CN218554115U - Digital PCR chip and detection device based on nanogold heating - Google Patents
Digital PCR chip and detection device based on nanogold heating Download PDFInfo
- Publication number
- CN218554115U CN218554115U CN202223014678.4U CN202223014678U CN218554115U CN 218554115 U CN218554115 U CN 218554115U CN 202223014678 U CN202223014678 U CN 202223014678U CN 218554115 U CN218554115 U CN 218554115U
- Authority
- CN
- China
- Prior art keywords
- temperature
- liquid
- digital pcr
- communicated
- channel
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The utility model provides a digital PCR chip and a detection device based on nanogold heating, the chip comprises a chip body consisting of an upper substrate and a lower substrate, wherein the upper substrate is provided with a liquid drop generation unit, a temperature circulation unit and a fluorescence detection unit which are sequentially communicated by utilizing a micro-channel; the lower substrate is used for hermetically packaging the chip body; the detection device comprises a digital PCR chip, a laser lamp, a liquid storage tank, a waste liquid tank and a negative pressure pump; the utility model discloses under the effect of negative pressure pump, the reaction system in the liquid storage tank gets into liquid drop generating element with the oil phase and generates the liquid drop, and the liquid drop gets into fluorescence detecting element and carries out fluorescence statistics after getting into the temperature cycle unit and accomplishing a plurality of temperature cycles, collects into the waste liquid pond at last. The utility model discloses a setting only needs the temperature cycle unit that laser irradiation can realize the control by temperature change, combines together nanometer gold photothermal effect and biochip, and the control by temperature change precision is high, provides the temperature guarantee for the PCR thermal cycle.
Description
Technical Field
The utility model relates to a digital polymerase chain reaction technical field, concretely relates to digit PCR chip and detection device based on heating of nanometer gold.
Background
Digital Polymerase Chain Reaction (dPCR) is a new generation of absolute quantitative detection technology for nucleic acid molecules, which disperses a sample solution into tens of thousands of Reaction units, so that each Reaction unit contains one or no target nucleic acid molecule. And then, each unit can be used as an independent reaction system to amplify the target molecules and generate fluorescent signals, and the accurate quantitative detection of the target nucleic acid molecules can be realized by counting the fluorescent signals of each unit. The dPCR technology has high sensitivity, strong specificity and good accuracy, and can be widely applied to a plurality of fields such as clinical diagnosis, environmental microorganism detection and the like.
The dPCR amplification process mainly comprises three steps of denaturation of nucleic acid under a high-temperature condition, annealing of nucleic acid under a low-temperature condition and extension, and the amplification of nucleic acid signals can be realized by circularly heating the reaction unit in a high-temperature region and a low-temperature region in a reciprocating manner. Therefore, it is particularly important to realize accurate and rapid temperature control in the dPCR process. The existing detection method usually adopts a PCR (polymerase chain reaction) amplification instrument to complete nucleic acid amplification, however, components such as a heating module, a fan heat dissipation module, a precise temperature control module and the like are mostly used in the temperature control of the PCR instrument in the current market, so that a long time is needed in temperature rise and fall, the detection speed is restricted, and the PCR instrument is large in size and poor in portability. Therefore, the utility model relates to a detect high-efficient, the high just portable PCR detection device of control by temperature change precision very important.
The nano-gold has good photo-thermal characteristics, generates photo-thermal effect under the irradiation of specific laser, can rapidly rise in temperature within a short time, and provides temperature guarantee for PCR thermal cycle. Therefore, there is a need for a nanogold heating-based digital PCR chip to achieve rapid, efficient and portable detection of nucleic acids.
SUMMERY OF THE UTILITY MODEL
In order to solve the above problems, it is necessary to provide a digital PCR chip based on nanogold heating and a detection device.
The utility model discloses a first aspect provides a digital PCR chip based on nanogold heating, including the chip body that comprises upper substrate and infrabasal plate, the upper substrate is provided with the liquid drop generation unit, temperature cycle unit and the fluorescence detection unit that utilize the miniflow channel to communicate in proper order;
the lower substrate is used for hermetically packaging the chip body;
the liquid drop generating unit is used for generating liquid drops, and is provided with a liquid inlet for sample liquid to enter and a liquid drop outlet for liquid drops to flow out; the liquid drop outlet is communicated with a snake-shaped flow channel inlet of the temperature circulating unit;
the temperature circulating unit comprises a high temperature area, a low temperature area and a snake-shaped flow passage;
the high-low temperature zones are formed by arranging two temperature zone grooves on the upper substrate in an up-down manner and embedding nanogold with different concentrations in the two temperature zone grooves; wherein, the temperature zone groove where the high-concentration nano-gold is positioned forms a high-temperature zone when being irradiated by laser, and the temperature zone groove where the low-concentration nano-gold is positioned forms a low-temperature zone when being irradiated by the laser;
the snakelike flow channel consists of a plurality of U-shaped flow channels which are arranged on the bottom surface of the upper substrate and are arranged up and down; the U-shaped flow channels at the upper part are embedded in the temperature area groove of the high-temperature area, the U-shaped flow channels at the lower part are embedded in the temperature area groove of the low-temperature area, the bottom walls of the flow channels are arranged in an open mode, the U-shaped flow channels positioned in the two temperature areas are sequentially communicated according to a high-temperature interval and a low-temperature interval for temperature circulation, the inlet of the first U-shaped flow channel positioned in the high-temperature area is used as the inlet of the snake-shaped flow channel of the temperature circulation unit, and the outlet of the last U-shaped flow channel positioned in the low-temperature area is used as the outlet of the snake-shaped flow channel of the temperature circulation unit;
the fluorescence detection unit comprises a sample outlet arranged on the top surface of the upper substrate and a liquid drop array storage cavity arranged on the bottom surface of the upper substrate and used for performing fluorescence statistics; and the inlet of the liquid drop array storage cavity is communicated with the snake-shaped flow passage outlet of the temperature circulating unit, and the outlet of the liquid drop array storage cavity is communicated with the sample outlet.
Based on the above, the upper substrate and the lower substrate are both substrates made of siliceous materials.
Based on the above, the temperature of the high-temperature zone formed by the temperature zone groove with the high-concentration nano-gold under the laser irradiation is 85-98 ℃, and the temperature of the low-temperature zone formed by the temperature zone groove with the low-concentration nano-gold under the laser irradiation is 50-72 ℃.
Based on the above, the number of temperature cycles is 20-40.
The utility model provides a second aspect provides a digital PCR detection device based on nanogold heating, which comprises a digital PCR chip based on nanogold heating, a laser lamp, a liquid storage tank, a waste liquid tank and a negative pressure pump;
the laser lamps are arranged above the two temperature areas of the digital PCR chip and used for providing irradiation light;
a liquid inlet of a liquid drop generating unit of the digital PCR chip is communicated with the liquid storage tank;
and a sample outlet of a fluorescence detection unit of the digital PCR chip is communicated with the waste liquid pool, and the waste liquid pool is communicated with the negative pressure pump.
Based on the above, the liquid storage tank comprises a water phase liquid storage tank and an oil phase liquid storage tank;
the liquid drop generating unit of the digital PCR chip comprises a first sample inlet and a second sample inlet which are arranged on the top surface of the upper substrate and are used as liquid inlets, and a first micro-channel and a second micro-channel which are arranged on the bottom surface of the upper substrate;
the first micro-channel and the second micro-channel are intersected and communicated with each other to form a cross-shaped structure; two ends of the first micro-channel are communicated with the first sample inlet, one end of the second micro-channel is communicated with the second sample inlet, and the other end of the second micro-channel is used as the liquid drop outlet;
the water phase liquid storage tank is communicated with the second sample inlet, and the oil phase liquid storage tank is communicated with the first sample inlet.
The utility model discloses relative prior art has substantive characteristics and progress, specific theory:
1. the utility model discloses a temperature cycle unit that only needs laser irradiation can realize the control by temperature change is set up, nanometer gold photothermal effect combines together with biochip, and the control by temperature change precision is high, provides the temperature guarantee for PCR thermal cycle, has solved traditional PCR device and has needed longer time when rising and falling the temperature to restriction detection speed's problem;
2. the utility model discloses a temperature cycle unit is through setting up snakelike runner, and the two advantage of full play is realized to the nanometer gold optothermal effect of reunion, realizes detecting required temperature cycle many times.
Drawings
Fig. 1 is a schematic diagram of the overall structure of the digital PCR chip of the present invention.
FIG. 2 is a top view of the digital PCR chip of the present invention.
FIG. 3 is a cross-sectional view of the serpentine channel of the digital PCR chip of the present invention.
Fig. 4 is a schematic sectional view taken along line B-B of fig. 2.
Fig. 5 is a schematic structural diagram of the digital PCR detection apparatus of the present invention.
In the figure: nano gold A; an upper substrate 1; a lower substrate 2; a droplet generating unit 3; a temperature cycle unit 4; a fluorescence detection unit 5; a first sample inlet 6; a second sample inlet 7; a first microchannel 8; a second microchannel 9; a laser lamp 10; a high-temperature zone 11; a low-temperature zone 12; a first U-shaped channel 13 of the high temperature zone; a first U-shaped flow channel 14 of the low temperature zone; the last U-shaped channel 15 of the low temperature zone; a sample outlet 16; a droplet array storage chamber 17; a waste liquid tank 18; a negative pressure pump 19; a water phase liquid storage tank 20; an oil phase reservoir 21.
Detailed Description
In order to make the purpose and technical solution of the present invention more clearly understood, the present invention is further described in detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
Example 1
As shown in fig. 1 to 4, the present embodiment provides a digital PCR chip based on nanogold heating, which includes a chip body composed of an upper substrate 1 and a lower substrate 2, wherein the upper substrate 1 is provided with a droplet generation unit 3, a temperature circulation unit 4 and a fluorescence detection unit 5 which are sequentially communicated by using a micro channel; the lower substrate 2 is used for hermetically packaging the chip body. Specifically, the dimensions of the upper substrate 1 and the lower substrate 2 are 90mm × 40mm × 5mm, and both are made of a silicon material (PDMS polymer).
The liquid drop generating unit 3 is used for generating liquid drops, and is provided with a liquid inlet for sample liquid to enter and a liquid drop outlet for liquid drops to flow out; the liquid drop outlet is communicated with the snake-shaped flow channel inlet of the temperature circulating unit 4;
specifically, the droplet generation unit 3 includes a first sample inlet 6 and a second sample inlet 7 disposed on the top surface of the upper substrate 1 and used as liquid inlets, and a first microchannel 8 and a second microchannel 9 disposed on the bottom surface of the upper substrate 1; the first micro-channel 8 and the second micro-channel 9 are intersected and communicated with each other to form a cross-shaped structure; two ends of the first micro-channel 8 are communicated with the first sample inlet, one end of the second micro-channel 9 is communicated with the second sample inlet 7, and the other end of the second micro-channel 9 is used as the liquid drop outlet;
further, the inner diameters of the first sample inlet 6 and the second sample inlet 7 are both 5mm, and the widths and the depths of the first micro flow channel 8 and the second micro flow channel 9 are both 150 μm.
The temperature circulating unit 4 comprises a high temperature area, a low temperature area and a snake-shaped flow passage; the high-low temperature regions are formed by arranging two temperature region grooves in an upper substrate 1 and a lower substrate 1 in an up-down arrangement mode and embedding nano-gold A with different concentrations in the two temperature region grooves; wherein, the temperature zone groove where the high concentration nano-gold is located forms a high temperature zone 11 when being irradiated by laser, and the temperature zone groove where the low concentration nano-gold is located forms a low temperature zone 12 when being irradiated by the laser; preferably, the temperature of the high-temperature zone 11 formed by the temperature zone groove in which the high-concentration nano-gold is positioned when the laser is irradiated is 85-98 ℃, and the temperature of the low-temperature zone 12 formed by the temperature zone groove in which the low-concentration nano-gold is positioned when the laser is irradiated is 50-72 ℃;
the snakelike flow channel consists of a plurality of U-shaped flow channels which are arranged on the bottom surface of the upper substrate and are arranged up and down; the U-shaped flow channels at the upper part are embedded in the temperature area groove of the high-temperature area, the U-shaped flow channels at the lower part are embedded in the temperature area groove of the low-temperature area, the bottom walls of the flow channels are arranged in an open mode, the U-shaped flow channels positioned in the two temperature areas are sequentially communicated according to a high-temperature interval and a low-temperature interval for temperature circulation, the inlet of the first U-shaped flow channel 13 positioned in the high-temperature area is used as the inlet of the snake-shaped flow channel of the temperature circulation unit, and the outlet of the last U-shaped flow channel 15 positioned in the low-temperature area is used as the outlet of the snake-shaped flow channel of the temperature circulation unit;
specifically, the outlet of the second microchannel 9 is communicated with the inlet of the first U-shaped channel 13 of the high temperature region, the liquid drops are heated in the high temperature region, the outlet of the U-shaped channel 13 is communicated with the inlet of the first U-shaped channel 14 of the low temperature region, and the liquid drops are heated in the low temperature region to complete one complete temperature cycle. The outlet of the U-shaped flow channel 14 is communicated with the inlet of the second U-shaped flow channel in the high-temperature area, and then the liquid drops enter the high-temperature area to continue the heating reaction until the liquid drops flow out from the outlet of the last U-shaped flow channel 15 in the low-temperature area. The liquid drops are alternately and circularly heated in the U-shaped flow channels of the high-temperature area and the low-temperature area to complete a plurality of temperature cycles, and the optimal times of the temperature cycles are 20-40. The width and depth of the U-shaped flow channel of the serpentine flow channel in this embodiment are both 150 μm.
The fluorescence detection unit 5 comprises a sample outlet 16 arranged on the top surface of the upper substrate 1 and a liquid drop array storage cavity 17 arranged on the bottom surface of the upper substrate 1 and used for performing fluorescence statistics; the inlet of the liquid drop array storage cavity 17 is communicated with the outlet of the snake-shaped flow channel of the temperature circulating unit, and the outlet of the liquid drop array storage cavity 17 is communicated with the sample outlet 16. Specifically, the inner diameter of the sample outlet 16 is 5mm, and the size of the droplet array storage chamber 17 is 15mm × 15mm × 150 μm, so that a single-layer arrangement of droplets can be accommodated.
Example 2
As shown in fig. 5, the present embodiment provides a digital PCR detection apparatus based on nanogold heating, which includes the digital PCR chip based on nanogold heating described in embodiment 1, a laser lamp 10, a water phase liquid storage tank 20, an oil phase liquid storage tank 21, a waste liquid tank 18, and a negative pressure pump 19; the laser lamp 10 is arranged above two temperature areas of the digital PCR chip and used for providing irradiation light; the first sample inlet 6 of the droplet generating unit 3 of the digital PCR chip is communicated with the oil phase liquid storage tank 21, and the second sample inlet 7 of the droplet generating unit 3 of the digital PCR chip is communicated with the water phase liquid storage tank 20; the sample outlet 16 of the fluorescence detection unit 5 of the digital PCR chip is communicated with the waste liquid pool 18, and the waste liquid pool 18 is communicated with the negative pressure pump 19.
In this embodiment, under the action of the negative pressure pump 19, the reaction system and the oil phase in the water phase liquid storage tank 20 and the oil phase liquid storage tank 21 enter the liquid drop generating unit 3 to generate liquid drops, and after the liquid drops enter the temperature circulating unit 4 to complete a plurality of temperature cycles, the liquid drops enter the fluorescence detecting unit 5 to perform fluorescence statistics, and are finally collected into the waste liquid tank 18.
Example 3
The present embodiment illustrates a specific application of the digital PCR detection apparatus based on nanogold heating with the quantitative detection of AGV 2.
(1) Downloading a VP2 gene conserved sequence of the AGV2, and designing a probe primer group, wherein specific primers and sequences of the AGV2 are as follows: the primer is named AGV2-F, and the sequence is GACGATGGAGGAGTCACTGGTT;
(2) The reaction system consists of the following components: 10 mu L of special enzyme ddPCR Supermix for Probe for digital PCR, 1 mu L of each upstream primer and downstream primer with the concentration of 600nmol/L, 1 mu L of Probe with the corresponding concentration of 150nmol/L and 2 mu L of template, and finally adding ddH2O to make up for 20 mu L. The oil phase adopts fluorinated oil;
(3) The reaction system and the oil phase respectively enter the droplet generation unit 3 from the first sample inlet 6 and the second sample inlet 7, and droplets are formed at the cross-shaped structure of the droplet generation unit 3 by utilizing the flow focusing technology. And turning on the negative pressure pump 19, wherein the negative pressure pump 19 provides negative pressure so that the liquid drops can flow into the digital PCR chip to complete the reaction. The laser lamp 10 is turned on, and the nano-gold generates a photo-thermal effect under the irradiation of light to form a high-temperature and low-temperature region. The liquid drops enter the snake-shaped flow channel in the temperature circulation unit 4, after a plurality of temperature cycles are carried out in the snake-shaped flow channel, the liquid drops flow into the inlet of the liquid drop array storage cavity 17 from the outlet of the snake-shaped flow channel, and reach the fluorescence detection unit 5, the 488nm excitation light is used for irradiating detection reaction results, and the number of positive small chambers is counted. The molecular number of the initial template of the target to be detected can be calculated by utilizing the Poisson distribution principle.
Claims (6)
1. A digital PCR chip based on nanogold heating comprises a chip body consisting of an upper substrate and a lower substrate, and is characterized in that:
the upper substrate is provided with a liquid drop generating unit, a temperature circulating unit and a fluorescence detecting unit which are sequentially communicated by using a micro-channel;
the lower substrate is used for hermetically packaging the chip body;
the liquid drop generating unit is used for generating liquid drops and is provided with a liquid inlet for sample liquid to enter and a liquid drop outlet for liquid drops to flow out; the liquid drop outlet is communicated with the snake-shaped flow channel inlet of the temperature circulating unit;
the temperature circulating unit comprises a high temperature area, a low temperature area and a snake-shaped flow passage;
the high-low temperature zones are formed by arranging two temperature zone grooves on the upper substrate in an up-down manner and embedding nanogold with different concentrations in the two temperature zone grooves; wherein, the temperature zone groove where the high-concentration nano-gold is positioned forms a high-temperature zone when being irradiated by laser, and the temperature zone groove where the low-concentration nano-gold is positioned forms a low-temperature zone when being irradiated by the laser;
the snakelike flow channel consists of a plurality of U-shaped flow channels which are arranged on the bottom surface of the upper substrate and are arranged up and down; the U-shaped flow channels at the upper part are embedded in the temperature area groove of the high-temperature area, the U-shaped flow channels at the lower part are embedded in the temperature area groove of the low-temperature area, the bottom walls of the flow channels are arranged in an open mode, the U-shaped flow channels positioned in the two temperature areas are sequentially communicated according to a high-temperature interval and a low-temperature interval for temperature circulation, the inlet of the first U-shaped flow channel positioned in the high-temperature area is used as the inlet of the snake-shaped flow channel of the temperature circulation unit, and the outlet of the last U-shaped flow channel positioned in the low-temperature area is used as the outlet of the snake-shaped flow channel of the temperature circulation unit;
the fluorescence detection unit comprises a sample outlet arranged on the top surface of the upper substrate and a liquid drop array storage cavity arranged on the bottom surface of the upper substrate and used for performing fluorescence statistics; and the inlet of the liquid drop array storage cavity is communicated with the snake-shaped flow passage outlet of the temperature circulating unit, and the outlet of the liquid drop array storage cavity is communicated with the sample outlet.
2. The nanogold heating-based digital PCR chip according to claim 1, wherein: the upper substrate and the lower substrate are both substrates made of siliceous materials.
3. The nanogold heating-based digital PCR chip according to claim 1, wherein: the temperature of the high-temperature zone formed by the temperature zone groove with the high-concentration nano-gold under the laser irradiation is 85-98 ℃, and the temperature of the low-temperature zone formed by the temperature zone groove with the low-concentration nano-gold under the laser irradiation is 50-72 ℃.
4. The nanogold heating-based digital PCR chip according to claim 1, wherein: the number of temperature cycles is 20-40.
5. A digital PCR detection device based on nanogold heating is characterized in that: the digital PCR chip based on nanogold heating, which comprises the digital PCR chip, the laser lamp, the liquid storage tank, the waste liquid tank and the negative pressure pump which are arranged in any one of claims 1 to 4;
the laser lamps are arranged above the two temperature areas of the digital PCR chip and used for providing irradiation light;
a liquid inlet of a liquid drop generating unit of the digital PCR chip is communicated with the liquid storage tank;
and a sample outlet of a fluorescence detection unit of the digital PCR chip is communicated with the waste liquid pool, and the waste liquid pool is communicated with the negative pressure pump.
6. The nanogold heating-based digital PCR detection device according to claim 5, wherein: the liquid storage tank comprises a water phase liquid storage tank and an oil phase liquid storage tank;
the liquid drop generating unit of the digital PCR chip comprises a first sample inlet and a second sample inlet which are arranged on the top surface of the upper substrate and are used as liquid inlets, and a first micro-channel and a second micro-channel which are arranged on the bottom surface of the upper substrate;
the first micro-channel and the second micro-channel are intersected and communicated with each other to form a cross-shaped structure; two ends of the first micro-channel are communicated with the first sample inlet, one end of the second micro-channel is communicated with the second sample inlet, and the other end of the second micro-channel is used as the liquid drop outlet;
the water phase liquid storage tank is communicated with the second sample inlet, and the oil phase liquid storage tank is communicated with the first sample inlet.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202223014678.4U CN218554115U (en) | 2022-11-14 | 2022-11-14 | Digital PCR chip and detection device based on nanogold heating |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202223014678.4U CN218554115U (en) | 2022-11-14 | 2022-11-14 | Digital PCR chip and detection device based on nanogold heating |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN218554115U true CN218554115U (en) | 2023-03-03 |
Family
ID=85324706
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202223014678.4U Active CN218554115U (en) | 2022-11-14 | 2022-11-14 | Digital PCR chip and detection device based on nanogold heating |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN218554115U (en) |
-
2022
- 2022-11-14 CN CN202223014678.4U patent/CN218554115U/en active Active
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cao et al. | Advances in digital polymerase chain reaction (dPCR) and its emerging biomedical applications | |
| JP4091656B2 (en) | Silicon-dependent sleeve device for chemical reaction | |
| CN106047687B (en) | Ribonucleic acid chain type polymerize amplified reaction detection device and its method for carrying out DNA concentration detection | |
| CN102199529A (en) | Biochip hybridization system | |
| CN107051598B (en) | PCR microfluidic chip, preparation and use methods thereof and PCR equipment | |
| CN102083533A (en) | Microfluidic chip devices and their use | |
| JP2007520229A (en) | Continuous flow high performance reactor | |
| CN110951605B (en) | Array type paper-based chip capable of being used for 2019-nCoV virus high-throughput detection and manufacturing method thereof | |
| CN108485909A (en) | Micro-fluidic chip and its application | |
| CN102899245A (en) | Micro-chamber static-state PCR (Polymerase Chain Reaction) and CE (Capillary Electrophoresis) function integrated micro-fluidic chip | |
| CN209974793U (en) | Digital PCR device and centrifugal microfluidic chip | |
| CN218554115U (en) | Digital PCR chip and detection device based on nanogold heating | |
| CN101718698A (en) | Laser-induced fluorescence analyzer with PCR-CE coupled microfluidic chip | |
| Kulkarni et al. | Mini-thermal platform integrated with microfluidic device with on-site detection for real-time DNA amplification | |
| CN202951486U (en) | Micro-fluidic chip integrating functions of micro-cavity dynamic polymerase chain reactions (PCRs) and capillary electrophoresis (CE) | |
| CN108690874B (en) | Rapid digital PCR chip with continuously adjustable cycle number | |
| CN1117282C (en) | PCR microarray probe circulating detection type biological chip | |
| CN102154261B (en) | Device for performing nucleic acid amplification in micro-fluidic chip | |
| CN111235007A (en) | Liquid drop digital PCR system adopting graphene for heating | |
| CN202951487U (en) | Micro-fluidic chip integrating functions of micro-cavity static polymerase chain reactions (PCRs) and capillary electrophoresis (CE) | |
| CN109536384A (en) | A kind of digital pcr system and its application for the quick absolute quantitation of nucleic acid | |
| Hupert et al. | Polymer-based microfluidic devices for biomedical applications | |
| US11648563B2 (en) | Method and system for heating and temperature measurement using patterned thin films | |
| CN112779125A (en) | Light-driven circulating polymerase chain reaction micro-fluidic device and application thereof | |
| KR100593263B1 (en) | High throughput device for performing continuous-flow reactions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| GR01 | Patent grant | ||
| GR01 | Patent grant |