CN211620465U - Micro-fluidic chip, portable control device and detection system - Google Patents
Micro-fluidic chip, portable control device and detection system Download PDFInfo
- Publication number
- CN211620465U CN211620465U CN201922390644.7U CN201922390644U CN211620465U CN 211620465 U CN211620465 U CN 211620465U CN 201922390644 U CN201922390644 U CN 201922390644U CN 211620465 U CN211620465 U CN 211620465U
- Authority
- CN
- China
- Prior art keywords
- control unit
- nucleic acid
- chamber
- control
- micro
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The utility model discloses a micro-fluidic chip, portable controlling means and detecting system. The microfluidic chip comprises a cover sheet layer, a substrate layer and a control layer which are arranged in sequence; the substrate layer comprises a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a micro-channel and control valves arranged among the chambers, wherein the nucleic acid extraction chamber, the mixing chamber, the reaction chamber and the micro-channel are mutually communicated; the control layer comprises a first control unit, a second control unit and a third control unit, the first control unit is arranged above the nucleic acid extraction chamber, the second control unit is arranged above the control valve, and the third control unit is arranged above an outlet communicated with the reaction chamber. The portable control device is matched with the microfluidic chip for use. The utility model discloses a micro-fluidic chip can be under the control of peripheral miniaturized portable system full-automatic completion from waiting to detect the sample and carry out genome DNA extraction purification and isothermal nucleic acid amplification detection, have advantages such as sensitivity height, specificity are strong, reaction sequence is simple, check-out time is short.
Description
Technical Field
The utility model relates to a micro-fluidic chip of HLA-B58: 01 allele, in particular to a micro-fluidic chip, a portable control device and a system for detecting HLA-B58: 01 allele, belonging to the technical field of gene detection.
Background
Allopurinol is a first-line medicine for effectively treating hyperuricemia and gout, is low in price and good in uric acid reducing effect, and multiple studies show that allopurinol also has the functions of resisting oxidative stress and improving endothelial cells, has a protective effect on multiple systemic organs, is the best choice for patients with renal insufficiency or ineffective uric acid treatment, and has irreplaceability. Allopurinol has the risk of causing hypersensitivity, and researches prove that severe hypersensitivity related to allopurinol is closely related to HLA-B58: 01, the positive rate of Asian population is obviously higher than that of white population, so that the risk of generating hypersensitivity is higher. 3 in 3 the 3 study 3 of 3 51 3 patients 3 with 3 severe 3 adverse 3 skin 3 reactions 3 caused 3 by 3 allopurinol 3 in 3 Taiwan 3 and 3 228 3 allopurinol 3- 3 resistant 3 patients 3, 3 Hung 3 et 3 al 3 ( 3 PNAS 3, 3 102 3 ( 3 11 3) 3 4134 3- 3 4139 3 ( 3 2015 3) 3) 3 found 3 that 3 SNP 3 sites 3 strongly 3 associated 3 with 3 severe 3 drug 3 eruptions 3 were 3 located 3 on 3 MHC 3 genes 3, 3 and 3 were 3 concentrated 3 at 3 HLA 3- 3A 3, 3B 3, 3C 3 and 3 DRB 31 3 loci 3, 3 especially 3 HLA 3- 3B 3 58 3: 301 3 allele 3. 3 HLA-B58: 01 was present in 100% of patients with severe adverse cutaneous reactions after administration of allopurinol, whereas in patients without adverse cutaneous reactions (tolerant group) and normal control group, the carrying rate was only 15% and 20%. The HLA-B58: 01 allele detection is carried out before allopurinol is taken to judge whether the patient belongs to high risk group, and the method has important significance for guiding clinical safe medication. Therefore, in 2008, taiwan in China has carried out the detection of the gene on patients ready to use allopurinol, and the use of patients with positive results is prohibited, and 2012, the American College of Rheumatology (ACR) suggests that: before allopurinol is used, the Asian population should be subjected to the detection of HLA-B58: 01, and the detection of HLA-B58: 01 is also recommended by the Chinese medical society in 2013, namely the endocrinology society of China for treating hyperuricemia and gout.
The "gold standard" identified by HLA-B58: 01 is a base sequence sequencing analysis method published by International Histocompatibility Working Group (IHWG), a nucleic acid sequence directly obtained by sequencing to identify polymorphisms. However, due to the high polymorphism and complexity of the HLA system, primer design and other factors, the sequencing result has a set of peaks, and the interpretation is more complex. Moreover, HLA-SBT requires expensive sequencers and the requirement for the operator for preparation of sequencing samples is high, making routine deployment of this method in hospitals difficult. Another method is to adopt sequence specific primer PCR (PCR-SSP) to screen HLA allelic type, for example, SSP HLA kit of the Switzerland Olerup company uses more than twenty pairs of primers to respectively amplify and then uses agarose gel electrophoresis separation to identify the genotype, which is long in time consumption, easy to pollute and extremely complex in operation. And the kit is designed aiming at European and American populations, and common HLA alleles in some European and American populations do not appear in Chinese populations. Therefore, the kit is not suitable for clinical application in domestic hospitals. To address the clinical need for rapid detection of HLA-B58: 01 in chinese populations, fluorescence quantitative PCR-based kits were developed and CFDA certified in taiwan and suzhou, respectively.
However, in general, the prior art for detecting HLA-B58: 01 allele still has the defects of expensive instrument and equipment, severe requirements on laboratory environment, high requirements on operator skills, long period, low efficiency and the like.
The microfluidic technology is to integrate basic functional units related to sample pretreatment, chemical and biological reactions, separation and detection and the like in the research fields of chemistry, biology and the like on a chip or a device with the size of a few square centimeters or less through a micro/nano processing technology. It can complete a series of complex tasks such as sample preparation, biochemical reaction, result detection and analysis, which can only be completed in conventional chemical or biological laboratories depending on large-scale instruments, and is therefore also known as a Lab on a Chip. Sample processing, genome nucleic acid extraction and nucleic acid amplification in the HLA-B58: 01 detection process are integrated on a microfluidic chip by utilizing a microfluidic technology, so that full-automatic analysis from the sample to the result is realized.
Recombinase Polymerase Amplification (RPA) is a constant temperature nucleic acid Amplification technique developed by twist dsxinc, uk, and is considered as a nucleic acid detection technique that can replace PCR. RPA technology relies primarily on three enzymes: recombinases that bind single-stranded nucleic acids (oligonucleotide primers), single-stranded DNA binding proteins (SSBs), and strand-displacing DNA polymerases. The mixture of the three enzymes of the RPA reaction system has activity at normal temperature, the optimal amplification temperature is between 37 ℃ and 42 ℃, thermal denaturation is not needed, and compared with PCR, the method does not need to realize circulation between two or three temperatures and corresponding temperature control equipment, and can be carried out at 37 ℃ to 42 ℃, even at normal temperature. The micro-fluidic technology and the RPA technology are combined, so that the requirements of HLA-B58: 01 detection items on instruments and equipment, laboratory environment and the skill of operators can be greatly reduced, and portable rapid detection is realized, so that the detection items can be developed in outpatients and even at home of patients.
Disclosure of Invention
The main objective of the present invention is to provide a microfluidic chip for detecting HLA-B58: 01 allele, so as to overcome the disadvantages of the prior art.
Another objective of the present invention is to provide a portable control device for HLA-B58: 01 allele and a system for detecting HLA-B58: 01 allele.
In order to achieve the purpose of the invention, the technical scheme adopted by the utility model comprises:
the embodiment of the utility model provides a micro-fluidic chip, which comprises a cover sheet layer, a substrate layer and a control layer which are arranged in sequence along a set direction;
the substrate layer comprises a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a micro-channel and a control valve, wherein the nucleic acid extraction chamber, the mixing chamber, the reaction chamber, the micro-channel and the control valve are communicated with each other, the micro-channel is at least used for communicating the chambers, the control valve is arranged between the chambers, the nucleic acid extraction chamber is at least used for extracting nucleic acid in a sample to be detected, the mixing chamber is at least used for storing an RPA freeze-drying reagent and mixing the RPA freeze-drying reagent with the extracted nucleic acid, and the reaction chamber is at least used for storing a primer group and a probe which are used for detecting HLA-B58: 01 allele and carrying out isothermal amplification reaction with the RPA freeze-;
the control layer comprises a first control unit, a second control unit and a third control unit, the first control unit is arranged above the nucleic acid extraction chamber and at least used for providing pressure for driving liquid to flow among the chambers, the second control unit is arranged above the control valve and at least used for closing or opening the control valve, and the third control unit is arranged above an outlet communicated with the reaction chamber and at least used for discharging the liquid in the reaction chamber.
The embodiment of the utility model also provides a portable control device, which is used by matching with the micro-fluidic chip and comprises a liquid and flow path control unit, a thermal management and temperature control unit and a fluorescence excitation and acquisition unit;
wherein the liquid and flow path control unit includes:
the liquid driving assembly is at least used for pressing the dome pressure cavity of the microfluidic chip so as to drive the liquid to flow;
a control valve control assembly to at least compress the second control unit to close or open the control valve;
the thermal management and temperature control unit includes:
a first heating component at least used for heating and enabling the nucleic acid extracting chamber to reach the temperature required by nucleic acid elution;
a second heating component at least used for heating and enabling the temperature in the reaction chamber to reach the temperature required by the RPA reaction;
the fluorescence excitation and collection unit comprises a fluorescence excitation component and a fluorescence image collection component.
The embodiment of the utility model provides a detection system of 01 allele is left to HLA-B58, it includes:
the kit for detecting HLA-B58: 01 allele as described above;
an RPA reaction system;
the microfluidic chip is described above; and the number of the first and second groups,
the portable control device is provided.
Compared with the prior art, the utility model has the advantages that:
1) the utility model provides an integrated HLA-B58: 01 allele detection method, primer and fluorescent probe, micro-fluidic chip and portable detection device and detection system based on the micro-fluidic technology realizes recombinase polymerase amplification real-time fluorescence detection, the method introduces RPA reaction internal control aiming at the requirement of clinical detection, and guarantees the authenticity and accuracy of detection reaction;
2) the utility model discloses after carrying out genome DNA extraction purification from samples such as blood specimen, throat swab or saliva, carry out isothermal nucleic acid amplification, need not the thermocycling reaction, needn't amplify in the PCR appearance, have advantages such as sensitivity is high, the specificity is strong, the reaction procedure is simple, check-out time is short, and the utility model discloses the testing process is quick, with low costs, has extensive spreading value.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings needed to be used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments described in the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.
Fig. 1 is a schematic structural diagram of a microfluidic chip according to an exemplary embodiment of the present invention.
Fig. 2 is a schematic structural diagram of a microfluidic chip and a portable control device according to an exemplary embodiment of the present invention.
Fig. 3 a-3 e are schematic diagrams of the steps of the method for detecting the HLA-B58: 01 allele according to an exemplary embodiment of the present invention.
Fig. 4 a-4B are schematic diagrams illustrating the results of the detection of HLA-B58: 01 allele according to an exemplary embodiment of the present invention.
Description of reference numerals: 100-cover plate layer, 200-substrate layer, 201-nucleic acid extraction chamber, 202-mixing chamber, 203-reaction chamber, 204-micro channel, 205-first control valve, 206-second control valve, 300-control layer, 301-dome, 302-porous membrane, 303-soft material membrane, 304-porous membrane, 401-first linear motor, 402-second linear motor, 403-third linear motor, 404-infrared LED heating component, 405-heating and temperature control component, 406a-LED light source, 406 b-excitation color filter, 407a-CCD component, 407 b-emission color filter.
Detailed Description
In view of the defects that the prior art detects HLA-B5801 allele, instruments and equipment are expensive, the requirement on laboratory environment is severe, the requirement on the skill of operators is high, the period is long, the efficiency is low and the like, the inventor of the present application can provide the technical scheme of the utility model through long-term research and a large amount of practice, and establishes a detection method, a primer and a fluorescent probe, a microfluidic chip, a portable detection device and a detection system for realizing real-time fluorescence detection of Recombinase Polymerase Amplification (RPA) based on the microfluidic technology, and the method introduces RPA reaction internal control aiming at the requirement of clinical detection to ensure the authenticity and accuracy of the detection reaction.
The technical solution, its implementation and principles, etc. will be further explained as follows.
The technical solution of the present invention will be explained in more detail below. It is to be understood, however, that within the scope of the present invention, each of the above-described features of the present invention and each of the features described in detail below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.
An aspect of an embodiment of the present invention provides a primer set for detecting HLA-B58: 01 allele, comprising:
a first primer pair comprising a first forward primer and a reverse primer;
a second primer pair comprising a second forward primer and a reverse primer;
a third primer pair comprising a third forward primer and a reverse primer;
the utility model designs sequence specific primer primers and fluorescent probes for detecting human HLA-B58: 01 allele in HLA-B polymorphic site concentrated region according to HLA-B58: 01 allele sequence (GenbankSequence ID: KU319333.1), and the sequences are as follows:
further, the first forward primer (i.e., forward primer 1: B58: 01-FP1) is represented as: ATAGAGCAGGAGGGGCCGGAGTATTGGGACG are provided.
Further, the second forward primer (i.e., forward primer 2: B58: 01-FP2) is represented as: CCGCGCAGACTTACCGAGAGAACCTGCCGAT are provided. The fourth position of the 3' end of the sequence is introduced with amplification retarding mutation, and g is replaced by c so as to improve the amplification specificity.
Further, the third forward primer (i.e., forward primer 3: B58: 01-FP3) is represented as: CCCGAGTCTCCGTGTCCGAGATCCGCCT are provided.
The thirteenth site of the 5 'end in the sequence is introduced with T to replace G, the influence of the secondary structure of the primer on amplification is damaged, and the design utilizes the good compatibility of an RPA system to the mismatch of the 5' end and the middle part of the sequence.
Further, the reverse primer (i.e. B58: 01-RP) has the specific sequence: CCCAGGTCGCAGCCATACATCCTCTGGATGA are provided.
Yet another aspect of the embodiments of the present invention provides a Probe for detecting HLA-B58: 01 allele, wherein the specific sequence SEQ ID No.5 of the Probe (i.e. B58: 01-Probe) is represented as: CCGGCGAGAGCCCCAGGCGCGTTTACCCGG [ FAM-dT ] T [ THF ] CA [ BHQ-dT ] TTTCAGTTGAGGCC [3 ' -C3], i.e. ' CCGGCGAGAGCCCCAGGCGCGTTTACCCGGTTTCATTTTCAGTTGAGGCC '.
Wherein FAM-dT is a fluorescein-labeled base dT, BHQ-dT is a fluorescence quencher-labeled base dT, THF is tetrahydrofuran, and after the cleavage by exonuclease III, the fluorophore and the quencher are separated to realize fluorescence quantification, and C3 is a 3' end blocking group which can prevent the extension of the fluorescent probe.
The utility model discloses in, the relative PCR primer sequence of Rpa primer is longer, and the RPA amplification system is insensitive to primer 5 'end and middle mismatching basic group simultaneously, and is better to near the mismatching specificity of primer 3' end, can also introduce the amplification retardation mutation in the primer sequence and further improve the specificity, so can be as required better design primer.
Further, the utility model discloses realize gene detection in the full-automatic realization of totally closed reaction system, the laboratory that the aerosol caused can be avoided in the low temperature reaction pollutes, need not professional molecular biology laboratory and professional training personnel.
Yet another aspect of the embodiments of the present invention provides a kit for detecting an HLA-B58: 01 allele, comprising: at least one primer group and at least one probe, wherein one primer group is the primer group, and one probe group is the probe.
In some preferred embodiments, the kit further comprises an internal reference primer pair and an internal reference probe, wherein the internal reference primer pair comprises an internal reference forward primer and an internal reference reverse primer.
Further, the utility model designs a pair of internal reference primers and a fluorescent probe according to the GAPDH gene sequence:
specifically, the specific sequence of the internal reference forward primer (i.e. GAPDH-FP) is as follows: CCGGGAAACTGTGGCGTGATGGCCGCGG are provided.
Specifically, the specific sequence of the internal reference reverse primer (i.e. GAPDH-RP) is as follows: GGTGGAGGAGTGGGTGTCGCTGTTGAAGTC are provided.
Specifically, the specific sequence of the internal reference probe (i.e. GAPDH-probe) is as follows: AGCTGAACGGGAAGCTCACTGGCATGGCCT [ FAM-dT ] C [ THF ] G [ BHQ-dT ] GTCCCCACTGCCAAC [ 3' -C3], i.e., AGCTGAACGGGAAGCTCACTGGCATGGCCTTCTGTGTCCCCACTGCCAAC.
Wherein FAM-dT is a fluorescein-labeled base dT, BHQ-dT is a fluorescence quencher-labeled base dT, THF is tetrahydrofuran, and after cutting by exonuclease III, the fluorescent group and the quencher group are separated to realize fluorescence quantification, and C3 is a 3' end blocking group which can prevent the fluorescent probe from being extended.
Another aspect of the embodiments of the present invention further provides a microfluidic chip, which includes a cover layer, a substrate layer, and a control layer sequentially arranged along a set direction;
the substrate layer comprises a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a micro-channel and a control valve, wherein the nucleic acid extraction chamber, the mixing chamber, the reaction chamber, the micro-channel and the control valve are communicated with each other, the micro-channel is at least used for communicating the chambers, the control valve is arranged between the chambers, the nucleic acid extraction chamber is at least used for extracting nucleic acid in a sample to be detected, the mixing chamber is at least used for storing an RPA freeze-drying reagent and mixing the RPA freeze-drying reagent with the extracted nucleic acid, and the reaction chamber is at least used for storing a primer group and a probe which are used for detecting HLA-B58: 01 allele and carrying out isothermal amplification reaction with the RPA freeze-;
the control layer comprises a first control unit, a second control unit and a third control unit, the first control unit is arranged above the nucleic acid extraction chamber and at least used for providing pressure for driving liquid to flow among the chambers, the second control unit is arranged above the control valve and at least used for closing or opening the control valve, and the third control unit is arranged above an outlet communicated with the reaction chamber and at least used for discharging the liquid in the reaction chamber.
In some embodiments, the first control unit comprises a porous membrane, and a dome disposed on a surface of the porous membrane, wherein at least a dome pressure chamber for driving liquid to flow between the chambers is formed between the dome and the porous membrane.
In some embodiments, the dome is made of a soft material such as silicone, TPE or TPU, which can deform under pressure to drive the liquid, but is not limited thereto.
Further, the porous membrane is a gas-permeable and water-impermeable membrane, and the material of the porous membrane includes, but is not limited to, polytetrafluoroethylene PTFE and the like.
In some embodiments, the second control unit overlies a control valve seat of the substrate layer.
Furthermore, the second control unit comprises a soft material film, and at least can stretch and deform under the action of pressure so as to control the state of the control valve, the second control unit is made of a soft material, and can comprise a silica gel film, a latex film, and a thermoplastic material film such as Polycarbonate (PC) with certain ductility, and can stretch and deform under pressure.
Further, the third control unit includes a porous membrane, the porous membrane is a gas-permeable and water-impermeable membrane, and the material of the porous membrane includes, but is not limited to, polytetrafluoroethylene, PTFE, and other materials.
Further, the cover sheet layer is attached or bonded to the substrate layer, thereby forming a nucleic acid extraction chamber, a mixing chamber, a reaction chamber and a micro flow channel.
Further, the thickness of the substrate layer is 0.3-10 mm.
Further, the thickness of the cover plate layer is 0.01-0.5 mm.
In some embodiments, a first control valve is disposed between the nucleic acid extraction chamber and the mixing chamber, and a second control valve is disposed between the mixing chamber and the reaction chamber.
To sum up, the utility model provides a micro-fluidic chip can carry out nucleic acid extraction elution and RPA isothermal amplification from the FTA sample, and its characteristics include three little reaction chamber, are nucleic acid extraction cavity, mixing chamber and RPA reaction chamber in proper order. The nucleic acid extraction chamber is used for receiving an FTA card for collecting samples such as blood, throat swab or saliva and heating to elute nucleic acid; the mixing chamber stores the RPA lyophilized reagent and mixes with the eluted nucleic acids; the RPA reaction chamber stores lyophilized sequence-specific primers and probes and performs an isothermal amplification reaction.
FTA cards use the FTA technology of Whatman (now part of GE Healthcare) patent, a simple one-step method to capture DNA. The FTA card contains unique chemical substances, can lyse cells, denature proteins and effectively protect nucleic acids from nuclease, oxidant and ultraviolet rays, and the captured nucleic acids can be used for downstream various applications, so that the operation and treatment of the nucleic acids are simple.
The embodiment of the utility model provides a another aspect still provides a portable controlling means, its cooperation micro-fluidic chip accomplishes the detection of HLA-B58: 01 allele, portable controlling means is by single chip microcomputer control, it includes liquid and flow path control unit, thermal management and temperature control unit and fluorescence excitation and acquisition unit;
wherein the liquid and flow path control unit includes:
the liquid driving assembly is at least used for pressing the dome pressure cavity of the microfluidic chip so as to drive the liquid to flow;
a control valve control assembly to at least compress the second control unit to close or open the control valve;
the thermal management and temperature control unit includes:
a first heating component at least used for heating and enabling the nucleic acid extracting chamber to reach the temperature required by nucleic acid elution;
a second heating component at least used for heating and enabling the temperature in the reaction chamber to reach the temperature required by the RPA reaction;
the fluorescence excitation and collection unit comprises a fluorescence excitation component and a fluorescence image collection component.
Further, the liquid drive assembly and the control valve control assembly comprise linear motors.
Further, the liquid and flow path control unit includes three linear motors: the first linear motor drives liquid to sequentially flow between the mixing chamber and the reaction chamber by extruding a dome pressure cavity on the microfluidic chip; a second linear motor controls a micro valve (i.e., a first control valve) between the sample extraction chamber and the mixing chamber, which closes the micro valve by pressing the soft material film above the valve seat of the control micro valve with a downward motion, or opens the micro valve by separating the soft material film with an upward motion; a third linear motor controls the microvalve (i.e., the second control valve) between the mixing chamber and the RPA reaction chamber, which closes the microvalve by pressing the film of soft material over the valve seat of the control microvalve in a downward motion, or opens the microvalve by moving upward away from the film of soft material.
Further, the first heating assembly comprises an infrared LED heating assembly.
Further, the thermal management and temperature control unit comprises two parts: the first part is that liquid in the nucleic acid extraction cavity is heated by an infrared LED heating assembly below the nucleic acid extraction cavity to provide the temperature required by nucleic acid elution, and the temperature range is 80-98 ℃; the second part is a heating and warming unit below the RPA reaction chamber, providing an optimal reaction temperature of the RPA reaction of 37 ℃ to 42 ℃.
In some preferred embodiments, the fluorescence excitation assembly includes an LED light source and an excitation color filter, the LED light source being disposed over the excitation color filter.
In some preferred embodiments, the fluorescent image acquisition assembly comprises a CCD assembly and an emission color filter, the CCD assembly being disposed over the emission color filter.
Further, the liquid and flow path control unit, the thermal management and temperature control unit and the fluorescence excitation and acquisition unit are all controlled by a control center, and the control center comprises a single chip microcomputer.
Further, the LED light source, excitation color filter, and emission color filter are selected according to the wavelength of the dye used for the fluorescent probe.
Another aspect of the embodiments of the present invention provides a system for detecting an HLA-B58: 01 allele, comprising:
the aforementioned kit for detecting HLA-B58: 01 allele;
an RPA reaction system;
the microfluidic chip described above; and the number of the first and second groups,
the portable control device is provided.
In the utility model, the RPA reaction system, the microfluidic chip and the portable control device form a complete integrated HLA-B58: 01 allele detection system, and after a sample is added, the one-touch full-automatic operation is carried out to complete the detection. And a dome pressure cavity is covered after the FTA sample is added, so that a totally-closed microfluidic chip reactor is formed, and an amplification product is sealed in the microfluidic chip, so that laboratory pollution is avoided.
In another aspect of the embodiments of the present invention, there is also provided a use of the primer set, the probe, and the kit for detecting the HLA-B58: 01 allele in the preparation of a product for detecting the HLA-B58: 01 allele.
Further, the method for detecting an HLA-B58: 01 allele using the product is mainly performed based on the aforementioned detection system for an HLA-B58: 01 allele, and the detection method includes:
placing a sample to be detected in a nucleic acid extraction chamber of the microfluidic chip, placing an RPA freeze-dried reagent in a mixing chamber, and placing a kit for detecting HLA-B58: 01 allele in a reaction chamber;
heating by adopting a first heating component of a portable control device to heat the nucleic acid extraction chamber, and eluting the sample to be detected to obtain extracted nucleic acid;
a dome pressure cavity of the microfluidic chip is extruded by a liquid driving component of the portable control device, and a first control valve is opened at the same time, so that nucleic acid is driven to enter a mixing cavity to be mixed with the RPA freeze-drying reagent;
continuously extruding the dome pressure cavity of the microfluidic chip by the liquid driving component, and simultaneously opening a second control valve, so that nucleic acid and an RPA freeze-drying reagent are driven to enter a reaction cavity to be mixed with a primer group and a probe for detecting HLA-B58: 01 allele;
heating by adopting a second heating component of the portable control device to raise the temperature in the reaction chamber for carrying out RPA reaction, and,
and detecting the RPA reaction product by adopting a fluorescence excitation and acquisition unit of the portable control device.
Further, the sample to be detected includes, but is not limited to, a pharyngeal swab, blood or saliva sample collected by the FTA card.
Further, the elution temperature is 80-98 ℃, and the RPA reaction temperature is 37-42 ℃.
Further, the detection method comprises the following steps: and monitoring and collecting the light intensity of the RPA reaction product in real time, and analyzing the result by an amplification curve of which the fluorescence intensity changes along with time.
Further, the collection time is 15-40 min.
The utility model discloses a detection method of HLA-B58: 01 allele includes: collecting a throat swab or a blood sample by using an FTA card, adding a microfluidic chip, fully automatically completing extraction and elution of genome DNA of the sample to be detected, placing three pairs of specific primers, one pair of internal reference primers and corresponding fluorescent probes in an environment of 37-42 ℃ for isothermal amplification, monitoring and collecting fluorescence intensity in real time, and analyzing a result by using an amplification curve of the fluorescence intensity changing along with time. After genomic DNA is extracted and purified from samples such as blood samples, throat swabs or saliva, isothermal nucleic acid amplification is carried out, thermal cycle reaction is not needed, amplification in a PCR instrument is not needed, and the kit has the advantages of high sensitivity, strong specificity, simple reaction procedure, short detection time and the like. The utility model discloses quick, with low costs, have extensive spreading value.
The technical solutions in the embodiments of the present invention will be described in detail below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments in the present invention, all other embodiments obtained by a person skilled in the art without creative efforts belong to the protection scope of the present invention.
Referring to fig. 1, a microfluidic chip according to an embodiment of the present invention can perform nucleic acid extraction, elution, and RPA isothermal amplification from an FTA sample, and the structure thereof is mainly divided into three layers: respectively a cover sheet layer 100, a substrate layer 200 and a control layer 300.
Wherein, the middle layer is a substrate layer 200, which comprises three micro-reaction chambers (i.e. a nucleic acid extraction chamber 201, a mixing chamber 202 and a reaction chamber 203), a micro-channel 204 connecting each micro-reaction chamber and a valve seat of a control valve (i.e. a first control valve 205 and a second control valve 206), and the thickness of the substrate layer is generally 0.3mm to 10 mm. The nucleic acid extraction chamber 201 is configured to receive an FTA card from which a sample such as blood, throat swab, or saliva is collected and heat-elute nucleic acids; the mixing chamber 202 stores RPA lyophilized reagents and mixes with eluted nucleic acids; the RPA reaction chamber stores lyophilized sequence-specific primers and probes and performs an isothermal amplification reaction.
After the cover sheet layer 100 of the microfluidic chip is attached or bonded with the substrate layer 200, a closed micro-reaction cavity and a closed micro-channel are formed, and the thickness of the cover sheet layer is generally 0.01mm to 0.5 mm.
The control layer 300 includes three parts: the first control unit is at least used for providing pressure for driving liquid to flow between the chambers, and comprises a porous membrane 302 and a dome 301 arranged on the surface of the porous membrane 302, wherein a dome pressure chamber for driving the liquid to flow between the chambers is formed between the dome 301 and the porous membrane 302, the dome 301 can deform the driving liquid under pressure, the dome 301 can be made of soft materials such as silica gel, TPE (thermoplastic elastomer) and TPU (thermoplastic polyurethane), and the porous membrane 302 is a breathable and waterproof membrane made of PTFE (polytetrafluoroethylene) and the like; the second control unit is at least used for closing or opening the first control valve 205 and the second control valve 206, and can be a soft material film 303 which is covered on a valve seat of the substrate layer 200 of the microfluidic chip and can be stretched and deformed under pressure to close the first control valve 205 and the second control valve 206; the third control element is a gas permeable, water impermeable porous membrane 304, such as a membrane of PTFE material, that drains the liquid that originally occupied the reaction chamber during filling of the reaction chamber 203.
Referring to fig. 2, in an embodiment of the present invention, a portable control device is provided, which is matched with a microfluidic chip to complete the detection of HLA-B58: 01 allele, and is controlled by a single chip, and the main functional units of the portable control device include: a liquid and flow path control unit, a thermal management and temperature control unit, and a fluorescence excitation and acquisition unit.
The liquid and flow path control unit comprises three linear motors, namely a first linear motor 401 drives the liquid to flow between the mixing chamber 202 and the reaction chamber 203 in sequence by pressing a dome pressure cavity on the microfluidic chip; the second linear motor 402 controls the micro valves (i.e., the first control valve 205, the second control valve 206) between the nucleic acid extraction chamber 201 and the mixing chamber 202, which close the micro valves by moving downward the soft material film 303 above the valve seats of the pressing control micro valves, or open the micro valves by moving upward the separation soft material film 303; the third linear motor 403 controls the microvalve between the mixing chamber 202 and the RPA reaction chamber 203, which closes the microvalve by pressing the soft material film 303 above the control microvalve valve seat in a downward motion, or opens the microvalve by moving upward off the soft material film 303.
The thermal management and temperature control unit comprises two parts: the first heating component is a heating and temperature control component 405 below the RPA reaction chamber, and provides the optimal reaction temperature of the RPA reaction at 37-42 ℃, wherein the temperature required by nucleic acid elution is provided by heating liquid in the nucleic acid extraction chamber by an infrared LED heating component 404 below the nucleic acid extraction chamber 201, and the temperature range is 80-98 ℃.
The fluorescence excitation and collection includes a fluorescence excitation component and a fluorescence image collection component. The fluorescence excitation component comprises a fluorescence excitation component part consisting of an LED light source 406a and an excitation color filter 406 b; the fluorescent image acquisition assembly includes a fluorescent image acquisition portion composed of emission color filter 407b and CCD assembly 407 a. Wherein the LED light source, excitation filter and emission filter are selected according to the wavelength of the dye used for the fluorescent probe.
The utility model discloses a detection method of HLA-B58: 01 allele that provides in a specific embodiment includes:
(a) placing the FTA membrane to be detected into a nucleic acid extraction chamber 201 of the microfluidic chip;
(b) opening a first heating assembly, namely an infrared LED heating assembly 404 for heating, and eluting the genome nucleic acid;
(c) the first linear motor 401 presses the dome pressure chamber while the first control valve 205 is opened, so that the liquid of the nucleic acid extraction chamber 201 fills the mixing chamber 202, and the liquid dissolves the lyophilized RPA reagent;
(d) the first linear motor 401 continues to extrude the dome pressure cavity, the second control valve 206 is opened at the same time, and the freeze-dried primers, the probes and the magnesium acetate are mixed with the RPA reaction liquid;
(e) the second control valve 206 is closed, the second heating component, namely the heating and temperature control component 405 is heated, so that the RPA reaction temperature in the reaction chamber 203 is controlled to be 37-42 ℃, and finally, the fluorescence excitation and collection unit is used for detecting the RPA reaction product.
Example 1 pharyngeal swab sample Collection
The Buccal cells of the patient are collected by a pharyngeal swab sample Collection card (FTA commercial Collection Kit, P/N: WB120239, GEHealthcare), and the specific method comprises the following steps: (a) patients were unable to eat 30 minutes prior to sampling; (b) filling patient information in an acquisition card; (c) after gargling with clear water, firstly, placing a sampling rod under the tongue and the like, dipping saliva, wiping one side of the sampling rod for 30 seconds at the left side in the oral cavity, and wiping the other side of the sampling rod for 30 seconds at the right side in the oral cavity; (d) pressing the flat surface of the sponge head into a sample area of the acquisition card to fully absorb the sample; then the sponge head is turned over and placed in a sample area of the acquisition card for repeated pressing; (e) the capture cards were left at room temperature for 1 hour until completely dry.
EXAMPLE 2 fingertip blood sample Collection
Collecting blood of fingertip of patient with a blood sample collection card (FTA blood sample collection kit, P/N: WB120238, GEHealthcare), the specific method comprises: (a) filling patient information in an acquisition card; (b) disinfecting the blood sampling part by medical alcohol; (c) inserting the needle tip of a medical blood taking needle into a blood taking part, and extruding the blood taking part to enable blood to flow out to form a blood drop; (d) naturally permeating blood into a sample area of the acquisition card, and paying attention to the fact that the sample area does not directly contact the blood; (e) slightly pressing the blood sampling part with a dry cotton ball to stop bleeding; (f) the capture card was left to dry at room temperature.
Example 3 microfluidic chip fabrication
The substrate layer of the micro-fluidic chip comprising the micro-reaction cavity, the micro-channel and the valve seat of the control valve is manufactured by a double-sided hot die pressing or injection molding process, the material of the substrate layer is PMMA, and the thickness of the substrate layer is 4 mm. A microcavity having a diameter of 6mm, a depth of 4mm (perforation) and a volume of 113. mu.L for the nucleic acid extraction chamber; the diameter of the mixing chamber is 6mm, the depth is 1.8mm, and the volume of the mixing chamber is 50 mu L of microcavity; the RPA reaction chamber is 4 microcavities with a diameter of 4.6mm, a depth of 0.6mm and a volume of 10. mu.L. The valve seat has a diameter of 6mm, a depth of 0.1mm and a maximum dead volume of 2.8. mu.L. The width of the micro flow channel is 0.5mm and the depth is 0.1 mm.
The cover sheet layer of the microfluidic chip is an optical film coated with pressure-sensitive adhesive, and before pressure is applied to seal the micro-channel and the reaction chamber, a sequence specific primer, a fluorescent probe and magnesium acetate are added into the RPA reaction chamber, and the mixture is heated and evaporated to dryness; then TwistAdding an exo freeze-drying reagent (which can be dissolved into a reaction system of 50 mu L by adding water) into the mixing cavity; and finally, sealing by using a pressure-sensitive optical film.
The soft film for controlling the opening and closing of the micro valve is a PDMS film with the thickness of 0.2mm, the PDMS film is adhered to the substrate layer of the micro-fluidic chip by double-sided pressure-sensitive adhesive, and the double-sided pressure-sensitive adhesive area corresponding to the valve seat of the micro valve is removed by a nicking tool. The dome pressure cavity is formed by injection molding after being heated by TPE material with the hardness of 50, and the bottom of the dome pressure cavity is adhered to the PTFE porous membrane by double-sided pressure sensitive adhesive. The PTFE porous membrane is adhered to the outlet of the reaction chamber by double-sided pressure sensitive adhesive.
Example 4 HLA-B58: 01 allele detection protocol
The procedure for detecting HLA-B58: 01 allele in this example is shown in FIG. 3-FIG. 3e, (a) placing FTA membrane chip with a diameter of about 3mm into the nucleic acid extraction chamber of the microfluidic chip, and adding about 100. mu.L of sterile water (shown in FIG. 3 a); (b) opening 850nm infrared laser tube and heating for 15 min to elute the genome nucleic acid (see FIG. 3 b); (c) the first linear motor squeezes the soft material cap, i.e., the domed pressure chamber, while the first control valve opens, about 50 μ L of liquid fills the mixing chamber, dissolving the lyophilized RPA reagent (see fig. 3 c); (d) the first linear motor continues to press the dome pressure chamber while the second control valve is opened, and the freeze-dried primers, the probes and the magnesium acetate are mixed with the RPA reaction liquid (as shown in FIG. 3 d); (e) the second control valve was closed and the reaction temperature was controlled at 37-42 ℃ for fluorescence collection 15-40 min (see FIG. 3e), where this step was fluorescence collection at 510nm with 470nm excitation. Wherein, only the step (a) needs manual operation, which needs 2 minutes, and the following steps are automatically completed within 1 hour under the control of the singlechip.
Example 5 HLA-B58: 01 allele assay results
Saliva samples were collected from 10 gout patients according to the method of example 1, and the test procedure of example 4 was performed to obtain 1 HLA-B58: 01 positive patient, the fluorescence intensity changes with time as shown in FIG. 4a, and the test results of 1 patient were selected as shown in FIG. 4B. Through PCR clone sequencing and sequence alignment, the two patients are respectively HLA-B58: 01/HLA-B52: 01 heterozygote and HLA-B51: 01 homozygote. The above results show that the detection results obtained according to the embodiment of the utility model are consistent with the sequencing results.
In conclusion, by the above technical scheme, the utility model discloses after treating the sample to detect and carry out genome DNA extraction purification, carry out isothermal nucleic acid amplification, do not need the thermal cycle reaction, needn't amplify in the PCR appearance, have advantages such as sensitivity is high, the specificity is strong, the reaction procedure is simple, the check-out time is short, this method introduces RPA reaction internal control to clinical detection's requirement, guarantees to detect authenticity and the accuracy of reaction; and the detection process is rapid and low in cost.
The aspects, embodiments, features and examples of the present invention should be considered illustrative in all respects and not intended to be limiting, the scope of the invention being defined only by the claims. Other embodiments, modifications, and uses will be apparent to those skilled in the art without departing from the spirit and scope of the claimed invention.
The use of titles and chapters in the utility model is not meant to limit the utility model; each section may apply to any aspect, embodiment, or feature of the present invention.
Throughout the present application, where a composition is described as having, containing, or including specific components or where a process is described as having, containing, or including specific process steps, it is contemplated that the compositions taught by the present invention also consist essentially of, or consist of, the recited components, and that the processes taught by the present invention also consist essentially of, or consist of, the recited process steps.
It should be understood that the order of steps or the order in which particular actions are performed is not critical, so long as the teachings of the present invention remain operable. Further, two or more steps or actions may be performed simultaneously.
In addition, the inventors of the present invention have also made experiments with other materials, process operations, and process conditions described in the present specification with reference to the above examples, and have obtained preferable results.
While the invention has been described with reference to illustrative embodiments, it will be understood by those skilled in the art that various other changes, omissions and/or additions may be made and substantial equivalents may be substituted for elements thereof without departing from the spirit and scope of the invention. In addition, many modifications may be made to adapt a particular situation or material to the teachings of the invention without departing from its scope. Therefore, it is intended that the invention not be limited to the particular embodiment disclosed for carrying out this invention, but that the invention will include all embodiments falling within the scope of the appended claims.
Claims (10)
1. A micro-fluidic chip is characterized by comprising a cover sheet layer, a substrate layer and a control layer which are sequentially arranged along a set direction;
the substrate layer comprises a nucleic acid extraction chamber, a mixing chamber, a reaction chamber, a micro-channel and a control valve, wherein the nucleic acid extraction chamber, the mixing chamber, the reaction chamber, the micro-channel and the control valve are communicated with each other, the micro-channel is at least used for communicating the chambers, the control valve is arranged between the chambers, the nucleic acid extraction chamber is at least used for extracting nucleic acid in a sample to be detected, the mixing chamber is at least used for storing an RPA freeze-drying reagent and mixing the RPA freeze-drying reagent with the extracted nucleic acid, and the reaction chamber is at least used for storing a primer group and a probe which are used for detecting HLA-B58: 01 allele and carrying out isothermal amplification reaction with the RPA freeze-;
the control layer comprises a first control unit, a second control unit and a third control unit, the first control unit is arranged above the nucleic acid extraction chamber and at least used for providing pressure for driving liquid to flow among the chambers, the second control unit is arranged above the control valve and at least used for closing or opening the control valve, and the third control unit is arranged above an outlet communicated with the reaction chamber and at least used for discharging the liquid in the reaction chamber.
2. The microfluidic chip of claim 1, wherein: the first control unit comprises a porous membrane and a dome arranged on the surface of the porous membrane, and at least a dome pressure chamber for driving liquid to flow between the chambers is formed between the dome and the porous membrane.
3. The microfluidic chip of claim 2, wherein: the dome is made of silica gel, TPE or TPU; and/or the porous membrane is a breathable and waterproof membrane, and the material of the porous membrane comprises polytetrafluoroethylene.
4. The microfluidic chip of claim 1, wherein: the second control unit is arranged on the control valve seat of the substrate layer in a covering mode; and/or the second control unit comprises a film of soft material, at least capable of being deformed in tension under the action of pressure, so as to control the state of the control valve; and/or the second control unit is made of a silicon gel film, a latex film or polycarbonate.
5. The microfluidic chip of claim 1, wherein: the third control unit comprises a porous membrane, the porous membrane is a breathable and waterproof membrane, and the porous membrane is made of polytetrafluoroethylene.
6. The microfluidic chip of claim 1, wherein: the cover sheet layer is attached or bonded with the substrate layer, so that a nucleic acid extraction chamber, a mixing chamber, a reaction chamber and a micro-channel are formed; and/or the thickness of the substrate layer is 0.3-10 mm; and/or the thickness of the cover plate layer is 0.01-0.5 mm; and/or a first control valve is arranged between the nucleic acid extraction chamber and the mixing chamber, and a second control valve is arranged between the mixing chamber and the reaction chamber.
7. A portable control device for use with the microfluidic chip of any one of claims 1-6, comprising a liquid and flow path control unit, a thermal management and temperature control unit, and a fluorescence excitation and collection unit;
wherein the liquid and flow path control unit includes:
the liquid driving assembly is at least used for pressing the dome pressure cavity of the microfluidic chip so as to drive the liquid to flow;
a control valve control assembly to at least compress the second control unit to close or open the control valve;
the thermal management and temperature control unit includes:
a first heating component at least used for heating and enabling the nucleic acid extracting chamber to reach the temperature required by nucleic acid elution;
a second heating component at least used for heating and enabling the temperature in the reaction chamber to reach the temperature required by the RPA reaction;
the fluorescence excitation and collection unit comprises a fluorescence excitation component and a fluorescence image collection component.
8. The portable control device of claim 7, wherein: the liquid driving component and the control valve control component comprise linear motors;
and/or, the first heating assembly comprises an infrared LED heating assembly; and/or the fluorescence excitation assembly comprises an LED light source and an excitation color filter, wherein the LED light source is arranged above the excitation color filter; and/or the fluorescent image acquisition assembly comprises a CCD assembly and an emission color filter, wherein the CCD assembly is arranged above the emission color filter.
9. The portable control device of claim 7, wherein: the liquid and flow path control unit, the thermal management and temperature control unit and the fluorescence excitation and acquisition unit are all controlled by a control center, and the control center comprises a singlechip.
10. A system for detecting the HLA-B58: 01 allele, comprising:
a kit for detecting the HLA-B58: 01 allele;
an RPA reaction system;
the microfluidic chip of any one of claims 1-6; and the number of the first and second groups,
the portable control device of any one of claims 7-9.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201922390644.7U CN211620465U (en) | 2019-12-27 | 2019-12-27 | Micro-fluidic chip, portable control device and detection system |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201922390644.7U CN211620465U (en) | 2019-12-27 | 2019-12-27 | Micro-fluidic chip, portable control device and detection system |
Publications (1)
Publication Number | Publication Date |
---|---|
CN211620465U true CN211620465U (en) | 2020-10-02 |
Family
ID=72632633
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201922390644.7U Active CN211620465U (en) | 2019-12-27 | 2019-12-27 | Micro-fluidic chip, portable control device and detection system |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN211620465U (en) |
-
2019
- 2019-12-27 CN CN201922390644.7U patent/CN211620465U/en active Active
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US9988676B2 (en) | Microfluidic cartridge | |
CN102618626B (en) | Method and kit for rapidly detecting single nucleotide polymorphisms (SNPs) | |
US7718421B2 (en) | Sample processing | |
JP5811483B2 (en) | Amplicon Rescue Multiplex Polymerase Chain Reaction for Amplification of Multiple Targets | |
US20150217293A1 (en) | Fluid Processing Device and Method | |
US20090061450A1 (en) | System and method for diagnosis of infectious diseases | |
US20110244466A1 (en) | Nucleic acid testing device and method | |
US20130331298A1 (en) | Analyzer and disposable cartridge for molecular in vitro diagnostics | |
US20080003564A1 (en) | Sample processing | |
JP2008546401A (en) | Cartridge, system and method for automatic medical diagnosis | |
AU2007225103A1 (en) | System and method for diagnosis of infectious diseases | |
AU2005238486A1 (en) | Method and device for sample preparation control | |
JP2009500011A (en) | Cartridge for automated medical diagnosis | |
JP2010207237A (en) | Apparatus for polynucleotide detection and quantitation | |
US20140328733A1 (en) | Simplified Gating Method for Sealing and Flow Control in Micro and Nano Devices | |
EP1371419A1 (en) | Method and device for detecting the presence of an analyte in a test sample | |
JP2021047170A (en) | Microfluidic device for preparing and analyzing biological sample | |
WO2014022700A2 (en) | Functionally integrated device for multiplex genetic identification and method for separation and detection of dna fragments | |
CN211620465U (en) | Micro-fluidic chip, portable control device and detection system | |
CN114182000A (en) | Integrated nucleic acid detection chip and method based on CRISPR technology | |
US20150238958A1 (en) | Microfluidic device for biological sample preparation | |
CN113046428A (en) | Primer group, probe, microfluidic chip, detection method and system for detecting HLA-B58: 01 allele | |
CN103602583A (en) | Integrated multifunctional microfluidic chip | |
KR101080087B1 (en) | Chip for cell amplification reaction and isothermal amplification device using the same | |
WO2009149115A1 (en) | Cartridge for conducting biochemical assays |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
GR01 | Patent grant | ||
GR01 | Patent grant |