CN204369862U - Cock sexual prematurity genes involved---GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit - Google Patents

Abstract

Cock sexual prematurity genes involved-GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit, comprise the vestibule on upper and lower layer box body (2,3), liner (4), liner, lower floor's box body is provided with cryosphere (5); Be respectively equipped with primer mixture (6), DNA Tag enzymatic amplification damping fluid (7), restriction endonuclease damping fluid (8), dNTP(9 in the box body liner vestibule of upper strata), transfection reagent (10), 1 × PBS(11); Be respectively equipped with DNA Tag enzyme (12), Hin6I restriction endonuclease (13), pGL3-GDF9-333-GG-Basic/promoter plasmid 1(14 in lower floor's box body liner vestibule), pGL3-GDF9-333-TT-Basic/promoter plasmid 2(15), pGL ₃-Basic plasmid 3(16), pRL-CMV plasmid 4(17), Dual-Luciferase reagent (18), Dual-Luciferase termination reaction substrate (19), Dual-Luciferase damping fluid (20).The utility model ensure that the accuracy of SNP somatotype and determines to have cock sexual prematurity the mutational site of remarkable hereditary effect, ensure that the accuracy of experimental result, and makes experimenter eliminate the tedious steps of carrier construction.

Description

Cock sexual prematurity genes involved---GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit

Technical field

The utility model belongs to biological technical field, utilizes PCR-RFLP and two reporter gene technology to detect and provides a stock cock sexual prematurity genes involved---growth conversioning factor-9 (GDF9) 5 ' control region SNP somatotype and promoter activity quick detection kit.

Background technology

Growth conversioning factor-9 (growth differentiation factor-9, GDF9) be one of the member of transfer factor-β (TGF-β) superfamily, to be in the news (Hanrahan at el 2004 as the major gene or candidate gene that control mammalian reproduction proterties, Palmer at el 2010, Barzegari, at el 2006).Research finds GDF9 particular expression in the ovary of hen, and can promote the mitotic division of ovum gallinaceum parent cell, the propagation (Johnson at el 2005) of reinforcement granulosa cell.Although the fecundity of GDF9 to jenny plays an important role, it is little in the research of buck, and only rests on expression level.Research finds that GDF9 expresses (Aaltonen at el 1999 in the testis of people and Niu, Pennetier at el 2004), GDF9 is the sexual cell atopen of rat testicle, and can regulate the growth (Nicholls at el 2009) of sustentacular cell of testis.But GDF9 does not report in the research of cock, the growth of cockscomb is the most obvious in chicken secondal sexual character, and most important feature, can be used as the index (Lei Qiuxia weighing sexual maturity degree, 2005), therefore GDF9 gene can as the control sexually matured major gene of cock or candidate gene.

Single nucleotide polymorphism (single nucleotide polymorphism, SNP), develop rapidly is obtained as third generation genetic marker, there is multiple full-fledged detection technique at present, as technique means such as single strand conformation polymorphism (SSCP), Restrictive fragment length polymorphism (RFLP), DNA chip and Taqman probes.Restriction fragment length polymorphism polymerase chain reaction (PCR-RFLP) technology utilizes pcr amplification target DNA exactly, and amplified production cuts into different size fragment with specificity endonuclease digestion again, directly somatotype in gel electrophoresis.This technology have specificity high, detect fast, highly versatile, the feature such as applied widely, with low cost, the SNP being successfully applied to human diseases and poultry diease genes involved molecule marker at present detects and the research and development of gene diagnosis kit.

Reporter gene a kind ofly encodes that certain is easy to detect the gene of protein or enzyme, demarcated the expression regulation of goal gene by its expression product.The major advantage of this technology is highly sensitive, credibility and easy to detect and applicable extensive detection.Promoter Analysis, various kinds of cell event such as monitoring transgenosis and expression, the signal transduction of cell and the screening of medicine etc. are widely used at present.Along with the progress of technology and detection method, fluorometric analysis can by visual for the activity of reporter gene in cell and more and more become main flow to the nondestructive of cell with it, and the reporter gene that therefore luciferase and green fluorescent protein these two kinds can send fluorescence becomes the up-and-coming youngster in numerous reporter gene.Two reporter gene technology combines Photinus pyralis LUC test and the test of ocean coelenteron luciferase, in single tube, carry out luciferase reporter gene test, quick, sensitive, easy.The relative changes of reporter gene expression vigor is relevant to the change that coupling regulates and controls promoter transcription vigor, two reporter gene technology makes second reporter gene being coupled to constitutive promoter, the internal reference of the vigor of transcribing is provided, make test not by experiment condition change disturb, ensure that the accuracy of experimental result.

Through the retrieval to existing domestic and foreign literature and patent, so far there are no the report of GDF9 gene 5 ' control region pleomorphism site and promoter activity and cock sexual prematurity dependency.

Utility model content

The purpose of this utility model is in order to cock sexual prematurity genes involved---the detection in GDF9 gene 5 ' control region G-333T (by first base of promotor to the 333rd base in control region direction) site provides a kind of gene type and promoter function analysis test kit, and this test kit accuracy is high, quick, cheap.

The purpose of this utility model is achieved through the following technical solutions, cock sexual prematurity genes involved---GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit, comprise box body, box body is bilayer structure, comprise upper strata box body and lower floor's box body, be equipped with liner in upper and lower layer box body, liner is provided with vestibule; Described lower floor box body is cryosphere;

Be respectively equipped with in the box body liner vestibule of upper strata for the upstream and downstream primer mixture of GDF9 gene 5 ' control region pcr amplification, DNA Tag enzymatic amplification damping fluid, restriction endonuclease damping fluid, dNTP, transfection reagent, 1 × PBS;

DNA Tag enzyme, Hin6I restriction endonuclease, pGL3-GDF9-333-GG-Basic/promoter plasmid 1, pGL3-GDF9-333-TT-Basic/promoter plasmid 2, pGL is respectively equipped with in lower floor's box body liner vestibule ₃-Basic plasmid 3, pRL-CMV plasmid 4, Dual-Glo Luciferase Reagent Dual-Luciferase reagent, Dual-Glo Stop & Glo Substrate Dual-Luciferase termination reaction substrate, Dual-Glo Luciferase Reagent Buffer Dual-Luciferase damping fluid.

Preferably, described box body cross section is oval.

Preferably, described box body is provided with lid, and lid is oval.

Primer mixture P represents the upstream and downstream primer mixture for GDF9 gene 5 ' control region pcr amplification, and primer information is as follows:

Upstream primer S:5'CACCACAGTCAAAACAGCTTTAAGA 3'

Downstream primer A:5'GTCAGGCTGAGCCTTTGCAC 3'.

Plasmid 1 (pGL3-GDF9-333-GG-Basic/promoter) represents that (capitalization is promoter region to the recombinant plasmid correctly inserted in reporter plasmid (pGL3-Basic) by promoter region (-333 bases are G), lowercase is pGL3-Basic plasmid fraction sequence, band frame ATG is promotor, be 333rd base of promotor first letter to control region direction with frame G), its information is as follows:

ggtaccgagctcttacgcgtCACCACAGTCAAAACAGCTTTAAGAGATGTAAGAAAAAAGGTGAT GTTGTTTCACATTACAGATTGCTATCTGAATTAACCTTCCACTCCAAATGAAAGAATTCTGTAAGTCAATTAAGCATTCTCTGAACAAGCACTCCTTACTTAGAAGCCGTAAGATGTGAAAGCTAGATTACAGGTGACACTTCACTAGATTACTGACAGCACAGCTCTAATTAAAAACATCTGGCATGAAAACACATTCCCTTACACATTTTCCTCACTCAATAAAACAAAAATCCACCCCTTTCATTACATCCTGTAAGAAGAGTTTCTAAACACTCCAGGCAGGCACTACTACTCCAGTCGGAGTCTTCGGGAGCAATAATGTTTAGCATCTTATATACATTTAGCAATGCTAACTGGCGCTGTTGCTGCCCTTGCTTTAACAGCTAACCCACGAATACCGGAATTCCCGCAGGTCGCGCTCTCAGCCGGACCGGCGGCATCCCTTCCCCTCCCGGCTCCCCCTGGGGGCCGATCCACGAACAGTCGTGCCTTACAGTTTACCAGGTAGAAAAGTGTAACCCTGAGAAGCAGCGTTTGTTGGTGAGACGCCGCCACGTGCAAAGGCTCAGCCTGACCGCACACACACACGTGGGTTCCACAGCCAGCTGCGGGGCTTTCCCTTTGGTTTCTAATCACAAAGAAACCTCCCTCCTGAGCCACAGCTGAAACACATATAACAGCTCGAGCTCGCGTGCTCTTTTTTCTTGAATGCTTGGGGGGAGGCGTTGTTAGGCTACAGCCCTGAAGAGC GAGGGTACGTGGAGGATCTGTGTTTGTTTCTATTGCTGCATTCACTGGCTTctcgagatctgcgatctaagtaagctt

Plasmid 2 (pGL3-DRD1-333-TT-Basic/promoter) represents that (capitalization is promoter region to the recombinant plasmid correctly inserted in reporter plasmid (pGL3-Basic) by promoter region (-333 bases are T), lowercase is pGL3-Basic plasmid fraction sequence, band frame ATG is promotor, be 333rd base of promotor first letter to control region direction with frame T), its information is as follows:

ggtaccgagctcttacgcgtCACCACAGTCAAAACAGCTTTAAGAGATGTAAGAAAAAAGGTGATGTTGTTTCACATTACAGATTGCTATCTGAATTAACCTTCCACTCCAAATGAAAGAATTCTGTAAGTCAATTAAGCATTCTCTGAACAAGCACTCCTTACTTAGAAGCCGTAAGATGTGAA AGCTAGATTACAGGTGACACTTCACTAGATTACTGACAGCACAGCTCTAATTAAAAACATCTGGCATGAAAACACATTCCCTTACACATTTTCCTCACTCAATAAAACAAAAATCCACCCCTTTCATTACATCCTGTAAGAAGAGTTTCTAAACACTCCAGGCAGGCACTACTACTCCAGTCGGAGTCTTCGGGAGCAATAATGTTTAGCATCTTATATACATTTAGCAATGCTAACTGGCGCTGTTGCTGCCCTTGCTTTAACAGCTAACCCACGAATACCGGAATTCCCGCAGGTCGCTCTCTCAGCCGGACCGGCGGCATCCCTTCCCCTCCCGGCTCCCCCTGGGGGCCGATCCACGAACAGTCGTGCCTTACAGTTTACCAGGTAGAAAAGTGTAACCCTGAGAAGCAGCGTTTGTTGGTGAGACGCCGCCACGTGCAAAGGCTCAGCCTGACCGCACACACACACGTGGGTTCCACAGCCAGCTGCGGGGCTTTCCCTTTGGTTTCTAATCACAAAGAAACCTCCCTCCTGAGCCACAGCTGAAACACATATAACAGCTCGAGCTCGCGTGCTCTTTTTTCTTGAATGCTTGGGGGGAGGCGTTGTTAGGCTACAGCCCTGAAGAGC GAGGGTACGTGGAGGATCTGTGTTTGTTTCTATTGCTGCATTCACTGGCTTctcgagatctgcgatctaagtaagctt

Compared with prior art, the utility model has following beneficial effect: the first, and the utility model is by designing Auele Specific Primer, pcr amplification and RFLP method, make product have more specificity, ensure that the accuracy of SNP somatotype and determine to have cock sexual prematurity the mutational site of remarkable hereditary effect.Second, the utility model is by the structure to GDF9 gene 5 ' control region different genotype carrier, cell transfecting and two reporter gene detect promoter activity, demonstrate promoter region different genotype promoter activity, ensure that the accuracy of experimental result, and make experimenter eliminate the tedious steps of carrier construction.3rd, the utility model is reasonable in design, easy to use, reliable results and with low cost.

Accompanying drawing explanation

Fig. 1 is the utility model cock sexual prematurity genes involved---the structural representation of GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit;

Fig. 2 is plating cells schematic diagram;

Fig. 3 is cell transfecting schematic diagram;

Fig. 4 is promoter function analysis schematic diagram;

In figure: 1 lid, 2 upper strata box bodys, 3 lower floor's box bodys, 4 liners, 5 cryospheres, 6 primer mixtures, 7DNA Tag enzymatic amplification damping fluid, 8 restriction endonuclease damping fluids, 9dNTP, 10 transfection reagents, 111 × PBS, 12DNA Tag enzyme, 13 restriction endonucleases (Hin6I), 14 plasmids 1 (pGL3-GDF9-333-GG-Basic/promoter), 15 plasmids 2 (pGL3-GDF9-333-TT-Basic/promoter), 16 plasmid 3 (pGL ₃-Basic), 17 plasmids 4 (pRL-CMV), 18 Dual-Luciferase reagent (Dual-Glo Luciferase Reagent), 19 Dual-Luciferase termination reaction substrates (Dual-Glo Stop & Glo Substrate), 20 Dual-Luciferase damping fluids (Dual-Glo Luciferase Reagent Buffer).

Embodiment

The utility model is described in further detail for specific embodiments and the drawings.Should be understood that these embodiments are only for illustration of object, and be not used in restriction the utility model scope.

As shown in Figure 1, the utility model cock sexual prematurity genes involved---GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit are by box body, liner 4, , cryosphere 5, for the upstream and downstream primer mixture 6 of GDF9 gene 5 ' control region pcr amplification, DNA Tag enzymatic amplification damping fluid 7, restriction endonuclease damping fluid 8, dNTP9, transfection reagent 10, 1 × PBS11, DNA Tag enzyme 12, restriction endonuclease (Hin6I) 13, plasmid 1 (pGL3-GDF9-333-GG-Basic/promoter) 14, plasmid 2 (pGL3-GDF9-333-TT-Basic/promoter) 15, plasmid 3 (pGL ₃-Basic) 16, plasmid 4 (pRL-CMV) 17, Dual-Luciferase reagent (Dual-Glo Luciferase Reagent) 18, Dual-Luciferase termination reaction substrate (Dual-Glo Stop & Glo Substrate) 19, Dual-Luciferase damping fluid (Dual-Glo Luciferase Reagent Buffer) 20 form.

Box body is bilayer structure, comprises upper strata box body 2 and lower floor's box body 3.Lower floor's box body is cryosphere.Be equipped with liner 4 in upper and lower layer box body 2,3, liner is provided with vestibule.

Be contained in respectively in the box body liner vestibule of upper strata for the upstream and downstream primer mixture 6 of GDF9 gene 5 ' control region pcr amplification, DNA Tag enzymatic amplification damping fluid 7, restriction endonuclease damping fluid 8, dNTP9, transfection reagent 10,1 × PBS 11.

DNA Tag enzyme 12, restriction endonuclease (Hin6I) 13, plasmid 1 (pGL3-GDF9-333-GG-Basic/promoter) 14, plasmid 2 (pGL3-GDF9-333-TT-Basic/promoter) 15, plasmid 3 (pGL ₃-Basic) 16, plasmid 4 (pRL-CMV) 17, Dual-Luciferase reagent (Dual-Glo Luciferase Reagent) 18, Dual-Luciferase termination reaction substrate (Dual-Glo Stop & Glo Substrate) 19, Dual-Luciferase damping fluid Dual-Glo Luciferase Reagent Buffer 20 be contained in lower floor's box body liner vestibule respectively.

Box body cross section can be oval.

Mentioned reagent box also comprises lid 1, and lid covers on box body.Lid 1 can be oval.

The using method of the utility model test kit:

1, pcr amplification SNP site place fragment

1) pcr amplification reaction system prepares

The reaction system of PCR is 25 μ l, comprising:

In the PCR thin-walled tube of 200 μ l, add reagent according to above reaction system, fully of short duration centrifugal after mixing.

2) pcr amplification reaction programming

Eppendorf PCR instrument is arranged as described in Table 1, after programming, PCR reaction tubes is put into PCR instrument and carry out reaction amplification.

Table 1 pcr amplification reaction program

3) after reaction terminates, get 5 μ l reaction product at 1.5% agarose gel, electrophoresis in 0.5 × TBE, whether detection reaction is successful.

2, RFLP enzyme is cut and identified gene type

The first step gained PCR primer gets 7ul, add 2ul restriction endonuclease damping fluid, restriction endonuclease (Hin6 I) 0.5ul, ultrapure water 10.5 μ l, fully of short duration centrifugal after mixing, then put into 37 DEG C of water-bath water-baths 8 hours, finally get 6ul digestion products at 3% sepharose, electrophoresis in 0.5 × TBE, uses Labworks image acquisition and analysis software video picture, identified gene type.

3, promoter function analysis

1) cell cultures

Experimentally requirement, selects suitable cell to cultivate, and waits for that cells grown can carry out plating cells after stable.

2) plating cells

Experimentally require that selection 96 orifice plate or 48 orifice plates carry out plating cells, for specific cell type, recommendation 96 orifice plate specification optimizes transfection conditions.By cultured 293T (recommendation is easily lived, easily growth, transfection efficiency be high) cell according to 1-2 × 10, every hole ⁴be transferred in 96 orifice plates, promotor (the plasmid 1 and 2) suggestion of different genotype is 5-7 and is repeated, and does one group of blank (plasmid 3), transfection when cell grows to 70-80%.

3) cell transfecting

1. before transfection, every hole add 100 μ L fresh containing serum and dual anti-substratum, place 30-60 minute;

2. every hole amount: add in the DMEM of 0.2 μ g pGL3-Basic plasmid (arrange 1 to 7 row and add plasmid 2, C as Fig. 2, A row 1 to 7 row add plasmid 1, B and arrange 1 to 7 row and add plasmid 3) and the high sugared serum-free of 0.01 μ g pRL-CMV to 10 μ L, vibrate centrifugal;

3. every hole amount: add 0.5 μ L transfection reagent in the DMEM of the high sugar of 10 μ L, vibrate centrifugal;

4. the plasmid diluted to be added in the transfection reagent diluted (attention order can not be put upside down) rapidly;

5. rapid oscillation, centrifugal, and mixed solution is placed 15-20min (attention does not exceed 20min) in room temperature;

6. every hole adds 20 μ L mixed solutions and soft mixing;

7. transfection efficiency is detected after 24-48 hour after transfection.

4) promoter function analysis

1. the cell of transfection after 24 hours is washed 2 times with 1 × PBS, fall after dry liquids, every hole adds 20ul 1 × PBS, and its correspondence is proceeded to lighttight 96 hole blanks (must be compatible mutually with fluorescence radiation instrument used);

2. in every hole, add 20ul Dual-Luciferase reagent (Dual-Glo Luciferase Reagent), lucifuge is vibrated at least 10min, allows the abundant cracking of cell, then in fluorescence radiation instrument, measures Lampyridea fluorescent value;

3. the Dual-Luciferase calculated needed for experiment stops the consumption of reagent (Dual-Glo Stop & Glo Reagent), in light resistant container, Dual-Luciferase termination reaction substrate (Dual-Glo Stop & Glo Substrate) is diluted in Dual-Luciferase damping fluid (Dual-Glo Stop & Glo Buffer) with 1:100 and (makes sure to keep in mind matching while using, can't once dilute all reagent), reagent (Dual-Glo Stop & Glo Reagent) is stopped to obtain volume required Dual-Luciferase.Every hole adds Dual-Luciferase termination reagent (Dual-Glo Stop & Glo Reagent) that 20ul has diluted, at least wait for 10 minutes, then measure sea pansy fluorescent value, the plane table surveying order of sea pansy fluorescence should be identical with Lampyridea fluorescence.

The utility model is by design Auele Specific Primer, and pcr amplification and RFLP method, make product have more specificity, ensure that the accuracy of SNP somatotype and determines to produce to chicken the mutational site that sexual prematurity shape has remarkable hereditary effect.

The utility model is by the structure to GDF9 gene 5 ' control region different genotype carrier, cell transfecting and two reporter gene detect promoter activity, demonstrate the activity of promoter region different genotype promotor, ensure that the accuracy of experimental result, and make experimenter eliminate the tedious steps of carrier construction.

The utility model is reasonable in design, easy to use, reliable results and with low cost.

Embodiment 1

This test kit is used to carry out somatotype to 216 Wenchang Chicken GDF9 gene 5 ' control region G-333-T SNP site.

1, sample

Gather the blood of 216 Wenchang Chicken, apply traditional phenol/chloroform method and extract DNA, and by DNA concentration dilution to 50ng/ μ l.

2, pcr amplification reaction and result

Pcr amplification and detected result are carried out according to test kit using method step 1, and GDF9 gene PCR product size is 623bp, consistent with the result estimated, 1.5% agarose detected result.

3, the RFLP qualification of GDF9 gene PCR amplified production

GDF9PCR product RFLP qualification is carried out according to test kit using method step 2,3% agarose detected result.

4, GDF9 gene plasmid 1 and plasmid 2 are recombinated and are identified

By the correct insertion vector PGL3-Basic of GDF9 gene 5 ' promoter region object fragment, 1.5% agarose detected result.

5,293T plating cells

Carry out plating cells according to requirement of experiment, make cell attachment even, the repetition of 7, each sample, is shown in Fig. 2 as far as possible.

6, cell transfecting

Cell transfecting working method (see Fig. 3):

(1) can transfection be carried out when cell grows to 70-80%, before transfection, every hole add 100 μ L fresh containing serum and dual anti-substratum, place 30-60 minute;

(2) every hole amount: add 0.2 μ g pGL3-Basic plasmid (as Fig. 2, A row 1 to 7 row add plasmid 1, B row 1 to 7 row add plasmid 2, C and arrange 1 to 7 row and add plasmid 3) and the high sugared serum-free of 0.01 μ g pRL-CMV to 10 μ L DMEM in, vibrate centrifugal;

(3) every hole amount: add 0.5 μ L transfection reagent in the DMEM of the high sugar of 10 μ L, vibrate centrifugal;

(4) rapidly the plasmid diluted is added to (attention order can not be put upside down) in the transfection reagent diluted;

(5) rapid oscillation, centrifugal, and mixed solution is placed 15-20min (attention does not exceed 20min) in room temperature;

7, promoter function analysis

Promoter function analysis method (see Fig. 4):

(1) cell of transfection after 24 hours is washed 2 times with 1 × PBS, after dry liquids, every hole adds 20ul 1 × PBS, and its correspondence is proceeded to lighttight 96 hole blanks, 20ul Dual-Luciferase reagent (Dual-Glo Luciferase Reagent) is added in every hole, lucifuge is vibrated at least 10min, allows the abundant cracking of cell;

(2) Lampyridea fluorescent value is measured;

(3) Dual-Luciferase termination reaction substrate (Dual-Glo Stop & Glo Substrate) is diluted in Dual-Luciferase damping fluid (Dual-Glo Stop & Glo Buffer) with 1:100, stops reagent (Dual-Glo Stop & Glo Reagent) to obtain volume required Dual-Luciferase;

(4) Dual-Luciferase being stopped reagent (Dual-Glo Stop & Glo Reagent) adds in plate, and room temperature places 10 minutes to 2 hours;

(5) sea pansy fluorescent value is measured.

Claims (3)

1. cock sexual prematurity genes involved---GDF9 gene 5 ' control region SNP somatotype and promoter activity quick detection kit, comprise box body, it is characterized in that, described box body is bilayer structure, box body comprises upper strata box body (2) and lower floor's box body (3), be equipped with liner (4) in upper and lower layer box body, liner is provided with vestibule; Described lower floor box body is cryosphere (5);

Be respectively equipped with upstream and downstream primer mixture (6), DNA Tag enzymatic amplification damping fluid (7), restriction endonuclease damping fluid (8), the dNTP(9 for GDF9 gene 5 ' control region pcr amplification in upper strata box body (2) liner vestibule), transfection reagent (10), 1 × PBS(11);

Be respectively equipped with in lower floor's box body (3) liner vestibule DNA Tag enzyme (12), hin6I restriction endonuclease (13), pGL3-GDF9-333-GG-Basic/promoter plasmid 1(14), pGL3-GDF9-333-TT-Basic/promoter plasmid 2(15), pGL ₃-Basic plasmid 3(16), pRL-CMV plasmid 4(17), Dual-Glo Luciferase Reagent Dual-Luciferase reagent (18), Dual-Glo Stop & Glo Substrate Dual-Luciferase termination reaction substrate (19), Dual-Glo Luciferase Reagent Buffer Dual-Luciferase damping fluid (20).

2. test kit according to claim 1, is characterized in that, described box body cross section is oval.

3. test kit according to claim 2, is characterized in that, described box body is provided with lid (1), and lid (1) is oval.