CN1986796B - Compound allyl isothiazole induced W-box element and its application - Google Patents
Compound allyl isothiazole induced W-box element and its application Download PDFInfo
- Publication number
- CN1986796B CN1986796B CN200610147253A CN200610147253A CN1986796B CN 1986796 B CN1986796 B CN 1986796B CN 200610147253 A CN200610147253 A CN 200610147253A CN 200610147253 A CN200610147253 A CN 200610147253A CN 1986796 B CN1986796 B CN 1986796B
- Authority
- CN
- China
- Prior art keywords
- plant
- gene
- expression
- promotor
- cis
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention belongs to the field of gene engineering technology, and is especially one kind of cis-form element for separating and utilizing nucleic acid. The element is originated from the promoter sequence in the upstream of wheat disease resistance related gene. Recombinant DNA is obtained through repeating the nucleotide sequence and single element or its cis-form series of the target product gene and fusing the obtained promoter, and used in transforming plant to obtain new transgenic plant. In the new plant, the expression of the target gene with the recombinant DNA is regulated and controlled by the chemical inducer of probenazole (PBZ) and its active metabolite 1, 2-benzisothiazole-1, 1-dioxide (BIT).
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to a kind of be subjected to chemical substance allyl isothiazole or its active metabolite inductive cis element and application thereof.This cis element derives from the promoter sequence of disease-resistant related gene upstream in the barley.The promotor that obtains after the coding nucleotide sequence of desirable purpose product gene and unit piece or its cis polyphone repeated merges and obtains recombinant DNA, with this recombinant DNA conversion plant, will obtain new transgenic plant.The expression of the goal gene in new plant in this recombinant DNA is subjected to allyl isothiazole probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ) or its active metabolite 1,2-benzisothiazole-1, the chemical inducer regulation and control of 1-dioxide (BIT).
Background technology
In more than ten years, people have obtained up to a hundred the functional genes that significant application value is arranged in crop genetic improvement in the past.Along with the progress of functional genome research, people also can clone the functional gene that is widely used and is worth in bulk.These multifarious genetic resourceses will be used to improve on a large scale crop and other important plant; cause the demand growing so that satisfy the population growth to grain; alleviate the immense pressure of environmental improvement and protection, and provide abundant daily necessities and high-quality living environment for the town dweller.These multifarious functional gene resources need could play a role under the regulation and control of dissimilar promotors rightly.
In general, promotor is the section of DNA that is positioned at the gene coding region upstream, comprises transcription initiation region.Promoter region comprises the element of multiple regulate gene expression simultaneously, as approximately being positioned at the TATA box of transcription initiation site upstream 30bp (30) position, and the CAAT box that is positioned at 75bp position, upstream.Also comprise the controlling element that to respond to other extraneous factors in the plant promoter,, and then genes involved carried out expression regulation such as environmental factors such as light, chemical substance, nutritional condition, heat, anoxic, heavy metals.Other dna sequence dna in the promotor is relevant with the tissue specificity of the sequential of growth or genetic expression.Also there is enhancer sequence in the eucaryon system, near expression of gene level can improving greatly; These reinforcing effects position residing with it and direction are had little or nothing to do with.
In recent years, plant gene engineering technology is aspect the genetic improvement of crop varieties, particularly in disease-resistant worm characteristic and antiweed characteristic, and obtained achievement and the progress that attracts people's attention on the cereal kernel quality-improving, and also more and more demonstrated its huge application potential in many others, as structure of plant bioreactor etc.Yet, when obtaining these breakthroughs, caused also that about ecological safety and the food-safety problem of transgenic plant the public more and more pays close attention to, argues even protests.Except irrational and non-science factor, also there are its intrinsic limitation really in existing selected gene and objective function expression of gene system in the middle of this.Under the state of nature, the intragentic expression of organism all is subjected to strict regulation and control.Regulatory factor may be that developmental process is relevant, and the sequencing that shows as gene is expressed, and comprises spatial and temporal expression; May be the environmental factor inductive also, the emergency that shows as gene be expressed.Yet at present used promotor mostly is composing type in the plant genetic engineering, and the promotor of these composing types orders about the selected marker and the objective function gene continues to efficiently express, for the safety issue of transgenic technology and transgenic plant has been buried hidden danger.In fact, the selected marker only need express when the screening transformant; Objective function gene in disease-resistant worm, antiweed and the bio-reactor also just needs to express in the specific stage of growing, in the time of many even only be of short duration expression.For plant, the invalid continuous expression of foreign gene is not only the unnecessary consumption of matter and energy, but also disturbs the normal physiological activity of vegetable cell, the yield and quality of influence results organ, even also can cause consequence such as proterties forfeiture.Take and find at Bt (Bacillus thuringiensis) toxic protein transgenic cotton recently, the toxicity in vivo protein gene is expressed for a long time, easily cause bollworm that toxic protein is produced resistance (Mcaughey et al., Nature biotechnol.16:144-146.1998).Also there is similar problem with plant as bio-reactor.For ecotope, the foreign gene of continuous expression may shift between nearly edge species by pollen or other approach, cause having the part selected gene of potential hazard or the proterties of functional gene and control thereof to be escaped, and then whole food chain and species diversity are caused the consequence that is difficult to expect.
In order to overcome constitutive promoter these shortcomings in plant genetic engineering, people have considered to develop inducible promoter, tissue specificity/etap specificity promoter.Inducible promoter is applied to plant genetic engineering many outstanding advantages, is mainly reflected in: 1, objective function gene abduction delivering as required; 2, the expression of gene level can be adjusted by the intensity of regulating inductor/factor; 3, by using different inductor/combinations of factors can regulate the coordinate expression of correlation function gene.
On plant, the wound-induced expression system be early be studied, attempt to be used for the engineered a kind of inducible expression system of disease-resistant worm (Lorberth et al., Plant J.2:477-86.1992).But because this class promotor is to induce objective function genetic expression by means of the wound that the infringement of sick worm causes, the speed of the disease-resistant worm genetic expression of institute's inductive and undercapacity to be producing resistance timely and effectively, thereby can not produce ideal resistance effect.In addition, other physical abuse as Storms etc., also can cause the unnecessary expression of disease-resistant worm gene.
Secondly, the promotor of the maize alcohol dehydrogenase Adh I gene of hypoxia inducible may be one of inducible promoter of studying the most detailedly.
By the method for electroporation, the maize alcohol dehydrogenase AdhI gene transformation of hypoxia inducible is come from the corn protoplastis of suspension culture.Protoplastis after the conversion places the low oxygen content place, and in the expression of 20 hours post analysis Adh I.Express for ease of the Adh I that measures hypoxia inducible, natural A dh I gene 5 ' regulation and control fragment (1096bp) is linked to each other with CAT.Their result shows that in the protoplastis that comes from the homologous culturing cell, the anoxia condition of standard can be regulated and control the AdhI promotor/CAT gene of monocotyledons corn.Simultaneously, they find that again in the corn protoplastis, the promoter fragment of Adh I itself just is enough to respond inducing of anoxia condition, and then the regulation and control expression of exogenous gene, need not coding region and 3, there is (Howard in the district, et al., Planta, 170:535-450.1987).
Other investigators have further determined the corn Adh I gene dna fragmentation relevant with hypoxia inducible.These investigators change the recombination that comprises CAT encoding sequence and Adh I promotor in the corn protoplastis, detect the CAT activity after 24 hours.By changing the length of promoter fragment, people such as Lee determine to be enough to from the initiator sequence of transcription initiation site upstream 146bp the expression of startup CAT under anoxic condition.Yet promoter sequence to 5 ' end continue to extend to 266 or 955bp after, CAT expression amount risen 5 or 8 times (Lee et al., Plant Physiology 85:327-330,1987).
People such as Walker continue to be subjected to moment expression method research corn Adh I upstream region of gene the sequence of hypoxia inducible promotor gene expression.They determined in the promotor 2 sections sequence :-133--124 that the genetic expression with hypoxia inducible is relevant and-113--99 (transcription initiation site upstream).These 2 sections sequences are necessary for inducing.Before the viral promotors of affinity-less relation, can obtain hypoxia inducible performance (Walker et al., proc.Natl.Acad.Sci.USA 84:6624-6628,1987) behind the element of this section of interpolation 40bp.
The someone finds in the tobacco cell of stable conversion in addition, if with these section regulation and control of corn Adh I gene-1 094-+106 CAT gene, under suitable anoxia condition, low-down CAT genetic expression is arranged.In fact, only detect the mRNA of CAT.Yet, the promoter element of octopine synthase gene or cauliflower mosaic virus (CaMV) is connected on 5 ' end of Adh I promotor, the expression that can stimulate CAT, and behind hypoxia inducible, detect CAT.Comprise the fragment with Adh I genetic transcription initiation site 5 ' flanking sequence 247bp, be enough to the CAT expression of gene is placed under the hypoxia regulatory.Therefore, even under the condition of octopine synthetic enzyme that composing type is arranged or the existence of CaMV 35S promoter fragment, the existence of the order of this section 247bp still makes expression of gene be subjected to hypoxia regulatory (Ellis et al., EMBO Journal 6:11-16,1987).People such as Howard, Lee and Walker by moment the Adh I promoter region that is subjected to the hypoxia inducible regulation and control that obtains of expression analysis with people such as Ellis by the stable conversion plant obtained consistent or similar.
Because the promotor evoked response factor of Adh I gene is an anoxic condition, thereby the application on genetically modified crops does not have the operability of reality.
In numerous inducible promoters, chemical inducible promoter has many outstanding advantages on the regulation and control expression of exogenous gene, and wherein topmost advantage is that controllability is strong.Efficiently, single-minded chemically inducible promoter can be used for the safely expressed of all kinds functional gene in theory, optimal may be to be used for plant genetic engineering of disease-resistant worm and the structure of bio-reactor plant.
The inductor of existing much energy regulating expression of foreign genes/promotor combination in bacterium and animal system.The system of inducing in many bacteriums is based on the promotor that can respond metabolite or its analogue.After comprising promoter related target gene transform bacteria, in its substratum, add suitable inductor, just can cause the expression of target product.Sophisticated inductor/promotor combination comprises 3-β-indolylacetic acid/trp promoter, the IPTG/lac promotor, and the hungry evoked promoter of phosphate/phosphate, and L-arabinose/ara B promotor etc.Similarly, heavy metal/metallothionine promotor, promotors such as heat/heat-shocked have been applied in the culture systems of zooblast, the regulation and control expression of exogenous gene.
On plant, the herbicide-safener evoked promoter is the practical chemically inducible promoter that a class is studied more deeply, but because aspects such as its inducing specific remain in some problems, (Hershey et al. at present as yet is not widely used, PlantMolBiol.17:679-690,1991).The U.S. once ratified the patent of a herbicide-safener inductive promotor, and (U.S. Patent number: 5364780), the investigator has obtained patent (1991 years) with first " be applicable to chemical substance that the land for growing field crops produces is induced and in transgenic plant the promotor of goal of regulation and control genetic expression ".In further using, they link to each other In2-2 promotor with reporter gene GUS, the arabidopsis thaliana transformation plant, find by histochemical methods analyst, for dissimilar herbicide-safeners, GUS is expressed in (De Veylder L et al., Plant CellPhysiology in the different tissues such as root, seedling respectively, 38 (5): 568-577,1997).
Chemical inducible promoter of other report has Whitfield's ointment, dextran acceptor, Cu2+, alcohols, tsiklomitsin, female hormone, growth hormone, cytokinin, gibberic acid, evoked promoter such as ethene and dormin (Davies, P. (Ed.) PlantHormones and Their roles in Plant Growth and Development, Martinus Nijhoff Publ.1987; Ebel et al., 1984).These promotors are mainly used in theoretical investigation, do not possess actual application value.
Chemical induction material used in the present invention---PBZ is to produce to go up the inductor that uses botanical system acquired resistance for many years, has many superiority.At first, this medicament is grown no significant adverse influence to the normal growth of plant, pathogenic bacteria there is not direct toxicity yet, be difficult for causing resistance, its inducing anti-disease mechanism mainly realizes (Sakamoto et al. by a series of Expression of Related Genes in the regulation and control body on transcriptional level, Plant Mol Biol.40:847-855,1999; Yoshioka et al., Plant is (2) J.25: 149-157,2001; Ding Derong, the post-doctor of Fudan University report of setting off, 2001).Secondly, it is a kind of efficient disease-resistance inductor of preventing and treating rice blast, can alleviate the 80-90% that causes production loss by rice blast, and effect stability, become the disease-resistant inductor (Zeigler of South East Asia Dao Qu control rice blast usable floor area maximum, Leogler and Teng (Ed.) Strategies for the discovery of rice blast fungicides.in:Rice Blast Disease, CAB InternationalPress.1994).At last, inhale transporting in allyl isothiazole has in plant materials, having overcome inductors such as Whitfield's ointment can not transporting in plant materials, easily cause the shortcoming (Kessmann, et al., Annu Rev Phytopathol.32:439-459,1994) of plant poisoning.
In sum, the application of allyl isothiazole in agriculture production has very big operability, thereby most possibly is applied to the expression of goal gene in the transgenic plant of land for growing field crops.It is reported, allyl isothiazole can inducing paddy rice in the enhancing of some disease-resistant related genes express, as the RPR1 gene.The coded product of this gene contains leucine enrichment iteron (LRR) and nucleic acid binding site (NBS), and these are the common features of many known disease-resistant genes.The RPR1 expression of gene can also be by the commonly used acquired disease resistance of botanical system (SAR) inductor BTH and SA, and the inducing of pathogenic bacteria (Sakamoto et al., PlantMol Biol.40:847-855,1999).Discovering on Arabidopis thaliana, PBZ or its active metabolite BIT also can inducible system acquired resistances (SAR).Different with common chemical inductor BTH and INA, PBZ is by activating the defence signal pathway that the SA upstream becomes to assign to activate the SA/NPR1 mediation, and then induce SAR, and the former is seemingly as the analogue of SA (the Yoshioka et al. that plays a role, Plant is (2) J.25: 149-157,2001).
WRKY is the plant specific one class transcription factor family of discovered in recent years, gains the name because of containing the conserved sequence of being made up of 7 amino acid of WRKYGQK, has found 74 members altogether in Arabidopis thaliana (Arabidopsis thaliana).WRKY albumen can be transcribed with the single-minded regulatory gene that combines of TTGAC sequence (claiming W-box again), and it is expressed and mainly is subjected to inducing of pathogenic bacteria, damage and signaling molecule SA.Remove outside the Pass the degeneration-resistant reaction of main and plant and aging have also other growth and metabolic regulation and control of involved in plant of WRKY.In the degeneration-resistant reaction process of plant, it is early stage that the expression of WRKY usually occurs in inductive, and do not need proteinic synthetic again.Discover with the single-minded bonded sequence of WRKY and more be present in upstream regulatory region territory with disease-resistant, damage, senescence-associated gene and Induced by Salicylic Acid gene.In addition, at fruit maturation, all found the WRKY expression of gene in the processes such as seed trichome development, invertase signal transduction and Plant hormones regulators,gibberellins signal transduction.
The present invention concentrates on to derive from and is subjected to PBZ inductive DNA promoter fragment in the plant.These promoter fragments are used to set up the system of a cover PBZ/PBZ induced gene, and regulate and control expression of exogenous gene in transgenic plant.This system is used in the expression of exogenous regulation and control goal gene in the transgenic plant of big Tanaka growth.Its advantage comprises the high reactivity that these promoter fragments show after handling with PBZ, obvious expression is all arranged in the plant tissue of all experiments, and the pleiotropy that produces after the chemical substance treatment of no use etc.
Be applicable to that chemical substance that the land for growing field crops produces is induced and in transgenic plant the promotor of regulation and control destination gene expression, the specificity of its expression must be convenient to the exogenous adjusting to plant, used chemical substance should have the method for multiple use, and can induce the expression of special goal gene.And PBZ is very general in big Tanaka's application.The work that relevant PBZ inductive promotor is applied to the transgenic plant aspect yet there are no report.The application of PBZ evoked promoter is expressed the gene that makes people can effectively regulate and control to have agronomical value in transgenic plant in good time.
Summary of the invention
The object of the present invention is to provide a kind of be subjected to chemical substance allyl isothiazole or its active metabolite inductive cis element and application thereof, thereby realize the selective expression of gene in applied chemistry material control transgenic plant or the plant tissue.
The cis element that the present invention proposes is a cis-acting elements that comes from barley and inducing of PBZ made replying, and is designated as W-box, and its nucleotides sequence is classified SEQ.ID.NO.1 as.This cis element has been building up in the recombinant vectors that contains non-plant source gene, and the expression level of discovery structure gene is subjected to the regulation and control of chemical substance behind the conversion plant.
Especially, the present invention proposes a nucleic acid promoter, this nucleic acid promoter fragment is subjected to compound allyl isothiazole probenazole (3-allyloxy-1,2-benzisothiazole-1,1-dioxide, PBZ) or its active metabolite 1,2-benzisothiazole-1,1-dioxide (BIT) etc. induces.Therefore after inducing with compound, the transgenic plant that have described element can cause that the DNA sequence expression of a coding specific gene product that is connected described promotor 3 ' end raises.
Another aspect of the present invention provides a recombinant DNA carrier.This carrier contains the promotor of above-mentioned cis element W-box or its cis polyphone (being a plurality of W-box cis series connection) formation.In the plant after this carrier transforms, the DNA sequence of the coding specific gene that comprise above-mentioned promotor among the present invention, links to each other and 3 ' suitable downstream sequence with this promotor, make the plant that transforms behind this recombinant vectors under the effect of compound allyl isothiazole (PBZ) or its active metabolite BIT, specific gene product level rises.The specific gene of selecting among the embodiment is the gene of coding GUS.
The present invention also comprises with recombinant DNA thaumatropy plant of the present invention, this transgenic plant increase with the DNA sequence expression that compound allyl isothiazole (PBZ) or its active metabolite BIT handle the gene product that causes that coding is selected, and this DNA sequence is through being operatively connected 3 ' end at described promoter fragment.The seed of such transgenic plant is regarded as the embodiment of this invention equally.
The present invention also is included in the method that causes in the plant that selected gene product expression increases at last, and it is made up of several steps: the recombinant DNA thaumatropy plant of a) using foregoing description; B) handle transgenic plant with Compound P BZ; C) the render transgenic plant increases the expression of selected gene product in expectation.
Embodiment
The segmental acquisition of embodiment 1:W-box cis element
According in the existing research to search, summary and the bioinformatic analysis of PBZ induced gene, the SAR of PBZ inducing plant may relate to multiple signal transduction pathway in the plant materials, and the WRKY gene that wherein all plays an important role in plant stress-resistance is disease-resistant may have vital role in PBZ inducement signal path; Nucleotide sequence analysis also shows a plurality of W-box (28bp, SEQ ID No.1) in addition, is present in the promotor that can be subjected to PBZ inductive paddy disease-resistant related gene upstream.Therefore the sequence (SEQ IDNo.6) according to the more barley disease-resistant related gene 5 ' upstream promoter of research has designed the synthetic nucleotide fragment:
5’CTAGACACACTTAATTTGACCGAGTAACATTCGCCACTAGTAAGCTTCTGCA3’(SEQ?ID?No.2)
5’GAAGCTTACTAGTGGCGAATGTTACTCGGTCAAATTAAGTGTGT 3’(SEQID?No.3)
The justice and the antisense base sequences of synthetic are dissolved respectively, anneal on the PCR instrument behind the mixing, reaction conditions is 94 ℃ of sex change 5min, again by 94 ℃ of 60s, and 55 ℃ of 30s, last 4 ℃ of insulation 10min form double-stranded product.Electrophoresis detection also reclaims double-stranded product.
Above-mentioned double-stranded product is connected with the T-carrier and obtains plasmid as inserting fragment, and transformed into escherichia coli DH5 α, carry out blue hickie on the antibiotic LB solid medium of ammonia benzyl and screen scribbling containing of IPTG and X-gal, acquisition contains the recon of W-box.With this plasmid is template, and to be PCR accordingly, whether checking has correct fragment to insert.To contain the segmental clone of correct insertion really and check order, further confirm the exactness of W-box sequence.
Embodiment 2: the structure of the segmental plant transgene carrier of tape starting
Will be through the plasmid XbaI and the SpeI double digestion of sequence verification, electrophoresis reclaims and obtains W-box cis element sequence.With the three kind array modes of this sequence with 1X, 2X and 4X, be cloned into the upstream of the basic promotor (mini promoter) on the pCAMBIA 1301 double base conversion carriers, drive the expression of gus gene, corresponding acquisition three kinds of carrier: pCW-box1, pCW-box2 (SEQ ID No.4), pCW-box3 (SEQ ID No.5).After the PCR checking, transform agrobacterium strains LBA4404 respectively with electric shocking method.Screen containing on Rifampin, Streptomycin sulphate and three kinds of antibiotic LB solid mediums of Ka Na, choose single bacterium colony, tubule shakes bacterium.With bacterium liquid is template, to being that primer is bacterium colony PCR, verifies whether each plasmid has changed Agrobacterium over to the corresponding primer of each fragment, and each reaction of negative control does not add template.
Embodiment 3: transgenic plant are subjected to PBZ to induce the research that drives reporter gene expression
The Agrobacterium-mediated Transformation Arabidopis thaliana that will have pCW-box1, pCW-box2, pCW-box3.28 ℃, 120rpm cultivates agrobacterium strains to OD600=1.2; 5000rpm (used whizzer is Hitachi CR22E, and rotary head is R22A2, No. 24), 4 ℃, 10min is centrifugal, repeatedly centrifugal collection thalline; 5% sucrose solution suspension thalline is to OD600=0.8, and thalline adds Silwet L-77 (0.03%) after evenly suspending into muddy liquid; Plant is immersed in 3s in the bacterium liquid; Hidden preserving moisture 24 hours forwards under the normal condition and cultivates.
T through transforming
0Tie seed (T for Arabidopis thaliana
1Generation) after one week of vernalization under 4 ℃ of refrigerator dark conditions, begins screening.Seed is sub-packed in the Ep pipe of 1.5ml, and the about 100ul volume of every pipe adds mercuric chloride (0.1%HgCl
2) 1ml sterilization 6 minutes, with sterile water wash 5 times, use sterilized water resuspended at last after, transfer on the MS substratum of Totomycin 30mg/L, make seed uniform distribution on substratum, inhale and remove excessive moisture, seal film and seal.In Arabidopis thaliana culturing room, screened 7 days.Select and be evident as deep green, root system is long, plant is high Arabidopis thaliana plantlet of transplant in soil.Water earlier before transplanting, transplant the back preservative film and covered four days.Plant strain growth was got blade and is extracted DNA to the certain period.Be template, to be transformed into segmental corresponding primer to being that primer is PCR, whether checking is transfer-gen plant.
T1 receives kind of (a T2 generation) for the plant individual plant, after one week of vernalization under 4 ℃ of refrigerator dark conditions, begins screening.Seed is sub-packed in the Ep pipe of 1.5ml, and the about 100ul volume of every pipe adds mercuric chloride (0.1%HgCl
2) 1ml sterilization 6 minutes, with sterile water wash 5 times, use sterilized water resuspended at last after, transfer on the MS substratum of Totomycin 30mg/L, make seed uniform distribution on substratum, inhale and remove excessive moisture, seal film and seal.In Arabidopis thaliana culturing room, screened 7 days.Select hygromycin resistance and separate than the strain system that is 3: 1, select the strain system that single copy inserts with the Southern molecular hybridization, the resistant plant that single copy is inserted strain system is transplanted in the soil.The seed of receiving (T3 generation) is determined by hygromycin selection whether it is homozygous lines, will be that T3 is for sowing in soil through the seed that is accredited as the strain system of isozygotying.With all normal growth plants of its 4-6 is material, detects promoter fragment and drives the situation that gus gene is expressed.
As the positive control that Arabidopis thaliana transforms and GUS expresses, drive the pCAMBIA1301 carrier arabidopsis thaliana transformation that gus gene is expressed to contain 35S promoter, obtain 10 strain transfer-gen plants, wherein four strains are used for T
3In generation, analyzed.This four strains normal growth transgenic line will be put in order the strain Arabidopis thaliana and extract from soil after all around, do not damage root as far as possible.Water cleans up plant and removes excessive moisture with the filter paper suction, will put in order the strain plant then and be put in the little culture dish, with the dyeing of X-Gluc dye liquor, detects GUS and expresses.Four plant all detect GUS and express, and blue each position that appears at plant, comprise blade, petiole, leaf primordium, root etc.
The painted negative control one of GUS promptly is in isometric growth wild-type Arabidopis thaliana four strains in period through what PBZ handled, does not detect the expression of gus gene.
These results show that we transform by Arabidopis thaliana and the detection system of gus gene expression is reliable.
PCW-box1, pCW-box2, pCW-box3 arabidopsis thaliana transformation obtain 9,7,11 strain transfer-gen plants respectively, respectively called after pCW-box1 (1)-pCW-box1 (10), pCW-box2 (1)-pCW-box2 (9), pCW-box3 (1)-pCW-box3 (12).
After pW-box1, pCW-box2, pCW-box3 transformed the part transgenic line that obtains water and PBZ handle 3 days respectively, will put in order the strain plant and carry out the GUS expression analysis, detect the expression of gus gene.In four plant that pCW-box1 transforms, there are 3 strains to show that GUS expresses, express only to appear at whole blade and part root.The tissue positioned that pCW-box2, pCW-box3 transfer-gen plant show is similar, but expression intensity is obviously different.
After pCW-box1, pCW-box2, pCW-box3 transformed the transgenic line that obtains water and PBZ handle 3 days respectively, get abundant expansion blade and carry out the quantitative analysis alive of GUS enzyme, the result shows that different polyphone elements repeats to show the gradient that enzyme is lived, but the size that enzyme is lived and element how much not present linear positive relevant, and its background expression amount also shows the trend of increase simultaneously with the increase of element polyphone, and wherein pCW-box2 shows best PBZ induced activity.
In negative control two, promptly contain in the plant of the carrier that basic promoters driven gus gene expresses in commentaries on classics, can detect the trace expression of gus gene, mainly concentrate on petiole base, and it expresses the influence that not handled by PBZ.
Above result shows, the W-box sequence of synthetic can respond inducing of PBZ in transgenic arabidopsis, it is active to have derivable startup, and its overall activity and induced activity all can be regulated by technique means, wherein show stronger overall activity and lower background expression behind the 2X cis of the W-box polyphone, have best PBZ induced activity.
The sequence that the present invention relates to
The information of SEQ ID No:1
Length: 28 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: oligonucleotide
Sequence description: SEQ ID No:1
CACTTAATTTGACCGAGTAACATTCGCC
The information of SEQ ID No:2
Length: 47 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: oligonucleotide
Sequence description: SEQ ID No:2
CTAGACACACTTAATTTGACCGAGTAACATTCGCCACTAGTAAGCTTCTGCA
The information of SEQ ID No:3
Length: 39 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: oligonucleotide
Sequence description: SEQ ID No:3
GAAGCTTACTAGTGGCGAATGTTACTCGGTCAAATTAAGTGTGT
The information of SEQ ID No:4
Length: 71 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: oligonucleotide
Sequence description: SEQ ID No:4
CTCTAGACACATTTAATTTGAAGTAACATTCCCCACTAGACACACTTAATTTGAAGTAACATTCCCCACTA
The information of SEQ ID No:5
Length: 132 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: genomic dna
Sequence description: SEQ ID No:5
CTCTAGACACATTTAATTTGAAGTAACATTCCCCACTAGACACACTTAATTTGAAGTAACATTCCCCACTAGACACACTTAATTTGAAGTAACATTCCCCACTAGACACACTTAATTTGAAGTAACATTCGCCACTAGTA
The information of SEQ ID No:6
Length: 1520 bases
Type: nucleic acid
Chain: strand
Topological framework: linearity
Molecule type: genomic dna
Sequence description: SEQ ID No:6
1 CGTATTCGAA?TTCGAATACG?GATAATATCC?GTTTTTTTCC?GGATACGAAT?GCAGATATTT
61 CAGACGGATT?TTGGATTTTT?TGATGATCCT?GTCATATTAT?TGATGATTTC?AGAACAATTT
121?TTTACCGTTA?AACTCAAATA?ATATTTTACT?ATATGTATAA?AATATTTGTA?CAATTATATA
181 AAATTTGTAT?AAATGTATTA?TTTAATGTAT?ATACACATAT?TATAAAATAA?TTGAATAAAT
241 TTAAATTATT?TAATATTTAT?ATATATTCGG?ATTCGAATAT?CCCGGATTCG?GATACGGATA
301 ATATCCACTT?TTTTTCGGAT?ACGGATAATA?TCCGCTTTTT?CCTGGATACG?AATACGGATT
361 TTTCGGACGG?ATATCGGATT?TTTCGAATTT?TTTTTACAGC?CTAAATGTTA?CAATATATAT
421 GTCACATGCA?GCTACGCCTG?CGCCTTATGC?ATAAGATGTG?TAGAAGTCAT?ATTGCACATA
481 CTTGTCAACT?ATCCTGATTA?TGTTATATAA?ACAAATATCA?TCGGGTAGGG?ATTACTGACC
541 TTGTGATTAC?TCTGATCATG?TTTAACAATT?AAGAGCAGTA?GTTATCATTA?ATTCCTTTTA
601 CAATCAATTT?TGTTCTAATT?CTAAACTTTA?TTATAAATCC?ATGTCTATTG?ATCTCTAAGT
661 ACACAAACCC?GTTTATTTAT?TATGACTAAA?TAGTCAGAAT?TTCCAACATT?TGAAAGTTGA
721 TTAAAAATTT?ATTCAAACTT?ACAGGAGTAA?GAAATGAATT?AGTTGAAGAA?CTTGCAATAA
781 ATATGAAGTG?GACAATACAA?AAAATTTGCT?TATTACACAC?TTAATTTGAC?CGAGTAACAT
841 TCACCTGTAT?ATTGCCTATC?AGTCGAGTCA?TAGATTATTG?TCTTCGTGGA?AAATTGGTTA
901 TGTAATGCCA?ATCACTAGTC?ACTATTAATA?TTACCTGGTC?AGCTTTCATA?ACTGTTTTAT
961 TAAATATACA?AATAAATAAT?GAAAATGAGA?AGATCATGCT?ATCAAATAAT?TCATGTAGAC
1021?AAGTTGAGAT?CCAGATTGAG?ATCCAGATTG?AACACTATAA?ATAGCAGCTC?AAACTACTCT
1081?TATTTACTCG?TACCAATCTC?AAAACACATA?CATTCAAACC?TGATTTTCTT?CCTCTCTTCT
1141?TATTTTCTCT?CGTCAGTTTA?TATTAACATA?TAATGGGTGT?TCAAAAGAGT?GAAGTCGAAA
1201?CTACTTCTTC?CGTCTCAGCA?GAGAAATTGT?TCAAGGGTTT?ATGCCTCGAC?ATCGATACCC
1261?TTCTTCCTCA?GGTTCTCCCT?GGTGCTATCA?AGAGTTCTGA?AACCCTTGAG?GG
Claims (3)
1. the cis element of an induced by chemical probenazole is characterized in that it being a cis-acting elements that comes from barley and inducing of allyl isothiazole made replying, and its nucleotides sequence is classified SEQ.ID.NO.1 as, is designated as W-box.
2. a class plant gene expression vector, it is characterized in that this carrier contain the described W-box of claim 1 or constitute by its polyphone, be included in the cis sequence in the promotor, and this cis element combines with the basic promotor of pCAMBIA1301 double base conversion carrier and is built into new promotor; Such promotor strengthens the expression of target gene under the effect of allyl isothiazole, make plant obtain useful proterties; Such target gene is connected 3 ' end of above-mentioned promotor.
3. one kind causes that in transgenic plant target gene expresses the method increase, it is characterized in that:
A) transform plant with the described plant gene expression vector of claim 2;
B) handle transgenic plant with the compound allyl isothiazole;
C) the render transgenic plant increases the expression of target gene in expectation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200610147253A CN1986796B (en) | 2006-12-14 | 2006-12-14 | Compound allyl isothiazole induced W-box element and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200610147253A CN1986796B (en) | 2006-12-14 | 2006-12-14 | Compound allyl isothiazole induced W-box element and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1986796A CN1986796A (en) | 2007-06-27 |
| CN1986796B true CN1986796B (en) | 2010-05-19 |
Family
ID=38183740
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200610147253A Expired - Fee Related CN1986796B (en) | 2006-12-14 | 2006-12-14 | Compound allyl isothiazole induced W-box element and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1986796B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101886077B (en) * | 2010-08-17 | 2012-07-25 | 福建农林大学 | Inducible promoter containing W box as well as construction method and application in genetic engineering |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1537944A (en) * | 2003-10-23 | 2004-10-20 | 复旦大学 | Promoter induced by plant system acquired character resistance inducer and its application |
| CN1706950A (en) * | 2004-06-11 | 2005-12-14 | 中国农业科学院作物育种栽培研究所 | Ethylene response component binding protein and its coding gene |
-
2006
- 2006-12-14 CN CN200610147253A patent/CN1986796B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1537944A (en) * | 2003-10-23 | 2004-10-20 | 复旦大学 | Promoter induced by plant system acquired character resistance inducer and its application |
| CN1706950A (en) * | 2004-06-11 | 2005-12-14 | 中国农业科学院作物育种栽培研究所 | Ethylene response component binding protein and its coding gene |
Non-Patent Citations (3)
| Title |
|---|
| JP特开平11-100398A 1999.04.13 |
| 阚云超，郭泽建，李德葆.转录因子IosWRKY基因的原核表达及其与顺式元件的结合.浙江大学学报（农业与生命科学版）29 1.2003,29(1),55-58. |
| 阚云超,郭泽建,李德葆.转录因子IosWRKY基因的原核表达及其与顺式元件的结合.浙江大学学报(农业与生命科学版)29 1.2003,29(1),55-58. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1986796A (en) | 2007-06-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chen et al. | DREB1C from Medicago truncatula enhances freezing tolerance in transgenic M. truncatula and China Rose (Rosa chinensis Jacq.) | |
| CN105934150A (en) | Transgenic maize | |
| CN101775398A (en) | Stress tolerance genetic engineering application of NAC protein gene DlNAC of chrysanthemum | |
| CN110358772B (en) | OsEBP89 gene for improving abiotic stress resistance of rice, and preparation method and application thereof | |
| CN107012147B (en) | Drought and/or high-salt induction promoter SlWRKY8P from tomato and application thereof | |
| CN102712929B (en) | Identification and use of plant root-specific expression promoter | |
| CN114214358B (en) | Inducible expression vector and application thereof in culturing sentry crops | |
| CN102250949B (en) | Application of rice miR166 in enhancing plant cadmium stress tolerance | |
| CN112062823B (en) | GLK7 protein and application of encoding gene thereof in drought resistance of plants | |
| WO2016128998A1 (en) | Improved transgenic rice plants | |
| CN107325161B (en) | Protein related to low-nitrogen stress and high-salt stress resistance as well as encoding gene and application thereof | |
| CN102482683A (en) | Expression of transcription regulators that provide heat tolerance | |
| WO2007033587A1 (en) | A method for isolating a bi-directional gene promotor and the use thereof | |
| CN1986796B (en) | Compound allyl isothiazole induced W-box element and its application | |
| CN104628840B (en) | Plant stress tolerance correlative protein VrDREB2A and its encoding gene and application | |
| CN106146628A (en) | The insect resistance protein of a kind of synthetic and relevant biological material thereof and application | |
| CN110904106B (en) | Application of cymbidium goeringii miR159b in enhancing plant cold sensitivity | |
| CN107056907A (en) | The application of NAC062D transcription factor proteins and its encoding gene in germination is suppressed | |
| CN103397048B (en) | Method for cultivation of transgenic wheat resisting take-all and sharp eyespot and related biological materials thereof | |
| CN100510074C (en) | Promotor induced by resistance inducer acquired by paddy system | |
| CN115851753B (en) | Application of corn ZmBES1/BZR1-1 gene in improving plant yield | |
| CN113151273B (en) | Abiotic stress inducible promoter and application thereof | |
| CN1974771B (en) | Cis element induced by chemical probenazole and its application | |
| CN111424039B (en) | Cymbidium CgWRKY65 gene and application thereof | |
| WO2022082865A1 (en) | Stress-resistant functional system acsedcdw for improving biological salt tolerance and drought resistance performance and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20100519 Termination date: 20121214 |