CN1995343B - Method for preparing soluble high-activity remcombinant attokinase - Google Patents
Method for preparing soluble high-activity remcombinant attokinase Download PDFInfo
- Publication number
- CN1995343B CN1995343B CN2006101680563A CN200610168056A CN1995343B CN 1995343 B CN1995343 B CN 1995343B CN 2006101680563 A CN2006101680563 A CN 2006101680563A CN 200610168056 A CN200610168056 A CN 200610168056A CN 1995343 B CN1995343 B CN 1995343B
- Authority
- CN
- China
- Prior art keywords
- pronk
- pdi
- nattokinase
- gst
- activity
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a constructing, expressing and purifying technique of nanometer-soy kinase expressive carrier, which is characterized by the following: improving activity due to leading peptide; helping protein fold correctly through adding important molecular mate PDI; utilizing GST label to improve the solubility of protein; purifying product rapidly through ammino sulfate sediment method; adding HIS protein label to purify further.
Description
Technical field
The present invention relates to a kind of method for preparing soluble high-activity remcombinant attokinase, comprise structure, prokaryotic expression and the purifying process of its expression vector.
Background technology
Cardiovascular and cerebrovascular diseases is one of important diseases of serious harm human health, and every day is died from cardiovascular and cerebrovascular diseases above 10,000,000 people in the whole world, and annual nearly 2,600,000 people of China die from cardiovascular and cerebrovascular diseases, and generally concentrate on the big city.Thrombotic disease is the elderly's height morbidity, and China will enter aging society from now on, must mention enough attention to the control of cardiovascular and cerebrovascular diseases.The potential market of the thrombolytic drug that the whole world is required is about 2,000,000,000 dollars.Thrombolytic drug that uses on China domestic market such as streptokinase (SK), urokinase (UK), sense of organization fibrinolysin activator (tPA) etc. all exist obviously not enough, can produce anti reperfusion in for example clinical, occur reactions such as embolism, hemorrhage, allergy once more.
Natto is the traditional food of Japan, and is edible above thousand.Nattokinase (Nattokinase, be called for short NK) be Japanese scholar in 1987 must see the doctor of foreign firm at first from natto separation and purification come out.Nattokinase is a kind of serine protease that produces in the Bacillus natto fermenting process, and iso-electric point is 8.7, is made up of 275 amino acid, strand, does not contain disulfide linkage, and molecular weight is 27kD.Nattokinase is active quite stable in enteron aisle, compares with other thrombolysis medicine, and except that having stronger thrombolytic effect, advantage such as also have long action time in the body, have no side effect has been used as thrombolytic drug.Nattokinase can single-minded thrombus, and Fibrinogen is not had degrading activity, and a large amount of uses can not cause bleeding, and can prevent and the following illness of assisting therapy: cerebral thrombosis, cerebral infarction, myocardial infarction, thrombus sequela, thrombophlebitis, vasculitis etc.After taking Nattokinase, euglobulin lysis time in the blood (ELT) significant prolongation, scleroproein (former) degraded product (FDP) and histiotype plasminogen incitant (TPA) obviously increase.In Acute Myocardial Infarction Patients rescue process, adopt the intravenous drip Nattokinase, thrombus does not have hemorrhage risk substantially rapidly.
What at present be main component with the Nattokinase as the R﹠D work progress of medicine, functional foodstuff and foodstuff additive or healthcare products is very fast.But the main in the world Nattokinase related products that has put into production (the big and pharmacy " NKCP " of Japan, allergy research group " Nattokinase ", Korea S dimension longevity enzyme company " dimension longevity enzyme " etc.) all be from the wild fermented liquid of wild bacterium or improvement, to extract purifying and come, but wherein natural NK content very low (being generally less than 10%), make the purifying process complexity, output is not high, activity is also very low, and also undergo mutation easily in the wild bacterium fermenting process, be difficult to continue to produce.And utilize the recombinant expressed NK gene of general engineered method, and can cause NK to appear in the middle of the expression product with the form of inclusion body, the sex change renaturation can increase substantially cost again and reduce the enzymic activity of NK.So this class production technique causes the Nattokinase product to be difficult to promote significantly.
Summary of the invention
The purpose of this invention is to provide a kind of method for preparing soluble high-activity remcombinant attokinase, comprise and make up nattokinase gene (proNK) clone who contains leader peptide sequences, the molecular chaperones (homologous protein that comprises various sources such as people and mouse) that adds GST (glutathione-S-transferase) albumen label and PDI (protein disulfide isomerase), thereby help goal gene in intestinal bacteria, to efficiently express, in sequence, be embedded in HIS label (six successive Histidines, HIS
6) and protease cutting site help target protein efficiently to purify.
The recombinant expressed technology of Nattokinase solubility of the present invention is achieved by the following technical solution:
1) is template with Bacillus Subtilis Natto (natto Bacillus subtilus) thalline, draws, obtain to comprise the total length nattokinase gene of leading peptide, be called proNK by the method for PCR (polymerase chain reaction) according to Nattokinase full length sequence design; At terminal HIS sequence label (six successive Histidines, the HIS of increasing of the 3` of proNK gene
6), the gene clone that again proNK is added the HIS label enters pGEX-6P carrier (business-like prokaryotic expression carrier); Then utilize PCR the full-length gene of molecular chaperones PDI to be cloned out the 3` end of receiving the proNK gene; Front end at the PDI gene adds the Prescission Protease proteolytic enzyme restriction enzyme site sequence (sequence is Leu-Glu-Val-Leu-Phe-Gln-Gly-Pro, represents with pp) of (a kind of sequence-specific proteolytic enzyme is called for short PPase); Assembling becomes efficient expression vector pGEX-6p-proNK-HIS like this
6-pp-PDI is called for short 6pNHP; The corresponding recombinant protein that gives expression to is GST-pp-proNK-HIS
6-pp-PDI;
2) 6pNHP transformed into escherichia coli Rosseta (a kind of expression bacterial classification) induces the expression of recombination with IPTG (isopropyl-); The plasmid that will contain PPase simultaneously changes Rosseta bacterial strain, abduction delivering together over to; Then two kinds of thalline are collected in together in proportion;
3) with the resuspended bacterium of Tris (Tutofusin tris) damping fluid that contains 10% glycerine, ultrasonication, centrifugal collection supernatant liquor; Adjust pH value, the low temperature vibration makes PPase that the recombinant protein enzyme is cut entirely, discharges proNK albumen, thereby obtains the solution that contains Nattokinase of high density; Carry out protein quantification analysis and determination of activity;
4) solution that will contain Nattokinase carries out purification process.
The technology of the thick purifying of Nattokinase of the present invention is achieved by the following technical solution:
In the solution that contains Nattokinase of high density, dropwise adding saturated ammonium sulphate solution to final concentration is 30%, leaves standstill to saltout 4 hours or spend the night, and 12000 rev/mins centrifugal 20 minutes; Get precipitation, with the Tris damping fluid that contains 10% glycerine of 10 times of precipitation volumes with resolution of precipitate; 12000 rev/mins centrifugal 20 minutes; Get supernatant.Dialysed overnight promptly obtains the Nattokinase crude product of high density, can carry out carrying out determination of activity after SDS-PAGE (sodium lauryl sulphate sex change polyacrylamide gel electrophoresis) analyzes.
The technology of consummateization of Nattokinase of the present invention is achieved by the following technical solution:
In the solution that contains Nattokinase of high density, directly adjust pH value to 10, last nickel ion affinity column (Ni-NTAHis-Bind Resin), with the buffered soln upper prop of 10% glycerine, 25mM imidazoles wash-out foreign protein, 100mM imidazoles wash-out target protein.Dialysed overnight promptly obtains the elaboration of high-purity high-activity Nattokinase.Carrying out SDS-PAGE analyzes and determination of activity.
The preparation technology of the simplification recombinant expression vector of Nattokinase of the present invention is achieved by the following technical solution:
1) is template with Bacillus Subtilis Natto thalline,, obtains to comprise the total length nattokinase gene of leading peptide, be called proNK by the method for PCR according to Nattokinase full length sequence design primer; The gene clone of proNK is entered the pGEX-6P carrier; Then utilize PCR the full-length gene of molecular chaperones PDI to be cloned out the 3` end of receiving the proNK gene; Front end at the PDI gene adds Prescission Protease protease cutting site sequence, and assembling becomes efficient expression vector pGEX-6p-proNK-pp-PDI like this, is called for short 6pNP; The corresponding recombinant protein that gives expression to is GST-pp-proNK-pp-PDI;
2) 6pNP transformed into escherichia coli Rosseta induces the expression of recombination with IPTG; The plasmid that will contain PPase simultaneously changes Rosseta bacterial strain, abduction delivering together over to; Then two kinds of thalline are collected in together in proportion;
3) with the resuspended bacterium of Tris damping fluid that contains 10% order oil, ultrasonication, centrifugal collection supernatant liquor; Adjust pH value, the low temperature vibration makes PPase that the recombinant protein enzyme is cut entirely, discharges proNK albumen, thereby obtains the solution that contains Nattokinase of high density; Carry out protein quantification analysis and determination of activity;
4) in the solution that contains Nattokinase of high density, dropwise adding saturated ammonium sulphate solution to final concentration is 30%, leaves standstill to saltout 4 hours or spend the night, and 12000 rev/mins centrifugal 20 minutes; Get precipitation, with the Tris damping fluid that contains 10% glycerine of 10 times of precipitation volumes with resolution of precipitate; 12000 rev/mins centrifugal 20 minutes; Get supernatant; Dialysed overnight promptly obtains the Nattokinase crude product of high density, can carry out carrying out determination of activity after SDS-PAGE analyzes.
The PDI mate molecule has crucial booster action for the solubility expression of Nattokinase, and the relative position of they and proNK is variable; Final recombinant protein comprises GST-proNK-PDI, GST-PDI-proNK, HIS
6-proNK-PDI, HIS
6-PDI-proNK, and the state of non-recombinant protein (PDI and proNK or NK are mixed in the solution simultaneously) all can improve the solubility expression of Nattokinase.
Exist solubility expression to have crucial booster action in the time of GST and PDI mate molecule, and the relative position of they and proNK is variable for Nattokinase; Final recombinant protein comprises GST-proNK-PDI, GST-PDI-proNK, proNK-GST-PDI, proNK-PDI-GST, PDI-GST-proNK, the state of PDI-proNK-GST and non-recombinant protein (GST and PDI and proNK or NK three are mixed in the solution simultaneously) all can improve the solubility expression of Nattokinase.
Utilize recombinant expressed scheme of the present invention to make Nattokinase keep soluble state, form than inclusion body has more kept protease activities, also simplify the step of purifying significantly, and adopted the Nattokinase form that includes leading peptide more to keep proteic stability.The Nattokinase purity height that makes like this, the output height, active high, cost is low, and production technique is simple, constant product quality.Product can be made medicine or oral health product, is beneficial to masses to promote.
Description of drawings
Fig. 1: the plasmid construction collection of illustrative plates of nattokinase gene pGEX-6p-proNK-HIS-pp-PDI.
Fig. 2: the plasmid construction collection of illustrative plates of nattokinase gene pGEX-6p-proNK-pp-PDI.
Fig. 3: the 6pNHP enzyme is cut and is identified electrophorogram (HindIII and XhoI double digestion).
Fig. 4: the SDS-PAGE result who shows Nattokinase content and purity in the thick purified product.
Fig. 5: the SDS-PAGE result who shows Nattokinase content and purity in the smart purified product.
Fig. 6: show the active fibrin plate solusphere of purified product.
Among Fig. 1, Fig. 2, the collection of illustrative plates of plasmid pGEX-6p is from business-like test kit, and the sequence of amplification is inserted wherein.
Among Fig. 3, the left side is the contrast of base length, and the band of product is cut on the right for enzyme.In the middle of the carrier that builds, original XhoI restriction enzyme site is neutralized by SalI.HindIII is the exclusive restriction enzyme site of proNK like this, and XhoI is the exclusive restriction enzyme site (and having two) of PDI.So can emit three bands when identifying carrier construction with these two enzymes.1 is the carrier segment, and 2 are positioned at sequence after the HIndIII site and the sequence length overall before first XhoI site of PDI, the 3rd, the sequence between two XhoI sites of PDI for the proNK gene.
Among Fig. 4, be successively from left to right: the Nattokinase solution of slightly purifying; The protein molecular weight contrast.
Among Fig. 5, be successively from left to right: smart purification Nattokinase solution; Full bacterium lysate contrast; The protein molecular weight contrast.
Among Fig. 6, sample that each sequence number adds and corresponding solusphere area are:
| Sequence number | ?1? | 2? | 3? | 4? | ?5? | 6? | 7? | 8? |
| Sample | Urokinase | The thick purified product of Nattokinase | Smart purified product | Contrast * | ? | ? | ? | ? |
| Content | ?45u? | 75u? | 3ul? | 10ul? | 5ul? | 5ul? | 8ul? | 10ul? |
| The solusphere area | ?1944? | 3066? | 6351? | 22716? | 17246? | 7151? | 7824? | 32? |
* wherein contrast is the contrast of Tris damping fluid
Embodiment
Embodiment one: the structure of nattokinase gene expression vector and expression:
1) the frozen bacterial strain 1ul that gets Bacillus Subtilis Natto is inoculated in the 5mlLB substratum, and 37 ℃, 250rpm/min wave and culture base 16 hours (can not be long, prevent to form gemma).The dilution in 1: 20 of bacterium liquid is got 1ul then as pcr template.Design synthetic pcr primer thing, the proNK gene that is used to increase, the 5` of PCR primer, the 3` end contains restriction endonuclease sites:
Upstream primer: NKs:5`-3` CAT AGATCT GCCGGAAAAAGGAG
Downstream primer: NKHISa:5`-3` AGA GAATTC GTGATGATGATGATGATG TAAT
TGTG?CAGCTGC
It is stand-by that primer is diluted to 50pmol/ul.The method of utilizing heat start PCR then is with proNK-HIS
6Gene clone is come out:
PCR reaction system 50ul:
ddH
2O： 40ul
10*PCR?BUFFER 5ul
dNTP 1ul
Template: 1ul
On/downstream primer: 1ul
Pfu enzyme 1ul
The PCR reaction conditions:
94℃ 8min
94℃ 30s
65℃ 30s
72 ℃ of 2min40s 20 circulations
94℃ 30s
55℃ 30s
72 ℃ of 2min40s 20 circulations
72℃ 10min
Reaction is got the PCR product and is carried out 1% agarose gel electrophoresis after finishing, and ultraviolet detection is goal gene (proNK-HIS for a bright band with position, the 1.1kb left and right sides
6) size.
2) gel reclaims goal gene, is cut into sticky end with restriction enzyme BamHI and EcoRI, handles the pGEX-6p carrier equally, adds the T4DNA ligase enzyme, and 4 ℃ connect 12 hours, transformed into escherichia coli DH5 α.Choose the hickie clone with sodium ampicillin-LB plate screening, utilize the alkaline lysis or the boiling method of molecular cloning to extract plasmid, utilizing enzyme to cut identifies correct with the method for PCR, the nucleotides sequence sequential analysis contains correct gene order reading frame then, successfully constructs pGEX-6p-proNK-HIS
6Carrier.
The primer of design PDI comprises restriction enzyme site:
Upstream primer: PDI-PPs:5`-3`TA GAATTC CTGGAAGTTCTGTTCC
AGGGGCCC?ATGCTGCGCCGCGC
Downstream primer: PDI-PPa:5`-3`CT GTCGAC CAGTTCATCTTTCACAG
PCR reaction conditions (Tag enzyme):
94℃ 8min
94℃ 30s
65℃ 30s
72 ℃ of 1min 30 circulations
72℃ 10min
Agarose gel electrophoresis detects the PDI band and is positioned at about 700bp, and glue reclaims goal gene, with EcoRI and SalI gene enzyme is cut into sticky end, the pGEX-6p-proNK-HIS after access is cut with EcoRI and XhoI enzyme
6Carrier adds the T4DNA ligase enzyme, and 4 ℃ connect 12 hours, transformed into escherichia coli DH5 α.Choose the hickie clone with sodium ampicillin-LB plate screening, utilize the alkaline lysis or the boiling method of molecular cloning to extract plasmid, utilize enzyme to cut and identify that correctly the nucleotides sequence sequential analysis contains correct gene order reading frame then, successfully constructs pGEX-6p-proNK-HIS with the method for PCR
6-pp-PDI efficient expression vector (being abbreviated as 6pNHP).
3) with correct 6pNHP plasmid transformation escherichia coli Rosseta, select single spot clone with sodium ampicillin-LB flat screen, overnight incubation in the 5mlLB substratum, according to switching in 1: 100, in shaking bottle 37 ℃ to be cultured to OD600 be 0.4-0.6, add the IPTG liquid storage according to 1: 5000, cultivate 4-6 hour (time lengthening can significantly improve output) for 30 ℃, centrifugal collection thalline, be stored in-20 ℃ or enter down immediately the step purifying.
The plasmid that will contain PPase simultaneously changes the Rosseta bacterial strain over to, single spot clone is selected in same operation, spend the night in the 5mlLB culture medium culturing, switching in 1: 100 then, 37 ℃ of shake-flask culture to OD be 0.6, add the IPTG liquid storage according to 1: 1000, cultivated 6 hours for 30 ℃, centrifugal collection thalline is got suitably and is mixed with the 6pNHP thalline (thalline quality ratio is about 1: 50).
4) preparation is fit to preserve the buffer system that enzyme is lived:
Tris： 6.057g/L
NaCl： 2.925g/L
EDTA： 0.186g/L
Glycerine: 50ml/L
Wash mixed bacterial sediment with damping fluid; with the resuspended about 500ml bacterium liquid precipitate of 20-40ml volume; cooperate Triton X-100 to help cracking bacterium (optional) with N,O-Diacetylmuramidase; (2s is ultrasonic with carrying out ultrasonic bacteria breaking under the mixture of ice and water environment; 5s intermittently, total length 45min, 44 ℃ of protection temperature); the centrifugal 20min of 12000rpm/min collects supernatant liquor.Adjusting PH once more is about 7.0, the about 4h of oscillatory reaction (operation on ice helps to improve its lytic activity, needs to prolong action time to the 10h, adds DTT and helps to optimize reaction).Recombinant protein is cut entirely by the PPase enzyme substantially like this, discharges proNK albumen.ProNK albumen discharges highly active NK albumen from shearing.This moment, gained solution was the solution that contains Nattokinase of high density.
5) evaluation of expression product:
At first utilize SDS-PAGE to identify the concentration of expression product:
Sample preparation liquid: SDS1g, Glycerol5mL, tetrabromophenol sulfonphthalein (BPB) solid trace, dithiothreitol (DTT) (DDT) 2.5mL, B liquid 25mL adds deionized water to 50mL
Get enzyme and cut back Nattokinase solution 10ul, add 2ul sample preparation liquid, to boiling water bath 5 minutes.The point sample amount is the 5ul/ hole.The standard protein molecular weight is handled equally.With examining Ma Shi light blue R-250 dyeing.
The fibrinolytic of expression product is identified:
The side that preparation contains Fibrinogen and thrombogen is lived dull and stereotyped, and as the urokinase activity gradient solution of reference (100u, 200u, 300u, 400u, 500u).By measuring solusphere diameter expression product activity as can be known.
Embodiment two: Nattokinase stoste prepares the Nattokinase crude product
In the solution that contains the high density Nattokinase, dropwise slowly adding saturated ammonium sulphate solution to final concentration in the process that stirs is 30%, leave standstill saltoutd 4 hours or ice bath in spend the night, 12000 rev/mins are centrifugal 20 minutes; Get precipitation, with the Tris damping fluid that contains 10% glycerine of 10 times of precipitation volumes with resolution of precipitate; 12000 rev/mins centrifugal 20 minutes; Get supernatant.Dialysed overnight in the Tris damping fluid promptly obtains the Nattokinase crude product of high density, can carry out carrying out determination of activity after SDS-PAGE analyzes, and activity is about 62000u/ml.
Embodiment three: Nattokinase stoste prepares natto solution elaboration
In the solution that contains Nattokinase of high density, adjust its pH value to 10 (attention prevents near Nattokinase coagulation its iso-electric point 8.7) rapidly.Mix the post damping fluid:
MCAC-0 MCAC-1000
20mM Tris hydrochloric acid PH10.0 20mMTris hydrochloric acid PH10.0
05M?NaCl 0.5M?NaCl
10% (v/v) glycerine (can tune to 20%) 10% (v/v) glycerine
The 1M imidazoles
Clean nickel ion affinity column (Ni-NTA His-Bind Resin) post material with MCAC-0 solution, then post material and Nattokinase solution are educated altogether room temperature (better) jog 30min on ice.Upper prop is used MCAC-0 and MCAC-50 wash-out foreign protein respectively then, uses MCAC150 wash-out target protein at last.With the products therefrom dialysed overnight, promptly obtain highly purified Nattokinase elaboration.Carry out SDS-PAGE and analyze and active detection, activity is about 39000u/ml.Product can be used for further being made into finished product.
Embodiment four: simplify recombinant expression vector and prepare the Nattokinase crude product
Method according to embodiment one and example two prepares the Nattokinase crude product, when difference is to design the primer of proNK, removes the HIS sequence label at the downstream primer end, and idiographic flow is:
1) the frozen bacterial strain 1ul that gets Bacillus Subtiis Natto is inoculated in the 5mlLB substratum, and 37 ℃, 250rpm/min wave and culture base 16 hours (can not be long, prevent to form gemma).The dilution in 1: 20 of bacterium liquid is got 1ul then as pcr template.Design synthetic pcr primer thing, the proNK gene that is used to increase, the 5` of PCR primer, 3` end contain restriction endonuclease sites:
Upstream primer: NKs:5`-3` CAT AGATCT GCCGGAAAAAGCAG
Downstream primer: NKa:5`-3` TGA GAATTC TAATTGTGCAGCTGCTTGTAC
It is stand-by that primer is diluted to 50pmol/ul.Utilize the method for heat start PCR that the proNK gene clone is come out then:
PCR reaction system 50ul
ddH
2O： 40ul
10*PCR?BUFFER 5ul
dNTP 1ul
Template: 1ul
On/downstream primer: 1ul
Pfu enzyme 1ul
The PCR reaction conditions:
94℃ 8min
94℃ 30s
65℃ 30s
72 ℃ of 2min40s 20 circulations
94℃ 30s
55℃ 30s
72 ℃ of 2min40s 20 circulations
72℃ 10min
Reaction is got the PCR product and is carried out 1% agarose gel electrophoresis after finishing, and ultraviolet detection is the size that is goal gene (proNK) with a bright band of position, the 1.1kb left and right sides.
2) gel reclaims goal gene, is cut into sticky end with restriction enzyme BamHI and EcoRI, handles the pGEX-6p carrier equally, adds the T4DNA ligase enzyme, and 4 ℃ connect 12 hours, transformed into escherichia coli DH5 α.Choose the hickie clone with sodium ampicillin-LB plate screening, utilize the alkaline lysis or the boiling method of molecular cloning to extract plasmid, utilizing enzyme to cut identifies correct with the method for PCR, the nucleotides sequence sequential analysis contains correct gene order reading frame then, successfully constructs the pGEX-6p-proNK carrier.
The primer of design PDI comprises restriction enzyme site:
Upstream primer: PDI-PPs:5`-3`TA GAATTC CTGGAAGTTCTGTTCC
AGGGGCCC?ATGCTGCGCCGCGC
Downstream primer: PDI-PPa:5`-3`CT GTCGAC CAGTTCATCTTTCACAG
PCR reaction conditions (Tag enzyme):
94℃ 8min
94℃ 30s
65℃ 30s
72 ℃ of 1min 30 circulations
72℃ 10min
Agarose gel electrophoresis detects the PDI band and is positioned at about 700bp, glue reclaims goal gene, with EcoRI and SalI gene enzyme is cut into sticky end, pGEX-6p-proNK carrier after access is cut with EcoRI and XhoI enzyme, add the T4DNA ligase enzyme, 4 ℃ connect 12 hours, transformed into escherichia coli DH5 α.Choose the hickie clone with sodium ampicillin-LB plate screening, utilize the alkaline lysis or the boiling method of molecular cloning to extract plasmid, utilizing enzyme to cut identifies correct with the method for PCR, the nucleotides sequence sequential analysis contains correct gene order reading frame then, successfully constructs pGEX-6p-proNK-pp-PDI efficient expression vector (being abbreviated as 6pNP).
3) with correct 6pNP plasmid transformation escherichia coli Rosseta, select single spot clone with sodium ampicillin-LB flat screen, overnight incubation in the 5mlLB substratum, according to switching in 1: 100, in shaking bottle 37 ℃ to be cultured to OD600 be 0.4-0.6, add the IPTG liquid storage according to 1: 5000, cultivate 4-6 hour (time lengthening can significantly improve output) for 30 ℃, centrifugal collection thalline, be stored in-20 ℃ or enter down immediately the step purifying.
The plasmid that will contain PPase simultaneously changes the Rosseta bacterial strain over to, single spot clone is selected in same operation, spend the night in the 5mlLB culture medium culturing, switching in 1: 100 then, 37 ℃ of shake-flask culture to OD be 0.6, add the IPTG liquid storage according to 1: 1000, cultivated 6 hours for 30 ℃, centrifugal collection thalline is got suitably and is mixed with the 6pNP thalline (thalline quality ratio is about 1: 50).
4) preparation is fit to preserve the buffer system that enzyme is lived:
Tris： 6.057g/L
NaCl： 2.925g/L
EDTA： 0.186g/L
Glycerine: 50ml/L
Wash mixed bacterial sediment with damping fluid; with the resuspended about 500ml bacterium liquid precipitate of 20-40ml volume; cooperate Triton X-100 to help cracking bacterium (optional) with N,O-Diacetylmuramidase; (2s is ultrasonic with carrying out ultrasonic bacteria breaking under the mixture of ice and water environment; 5s intermittently, total length 45min, 44 ℃ of protection temperature); the centrifugal 20min of 12000rpm/min collects supernatant liquor.Adjusting PH once more is about 7.0, the about 4h of oscillatory reaction (operation on ice helps to improve its lytic activity, needs to prolong action time to the 10h, adds DTT and helps to optimize reaction).Recombinant protein is cut entirely by the PPase enzyme substantially like this, discharges proNK albumen.ProNK albumen discharges highly active NK albumen from shearing.This moment, gained solution was the solution that contains Nattokinase of high density.
5) in the solution that contains the high density Nattokinase, dropwise slowly adding saturated ammonium sulphate solution to final concentration in the process that stirs is 30%, leave standstill saltoutd 4 hours or ice bath in spend the night, 12000 rev/mins are centrifugal 20 minutes; Get precipitation, with the Tris damping fluid that contains 10% glycerine of 10 times of precipitation volumes with resolution of precipitate; 12000 rev/mins centrifugal 20 minutes; Get supernatant.Dialysed overnight in the Tris damping fluid promptly obtains the Nattokinase crude product of high density, can carry out carrying out determination of activity after SDS-PAGE analyzes, and activity is about 60000u/ml.
Nucleotide or aminoacid sequence table
Individual?Applicant
--------------------
Street: 11 301 in No. 1 institute in Jianxi District Anhui road
City: Luoyang City
State: Henan Province
Country: China
PostalCode：471003
PhoneNumber：13523581028
＜110〉LastName: Lee
＜110〉FirstName: intelligent clean
Individual?Applicant
--------------------
Street: No. 9 building 306, No. 56 RenMin Hospital Dormitory, double tower East St
City: Taiyuan City
State: Shanxi Province
Country: China
PostalCode：030012
PhoneNumber：03518918295
FaxNumber：
EmailAddress：
＜110〉LastName: poplar
＜110〉FirstName: elegant peach
Application?Project
--------------------
＜120〉Title: the method for preparing soluble high-activity remcombinant attokinase
<140>CurrentAppNumber：200610168056.3
<141>CurrentFilingDate：2006-12-25
<160>2
<170>PatentIn?Version?3.2
Sequence
--------
<210>1
<213>OrganismName：Bacillus?Subtilis?Natto
<400>PreSequenceString：
gccggaaaaa?gcagtacaga?aaagaaatac?attgtcggat?ttaagcagac?aatgagtgcc 60
atgagttccg?ccaagaaaaa?ggatgttatt?tctgaaaaag?gcggaaaggt?tcaaaagcaa 120
tttaagtatg?ttaacgcggc?cgcagcaaca?ttggatgaaa?aagctgtaaa?agaattgaaa 180
aaagatccga?gcgttgcata?tgtggaagaa?gatcatattg?cacatgaata?tgcgcaatct 240
gttccttatg?gcatttctca?aattaaagcg?ccggctcttc?actctcaagg?ctacacaggc 300
tctaacgtaa?aagtagctgt?tatcgacagc?ggaattgact?cttctcatcc?tgacttaaac 360
gtcagaggcg?gagcaagctt?cgttccttct?gaaacaaacc?cataccagga?cggcagttct 420
cacggtacgc?atgtcgccgg?tacgattgcc?gctcttaata?actcaatcgg?tgttctgggc 480
gtagcgccaa?gcgcatcatt?atatgcagta?aaagtgcttg?attcaacagg?aagcggccaa 540
tatagctgga?ttattaacgg?cattgagtgg?gccatttcca?acaatatgga?tgttatcaac 600
atgagccttg?gcggacctac?tggttctaca?gcgctgaaaa?cagtagttga?taaagcggtt 660
tccagcggta?tcgtcgttgc?tgccgcagcc?ggaaacgaag?gttcatccgg?aagcacaagc 720
acagtcggct?accctgcaaa?atatccttct?actattgcag?taggtgcggt?aaacagcagc 780
gaccaaagag?cttcattctc?cagcgtaggt?tctgagcttg?atgtaatggc?ccctggcgtg 840
tccatccaaa?gcacacttcc?tggaggcact?tacggcgctt?ataacggaac?gtccatggcg 900
actcctcacg?ttgccggagc?agcagcgcta?attctttcta?agcacccgac?ttggacaaac 960
gcgcaagtcc?gtgatcgttt?agaaagcact?gcaacatatc?ttggaaactc?tttctactat 1020
ggaaaagggt?taatcaacgt?acaagcagct?gcacaataa 1059
<212>Type：DNA
<211>Length：1059
SequenceName：proNK
Sequence
--------
<210>2
<213>OrganismName：Homo?sapiens
<400>PreSequenceString：
atgctgcgcc?gcgctctgct?gtgcctgccg?tggcccgccc?tggtgcgcgc?cgacgccccc 60
gaggaggagg?accacgtctt?ggtgctgcgg?aaaagcaact?tcgcggaggc?gctggcggcc 120
cacaagtacc?cgccggtgga?gttccatgcc?ccctggtgtg?gccactgcaa?ggctctggcc 180
cctgagtatg?ccaaagccgc?tgggaagctg?aaggcagaag?gttccgagat?caggttggcc 240
aaggtggacg?ccacggagga?gtctgaccta?gcccagcagt?acggcgtgcg?cggctatccc 300
accatcaagt?tcttcaggaa?tggagacacg?gcttccccca?aggaatatac?agctggcaga 360
gaggctgatg?acatcgtgaa?ctggctgaag?aagcgcacgg?gcccggctgc?caccaccctg 420
cctgacggcg?cagctgcaga?gtccttggtg?gagtccagcg?aggtggccgt?catcggcttc 480
ttcaaggacg?tggagtcgga?ctctgccaag?cagtttttgc?aggcagcaga?ggccatcgat 540
gacataccat?ttgggatcac?ttccaacagt?gacgtgttct?ccaaatacca?gctcgacaaa 600
gatggggttg?tcctctttaa?gaagtttgat?gaaggccgga?acaactttga?aggggaggtc 660
accaaggaga?acctgctgga?ctttatcaaa?cacaaccagc?tgccccttgt?catcgagttc 720
accgagcaga?cagccccgaa?gatttttgga?ggtgaaatca?agactcacat?cctgctgttc 780
ttgcccaaga?gtgtgtctga?ctatgacggc?aaactgagca?acttcaaaac?agcagccgag 840
agcttcaagg?gcaagatcct?gttcatcttc?atcgacagcg?accacaccga?caaccagcgc 900
atcctcgagt?tctttggcct?gaagaaggaa?gagtgcccgg?ccgtgcgcct?catcaccttg 960
gaggaggaga?tgaccaagta?caagcccgaa?tcggaggagc?tgacggcaga?gaggatcaca 1020
gagttctgcc?accgcttcct?ggagggcaaa?atcaagcccc?acctgatgag?ccaggagctg 1080
ccggaggact?gggacaagca?gcctgtcaag?gtgcttgttg?ggaagaactt?tgaagacgtg 1140
gcttttgatg?agaaaaaaaa?cgtctttgtg?gagttctatg?ccccatggtg?tggtcactgc 1200
aaacagttgg?ctcccatttg?ggataaactg?ggagagacgt?acaaggacca?tgagaacatc 1260
gtcatcgcca?agatggactc?gactgccaac?gaggtggagg?ccgtcaaagt?gcacggcttc 1320
cccacactcg?ggttctttcc?tgccagtgcc?gacaggacgg?tcattgatta?caacggggaa 1380
cgcacgctgg?atggttttaa?gaaattccta?gagagcggtg?gccaagatgg?ggcaggggat 1440
gttgacgacc?tcgaggacct?cgaagaagca?gaggagccag?acatggagga?agacgatgac 1500
cagaaagctg?tgaaagatga?actgtaa 1527
<212>Type：DNA
<211>Length：1527
SequenceName：PDI
Nucleotide or aminoacid sequence table
The nucleotide sequence of proNK gene:
gccggaaaaagcagtacagaaaagaaatacattgtcggatttaagcagacaatgagtgccatgagttccgccaagaaaaaggatgt
tatttctgaaaaaggcggaaaggttcaaaagcaatttaagtatgttaacgcggccgcagcaacattggatgaaaaagctgtaaaagaattg
aaaaaagatccgagcgttgcatatgtggaagaagatcatattgcacatgaatatgcgcaatctgttccttatggcatttctcaaattaaagcg
ccggctcttcactctcaaggctacacaggctctaacgtaaaagtagctgttatcgacagcggaattgactcttctcatcctgacttaaacgtca
gaggcggagca?agcttcgttccttctgaaacaa?acccataccaggacggcagttctcacggtacgcatgtcgccggtacgattgccgctctta
ataactcaatcggtgttctgggcgtagcgccaagcgcatcattatatgcagtaaaagtgcttgattcaacaggaagcggccaatatagctgga
ttattaacggcattgagtgggccatttccaacaatatggatgttatcaacatgagccttggcggacctactggttctacagcgctgaaaacagt
agttgataaagcggtttccagcggtatcgtcgttgctgccgcagccggaaacgaaggttcatccggaagcacaagcacagtcggctaccctg
caaaatatccttctactattgcagtaggtgcggtaaacagcagcgaccaaagagcttcattctccagcgtaggttctgagcttgatgtaatggc
ccctggcgtgtccatccaaagcacacttcctggaggcacttacggcgcttataacggaacgtccatggcgactcctcacgttgccggagcagc
agcgctaattctttctaagcacccgacttggacaaacgcgcaagtccgtgatcgtttagaaagcactgcaacatatcttggaaactctttctac
tatggaaaagggttaatcaacgtacaagcagctgcacaataa
The nucleotide sequence of PDI gene:
atgctgcgccgcgctctgctgtgcctgccgtggcccgccctggtgcgcgccgacgcccccgaggaggaggaccacgtcttggtgctgcg
gaaaagcaacttcgcggaggcgctggcggcccacaagtacccgccggtggagttccatgccccctggtgtggccactgcaaggctctggccc
ctgagtatgccaaagccgctgggaagctgaaggcagaaggttccgagatcaggttggccaaggtggacgccacggaggagtctgacctagc
ccagcagtacggcgtgcgcggctatcccaccatcaagttcttcaggaatggagacacggcttcccccaaggaatatacagctggcagagag
gctgatgacatcgtgaactggctgaagaagcgcacgggcccggctgccaccaccctgcctgacggcgcagctgcagagtccttggtggagtc
cagcgaggtggccgtcatcggcttcttcaaggacgtggagtcggactctgccaagcagtttttgcaggcagcagaggccatcgatgacatac
catttgggatcacttccaacagtgacgtgttctccaaataccagctcgacaaagatggggttgtcctctttaagaagtttgatgaaggccggaa
caactttgaaggggaggtcaccaaggagaacctgctggactttatcaaacacaaccagctgccccttgtcatcgagttcaccgagcagacag
ccccgaagatttttggaggtgaaatcaagactcacatcctgctgttcttgcccaagagtgtgtctgactatgacggcaaactgagcaacttcaa
aacagcagccgagagcttcaagggcaagatcctgttcatcttcatcga?cagcgaccacaccgacaaccagcgcatcctcgagttctttggcct
gaagaaggaagagtgcccggccgtgcgcctcatcaccttggaggaggagatgaccaagtacaagcccgaatcggaggagctgacggcag
agaggatcacagagttctgccaccgcttcctggagggcaaaatcaagccccacctgatgagccaggagctgccggaggactgggacaagc
agcctgtcaaggtgcttgttgggaagaactttgaagacgtggcttttgatgagaaaaaaaacgtctttgtggagttctatgccccatggtgtgg
tcactgcaaacagttggctcccatttgggataaactgggagagacgtacaaggaccatgagaacatcgtcatcgccaagatggactcgactg
ccaacgaggtggaggccgtcaaagtgcacggcttccccacactcgggttctttcctgccagtgccgacaggacggtcattgattacaacgggg
aacgcacgctggatggttttaagaaattcctagagagcggtggccaagatggggcaggggatgttgacgacctcgaggacctcgaagaagc
agaggagccagacatggaggaagacgatgaccagaaagctgtgaaagatgaactgtaa
Claims (5)
1. method for preparing soluble high-activity remcombinant attokinase is characterized in that:
Structure contains the nattokinase gene clone of leader peptide sequences, the molecular chaperones that adds GST albumen label and PDI helps goal gene to efficiently express in intestinal bacteria, being embedded in HIS label and protease cutting site in sequence helps target protein efficiently to purify, and bioactive evaluation, concrete grammar is:
1) be template with Bacillus Subtilis Natto thalline, according to Nattokinase Nattokinase, be called for short NK, full length sequence design primer obtains to comprise the total length nattokinase gene of leading peptide by the method for PCR, is called proNK; At the terminal HIS sequence label that increases of the 3` of proNK gene, six successive Histidines, HIS6, the gene clone that again proNK is added the HIS label enters the pGEX-6P carrier; Then utilize PCR the full-length gene of molecular chaperones PDI to be cloned out the 3` end of receiving the proNK gene; Front end at the PDI gene adds Prescission Protease, is called for short PPase, and protease cutting site sequence, sequence represent that with pp assembling becomes efficient expression vector pGEX-6p-proNK-HIS6-pp-PDI like this, is called for short 6pNHP; The corresponding recombinant protein that gives expression to is GST-pp-proNK-HIS6-pp-PDI;
2) 6pNHP transformed into escherichia coli Rosseta induces the expression of recombination with IPTG; The plasmid that will contain PPase simultaneously changes Rosseta bacterial strain, abduction delivering together over to; Then two kinds of thalline are collected in together in proportion;
3) with the resuspended bacterium of Tris damping fluid that contains 10% glycerine, ultrasonication, centrifugal collection supernatant liquor; Adjust pH value, the low temperature vibration makes PPase that the recombinant protein enzyme is cut entirely, discharges proNK albumen, thereby obtains containing the solution of Nattokinase; Carry out protein quantification analysis and determination of activity;
4) solution that will contain Nattokinase carries out purification process.
2. the method for preparing soluble high-activity remcombinant attokinase as claimed in claim 1 is characterized in that:
In containing the solution of Nattokinase, dropwise adding saturated ammonium sulphate solution to final concentration is 30%, leaves standstill to saltout 4 hours or spend the night, and 12000 rev/mins centrifugal 20 minutes; Get precipitation, with the Tris damping fluid that contains 10% glycerine of 10 times of precipitation volumes with resolution of precipitate; 12000 rev/mins centrifugal 20 minutes; Get supernatant; Dialysed overnight promptly obtains the Nattokinase crude product, can carry out carrying out determination of activity after SDS-PAGE analyzes.
3. the method for preparing soluble high-activity remcombinant attokinase as claimed in claim 1 is characterized in that:
In containing the solution of Nattokinase, adjust pH value to 10, go up nickel ion affinity column Ni-NTA His-Bind Resin then, with the buffered soln upper prop of 10% glycerine, 25mM imidazoles wash-out foreign protein, 100mM imidazoles wash-out target protein; Dialysed overnight promptly obtains the elaboration of Nattokinase; Carrying out SDS-PAGE analyzes and determination of activity.
4. the method for preparing soluble high-activity remcombinant attokinase as claimed in claim 1 is characterized in that:
Final recombinant protein comprises GST-proNK-PDI, GST-PDI-proNK, HIS6-proNK-PDI, HIS6-PDI-proNK, and the state of non-recombinant protein, PDI and proNK or NK are mixed in the solution simultaneously, all can improve the solubility expression of Nattokinase.
5. the method for preparing soluble high-activity remcombinant attokinase as claimed in claim 1, it is characterized in that: final recombinant protein comprises GST-proNK-PDI, GST-PDI-proNK, proNK-GST-PDI, proNK-PDI-GST, PDI-GST-proNK, the state of PDI-proNK-GST and non-recombinant protein, GST and PDI and proNK or NK three are mixed in the solution simultaneously, all can improve the solubility expression of Nattokinase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006101680563A CN1995343B (en) | 2006-12-25 | 2006-12-25 | Method for preparing soluble high-activity remcombinant attokinase |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2006101680563A CN1995343B (en) | 2006-12-25 | 2006-12-25 | Method for preparing soluble high-activity remcombinant attokinase |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1995343A CN1995343A (en) | 2007-07-11 |
| CN1995343B true CN1995343B (en) | 2010-12-22 |
Family
ID=38250546
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2006101680563A Expired - Fee Related CN1995343B (en) | 2006-12-25 | 2006-12-25 | Method for preparing soluble high-activity remcombinant attokinase |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1995343B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11135276B2 (en) | 2019-05-17 | 2021-10-05 | Imam Abdulrahman Bin Faisal University | Method of making PDIA2 and compositions containing PDIA2 |
| CN115715590B (en) * | 2022-11-18 | 2024-03-29 | 南昌大学 | Preparation method of controlled-release targeted nattokinase-puerarin gel microsphere |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1266097A (en) * | 1999-09-17 | 2000-09-13 | 常荣山 | Process for preparing recombinant natookinase |
| CN1814746A (en) * | 2005-01-31 | 2006-08-09 | 中国科学院微生物研究所 | Nattokinase and its coding gene and clone and expressing method |
-
2006
- 2006-12-25 CN CN2006101680563A patent/CN1995343B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1266097A (en) * | 1999-09-17 | 2000-09-13 | 常荣山 | Process for preparing recombinant natookinase |
| CN1814746A (en) * | 2005-01-31 | 2006-08-09 | 中国科学院微生物研究所 | Nattokinase and its coding gene and clone and expressing method |
Non-Patent Citations (2)
| Title |
|---|
| 彭勇 等.枯草杆菌DC-2纳豆激酶基因的克隆及其融合蛋白在E.coli中的表达.中国生物化学与分子生物学报15 5.2002,15(5),559-563. |
| 彭勇等.枯草杆菌DC-2纳豆激酶基因的克隆及其融合蛋白在E.coli中的表达.中国生物化学与分子生物学报15 5.2002,15(5),559-563. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1995343A (en) | 2007-07-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Li | Structure, application, and biochemistry of microbial keratinases | |
| Kulakova et al. | Cold-active serine alkaline protease from the psychrotrophic bacterium Shewanella strain Ac10: gene cloning and enzyme purification and characterization | |
| Peng et al. | Purification and characterization of a fibrinolytic enzyme produced by Bacillus amyloliquefaciens DC-4 screened from douchi, a traditional Chinese soybean food | |
| Koelsch et al. | Enzymic characteristics of secreted aspartic proteases of Candida albicans | |
| Zhang et al. | Trimeresurus stejnegeri snake venom plasminogen activator: site-directed mutagenesis and molecular modeling | |
| Graves et al. | Cloning and nucleotide sequence determination of the Clostridium pasteurianum ferredoxin gene. | |
| Peng et al. | Cloning and expression of a fibrinolytic enzyme (subtilisin DFE) gene from Bacillus amyloliquefaciens DC-4 in Bacillus subtilis | |
| Ribitsch et al. | Extracellular serine proteases from Stenotrophomonas maltophilia: screening, isolation and heterologous expression in E. coli | |
| RU2007124552A (en) | Glucoamylase TRICHODERMA REESEI AND ITS HOMOLOGIES | |
| Su et al. | A novel alkaline surfactant-stable keratinase with superior feather-degrading potential based on library screening strategy | |
| CN103602653A (en) | Keratinase with improved thermal stability and specific activity as well as preparation method and application thereof | |
| CN109266664A (en) | A method of expression strategy, which is truncated, using fusion improves glucose oxidation enzyme stability | |
| CN1995343B (en) | Method for preparing soluble high-activity remcombinant attokinase | |
| CN107400666A (en) | A kind of aminopeptidase and its encoding gene and application | |
| CN106636161A (en) | Preparation method of low-temperature protease | |
| Xie et al. | Heterologous expression and characterization of a novel subtilisin-like protease from a thermophilic Thermus thermophilus HB8 | |
| Rouhani et al. | Design, expression and functional assessment of novel engineered serratiopeptidase analogs with enhanced protease activity and thermal stability | |
| CN106929187A (en) | A kind of cold water cold water detergent and preparation method thereof | |
| Majumdar et al. | Statistical optimization for improved production of fibrin (Ogen) olytic enzyme by Bacillus cereus strain FF01 and assessment of in vitro thrombolytic potential of protease enzyme | |
| Nabiabad et al. | Expression analysis and purification of human recombinant tissue type plasminogen activator (rt-PA) from transgenic tobacco plants | |
| Taheri et al. | Engineering, expression and purification of a chimeric fibrin-specific streptokinase | |
| CN113416724B (en) | Recombinant protein of tissue type plasminogen activator and application thereof | |
| Purwaeni et al. | Bacterial fibrinolytic enzyme coding sequences from Indonesian traditional fermented foods isolated using metagenomic approach and their expression in Escherichia Coli | |
| CN101775405B (en) | Method for preparing recombinant chitinase | |
| Kotra et al. | Large scale production of soluble recombinant staphylokinase variant from cold shock expression system using IPTG inducible E. coli BL21 (DE3) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20070615 Address after: Lane two, Lane 12, West Road, Taiyuan, Pingyang Applicant after: Shanxi Jingwei Technology Co.,Ltd. Address before: No. 1, No. 1, Anhui Road, Jianxi District, Henan, Luoyang 1, 301 Applicant before: Li Huijie Co-applicant before: Yang Xiutao |
|
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: TAIYUAN JINBO BIOMEDICAL TECHNOLOGY CO., LTD. Free format text: FORMER OWNER: SHANXI JINGWEI SCIENCE + TECHNOLOGY CO., LTD. Effective date: 20110216 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 030012 NO. 12, XI ER LANE, PINGYANG ROAD, TAIYUAN CITY TO: 030006 ROOM 1407, HIGH-TECH. POWER PORT, CHANGZHI ROAD, TAIYUAN CITY, SHANXI PROVINCE |
|
| TR01 | Transfer of patent right |
Effective date of registration: 20110216 Address after: 030006 room 1407, hi tech power port, Changzhi Road, Shanxi, Taiyuan, China Patentee after: Taiyuan Jinbo Bio-Pharmaceutical Co.,Ltd. Address before: 030012 No. two, Lane 12, West Road, Taiyuan, Pingyang Patentee before: Shanxi Jingwei Technology Co.,Ltd. |
|
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101222 Termination date: 20131225 |