CN205443311U - Automatic miniflow workstation of solid phase PCR reaction carries out - Google Patents

Abstract

The utility model discloses an automatic miniflow workstation of solid phase PCR reaction carries out, this workstation includes: at least one micro -fluidic chip, chip contain the reaction channel that one or more is independent, and each reaction channel is established ties or parallelly connected "The reaction chamber" and/or runner including exit, one or more, and the anchoring of "The reaction chamber" bottom surface has the oligonucleotide sequence to carry out the single base of increase of solid phase PCR and/or solid phase and extend the reaction, liquid way system to differential response reagent solution flow to the "The reaction chamber" who corresponds is introduced in control, temperature control device adjusts with control temperature in the "The reaction chamber", control system, above -mentioned liquid way system and temperature control device are connected to it for control liquid way system and temperature control device, the solid phase PCR who goes on in micro -fluidic chip's "The reaction chamber" amplify and/or the reaction is extended to the single base of solid phase, and including the variability elution reaction and elution the reaction of degeneration (RD). This workstation has single -stop -type automation, higher flux, low cost, convenient operation, high efficiency, advantage that the accuracy is high.

Description

A kind of automatization's miniflow work station carrying out Solid phase PCR reaction

Technical field

This utility model relates to genetic engineering field, particularly to a kind of Solid phase PCR & single base extension based on micro-fluidic chip, docking nucleic acid Mass Spectrometer Method, it is mainly used in single nucleotide polymorphism detection, a kind of SNP detection Sample pretreatment being applicable to one-stop automatization, multisample, high flux, fast response, low cost, can directly dock with nucleic acid mass spectrometer detector such as MALDI-TOF-MS, carry out SNP site detection.

Background technology

Single nucleotide polymorphism (SingleNucleotidePolymorphisms, SNPs) single base A on specific nucleotide position in genes of individuals group is referred to, T, C, the change of G and the change of DNA sequence that causes or sudden change, this sudden change includes the single conversion of base, transversion, insert or disappearance etc..Strictly speaking, only just can deserve to be called SNPs when allelic frequency is more than or equal to 1%, but the variation that part SNPs data base such as HGVBase is less than 1% allelic frequency is also included within SNPs.Research shows, on the mankind every couple allelosomal, every 1000bp arises that 1 SNP, and the whole every 300bp of human genome arises that 1 SNP, between any two individualities, just there are single base difference of many millions and 100,000 amino acid whose differences, reflect the specificity of human individual or colony to a certain extent, also result in mankind's multiformity of chromogene group between interior species.

The SNP of human genome is studied on a large scale and has great importance, it is possible not only to study descent of man, evolution and population genetics feature, and provides scientific basic and advanced means for polygenic disease and the Complex Diseases such as research of related gene such as human tumor, diabetes, cardiovascular disease, autoimmune disease, psychosis, alzheimer disease and the research of pharmacogenetics.SNP detection is the main research of current gene diagnosis.Meanwhile, one of gene diagnosis important means being increasingly becoming neonate or specific crowd genetic screening representated by SNP detection.

Due to its importance of SNP, and popularizing and going deep into along with SNP research, the detection method of SNP there has been long-range development at present, such as genome sequencing, exon group checks order, whole genome SNP chip, mass spectrography, SNPseq method, SNPlex, SNaPshot etc., can quickly, efficiently, bigger flux detection genome in SNP, but these equipment prices are expensive, are only applicable to the research of large-scale experiment room, it is difficult to popularize in common lab.

Mass spectrography is common method and the technology of most prospect of SNP site detection.Mass spectrography is by detecting the molecular weight of material (mass-to-charge ratio), reaches to distinguish, differentiate the purpose of material.There is molecular weight difference between two allele of SNP site, by typing assay, difference is amplified, then carry out detecting the purpose that i.e. can reach SNP typing with mass spectrograph.It mainly designs one section of probe in adjacent SNP site, with bi-deoxyribose ribonucleoside triphosphote (ddNTP in reaction system, dideoxy-nucleosidetriphosphate) dNTP dideoxyribonucleotide triphosphate (dNTP is substituted, deoxy-nucleotidethiophosphate)), make probe only extend a base at SNP site i.e. to terminate.According to the difference of SNP site, probe will combine different ddNTP, thus have different molecular weight, and mass spectrograph can detect this small molecular weight difference, thus realizes the purpose of SNP typing.

Wherein, MassARRAY time-of-flight mass spectrometry biochip system is developed for the Sequenom company of the U.S. of genetic mutation and SNP area research by professional production biochip system, is to use mass spectrography directly to detect the mature equipment of SNP at present.The outstanding feature of this system is to carry out genotype identification with high degree of accuracy, directly measures with SNP or the target dna of other sudden changes.Substitutive characteristics-molecular weight due to the direct detection molecules of mass spectrography, it is not necessary to carry out indirect detection by fluorescent labeling, accurately and reliably；Highly sensitive, the nucleic acid fragment of as little as 10ng can be detected.But, offshore company utilizes the method that SNPs site is detected by mass spectrograph, there is many defects during Sample pretreatment.As the normal process of Sequenom uses two-step pcr: regular-PCR expands in advance and expands with Single base extension PCR, i.e. amplifies the ssDNA template containing SNP site to be detected and amplifies the extension products containing SNP site；PCR expands 45 circulations of needs in advance, and Single base extension circulation needs 40 outer circulations and the most embedded 5 the interior circular response of each outer circulation；And between twice PCR expands, in addition it is also necessary to use shrimp alkaline phosphotase (ShrimpAlkalinePhosphatase, SAP) digestion to remove remaining dNTP and primer in first time PCR reaction system；Thus causing the prolongation of sample process time, reagent consumption and the increase of testing cost, the most whole flow operations needs up to about 10 hours, is unfavorable for the instant detection of sample.

Microfluidic chip technology is that the basic operation units such as biological, prepared by chemistry, the sample of medical analysis process, react, separate, detection are integrated on the chip of one piece of micro-meter scale, is automatically performed analysis overall process；It is life sciences, chemical science and information science signal detection and the important technological platform of Study on processing method.Nearly ten years, microfluidic chip technology is developed rapidly in fields such as biology, medical science, clinics, and the especially amplification of nucleic acid and analysis etc. (ZhangY, OzdemirP.Analyticachimicaacta, 2009,638 (2): 115-125；HorsmanKM,BienvenueJM,BlasierKR.Journalofforensicsciences,2007,52(4):784-799.).

No. PCT skilful for PCT/US2012/056888 middle forest, Zhu Jing et al. disclose the separation on microchip of a kind of nucleic acid and the method for enrichment: based on micro-fluidic chip, Solid phase PCR amplification and single base extension is realized for carrier, to detect DNA molecular needed for SNPs and separation and enrichment with the magnetic bead in reaction microchamber.But the integrated micro-heater and temperature sensor of its microchip, with magnetic bead as reaction carriers, if relating to different sample and different SNP site detection, then need to change magnetic bead or the primer of its surface anchoring, thus cause the complex operation in course of reaction, and be difficult to the automatic business processing of reaction.

In sum, existing realize SNP site detection method, there is problems in that sample process complex operation step, required outfit instrument and equipment is more and expensive, the interference that manual operation brings is big, and whole experiment is the longest, it is difficult to realize the instant detection in clinic.

Utility model content

The purpose of this utility model is to provide for one based on micro-fluidic chip as reaction channel and solid phase carrier, and utilize Solid phase PCR amplification method and solid single base extension methods, in the miniflow work station that function is integrated, carry out SNP and detect Sample pretreatment, can directly dock with nucleic acid Mass Spectrometer Method analyser, detect SNP site.This work station connects reverse primer based on micro-fluidic chip passage bottom as solid phase substrate grappling, and carries out Solid phase PCR amplified reaction, degeneration-elution of reactive, a step single base extension and eluting-reaction of degeneration: need that sample carries out twice multi cycle pcr amplification reaction, SAP digestion process during overcoming existing mass spectrography detection SNP sample process and the defect such as the cost that causes is high, time-consuming, laborious；The one-stop automation mechanized operation of reaction is realized by the miniflow work station integrating liquid-way system, attemperating unit and control system etc.；The most disposable chip avoids the cross-contamination between sample, and can use dissimilar chip and different oligonucleotide sequences according to different SNP site and detection demand；After sample is processed by work station, can directly dock nucleic acid mass spectrometer；This work station have one-stop automatization, higher flux, low cost, easy to operate, rapidly and efficiently, accuracy advantages of higher.

In various aspects herein, this utility model includes can be used for one or more samples, including whole blood or DNA sample, carrying out the miniflow work station of Solid phase PCR amplification & single base extension, it includes micro-fluidic chip, liquid-way system, attemperating unit and control system etc..Wherein, micro-fluidic chip, thering is provided reaction channel and solid phase substrate: responded reaction chamber or runner in one or more series connection and complete, the solid phase substrate tiling grappling of passage bottom has reverse primer, can carry out Solid phase PCR amplification and solid phase single base extension on solid phase substrate；Liquid-way system, connects micro-fluidic chip, in course of reaction, then under special time and environment, the specific reaction reagent solution of control introducing is to reaction chamber, with reverse primer or target DNA fragments haptoreaction；Attemperating unit, is close to chip channel bottom surface, predominantly Peltier heating plate or other heating/cooling devices, provides specific temperature environment for passage bottom and reaction solution reagent in course of reaction；Control system, coupling liquid-way system and attemperating unit, for the operable system of user: input related information parameters can be arranged, including reaction temperature, response time, reagent flow rate etc., and with this control system and attemperating unit be monitored and feed back output order collection, make system response can be automatically performed according to setup parameter.

In an embodiment, micro-fluidic chip material is one or the combination of metal, glass, silicon chip and polymer；Micro-fluidic chip includes importing and exporting and passage, and its chips can be one or more parallel passage, and each passage can be reaction chamber or the runner of one or more serial, and passage bottom is plane or has array pan, and grappling connects one or more reverse primers；The connected mode of passage bottom-reverse primer is at least one in carboxyl/aldehyde radical/epoxy radicals-amino, Streptavidin-biotin.

In an embodiment, liquid-way system includes, the micro-pipe of peristaltic pump, capillary, agent bin and multiple-way valve etc..Peristaltic pump provides power for reagent solution；The micro-pipe of capillary provides runner for reagent solution, connects agent bin and micro-fluidic chip；Multiple-way valve provides selective switch for plurality of reagents.

In an embodiment, temperature control system includes, Peltier heating plate or other heating/cooling device parts, metal conducting strip, heat abstractor, temperature sensor and proportional-integral-differential (PID, Proportional-Integral-Derivative) controller etc.；Thering is provided suitable temperature environment for Solid phase PCR amplification and solid phase single base extension, preferred temperature control system has the characteristics such as temperature accuracy is high, homogeneity is good, warming and cooling rate is fast.

In an embodiment, control system includes, visualized operation interface, single-chip microcomputer, control panel etc., parameter information input can be carried out according to user's request, by single-chip microcomputer, temperature control system and liquid-way system are carried out instruction to export, and carry out each parameter information in operation implementing monitoring and making feedback.

In an embodiment, whole reaction includes, Solid phase PCR expands in advance, degeneration-elution of reactive, solid phase single base extension, eluting-reaction of degeneration: under liquid-way system control, introduce forward primer, Taq enzyme/whole blood DS enzyme, DNA/ blood, dNTP and PCR amplification system at interior mixed liquor to reaction chamber, attemperating unit carries out heating and cooling according to setup parameter, then in chip channel bottom surface, i.e. solid phase substrate generation Solid phase PCR amplified reaction, including degeneration-annealing-extension repeatedly, passage bottom covers with the double-stranded DNA (dsDNA) containing SNP site；Attemperating unit heats up or is passed through alkaline solution, the dsDNA of solid phase substrate grappling occurs degeneration to unwind, complementary single-stranded dna (ssDNA) dissociates to solution, the connection of target ssDNA is anchored on chip channel bottom surface, after be passed through cleaning buffer solution again reaction chamber carried out eluting repeatedly, i.e. wash away unreacted primer, dNTP, free complementary ssDNA etc., purify purpose with target ssDNA reached being anchored on solid phase substrate；Secondly liquid-way system controls to introduce the mixed liquors such as Single base extension primer, Taq enzyme, ddNTP and reaction system to reaction chamber, attemperating unit carries out heating and cooling according to setup parameter, carry out single base extension, including annealing-extension repeatedly, there is Annealing complementary in i.e. Single base extension primer and the ssDNA being anchored on solid phase substrate, extend a base at primer downstream i.e. to terminate, output and be anchored on solid phase substrate, can be complementary with target ssDNA extension products；Liquid-way system introduces cleaning buffer solution, reaction chamber is carried out cleaning repeatedly, i.e. wash away unreacted extension primer, ddNTP etc., purpose is purified with target ssDNA and extension products reached being anchored on solid phase substrate, wherein cleaning buffer solution continues to be introduced into and flows to waste liquid storehouse, after to be cleaned, it is passed through deionized water to be again carried out, follow-up startup attemperating unit carries out heat treated, target ssDNA and extension products generation degeneration, extension products unwinds and dissociates to deionized water, reclaims deionized water, directly can carry out machine testing on follow-up mass spectrum.

This work station is primarily adapted for use in, the Sample pretreatment of SNP Mass Spectrometer Method.This miniflow work station docking nucleic acid mass spectrometer carry out SNP site detection, it is possible to greatly reduce sample analysis process time, testing cost, have higher flux, low cost, easy to operate, rapidly and efficiently, accuracy advantages of higher.

In sum, this utility model has the advantage that

First, this work station utilizes micro-fluidic chip passage bottom to connect reverse primer as solid phase substrate grappling, and carries out Solid phase PCR amplified reaction, degeneration-elution of reactive, a step single base extension and eluting-reaction of degeneration: need that sample carries out twice multi cycle pcr amplification reaction, SAP digestion process during overcoming existing mass spectrography detection SNP sample process and the defect such as the cost that causes is high, time-consuming, laborious；The especially SNP detection Sample pretreatment time is substantially reduced, and can complete to process in 1-2 hour, the most shorter, then carries out machine acquisition SNP testing result on mass spectrum.

Then, Solid phase PCR amplification and solid phase Single base extension is realized in same reaction channel in micro-fluidic chip, and the nucleotide of extension products/containing SNP site is enriched with, separates, purifies, to carry out gene test and other purposes, and can directly dock mutually with SNP detection, it is possible to achieve the automatization of detection.

Finally, one-stop, the automation mechanized operation of reaction is realized by the miniflow work station integrating liquid-way system, attemperating unit and control system etc.；The most disposable chip reduces the cross-contamination between sample, and can use dissimilar chip according to different SNP site and detection demand；After sample is processed by work station, can directly dock nucleic acid mass spectrometer；This work station have one-stop automatization, higher flux, low cost, easy to operate, rapidly and efficiently, accuracy advantages of higher.

Reading described in detail below in conjunction with Figure of description and claims, these and other feature of the present utility model will become more apparent from.

Accompanying drawing explanation

Fig. 1 is experimental principle schematic diagram of the present utility model；

Fig. 2 is micro-fluidic chip schematic diagram of the present utility model；

Fig. 3 A is the micro-fluidic chip schematic diagram of double-layer structure of the present utility model；

Fig. 3 B is the micro-fluidic chip schematic diagram of three-decker of the present utility model；

Fig. 3 C is micro-fluidic chip illustraton of model after assembling of the present utility model；

Fig. 4 is miniflow work station schematic diagram of the present utility model；

Fig. 5 A is the structural representation of solid phase substrate of the present utility model (chip channel bottom surface) tiling grappling reverse primer；

After Fig. 5 B is Solid phase PCR of the present utility model amplification, the structural representation of solid phase substrate grappling target dsDNA；

Fig. 5 C is of the present utility model after degeneration & cleans, the structural representation of solid phase substrate grappling target ssDNA；

After Fig. 5 D is solid phase single base extension of the present utility model, single base extension product is combined with the complementation of target ssDNA, and is anchored on the structural representation of solid phase substrate；

Fig. 5 E is of the present utility model after over cleaning degeneration, and single base extension product departs from solid phase substrate, structural representation free in chip channel solution；

Fig. 6 is the MALDI-TOF-MS Mass Spectrometer Method figure that generation product of the present utility model is carried out.

Detailed description of the invention

Noun lexical or textual analysis

Before elaborating this utility model miniflow work station, can be best understood from mechanism of the present utility model and main points for everybody, term used herein is illustrated by spy, and its lexical or textual analysis is only limitted in embodiment.

Reverse primer/forward primer/Single base extension primer

In various embodiments, reverse primer, forward primer and Single base extension primer are all the SNP site design oligonucleotides sequences according to required detection, and transfer to relevant primer company to carry out synthesizing (such as, Sheng Gong biological engineering limited company, Shanghai).Wherein, 5 ' ends of reverse primer are through chemical modification, such as the chemical reaction group such as amino, biotin, it is simple to reverse primer is anchored on solid phase substrate.In PCR course of reaction, the ssDNA that reverse primer amplification extends is target ssDNA, and the ssDNA that forward primer connects is then complementary ssDNA, and forward primer can occur hybridization to combine with the free-end of target ssDNA；Single base extension primer is then applicable to single base extension, with target ssDNA, Complementary hybridization can occur, the downstream extending primer nestles up SNP site, in course of reaction, owing to ddNTP lacks the 3-OH group required for extending, extend primer and be only capable of at SNP site occurring a base extension i.e. to terminate.

Grappling/connection/fixing

In various embodiments, the Solid phase PCR amplification occurred in micro-fluidic chip reaction chamber and solid phase Single base extension, so-called " solid phase " is all to be fixed realization by reverse primer in chip channel bottom surface.In case study on implementation, " grappling ", " connection ", " the fixing " mentioned, i.e. legal by covalently bonded, reverse primer is combined by the covalent bond between biotin-Streptavidin or amino-carboxyl/aldehyde radical/epoxy radicals etc., is fixedly attached to passage bottom.Before the reaction, reverse primer, by hatching modification, is anchored at solid phase substrate；Reaction starts, and Solid phase PCR amplified reaction occurs on solid phase substrate；After degenerative treatments and eluting, target ssDNA is fixed on solid phase substrate, follow-up carries out solid phase single base extension.

Micro-fluidic chip/reaction chamber/solid phase substrate

In various embodiments, Solid phase PCR amplified reaction and solid phase single base extension, all complete in micro-fluidic chip, is specifically to complete in the reaction chamber of chip runner, further say it is the bottom surface of chip channel, the reaction that i.e. solid phase substrate surface is carried out；Micro-fluidic chip is the carrier of whole reaction, reaction channel then provides the space of closing, solid phase substrate is then really to react spot: reverse primer is fixed on solid phase substrate, and target ssDNA that PCR amplification generates is fixed on solid phase substrate, and single base extension is also to occur on the surface of solid phase substrate.

Micro-fluidic chip includes chip channel, and chip channel is made up of one or more parallel reaction channels, and a reaction channel can comprise reaction chamber or the runner of one or more serial.

Micro-fluidic chip, generally, refer at least a dimension upper channel size in millimeter, micron level, the least；The volume of chip channel is in microlitre, nanoliter rank, the least.Because of its micro-feature, it is few that micro-fluidic chip has sample consumption, it is easy to control characteristic；Its specific surface area another is relatively big, and molecule diffusion length is short, and fluid thermal capacitance is little, has the characteristics such as analysis detection speed is fast, reaction homogeneity is good.In the implementation case, a width of 50um～4mm of chip channel, a height of 50um～500um of passage.Chip channel bottom surface first passes through carboxyl/aldehyde radical/epoxy radicals/streptavidin chemical group surface in advance and modifies.

Liquid-way system

In various embodiments, liquid-way system includes agent bin (including product storehouse, waste liquid storehouse), syringe, multiple-way valve, Micropump and micro-pipe, pressure/flow sensor etc..Wherein agent bin is the storage device of reaction reagent, and can set different storage ambient temperatures according to different reagent；Micropump is then the power engine that reagent solution flows in chip channel, its method that can carry out positive pressure expulsion or negative pressure extracting by syringe, controls the flowing of fluid or static；Micro-Guan Ze is agent bin, the flow path channel of waste liquid storehouse connection micro-fluidic chip passage, can be described as the vascular system of system；Multiple-way valve is then to control different reagent to flow into chip channel, and waste liquid, product are in the collection of different bins, and by default parameter and the control of system, multiple-way valve switches automatically and realizes different reagent in the introducing of special time or outflow.It addition, work station also can assembling pressure sensor, it is possible to the character of reagent solution in monitoring passage in real time, including reagent leakage, liquid inventory and volume etc., in course of reaction, system can be safeguarded by user according to Monitoring Data, including the replacing of original paper；Especially when there is reporting an error fault, system can be carried out failture evacuation and debugging based on Monitoring Data.

Attemperating unit

In various embodiments, pcr amplification reaction and single base extension, unwind including dsDNA degeneration free into the degeneration of ssDNA and extension products, need to be integrated in micro-fluidic chip and complete；Course of reaction relates to: PCR temperature cycles such as 95 DEG C (degeneration)-55 DEG C (annealing)-72 DEG C (extension), and reaction of degeneration is in using thermal denaturation processing procedure, and temperature also need to be at about 95 DEG C；This is accomplished by miniflow work station and is provided with attemperating unit, and is close to die bottom surface.Attemperating unit to have the characteristic realizing accurately the controlling of temperature, good temperature uniformity and warming and cooling rate faster.In an embodiment, attemperating unit can use Peltier heating plate (Peltierheatingplates) or other heating/cooling devices, it is provided with: the metal/ceramic flat board of high heat conduction and chip can fit tightly, fan or chiller are capable of lowering the temperature rapidly and preventing superheating phenomenon, the temperature of chip is monitored in temperature sensor in real time, and PID controller controls temperature in real time and carries out warm up/down etc. according to user preset temperature curve.

Control system

In various embodiments, control system is the brain of miniflow work station, and its coupling liquid-way system and attemperating unit, in whole course of reaction, it is possible to each device of control system runs automatically according to user preset parameter.It includes energy supply control module, Information Collecting & Processing module, single-chip microcomputer, input/input signal module, visualized operation interface etc.；Wherein energy supply control module, powers for each parts；Information Collecting & Processing module connects pressure, temperature, flow transducer, and transmits to single-chip microcomputer；Single-chip microcomputer is microprocessor；Input/output signal module to single-chip microcomputer input signal or accept single-chip microcomputer output signal, and can export to each parts；Visualized operation interface then can show real-time system parameter, and user can pass through its parameter preset, including PCR reaction temperature, response time, reagent flow rate etc..

The utility model discloses one based on micro-fluidic chip as reaction chamber and solid phase carrier, by the miniflow work station that function is integrated, Solid phase PCR amplification and solid phase Single base extension is realized in same reaction channel in micro-fluidic chip, and the nucleotide sequence of extension products/containing SNP site is enriched with, separates, purifies, to carry out gene test and other purposes.

The utility model discloses a kind of based on micro-fluidic chip, in a reaction chamber, realize Solid phase PCR amplification and solid phase single base extension, the reverse primer that the solid phase substrate grappling that being included in micro-fluidic chip passage bottom provides connects.With reference to Fig. 1, Principle Method comprises the following steps: the mixed liquor containing PCR reactant liquor, dNTP, DNA profiling/whole blood, forward primer introduces solid phase substrate grappling connection the chip channel of reverse primer, through degeneration repeatedly, anneal, extend after generate target ssDNA containing reverse primer and containing the complementary ssDNA of forward primer, article two, ssDNA complementation generates dsDNA, and is fixed on passage bottom (see 110) by reverse primer；Pass through degenerative treatments, including chemical mode (being such as passed through aqueous slkali) or heat treatment, dsDNA occurs degeneration to unwind, complementary ssDNA occurs free, introduce cleaning buffer solution and reaction channel is carried out cleaning repeatedly, wash away free complementary ssDNA, unreacted primer and dNTP etc., i.e. target ssDNA being anchored on solid phase substrate is purified, wherein cleaning buffer solution is through connecting the micro-pipe of capillary and the selectively unlocking of multiple-way valve of chip outlet, is introduced into waste liquid storehouse (see 120)；Then, to be incorporated into chip channel containing PCR reactant liquor, ddNTP, the mixed liquor of Single base extension primer, after annealing-extension repeatedly, Single base extension primer hybridization is to target ssDNA, extend a base i.e. to terminate, and be anchored on solid phase substrate (see 130)；It is introduced back into cleaning buffer solution passage is cleaned repeatedly, wash away unreacted and extend primer, ddNTP etc., i.e. the ssDNA and extension products being anchored on solid phase substrate is purified, eluting through deionized water desalts again, finally carries out heat denatured process, and extension products unwinds free, reclaim the deionized water containing free extension products, now switching multiple-way valve, open product storehouse valve, the deionized water containing free extension products is introduced to product storehouse (see 140).The whole solution of reaction gets final product the upper machine of direct MALDI-TOF-MS (Matrix Assisted Laser Desorption ionization time-of-flight mass spectrometer), carries out Mass Spectrometer Method, generates SNP site report.

Above-mentioned experimental procedure is all carried out in micro-fluidic chip, is also called Microfluid based Lab on a chip or chip lab, and it is at least micron order yardstick in a dimension that its feature is mainly its resulting structure accommodating fluid.Micro-fluidic chip can be by least one in metal, silicon chip, glass and polymer or form.Micro-fluidic chip can use Micrometer-Nanometer Processing Technology to manufacture, and such as method of molding, lithographic chemical corruption candle method etc., it includes import and export, runner and reaction chamber.According to different demands with realize function, the chip of difformity and size can be processed into: chip runner can be circular passing through or square duct, and reaction chamber can be single chamber or multiple chamber series/parallel, and channel size can be 10um～2mm, the least.

In case study on implementation of the present utility model, use Solid phase PCR amplification and solid phase single base extension principle, responded and be all integrated in same reaction chamber realization, reaction reagent can be realized accurately controlling and integrated operation by implementation process, but do not limit to, also can be at two or more reaction chambers.Describe the micro-fluidic chip that this utility model uses, including import 210, outlet 220, upper cover 230, reaction channel 240 and the substrate 250 of chip Fig. 2 suitability.In the processing and implementation case of chip, chip manufacture scheme by two kinds of implementations, but can not limited to, double-layer structure and three-decker.Double-layer structure such as Fig. 3 A signal: upper cover 310 and substrate 320, upper cover punching is as the import and export of passage, and substrate performs etching grooving as reaction runner；Three-decker such as Fig. 3 B signal: upper cover 330, channel cage 340 and substrate 350, upper cover punching is as the import and export of passage, and fence is then for reaction runner interval；As Fig. 3 C illustrates, by hierarchy being carried out bonding packaging, being formed and can pass in and out the capping chamber of circulation, including importing and exporting 360,370 and passage 380.In an embodiment, micro-fluidic chip has 8 parallel reaction channels, and each passage contains only single reaction chamber；But not limiting to, also can be 1,2,4,10,16 parallel passages, each passage can contain again two or more reaction chambers, and such as the reaction chamber of dual serial, the PCR carrying out sample respectively expands and single base extension in advance.But single passage has strict closure, will not there is the circulation of solution reagent with other parallel channels, it is to avoid the cross-contamination of different samples.

In case study on implementation of the present utility model, micro-fluidic chip uses double-layer structure processing scheme as shown in Figure 3A: upper cover is alkali-free glass material, and substrate is Silicon Wafer material, a size of L*W*H=7.5cm*2.5cm*0.1mm, close with common slide size.First, alkali-free glass, Silicon Wafer are cut into above-mentioned size；Then according to respectively glass, silicon chip are punched, etch grooving in floor layout shape, i.e. glass top cover is provided with import and export, silicon chip substrate is provided with microchannel, passage length is 6cm, the degree of depth is 50um-200um, width is 0.5mm～3mm, and the reaction system cumulative volume of single reaction channel is 5ul～20ul；Secondly, chip upper cover, substrate are carried out ultrasonic cleaning, removes residual impurity drying and processing；Then solid phase substrate is carried out carboxyl/aldehyde radical/epoxy radicals/streptavidin surface moditied processing；Finally utilize photoresist to bond bonding techniques, in silicon chip non-passage area uniform gluing, after alignment silicon chip and glass top cover are gently pressed, carry out ultraviolet lighting bonding, after completing the making of micro-fluidic chip, it is carried out vacuum and seal 4 DEG C of retentions.

In case study on implementation of the present utility model, the method flow of above-mentioned solid phase substrate surface moditied processing, provide the concrete steps that silicon chip aldehyde radicalization is modified, including:

A, employing hydrogen peroxide and concentrated sulphuric acid process according to the ratio of v/v=1:3, make silicon chip surface height hydroxylating；

After silicon chip is cleaned by B, employing dehydrated alcohol repeatedly, utilize silylating reagent APTMS, make the hydroxyl amino of silicon chip surface；

After silicon chip is cleaned by C, employing dehydrated alcohol, deionized water repeatedly, utilize glutaraldehyde reagent, make the amino aldehyde radical of silicon chip surface.

In case study on implementation of the present utility model, such as schematic diagram 4, miniflow work station includes micro-fluidic chip, liquid-way system, attemperating unit and control system.

In case study on implementation of the present utility model, micro-fluidic chip 410, there is provided reaction chamber and solid phase substrate: responded reaction tank or runner in one or more series connection and complete, the solid phase substrate tiling grappling reverse primer of passage bottom, can carry out Solid phase PCR amplification and solid phase single base extension on solid phase substrate.

In case study on implementation of the present utility model, liquid-way system, in course of reaction, then for controlling the specific reaction reagent solution of introducing under special time and environment to chip channel, with the nucleotide haptoreaction of pcr amplification primer thing or primer extension, it includes agent bin 421, syringe 422, multiple-way valve 423 and micro-pipe 424 etc..Wherein, the agent bin being connected chip import by multiple-way valve includes blood/DNA profiling, PCR amplifing reagent, Single base extension reagent, buffering cleaning buffer solution and deionized water for storage reaction reagent, and the agent bin of connection outlet is used for collecting waste liquid and generating product；Multiple-way valve then introduces different reagent by switch valve and is passed through chip channel, draws different solutions and flows out product storehouse/waste liquid storehouse；Syringe and Micropump, Micropump shows the most in the drawings, its in course of reaction for reagent solution flowing provide power；Micro-pipe, connection chip is imported and exported and agent bin, it is provided that flow pipe.Micropump and multiple-way valve are all of coupled connections control system.

In case study on implementation of the present utility model, attemperating unit, it is close to chip channel bottom surface, predominantly Peltier heating plate or other heating/cooling devices, thering is provided specific temperature environment for passage bottom and reaction solution reagent in course of reaction, it includes Peltier heating plate 431 (Peltierheatingplates), fin 432 and fan 433 etc..Attemperating unit, it is possible to realize accurately controlling and warming and cooling rate faster of temperature, it is ensured that PCR reaction and single base extension efficiently and accurately complete.All coupling control system such as heating plate, fan and temperature sensor, temperature sensor is not shown in figure；Another for ensureing that attemperating unit accurately runs according to parameter preset, use PID controller to be controlled attemperating unit realizing.

In case study on implementation of the present utility model, control system, coupling liquid-way system and attemperating unit, for the operable system of user: predeterminable parameter, including reaction temperature, response time, reagent flow rate etc., reaction starts to automatically control each element and runs according to setup parameter, and in course of reaction, the real-time monitoring system running statuses such as the temperature sensor of coupling, flow transducer, and make each component parameters of feedback adjustment voluntarily, to ensure accurately completing of system response.Control system includes energy supply control module, Information Collecting & Processing module, single-chip microcomputer, input/input signal module, visualized operation interface etc., there is no display in the drawings.

In case study on implementation of the present utility model, the objective function of miniflow work station is to sample, including whole blood or DNA profiling, carries out the Sample pretreatment of SNP site detection, i.e. processes original sample, generates the single base extension product that can be directly used for Mass Spectrometer Method.In an embodiment, provide DNA sample and realize Solid phase PCR amplification and the concrete operations flow process of single base extension, choose including reagent and reaction condition.

In case study on implementation of the present utility model, micro-fluidic chip being loaded onto micro-fluidic work station adaptation fixed position, and carries out pretreatment operation, including micro-pipe and the connection of chip, reagent prepares, and response procedures parameter is preset.So far, control system start button can be started, start reaction.Whole reaction includes, primer solid phase construction of GPI-anchored mGM, and Solid phase PCR expands in advance, degeneration-elution action, solid phase single base extension, eluting-degeneration operation；In course of reaction, according to user setup parameter, system has automatically controlled.

In case study on implementation of the present utility model, first need before reaction according to SNP detection site, design reverse, forward primer and Single base extension primer, wherein reversely, forward primer is pcr amplification primer thing, Single base extension primer can hybridize combination with target ssDNA containing reverse primer, selects such as DNA profiling and contains the sequence that a Single base extension suddenlys change:

Rs111033318, mutational site is T > A, and sequence is

(GCAATACTGGACAACCCACATCATTTTACTATTGCCAAAGCTCCAAATGTATAATTCAGAAAACCAGAACCTTACCACCCGC[A/T]GTGATCTCACTCCAACAACGTCCAGGAA)；The reverse primer then designed is: (ACGTTGGATGTTTCCTGGACGTTGTTGGAG), the forward primer of design is: (ACGTTGGATGTG CAATACTGGACAACCCAC), ACGTTGGATGT is the joint added during design, and Single base extension primer is:

(AGAACCTTACCACCCGC, M.W=5084.29Da), and it is amido modified during reverse primer synthesis, its 5 ' end to be carried out C6；Synthesis and the modification of primer are synthesized by Shanghai Sheng Gong biological engineering limited company.Wherein, ddNTP buying for Sequenom company of the U.S., its molecular weight respectively: ddATP=271.2Da, ddTTP=327.1Da, ddCTP=247.2Da, ddGTP=287.2Da；If undergoing mutation, extension products is (AGAACCTTACCACCCGCA, M.W=5356.5Da)；Do not undergo mutation, be then (AGAACCTTACCACCCGCT, M.W=5412.3Da).

First, it is passed through cleaning buffer solution 1X (5mMTris-HCl, 0.5mMEDTA, 1MNaCl, and0.01%v/vTween-20, PH=7.5) chip channel is carried out rinse, the rear reverse primer modified containing 5 ' Amino End Group that introduces, amino and aldehyde radical generation condensation reaction, i.e. reverse primer modifies the solid phase substrate being anchored on chip channel, again being passed through cleaning buffer solution, wash away free reverse primer, solid phase substrate 501 grappling connects as shown in Figure 5A reverse primer 502；Subsequent control system is according to pre-defeated instruction, and liquid-way system response starts, and forward primer 503, DNA profiling 504 is introduced in reaction chamber at interior mix reagent, and mixed liquor includes Taq enzyme 0.1ul (5U/ul), 10 × Taq buffer (Mg²⁺) 2ul, dNTP mixed liquor (each 2.5mM) 0.8ul, DNA profiling 1ul, forward primer 0.6ul and deionized water 5.5ul；PCR amplification cycles temperature see table:

Table 1. Solid phase PCR cyclic amplification parameter

Secondly, starting attemperating unit, carry out being warming up to 95 DEG C according to setup parameter, DNA profiling generation degeneration is unwind；Attemperating unit carries out being cooled to 55 DEG C, then the complementary ssDNA containing forward primer and the reverse primer generation anneal being anchored on solid phase substrate, simultaneously from target ssDNA and the free forward primer generation anneal of sample；Attemperating unit is warming up to 72 DEG C, and primer occurs extension to generate dsDNA505 under polymerase effect, and is anchored on solid phase substrate；Attemperating unit is warming up to 95 DEG C again, and dsDNA occurs degeneration to unwind into free complementary ssDNA and fixing target ssDNA；Be cooled to 55 DEG C, then complementary ssDNA again with fixing reverse primer generation anneal.Repeating 30 circulations (degeneration, anneal and extend) and can realize the amplification of target dsDNA, and grappling is connected to chip channel bottom surface, dsDNA is anchored on chip channel bottom surface by reverse primer as shown in Figure 5 B.

Then, after pcr amplification reaction completes, (alkaline solution cleaning buffer solution is prepared to be passed through alkaline solution process, 0.1mMNaOH) or be passed through cleaning buffer solution post-heating to 95 DEG C, 1min, the dsDNA of solid phase substrate grappling occurs degeneration to unwind, complementary ssDNA containing forward primer occurs free, and the target ssDNA506 connection containing reverse primer is anchored on chip channel bottom surface, as shown in Figure 5 C；Then, it is passed through cleaning buffer solution reaction chamber is rinsed, unreacted primer, dNTP and free complementary ssDNA etc. can be washed away, purpose is purified with target ssDNA reached being anchored on solid phase substrate, wherein the micro-pipe of capillary of connection chip outlet is under the waste liquid valve opening of multiple-way valve, and cleaning buffer solution is introduced into waste liquid storehouse.

Then, liquid-way system controls to introduce the mix reagent such as Single base extension primer 507 and ddNTP508 to chip channel, and mixed liquor includes Taq enzyme 0.1ul (5U/ul), 10 × Taq buffer (Mg²⁺) 2ul, ddNTP mixed liquor 0.4ul, Single base extension primer working solution 1ul and deionized water 6.5ul；Attemperating unit carries out heating and cooling according to setup parameter, carry out single base extension, including annealing-extension repeatedly, there is Annealing complementary in i.e. Single base extension primer and target ssDNA being anchored on solid phase substrate, and extend a base, obtain and be anchored on the extension products that solid phase substrate target ssDNA is complementary, as shown in Figure 5 D；Single base extension circulating temperature see table:

Table 2. single base extension cyclic amplification parameter

Finally, liquid-way system introduces cleaning buffer solution, reaction channel carries out cleaning repeatedly, i.e. washes away unreacted extension primer, ddNTP etc., purifies purpose with target ssDNA and extension products reached being anchored on solid phase substrate, and wherein waste liquid still flows to waste liquid storehouse；It is passed through deionized water and carries out secondary cleaning；Start attemperating unit and be warming up to 95 DEG C, 1min, ssDNA and extension products are carried out degeneration operation process, as shown in fig. 5e, extension products 509 unwinds free, the product storehouse of switching multiple-way valve, product storehouse will be flow to containing the solution of free extension products, upper machine mass spectrum can be carried out to MALDI-TOF-MS by transfer product, obtain SNP site detection figure.As shown in Figure 6, sample to no mutant homozygote, the most simple detection after carrying out above-mentioned reaction, according to molecular weight quantitative analysis, three dotted lines in figure are respectively labeled as original extension primer (M.W=5084Da), sudden change extension products (M.W=5356Da), the molecular weight (M.W=5412Da) of wild extension products, and at extension primer, sudden change extension products, there are mass spectra peak in the drawings, the base that i.e. can determine that extension is ddATP, detect that SNP site is undergone mutation, base T sport A.

The foregoing is only preferred embodiment of the present utility model, those skilled in the art know, in the case of without departing from spirit and scope of the present utility model, these features and embodiment can be carried out various change or equivalent.It addition, under teaching of the present utility model, can modify these features and embodiment to adapt to particular situation and material without departing from spirit and scope of the present utility model.Therefore, this utility model is not limited to the particular embodiment disclosed, and the embodiment in the range of fallen with claims hereof broadly falls into protection domain of the present utility model.

Claims (11)

1. carrying out automatization's miniflow work station of Solid phase PCR reaction, described work station includes:

At least one micro-fluidic chip, chip contains one or more independent reaction channel, each reaction channel includes import and export, the reaction chamber of one or more serial or parallel connection and/or runner, the grappling of reaction chamber bottom surface has oligonucleotide sequence, to carry out Solid phase PCR amplification and/or solid phase single base extension；

Liquid-way system, introduces differential responses reagent solution with control and flow to the reaction chamber of correspondence；

Attemperating unit, to control to adjust the temperature in described reaction chamber；

Control system, it connects above-mentioned liquid-way system and attemperating unit, for controlling liquid-way system and attemperating unit, the Solid phase PCR amplification carried out in the reaction chamber of micro-fluidic chip and solid phase single base extension, and include degeneration-elution of reactive and eluting-reaction of degeneration.

Miniflow work station the most according to claim 1, it is characterized in that, described micro-fluidic chip includes upper cover, reaction channel and substrate, on be covered with the import and export of reaction channel, substrate performs etching grooving and becomes reaction channel, and passage length is 2-8cm, and the degree of depth is 50um-200um, width is 0.5mm～3mm, and the reaction system cumulative volume of single reaction channel is 5ul～20ul.

Miniflow work station the most according to claim 1, it is characterized in that, described micro-fluidic chip includes upper cover, channel cage and substrate, is above covered with the import and export of reaction channel, and " sandwich structure " of upper cover-channel cage-substrate forms multiple independent reaction channel.

4. according to the miniflow work station described in Claims 2 or 3, it is characterised in that by the bonding packaging to hierarchy, form the capping chamber that can pass in and out circulation.

Miniflow work station the most according to claim 1, it is characterized in that, described micro-fluidic chip material is to include at least one of metal, glass, silicon chip and polymer or combine composition, its resulting structure accommodating fluid is at least micron order yardstick in a dimension, micro-fluidic chip is under multiple states, and each micro-fluidic chip is independently connected with control system.

Miniflow work station the most according to claim 1, it is characterized in that, the solid phase substrate of described micro-fluidic chip is planar structure, can grappling one or more oligonucleotide sequences highdensity, described solid phase substrate tiling grappling oligonucleotide sequence be to be completed by carboxyl/aldehyde radical/epoxy radicals-amino, at least one in interior multiple chemical modification of Streptavidin-biotin.

Miniflow work station the most according to claim 6, it is characterised in that described in be anchored on the oligonucleotide sequence of chip channel bottom surface be the reverse primer needed for PCR amplification.

Miniflow work station the most according to claim 1, it is characterised in that described solid phase single base extension includes one or more annealing-extension.

Miniflow work station the most according to claim 1, it is characterised in that described attemperating unit is arranged on the bottom surface of chip reaction chamber.

Miniflow work station the most according to claim 1, it is characterized in that, described liquid-way system includes arranging the container of various described reagent, the path being connected with reaction channel and control valve, described reagent is including the forward primer expanded for PCR/Single base extension primer, dideoxyribonucleotide triphosphate/bi-deoxyribose ribonucleoside triphosphote, reaction enzymes, reaction buffer and cleaning buffer solution, control system is connected with this control valve, the size of switch or Access flow to control valve.

11. miniflow work stations according to claim 1, it is characterized in that, described control system includes that electric power provides device, controller, harvester, display device and/or output device, electric power provides device to provide electric power to miniflow work station, controller connects harvester, display device and/or output device, and connect liquid-way system and attemperating unit.