Potassium dihydrogen phosphate 1g

Sodium chloride 3g

Each composition is dissolved in the distilled water of 1.9L, the pH value is transferred to 7.15, in 2L fermentation tank (BIOENGINEERING, Benchtop Fermentor, KLF2000) high-temperature sterilization with 10N NaOH.

12.5g glucose is dissolved in the distilled water of 50mL high-temperature sterilization; 1.25g magnesium sulfate is dissolved in the distilled water of 50mL high-temperature sterilization.

Before the fermentation glucose of having sterilized and magnesium sulfate are put in the 2L fermentation tank.

The preparation of feed supplement:

250mL corn steep liquor 1 and 250mL corn steep liquor 2 are mixed, with 10N NaOH the pH value is transferred to 7.25, high-temperature sterilization.

2.25g ammonium sulfate, 7.56g sodium hydrogen phosphate, 1.2g potassium dihydrogen phosphate, 2.25g sodium chloride are dissolved in the distilled water of 60mL high-temperature sterilization.

The 15g yeast extract is dissolved in the distilled water of 100mL high-temperature sterilization.

70g glucose is dissolved in the distilled water of 140mL high-temperature sterilization.

In the distilled water with 30mL glycerine mixing 10mL, high-temperature sterilization.

20g magnesium sulfate is dissolved in the distilled water of 30mL high-temperature sterilization.

All solution are mixed, and adding kanamycins is 50 μ g/mL until concentration, adds the defoamer of 2mL.

35 ℃ of growths, at initial 6 hours, the pH value rose to 7.2 naturally by 6.9, beginning feed supplement (50mL/ hour).Under equilibrium condition, (with 5 N potassium hydroxide the pH value is maintained 7.2, dissolved oxygen level pO ₂Be not more than 0.5%), continued growth 26 hours.

Behind ferment tank, bacterium separates (5,000g, 8 minutes) at 4 ℃ through centrifuge, abandons supernatant, gets precipitation, precipitation is resuspended in the sodium phosphate buffer (50mM, pH are 7.5) of 600mL.With pearl mill method cracking bacterium, with 50mL/ minute speed the resuspended liquid of bacterium is sent in the ball mill (DYNO-MILL TYP KDL, diameter are the bead of 0.2mm, WA Bachofen), last develop bacterium is residual with the sodium phosphate buffer (50mM, pH are 7.5) of 800mL again.Bacterial lysate was soaked 30 minutes in 55 ℃ of water-baths,, get supernatant, be thick pure recommbined D-amino acid oxidase GHA with high speed centrifugation (10,000g, 30 minutes).The purifying of D-amino acid oxidase is pressed Alonso basically, J., and Barredo, J.L., Diez, B., Mellado, E., Salto, F., Garcia, J.L., Cortes, E. (1998, Microbiology 144:1095-1101) is described.The thick pure recommbined D-amino acid oxidase GHA that extracts, adding glycerine to ultimate density is 10%, with 5N NaOH the pH value is transferred to 8, centrifugal (13,000g, 30 minutes) get supernatant.By the described preparation method of product supplier prepare DEAE-cellulose ion exchanger resin (Sigma, D-0909).By the thick pure enzyme mixing 0.5mL DEAE-cellulose ion exchanger resin of every 1mL, stir 5 hours (100 rev/mins) at 4 ℃, use pan (Buchner filter funnel, 120 mm P1) with the elimination of enzyme liquid.Wash DEAE-cellulose ion exchanger resin with 3 times of phosphate sodium dihydrogen buffer solutions (containing 10% glycerine), with 2 times of phosphate sodium dihydrogen buffer solutions recommbined D-amino acid oxidase GHA wash-out is come out again to the 400mM of DEAE-cellulose ion exchanger resin volume to the 40mM of DEAE-cellulose ion exchanger resin volume.By the recommbined D-amino acid oxidase GHA of every 1L wash-out, add 262g ammonium sulfate, in stirring at room 15 minutes (100 rev/mins).Centrifugal (13,000g, 15 minutes) abandon supernatant, keep sediment.After sediment is dissolved in 20mM phosphate sodium dihydrogen buffer solution (pH is 7.5), remove the residual sulfuric acid ammonium, enzyme liquid is concentrated into 25mg/ml with the ultrafiltration of MilliporeYM30 filter membrane.Detect the purity of protein with SDS-PAGE.Get enzyme liquid 20ml, add bovine serum albumin(BSA) 3g, distilled water 90ml stirs, and obtains diluting enzyme liquid 110ml.The melamine sponge is cut into thick tabular of 5.5cm, and the sponge of puncturing again makes it to have the duct that penetrates of evenly gathering, and (density in hole is 6/cm ², the aperture is 0.2cm, all ducts are parallel and be miter angle with the sponge puncturing surface); Then, sponge is cut into diameter be 8.5cm, high be the disk column of 3cm, and to stay a diameter in disk central authorities be 2cm, penetrate and perpendicular to the duct of disc face.Afterwards, operation in the following order: a) add 32ml dilution enzyme liquid on sponge carrier, extruding evenly distributes enzyme liquid in sponge; B) add 0.05% polymine (PEI) solution (pH is 7.0) 260ml to sponge, push sponge repeatedly and become clear by mixing, push and remove the liquid that is not adsorbed once more to extruding liquid; C) to the glutaraldehyde solution 260ml of sponge adding 0.05%, extruding is evenly distributed glutaraldehyde and removes the liquid that is not adsorbed.D) repeating step is a) to c) 5 times.Behind dry 24 hours of the moving air, must the heavy 9.2 cellular immobilization D-amino acid oxidase pieces that restrain.

Adopt retort as shown in Figure 4.Cellular immobilization D-amino acid oxidase piece is inserted in the net dish, press example 2 described method operant response jars, but with pH controller (Biotech-2020, emerging biological plant Co., Ltd is protected in Shanghai) replace pH meter, the peristaltic pump output of pH controller is connected the fluid infusion mouth 15 at jar end, the peristaltic pump liquid sucting port of pH controller is inserted in 15% the ammonia spirit.Before reinforced, close sample tap 5, infusion port 6, leakage fluid dram 14 and baiting valve 4, exhaust outlet 16 keeps open; Oxygen is fed in the jar from passage 7, and the adjusting throughput is 2.17L/min; 300ml 75mM cephalosporin sodium-salt aqueous solution (pH is 7.5) is added in the jar from the cover charging aperture, cover and screw charging aperture blind nut 18 then, starter motor and timing, regulating rotating speed is 600 rev/mins; Temperature is set at 25 ℃; It is 7.5 ± 0.1 that startup pH controller is kept reactant liquor pH with 15% ammoniacal liquor; In different time (10,20,30,40,50 minutes) sampling, be that example 5 is described in the Chinese patent application of CN1680558 with reference to publication No., with HPLC method (chromatographic column: Diamonsil ^TMC18,250 * 4.6mm; Phase flows: contain 50mM K ₂HP0 ₄/ KH ₂PO ₄And 5% acetonitrile, pH is 7.0; Column temperature is 30 ℃; Flow velocity is 1ml/min; The detection wavelength is 260nm) to measure immobilization D-amino-acid oxidase enzymatic conversion cephalosporin be the vigor and the conversion ratio of Glularyl-7-amino cephalosporinic acid (GL-7-ACA).One unit enzyme activity is defined as at above-mentioned reaction condition per minute and transforms the enzyme amount that micromole's cephalosporin is the Glularyl-7-amino cephalosporinic acid.Carry out 7 secondary responses altogether, 99% cephalosporin was all transformed within 50 minutes to finish; This example records the initial 10 minutes enzyme activity of immobilization D-amino acid oxidase and is not less than 265 units/gram.

Example 10. monoblock perforate immobilized cells prepare 7-amino-cephalosporanic acid (7-ACA) as paddle batch stirring reaction

Glularyl-7-amino cephalosporinic acid acylase changes into 7-amino-cephalosporanic acid (7-ACA) with Glularyl-7-amino cephalosporinic acid (GL-7-ACA).The structure of Glularyl-7-amino cephalosporinic acid acylase expression vector pT7-kan-ACY: according to known pseudomonas SE83 Glularyl-7-amino cephalosporinic acid acylase dna sequence dna (Matsuda; A.etal.; 1987; J.Bacteriol.169; 5821-5826); design PCR upstream primer NdeI-ACY:5 '-CATATGAACGCTCCCGTCCCCGTCCC-3 ' and PCR downstream primer BglII-ACY:

5’-AGATCTTCAGATGGTGAAGCGGGCAC-3’。With pseudomonas SE83DNA is template, carries out PCR with above-mentioned primer, and amplification obtains 1, the 676bp product.The PCR condition is: 50ng pseudomonas SE83 DNA, 0.4 μ M NdeI-ACY, 0.4 μ MBglII-ACY, 50 μ M dATP, 50 μ M dTTP, 50 μ M dCTP, 50 μ M dGTP, 20mM Tris-HCl (pH is 8.8), 10mM KCl, 10mM (NH ₄) ₂SO ₄, 2mMMgSO ₄, 0.1%Triton X-100,2.5 U Pfu archaeal dna polymerases (Promega) are transferred reaction volume to 50 μ L with sterilized water.

The pcr amplification reaction program is: 95 ℃, and 5 minutes; 94 ℃, 1 minute, 50 ℃, 1 minute, 72 ℃, 3 minutes, circulate 35 times; 72 ℃, 10 minutes.This PCR product (1,676bp) contain NdeI and BglII restriction enzyme site respectively at 5 ' and 3 ' end.The PCR product is purified through 0.8% agarose electrophoresis, after NdeI and BglII enzyme are cut, and be connected with the pRSET-kan that the BglII enzyme is cut through NdeI, pT7-kan-ACY, its concrete nucleotides sequence is shown among Fig. 7.With pT7-kan-ACY transformed competence colibacillus e. coli bl21 (DE3) pLysS (Novagen), get bacterial strain BL-T7K-ACY.

To contain the 20L LB fluid nutrient medium of kanamycins (50mg/L), cultivated Escherichia coli BL-T7K-ACY 24 hours at 37 ℃, centrifugal collection thalline obtains the wet thallus cell.

The wet thallus cell is suspended in the distilled water of 4 times of thalline weight.The melamine sponge is cut into the sheet band shape of 0.5 * 5.5 * 150cm (3.3g), express the Escherichia coli immobilized cell of Glularyl-7-amino cephalosporinic acid acylase by following operating sequence preparation: a) the sponge sheet band is immersed in the cell suspension, the extruding sponge evenly distributes bacterium liquid in sponge, sponge is removed bacterium liquid too much on the sponge by roller bearing is pushed, and the gap of regulating two pairs of roller bearings makes bacterium liquid adsorbed on the sponge be about 100g; B) add 0.1% the polymine (pH is 7.0) of 300ml to sponge, the extruding sponge so that polymine evenly distribute, sponge once more by to roller bearing to remove the liquid that is not adsorbed; C) add 0.1% the glutaraldehyde solution of 300ml to sponge, the extruding sponge so that glutaraldehyde evenly distribute and remove too much liquid; D) repeating step is a) to c) 5 times; each repeating step is a) time; regulate the gap between two pairs of roller bearings so that the bacterium liquid measure that sponge is adsorbed once more is about 70g; then with distilled water extruding washing 3 times; after removing the liquid that is not adsorbed by extruding; drying is 10 hours in moving air, obtains Glularyl-7-amino cephalosporinic acid acylase immobilized cell sheet band 26g.

Adopt retort as shown in Figure 4.26g Glularyl-7-amino cephalosporinic acid acylase immobilized cell sheet tape wrapping is become reel and insert in the net dish, press example 9 described method operant response jars, but obstructed oxygen.Close sample tap 5, blow vent 7, exhaust outlet 16, infusion port 6, fluid infusion mouth 15, leakage fluid dram 14 and baiting valve 4; The Glularyl-7-amino cephalosporinic acid solution of example 9 preparations is added in the jar from the charging aperture on the cover 11, cover and screw charging aperture blind nut 18, starter motor and timing, the control temperature is 25 ℃, regulates rotating speed; It is 8.0 ± 0.1 that startup pH controller is kept reactant liquor pH with 5N NaOH; Take a sample from sample tap 5 at different time (10,30,60 minutes), with reference to Binder, R.et al., (1994, Appl.Environ.Microbiol.60,1805-1809) described method is with HPLC method (chromatographic column: Diamonsil ^TMC18,250 * 4.6mm; Phase flows: the K that contains 50mM ₂HPO ₄/ KH ₂PO ₄And 5% acetonitrile, pH is 7.0; Column temperature is 30 ℃; Flow velocity is 1ml/min; The detection wavelength is 260nm) measuring Glularyl-7-amino cephalosporinic acid acylase, to transform the Glularyl-7-amino cephalosporinic acid be the vigor of 7-amino-cephalosporanic acid (7-ACA).One unit Glularyl-7-amino cephalosporinic acid acylase activity is defined as at above-mentioned reaction condition per minute and transforms the enzyme amount of micromole's Glularyl-7-amino cephalosporinic acid to the 7-amino-cephalosporanic acid.Record initial 10 minutes enzyme activity in the experiment of four different rotating speeds, the result is as shown in table 5.

Table 5

Experiment	Reaction solution concentration (CPC)	Volume (mL)	Rotating speed (rpm)	The acylase vigor (units/gram) that immobilized cell is initial 10 minutes
					1	75mM	300	150	37.91
2	75mM	300	300	47.85
					3	75mM	300	600	48.38
4	75mM	270	900	51.10

Example 11. monoblock perforate immobilized cells prepare high concentration 7-amino-cephalosporanic acid as paddle batch stirring reaction

The Glularyl-7-amino cephalosporinic acid acylase immobilized cell sheet band that use-case 10 is used; and prepare the 7-amino-cephalosporanic acid as carrying out the catalysis stirring reaction as described in the example 10, only use the Glularyl-7-amino cephalosporinic acid solution and the speed of agitator of the high concentration of substrate (97.7mM) of 320ml to be 900rpm.Vigor and conversion ratio as mensuration Glularyl-7-amino cephalosporinic acid acylase as described in the example 10.Recording initial 10 minutes vigor is 61.78 units/gram immobilized cells; 10,20,30 and 40 minutes conversion ratio is respectively 70.7%, 87.40%, 92.0% and 93.36%.Compare with the data of example 10, concentration of substrate improves after 26%, the also corresponding raising about 20% of enzyme activity.

Example 12. particle immobilised enzymes are as paddle batch stirring reaction

Press example 10 fermentation Escherichia coli BL-T7K-ACY24,4 ℃ through centrifuge separation of bacterial (5,000g, 8 minutes) then, abandon supernatant, obtain wet bacterium.Bacterium is resuspended in the sodium phosphate buffer (50mM, pH are 8) of 400mL.With pearl mill method cracking bacterium, with 50mL/ minute speed the resuspended liquid of bacterium is sent in the ball mill (DYNO-MILL TYPKDL, diameter are the bead of 0.2mm, WA Bachofen), develop bacterium is residual with the sodium phosphate buffer (50mM, pH are 8) of 600mL again.Bacterial lysate is placed in 55 ℃ of water-baths soaked 15 minutes, high speed centrifugation is got supernatant after (10,000g, 30 minutes), is thick pure pseudomonas SE83 Glularyl-7-amino cephalosporinic acid acylase.

The preparation of immobilization pseudomonas SE83 Glularyl-7-amino cephalosporinic acid acylase is carried out with reference to the explanation of carrier supplier Germany R  hm company, and wherein concrete steps have change.Get the wet carrier and 1 of 50g Eupergit C250L, the thick pure pseudomonas SE83 Glularyl-7-amino cephalosporinic acid acylase of the preparation as mentioned above of 900mL (protein concentration is 3mg/ml) mixes, and at room temperature stirs (300 change 72 hours), leaves standstill a moment.Filter then; with distilled water agitator treating (300 change, 2 minutes) at room temperature, drain with No. 3 sand core funnels; the protein content of repeated washing step 8 time in filtered fluid is less than 0.1mg/mL, promptly obtains 202 gram immobilization Glularyl-7-amino cephalosporinic acid acylase particles.

Adopt retort as shown in Figure 4,200 gram immobilization Glularyl-7-amino cephalosporinic acid acylase particles packed in the net dish 20, with inner surface (end, lid, the week) lining of net dish 20 with 200 purpose filter clothes, in case particle spills.Afterwards, the operations of reaction condition, detection method and retort etc. are basic identical with example 10, just rotating speed is 800rpm, substrate is that (Glularyl-7-amino cephalosporinic acid preparation method is referring to Shibuya for the Glularyl-7-amino cephalosporinic acid of 75mM for 300mL concentration, Y.et a1., 1981, Agric.Biol.Chem.45,1561-1567), be 5,15,30 and 60 minutes sample time.Conversion ratio as mensuration Glularyl-7-amino cephalosporinic acid acylase as described in the example 10.Record the conversion ratio that 5,15,30 and 60 minutes Glularyl-7-amino cephalosporinic acids are converted into 7-amino-cephalosporanic acid (7-ACA) and be respectively 49.16%, 62.23%, 79.33% and 93.49%.

The reduction of example 13. 1,4-benzoquinone

With qualitative filter paper 102 (Hangzhou Paper Co., Ltd of Xinhua) 10%Pd/C catalyst 20 is restrained (BDH Laboratory Suppliers Poole, England) be bundled into 3cm * 3cm parcel, be wrapped on reactor net dish inwall shown in Figure 4 with 450 order filter clothes again.5 gram 1,4-benzoquinone (chemical pure, Chemical Reagent Co., Ltd., Sinopharm Group) are dissolved in 500 ml methanol, add one of 6 M HCl.The 1,4-benzoquinone methanol solution is injected retort shown in Figure 4, with reference to example 2 operant response jars.Rotating speed is controlled at 500rpm; Feed hydrogen, hydrogen flowing quantity is controlled at and is 2L-3L/min.With the OD value of 754 type ultraviolet specrophotometers (Shanghai Spectrum Apparatus Co., Ltd.), calculate the percent reduction of 1,4-benzoquinone at 435nm place assaying reaction liquid.Measurement result is as shown in table 6:

Table 6

Reaction time (min)	0	30	60	90
					1,4-benzoquinone content (%)	1	0.634	0.482	0.364
The 1,4-benzoquinone percent reduction	0	36.6	51.8	63.6

The reduction of example 14. Tanshinone I I A

Catalyst system therefor, retort and operation thereof are all described with reference to example 13.Substrate solution is for containing the ethanolic solution (500 milliliters) of 406 milligrams of Tanshinone I I A (the ancient white silk power professor of Zhongshan University provides).In Tanshinone I I A ethanol injecting reactor, open reactor, rotating speed is controlled at 500rpm; Feed hydrogen, hydrogen flowing quantity is controlled at and is 2L-3L/min.With the OD value of 754 type ultraviolet specrophotometers (Shanghai Spectrum Apparatus Co., Ltd.), calculate the percent reduction of 1,4-benzoquinone at 435nm place assaying reaction liquid.Measurement result is as shown in table 7:

Table 7

Reaction time (min)	0	120	150
				Tanshinone I I A content (%)	0.0813	0.00789	0.0039
Tanshinone I I A percent reduction	0	90.3	95.2

By above-mentioned application example as seen, compare with existing reactor, the utility model adopts the solid-phase catalyst of monoblock or uses a large amount of solid-phase catalysts that load of net dish/net bucket, the density of solid-phase catalyst can be considerably beyond existing stirring reactor in the retort, reach the tank body total capacity 95% or more than, reaction speed can therefore improve, then corresponding shortening of reaction time.This substrate or product to easy degraded is particularly favourable.Highdensity solid-phase catalyst consumption more can improve the concentration of when reaction substrate, and then fast reaction speed, and the purifying, crystallization etc. that help product with improve productive rate.And when reaction, solid-phase catalyst in net dish/net bucket 20 keeps static with respect to rotating shaft 21, also not direct and retort tank skin bumps against, avoided the collision between the solid-phase catalyst and agitator, solid-phase catalyst and tank skin and solid-phase catalyst in the stirring reactor thus and breaking and wearing and tearing of causing, thereby prolong the life cycle of solid-phase catalyst, also reduce impurity such as catalyst in the reactant liquor, zymoprotein, fixation support fragment and cell fragment, be convenient to product purification.In addition, when reaction, because centrifugal action, the mass transfer between reactant liquor and the solid-phase catalyst surface is accelerated, and therefore with respect to the packed bed reaction column, the catalytic efficiency of the utility model reaction promotes greatly.

No matter whole disclosures of the various documents of reference in the present patent application are patent documentation or non-patent literature, all incorporate this paper into way of reference.In addition, the utility model is not subjected to the restriction of the above-mentioned specific embodiment and application example.The utility model can be made various changes in the scope that claims are summarized, these change also within scope of the present utility model.

Claims (18)

1. reactor, comprise at least one retort, described retort comprises tank body, is installed on rotating rotating shaft in the tank body, it is characterized in that: described retort comprises that also being fixed on being used in the described rotating shaft holds the container of solid-phase catalyst, described container has outer wall, and being distributed with on whole outer wall can penetrating reactant liquor and gas but the hole of penetrating described solid-phase catalyst not.

2. reactor according to claim 1 is characterized in that: the perisporium that described outer wall has first end face, second end face and extends between first end face and second end face.

3. reactor according to claim 2 is characterized in that: first end face of described outer wall and second end face are provided with the hole that is used for interspersed rotating shaft, and the shape in described hole and size are complementary with rotating shaft.

4. reactor according to claim 3 is characterized in that: described hole is arranged on first end face of described container and the central position on second end face.

5. reactor according to claim 1 is characterized in that: described container also comprises inner core, and the internal diameter of described inner core and the external diameter of rotating shaft are complementary.

6. reactor according to claim 1 is characterized in that: described retort is a vertical type.

7. reactor according to claim 1 is characterized in that: the ratio of the volume of described container and the volume of retort is between 1% to 95%.

8. reactor according to claim 1 is characterized in that: described rotating shaft have with tank body in the channel that is used to carry liquid and/or gas that is interlinked to the outside.

9. reactor according to claim 1 is characterized in that: adopt bolt fixed mode between described container and the rotating shaft.

10. reactor according to claim 1 is characterized in that: adopt the clip fixed form between described container and the rotating shaft.

11. reactor according to claim 1 is characterized in that: adopt singly-bound or spline fixed form between described container and the rotating shaft.

12. reactor according to claim 1 is characterized in that: described solid-phase catalyst is a graininess.

13. reactor according to claim 1 is characterized in that: described solid-phase catalyst is a monoblock.

14. reactor according to claim 1, described solid-phase catalyst are immobilised enzymes/immobilized cell.

15. reactor according to claim 12, described graininess solid-phase catalyst is immobilised enzymes/immobilized cell.

16. reactor according to claim 13 is characterized in that: the solid-phase catalyst of described monoblock is immobilised enzymes/immobilized cell.

17. according to claim 15 or 16 described reactors, it is characterized in that: described solid-phase catalyst is by enzyme or expresses the cell of enzyme and the porous organic foam material of perforate is made.

18. reactor according to claim 17 is characterized in that: described organic foam material comprises wood pulp sponge, polyvinylalcohol sponge and melamine sponge.

Images