CN1984927A - Compositions and methods of purifying myelin-associated glycoprotein (MAG) - Google Patents

Abstract

The present invention provides compositions and methods useful for purifying recombinant myelin-associated glycoprotein (MAG) and fragments thereof. In particular, the invention provides a one-step purification method for MAG and MAG fragments. Novel forms of human recombinant MAG protein are also disclosed in addition to methods of reliably producing and storing stable recombinant MAG proteins.

Description

The composition and the method for purifying myelin-associated glycoprotein white (MAG)

Technical field

The present invention relates to belong to the film of IgG gene superfamily in conjunction with cell adhesion molecule.Especially, the present invention relates to the method for myelin associated glucoprotein (MAG) and MAG protein recovery and purifying.

Background of invention

Pathologic or traumatic damage to central nervous system (CNS) nerve fiber have caused the permanent loss of function in the Adult Mammals.The forfeiture of this neurotization partly is because the supressor of finding in myelin.Myelin associated glucoprotein (MAG) is the Feng Yu myelin protein that suppresses neurite outgrowth, and this makes it bring into play and work that described target is used to develop the therapy that promotes that people CNS damage back is recovered in the possible target of regeneration.

MAG is the glycoprotein of 100kDa, have the outer Ig spline structure territory of 5 born of the same parents, an independent membrane spaning domain and a cytoplasm domain, it can the adjusting form exist with two kinds of growths, and described two kinds of unique differences of regulating form are because the cytoplasm domain that variable mRNA montage produces.The axon regeneration that has shown the CNS that grows up is subjected to proteinic inhibition in the myelin, and described protein comprises MAG and NOGO.Although NOGO acceptor (NgR) has been accredited as aixs cylinder GPI anchorin matter, the MAG acceptor is still unclear.

Recently, show that MAG directly combines with the NgR high-affinity, and suppress axon regeneration (Domeniconi by interaction with NgR, M. wait the people, Myelin-associatedglycoprotein interacts with the Nogo66 receptor to inhibit neuriteoutgrowth.Neuron 35:283-290,2002; Liu, people such as B.P., Myelin-associatedglycoprotein as a functional ligand for the Nogo-66 receptor.Science297:1190-1193,2002).Blocking-up NgR and the interactional experiment of MAG can stop the inhibition (Domeniconi, people such as M., Neuron 35:283-290,2002) of MAG to neurite outgrowth.This interaction shows that MAG and Nogo-66 activate NgR separately, and as limiting CNS damage back aixs cylinder regenerated Feng Yu NgR part.

Yet currently used purification technique is not enough to the MAG protein purification to pure level and meet the human therapy product or the reliable needs of research tool.The many methods that produce reorganization MAG relate to the use of fused protein.The only atomic weak expression of MAG fused protein such as MAG-GST fused protein, and very unstable (Kursula P. (2000, Ph.D.Thesis) .Cytoplasmic domains of the Myelin-Associated Glycoprotien.ActaUniversitatis Ouluensis:D Medica 594.University of Oulu, Finland).In this area also known from different neuroblast oncocytes, isolating neurone and full brain or spinal cord the method for purifying MAG-Fc, described MAG-Fc be fused to MAG reorganization extracellular domain on people's the immunoglobulin Fc fragment (referring to, for example, people such as Kelm, Current Biol, page 4,965-72 (1994)).But before measuring or produce anti-MAG antibody, Fc merges must digested removing, and this has produced impure, unsettled cutting MAG protein.Therefore, scientist need use the combination of conventional chromatographic technique to come the required cutting MAG of purifying.Usually, because the common interaction sites, even high resolution affinity chromatography step can not provide the MAG with required Fc cutting to separate fully from other components.

Therefore, exist in this area not using Fc to merge the needs of the method for coming effective purifying MAG.Also need to be used for the improvement composition and the method for neurotization.

Summary of the invention

The invention provides and be used for purification of Recombinant myelin associated glucoprotein (MAG) and segmental composition and method.Concrete, the invention provides the segmental single step purification of MAG and MAG.Except the reorganization MAG method of protein of reliable generation and stable storing, people's proteinic new form of MAG of recombinating is also disclosed.

The present invention is partly based on following discovery: promptly the purification process of one step can provide highly purified MAG or its fragment reliably.As shown in embodiment, can be with MAG and fragment purification thereof to greater than 96% purity, described purity is determined with size exclusion chromatography (SEC).The proteinic functional of purifying measures to determine that described mensuration shows according to the level of the MAG inhibition neurite outgrowth of the inventive method purifying suitable with commercially available MAG-Fc protein by the neurite outgrowth inhibition.

On the one hand, the invention discloses the method for purification of Recombinant extracellular domain myelin associated glucoprotein (MAG) construct, it may further comprise the steps: use the carrier transfectional cell, described carrier has the nucleotide sequence of coding affinity labelling MAG construct and can express the affinity labelling MAG construct that comprises at least one Ig structural domain; In substratum, cultivate cells transfected, make the MAG construct of cell expressing affinity labelling; The substratum contact that contains the MAG construct makes its charged metal ion affinity chromatography resin with divalent-metal ion; And the affinity labelling MAG construct of wash-out purifying.The divalent-metal ion that uses in the affine resin of metal can be nickel, cobalt, copper, cadmium, calcium, iron, zinc or strontium.In certain embodiments, divalent-metal ion can be nickel or cobalt.Preferably, resin can be nickel-nitrilotriacetic acid(NTA) (Ni-NTA) resin or TALON ^TMResin.In comprising the substratum of FBS with cell cultures to the substratum that converges and change into afterwards serum-free.In substratum, use methotrexate.

On the other hand, the invention discloses the MAG that expresses affinity labelling, the MAG of described affinity labelling has the polyhistidyl tail and/or aminoacid sequence is the FLAG mark of DYKDDDDK.Present method also comprises the MAG that expresses affinity labelling, and the MAG of described affinity labelling comprises at least two Ig structural domains, at least 3 Ig structural domains, at least 4 Ig structural domains or at least 5 Ig structural domains.Cultivate transfectional cell and make glycosylation MAG express, wherein the glycosylation basically identical of this glycosylation and the endogenous MAG of people.In a certain embodiment, can use coding MAG or the segmental carrier stable transfection of MAG Chinese hamster ovary cell (CHO).

On the other hand, the invention discloses by changing the affinity labelling MAG that pH or interpolation sequestrant (as EDTA and EGTA) and/or competitive part (as imidazoles, histamine, glycine and ammonium chloride) come the wash-out purifying.PH approximately greater than 7 elute soln in sequestrant can be ethylenediamine tetraacetic acid (EDTA) (EDTA).Competitive part can be an imidazoles.

On the other hand, present method provides the condition of storage that keeps purifying MAG stability.The MAG of the affinity labelling of purifying can be stored in and comprise Na ₂HPO ₄, NaCl and pH be approximately greater than in 7.0 the damping fluid, be stored in the damping fluid that comprises imidazoles or be stored in the damping fluid that comprises stain remover.In some embodiments, stain remover can be a non-ionic detergent.The example that can be used for non-ionic detergent of the present invention includes but not limited to: hot menthylphenoxypolyethoxy ethanol (octoxynol-9, TRITON X-100, Rohm﹠amp; Haas), Spheron MD 30/70 (TWEEN80, ICI Americas, Inc., WilmingtonDel.), poly-Sorbic Acid alcohol ester 20 (TWEEN20, ICI, Americas, Inc.) and laureth-4 (laureth-4, BRIJ30, ICI Americas, Inc.).In certain embodiments, stain remover is Tween20.

Another aspect of the present invention disclose with the purifying of method disclosed herein preparation, glycosylated people extracellular domain myelin associated glucoprotein (MAG) construct of recombinating, wherein the purifying affinity labelling MAG construct of wash-out is greater than about 90% purity, or is preferably greater than about 95% purity.The MAG construct can have and the basic homologous aminoacid sequence of aminoacid sequence described in the SEQ ID NO:1.The MAG construct can have and the basic homologous aminoacid sequence of aminoacid sequence described in the SEQ ID NO:2.The MAG construct can have and the basic homologous aminoacid sequence of aminoacid sequence described in the SEQ ID NO:3.

On the other hand, the invention discloses the method that produces extracellular domain myelin associated glucoprotein (MAG), it comprises: the substratum contact that contains MAG makes its charged immobilized metal affinity chromatography (IMAC) resin with divalent-metal ion; With at least a IMAC washing soln washing IMAC resin; And with elute soln wash-out IMAC resin to obtain the MAG solution of purifying.This method further comprises and is selected from following divalent-metal ion: nickel, cobalt, copper, iron, calcium and zinc.In certain embodiments, divalent-metal ion is nickel or cobalt.This method further is included in the substratum of the methotrexate that contains have an appointment 10%FBS and about 100nM cells transfected is cultured to be converged, and this makes cell expressing comprise the MAG construct of at least one Ig structural domain.

In another aspect of this invention, storage MAG is disclosed to prevent the unstable and sedimentary method of protein.For example, at pH7.2, the sodium phosphate buffer (Na of high salt (500mM) and less salt (150mM) ₂HPO ₄) in, MAG fragment (comprise SEQ ID 3 and have the MAG (1-3) of 3 Ig structural domains) can at least 12 weeks of stable existence under room temperature and 4 ℃.Affine resin of metal and salt concn all to the purity of MAG (1-3) or stability without any influence.But on the stability that keeps MAG (1-5), the damping fluid that contains imidazoles is better than the sodium phosphate buffer that has or do not have stain remover slightly.Temperature also can influence the stability of MAG (1-5) (SEQ ID 2).At room temperature, accumulating in 12 weeks of the MAG of purifying (1-5) is increased to 10% from 3%.

Reorganization MAG protein of the present invention and fragment thereof can be as immunogen or selection targets in generating the MAG specific antibody.In addition, reorganization MAG protein and fragment thereof can be used to study the mensuration of NOGO acceptor and its ligand interaction, and are used to develop the therapeutical agent of blocking-up interaction with treatment Spinal injury and cerebral ischemia.

MAG or its segmental molecule that another aspect of the present invention provides specificity to be attached to purifying.Binding molecule can be antibody, antibody fragment or other molecules.The present invention also provides the method that produces specific recognition MAG or its segmental binding molecule.

From following detailed description, accompanying drawing and claim, those skilled in the art can know other features and advantages of the present invention.

Accompanying drawing describes in detail:

Fig. 1 is segmental the illustrating of multiple MAG of the present invention;

Fig. 2 A is to use TALON ^TMThe purifying chromatogram of the MAG of affinity column purifying (1-5);

Fig. 2 B is to use the purifying chromatogram of the MAG (1-5) of nickel affinity column purifying;

Fig. 3 is SDS PAGE, and it shows TALON ^TMMAG (1-5) and MAG (1-3) with purifying behind the Ni-NTA column purification;

Fig. 4 is a histogram, and it shows that the neuronic neurite outgrowth of the rat cerebellum particle of handling with the MAG (1-5) that uses the inventive method purifying suppresses.

Fig. 5 A is the histogram of UV absorbancy, and it shows the stability of MAG behind 3 freeze-thaw cycle (1-3).

Fig. 5 B is the purifying chromatogram of MAG (1-3) size exclusion chromatography (SEC), and its proof protein behind 3 freeze-thaw cycle does not have instability or gathering.

Fig. 6 A is the histogram of UV absorbancy, and it shows the stability of MAG1-5 behind 3 freeze-thaw cycle.

Fig. 6 B is the purifying chromatogram of MAG1-5 size exclusion chromatography (SEC), and it shows that protein does not have instability or gathering behind 3 freeze-thaw cycle.

Fig. 7 is at room temperature (RT) or 4 ℃ of following storages, the chart of the per-cent purity of the MAG1-3 of usefulness SEC on a plurality of time points.

Fig. 8 A is at room temperature (RT) or 4 ℃ of following storages, the chart of the per-cent purity of the MAG1-5 of usefulness SEC on a plurality of time points.

Fig. 8 B is the purifying chromatogram of MAG1-5 size exclusion chromatography (SEC), and it shows that storing the back gathering of 12 weeks down in room temperature (RT) increases.

Detailed Description Of The Invention

Unless otherwise specified, the ordinary method of recombinant DNA technology in enforcement operational analysis biological chemistry of the present invention, microbiology, molecular biology and the art technology.This class technology is explained in the literature in detail.

Term used herein is used to describe specific embodiment and is not intended to restriction (the present invention).Unless otherwise defined, all Science and Technology term be interpreted as have with they under the normally used meaning equivalent in meaning in the field.For the purposes of the present invention, with the following term of having given a definition:

Term used herein " MAG " refers to the member of immunoglobulin (Ig) (IG) superfamily that includes the outer Ig spline structure territory of 5 born of the same parents, and it is suitable with following proteins or the basic homology of peptide and function: the protein with conserved amino acid or non-aminoacid replacement or its functional brachymemma or its segmental SEQ of comprising ID NO:1 of interpolation (GenBank accession number No.P20916) promptly as described below or comprise the peptide of SEQ ID NO:1.The limiting examples of Mammals MAG sequence includes but not limited to: people's isotype (GenBank accession number AAH53347), rat (Rattus norvegicus) (GenBank accession number NP_058886, BNRT3 and BNRT3S) and mouse (Musmusculus) (GenBank accession number NP_034888, AAA39487).MAG comprises the MAG with conserved amino acid replacement, and described conserved amino acid replaces as described herein, causes functional and MAG non-functional.MAG is the glycoprotein of 100-kDa, it has the outer Ig spline structure territory of 5 born of the same parents, an independent membrane spaning domain and a cytoplasm domain, it can the adjusting form exist with two kinds of growths, and described two kinds of unique differences of regulating form are because the cytoplasm domain that variable mRNA montage produces.The extracellular domain of MAG has 8 N-and connects glycosylated site, and comprises the carbohydrate of about 30wt%.This oligosaccharides is very inhomogenous.In addition, MAG is the sialic acid conjugated protein, and those structural domain homologies of its preceding 4 Ig spline structure territories and other sialic acid bonded Ig sample lectin (saliva rabbit lectin (Siglecs)).Term used herein " MAG " comprises the activated glycosylation of MAG and the activated bigger peptide that non-glycosylated form, this molecule have the clipped form or the fragment of activity and non-activity and contain SEQ ID NO:1.Term MAG comprises and is translated back peptide that modify, that contain SEQ ID NO:1.The MAG of posttranslational modification comprises phosphorylation, glycosylation, acylation and proteolysis.In some embodiments, the included glycosylation MAG of the present invention connects on the glycosylation site at two N at least and comprises glycosylation, or on 3 N connection glycosylation sites, comprise glycosylation at least in certain embodiments, or on 4 N connection glycosylation sites, comprise glycosylation at least in other embodiments, or on 5 N connection glycosylation sites, comprise glycosylation at least in other embodiments, or on 6 N connection glycosylation sites, comprise glycosylation at least in other embodiments, or on 7 N connection glycosylation sites, comprise glycosylation at least in other embodiments, or on 8 N connection glycosylation sites, comprise glycosylation at least in other embodiments.In some embodiments, the included glycosylated MAG of the present invention comprises the carbohydrate of about 3wt% at least, or comprise the carbohydrate of about 6wt% in other embodiments at least, or comprise the carbohydrate of about 9wt% in other embodiments at least, or comprise the carbohydrate of about 15wt% in other embodiments at least, or comprise the carbohydrate of about 20wt% in other embodiments at least, or comprise the carbohydrate of about 25wt% in other embodiments at least, or comprise the carbohydrate of about 29wt% in other embodiments at least.

In the present invention, term " fragment " or " brachymemma " can be exchanged use, refer to structurally and functionally related each other chemical substance.Fragment or brachymemma comprise the structure from the modification of parent material, in this example, comprise Ig structural domain and/or biological function or the activity of MAG in cell and animal model of at least one MAG.Based on its subcellular location, MAG lacks biochemical property and the phenotype character of mouse, the possible function that belongs to MAG comprises that the initial sum of myelinization is carried out, the cell adhesion incident is as by on the sialic acid epi-position that is attached to other cells and the signal conduction between integrin combination, film motion, endocytosis, neurogliocyte, and the conduction of the signal between neurogliocyte and the neurone and to the inhibition of neurite outgrowth and axon regeneration.The limiting examples of MAG vitro bioassay is included in the neurite outgrowth described in the embodiment 4 and suppresses mensuration and combination mensuration.The segmental length of MAG can be less than about 626 amino acid, and and the basic homology of SEQ ID NO:1.In another embodiment, the segmental length of MAG can be less than about 517 amino acid, length and be less than that about 326 amino acid, length are less than about 241 amino acid or length is less than about 139 amino acid.In some embodiments, the fragment of MAG comprises affinity labelling, and it includes but not limited to polyhistidyl tail or FLAG mark (for example aminoacid sequence DYKDDDDK) at C end or N end.

Two polypeptide used herein are " basic homology " under following situation, promptly when between their aminoacid sequence being at least 70% homology, at least 80% homology, at least 90% homology, at least 95% homology or at least 99% homology, maybe the coded polynucleotide when this polypeptide can form stable duplex mutually.Same, two polynucleotide are " basic homology " under following situation, promptly when between their aminoacid sequence being at least 70% homology, at least 80% homology, at least 90% homology, at least 95% homology or at least 99% homology, or these polynucleotide can form stable duplex mutually.Generally speaking, " homology " refers to two polynucleotide sequences or peptide sequence and has the corresponding or amino acid of accurate Nucleotide and Nucleotide respectively with amino acid whose corresponding.Can determine per-cent identity by two intermolecular sequence informations of following direct comparison: sequence alignment, calculate the exact quantity that mates between the sequence of two comparisons, divided by the length of shorter sequence, and the result be multiply by 100.Can use easy available computer program to assist the analysis of similarity and identity, described computer program such as ALIGN, Dayhoff, M.O.in Atlas of Protein Sequence and Structure M.O.Dayhoff writes, 5 Suppl.3:353-358, National biomedical ResearchFoundation, Washington, D.C., it makes Smith and Waterman Advances inAppl.Math.2:482-489, and local homology's algorithm of 1981 is suitable for peptide analysis.The program that is used for definite kernel nucleotide sequence similarity and identity can be used Wisconsin Sequence AnalysisPackage, Version 8 is (available from Genetics Computer Group, Madison, Wis.), for example BESTFIT, FASTA and GAP program, they are equally based on Smith and Waterman algorithm.Default parameters with described in manufacturer's recommendation and the Wisconsin Sequence AnalysisPackage above-mentioned can be easy to use these programs.For example, the per-cent similarity of specific nucleotide sequence and reference sequences can use the Smith of the gap penalty with acquiescence score graph and 6 nucleotide positions and the homology algorithm of Waterman to determine.Alternative, homology can be determined by following: carry out multi-nucleotide hybrid making to form under the condition of stablizing duplex between the homology zone, use the specific nuclease digestion of strand subsequently, and the size of definite digestion fragment.Can for example be under the defined stringent condition of particular system, in the Southern hybrid experiment, identify basic homologous dna sequence dna.Define the technology category that suitable hybridization conditions belongs to this area.

Term used herein " the affine resin of metal " includes but not limited to: comprise can in conjunction with and the resin of the fixed function of coordination polyvalent cation part (as iminodiethanoic acid), comprise Chelating-Sepharose, Fractogel-EMD-Chelate, POROS 20 MC and MatrexCellufine Chelate.The bonded metal ion can be selected from more following possible selections, and it includes but not limited to copper, nickel, cadmium, calcium, cobalt, iron, zinc or strontium.

I.MAG and brachymemma thereof

Neurotization is the important step that exploitation is used for the new therapy of the human disorders that nervous center system (CNS) axonal injury causes.Myelin associated glucoprotein (MAG) is to stride the theca cell adhesion molecule, and it is the inhibitor of axon regeneration, and has important effect in keeping the stable interaction of aixs cylinder and myelin.MAG also works in some neurodegenerative diseases.For example, the early stage forfeiture of MAG has shown its effect in this disease incidence mechanism in the development of multiple sclerosis spot.During the neuroglia-aixs cylinder of MAG in peripheral nervous system (PNS) and central nervous system (CNS) interacts function is arranged all, and express (Quarles RH by becoming the myelin neurogliocyte, Deng the people, (1972) Biochemi Biophys Res Commun 47:491-497).It is the member of the sialic acid of immunoglobulin superfamily in conjunction with subgroup, and and the remarkable homology of neural cell adhesion molecule (N-CAM).

One aspect of the present invention provides dna sequence dna, and it comprises: the preferred codon that mixes selected nonmammalian host expresses; Be provided for the site of restriction endonuclease cutting; And provide additionally initial, the termination or the middle dna sequence dna that can promote to make up the carrier be easy to express.The present invention also provides the dna sequence dna of coding MAG polypeptide analog or derivative, and described MAG polypeptide analog or derivative (for example comprise the delation analogs that is less than all MAG specificity residues different with its natural existence form aspect the identity of one or more amino-acid residues or the position; Replace analogue, wherein one or more specific residues are replaced by other residues; Add analogue with this, wherein one or more amino-acid residues joined the terminal portions or the middle portion of polypeptide), and it has the some or all of character of natural existence form.

The new dna sequence dna of the present invention comprises the sequence that is used in safely expressed polypeptide product in protokaryon or the eukaryotic host cell, and described polypeptide product has part primary structure conformation and the one or more biological property of naturally occurring MAG at least.Unrestricted dna sequence dna of the present invention specifically comprises: (a) illustrated dna sequence dna and complementary strand thereof in SEQ ID No.4-6; (b) with the dna sequence dna of SEQ IDNo.4-6 or the dna sequence dna of its fragment hybridization; (c) with the hybridization of the dna sequence dna of SEQ ID No.4-6, the dna sequence dna of genetic code degeneracy.(b) and (c) part specifically comprises is coding MAG allelic variant form and/or the coding genomic dna sequence from the MAG of other mammalian species, and the dna sequence dna of the manufacturing of coding MAG, MAG fragment and MAG analogue.This dna sequence dna can mix and promote the codon of transcribing and translating of messenger RNA(mRNA) in microorganism host.According to people such as Alton, the method for disclosed PCT application WO 83/04053 can be easy to make up the sequence that this class is made.

According to a further aspect in the invention, the dna sequence dna that coding described herein has the active polypeptide of MAG is significant, because the aminoacid sequence of the mammalian proteins matter that the information that they provided can not obtain before relating to.This dna sequence dna also is significant as carrying out the extensive synthetic product of MAG by multiple recombinant technology.Dna sequence dna provided by the invention can be used for producing new and useful virus and cyclic plasmid dna vector, produce the protokaryon and the eukaryotic host cell (being included in bacterium, yeast cell and the mammalian cell of growing in the substratum) of new and useful conversion and transfection and produce the new and useful method that is used to cultivate this type of host cell that can express MAG and associated products thereof.

The invention provides purifying and isolating naturally occurring MAG, promptly with the one-level of naturally occurring material basically identical, secondary and three grades of conformations and glycosylation pattern; The MAG fragment that also provides non-natural to exist, it has and essentially identical primary structure conformation of naturally occurring MAG (for example continuous sequence of amino-acid residue) and glycosylation, and this makes it have the neurite outgrowth inhibition active (referring to embodiment 4) similar substantially to the neurite outgrowth inhibition activity of naturally occurring MAG.

In a certain embodiment, the product that the MAG that recombinates expresses (as bacterium, yeast cell, higher plant cell, insect cell and the mammalian cell by cultivating) as the protokaryon or the eucaryon host of exogenous DNA array produces, and described exogenous DNA array is cloned by genome or cDNA or obtained by gene is synthetic.In typical yeast (as S. cervisiae (Saccharomycescerevisiae)) host cell or prokaryotic organism (for example intestinal bacteria (E.coli)) host cell expressed products not can with the combination of any mammalian proteins matter.In vertebrates [as non-human mammal (for example COS and CHO) and bird] expressed products not can with your protein bound.According to employed host, polypeptide of the present invention can be with the carbohydrate glycosylation of mammiferous or other eucaryons or can be not by glycosylation.Host cell can use the people such as Lee that are incorporated herein by reference, J.Biol.Chem.264, and those technology described in 13848 (1989) change.Polypeptide of the present invention can also comprise initial methionine amino-acid residue (in the position-1).

Except naturally occurring MAG equipotential form, the present invention also comprises the polypeptide analog of other MAG fragments such as MAG.This type of analogue comprises the MAG fragment.Those of ordinary skill in the art can be easy to design and make the gene that coded polypeptide is expressed, and the one-level conformation that described polypeptide has is in different (for example replacement, end and intermediary add and lack) (referring to people's (WO 83/04053) such as for example Alton the methods) that offered some clarification on this paper aspect the identity of one or more residues or the position.Alternative, the modification of cDNA and genomic gene can realize easily by well-known site directed mutation technology, and can be with analogue that generates MAG and derivative.This type of product should have the biological property of a kind of MAG and can be in other respects different at least.As limiting examples, product of the present invention comprises: with those products of brachymemma (foreshorten) before for example disappearance is come; Or to those the most stable products of hydrolytic action (and therefore, can have a more significant or more persistent effect) than naturally occurring; Or deleted or added the product in one or more O-glycosylations and/or the glycosylated potential site of N-, perhaps one or more cysteine residues disappearances or by for example L-Ala or serine residue displacement and may the easier product of from microflora, separating with activity form; One or more tyrosine are replaced by phenylalanine and easier or more difficult and target cell on target proteins matter or the product of receptors bind.What also comprise is this polypeptide fragment, and promptly it only reappears continuous amino acid sequence or secondary conformation among the MAG of a part, can have a kind of character (for example receptors bind) of MAG and does not have other character (for example neurite outgrowth inhibition).Obviously, for any one or a plurality of product of the present invention, not the activity that must have the effect that therapeutic efficiency or other aspects such as MAG antagonistic action measure.Competitive antagonist can be used for the restraining effect as blocking-up MAG.

The present invention also comprises that class polypeptide by the part dna encoding, the protein coding chain complementation of the cDNA of described DNA and people MAG or genomic dna sequence, i.e. " complementary reverse protein ".

One aspect of the present invention, according to the aminoacid sequence of each the Ig structural domain shown in Fig. 1, the MAG fragment can be designed to comprise 1,2,3,4 or 5 Ig structural domain.Design primer so that each structural domain is appropriately expressed according to method well-known in the art.In order to allow suitable secondary structure, primer can be designed so that fragment is stretched in the adjacent Ig structural domain.For example, the MAG fragment that comprises preceding 3 the IG structural domains of MAG can be designed to comprise at least 1-325 amino acids, 1-327 amino acids or 1-350 amino acids, the amino-acid residue of 1-375 amino acids at least at least at least.Another aspect of the present invention can make up the MAG fragment and merge non-conterminous MAG Ig structural domain.For example, the 1-325 amino acids that comprises Ig structural domain 1-3 can be fused to the 413-508 amino acids that comprises Ig structural domain 5.

The representational MAG polypeptide of the present invention includes but not limited to MAG1-120, MAG1-237, MAG1-325, MAG1-412, MAG1-508, MAG1-517, MAG1-536, MAG1-626, MAG1-139, MAG1-241, MAG1-327, MAG1-413, MAG1-160, MAG1-180, MAG1-200, MAG1-260, MAG1-280, MAG1-300, MAG1-350, MAG1-370, MAG1-390, MAG1-430, MAG1-450, MAG1-470, MAG20-120, MAG237-327, MAG325-413, MAG412-508, MAG412-516, MAG325-516, MAG90-260, MAG210-340, MAG310-430, MAG390-516, MAG390-626, MAG1-241, MAG120-327, MAG120-413, MAG120-516, MAG120-626, MAG237-413, MAG237-516, MAG237-536, MAG237-626, MAG325-508, MAG325-536, MAG325-626, MAG1-325/508-626.MAG fragment of the present invention can comprise the polyhistidyl tail (that is, His6) and/or the FlAG mark at C end or N end.

II. purifying MAG

On the one hand, the present invention includes purifying MAG and the segmental single stage method of MAG from the material that contains MAG such as conditioned medium.

In order to express required polypeptide, the nucleotide sequence or the functional equivalents of this polypeptide of coding is inserted in the suitable expression, that is, and comprise the encoding sequence that inserts transcribe and translate must element carrier.Can use the well-known method of those skilled in the art to come construction of expression vector, described expression vector comprises the sequence of the desired polypeptides of encoding and suitable transcribing and the translational control element.

Multiple expression vector/host system can be used for comprising and expressing polynucleotide sequence.These include but not limited to, microorganism is as the bacterium that transforms with recombinant phage, plasmid or glutinous grain DNA expression vector; Yeast with the Yeast expression carrier conversion; Insect cell system with virus expression carrier (as baculovirus) infection; With virus expression carrier (as cauliflower mosaic virus, CaMV; Tobacco mosaic virus (TMV) is TMV) or with bacterial expression vector (for example Ti-plasmids or pBR322 plasmid) plant transformed cell system; Or zooblast system.

In bacterial system, can select many expression vectors according to the purposes of expressed polypeptide.For example, when needs are a large amount of, when for example being used for antibody induction, can instruction be easy to the carrier of the fused protein high level expression of purifying.But the use of bacterial system does not allow and the basic consistent posttranslational modification of endogenous MAG protein.In addition, the use of fused protein needs the rapid purification process of multistep.

In mammalian host cell, common more available expression system based on virus.For example, when adenovirus is used as expression vector, the sequence of coding desired polypeptides can be connected to the adenovirus of being made up of late promoter and tripartite leader[and transcribes/translate in the complex body.Insertion in virus genomic nonessential E1 or E3 zone can be used for obtaining can be in the host cell that is infected the live virus of express polypeptide.In addition, transcriptional enhancer such as Rous sarcoma virus (RSV) enhanser can be used for being increased in the expression in the mammalian host cell.

Specific start signal also can be used for realizing the encoding sequence of more effective translation purpose polypeptide.This class signal comprises ATG initiator codon and contiguous sequence.Under the situation of the sequence of coded polypeptide, its initiator codon and upstream sequence are inserted in the suitable expression, and can need other to transcribe or the translational control signal.But, under the situation of having only encoding sequence or its part to insert, should provide the external source translational control that comprises ATG initiator codon signal.In addition, initiator codon should be to guarantee the segmental translation of complete insertion in correct reading frame.External source translation element and initiator codon can be multiple sources, natural and synthetic can.By comprising the enhanser that is suitable for used specific cells system,, can strengthen expression efficiency as described those enhansers in the literature.

Usually, the dna sequence dna of coding MAG polypeptide effectively is connected to it in expression vector, expresses on other required genetic elements, generally include transcripting promoter and terminator.Although those skilled in the art will recognize that in some system and can on different carriers, provide selected marker; but carrier also will comprise one or more selected markers and one or more replication orgin usually, and provide duplicating of foreign DNA in the host cell gene group by being inserted into.Promotor, terminator, selected marker, carrier and other selection of components are the conventional design contents of those of ordinary skills' level.A lot of these class components have description in the literature and can obtain by commercial supplier.

For the MAG polypeptide being incorporated in the Secretory Pathway of host cell, in expression vector, provide secretory signal sequence (also being known as leader sequence, preceding former (prepro) sequence or presequence).Secretory signal sequence can be from other secreted protein or de novo synthesis.Secretory signal sequence effectively is connected on the dna sequence dna of MAG, that is, two sequences are connected with correct reading frame and the location so that new synthetic polypeptide is introduced in the Secretory Pathway of host cell.Although some signal sequence can be positioned at the elsewhere of target DNA sequence, secretory signal sequence is positioned at 5 ' end of the dna sequence dna of coding desired polypeptides usually.

In addition, can regulate the ability that insertion sequence expresses or process expressed proteinic ability according to required form and select host cell strain according to host cell strain.This type of modification of polypeptide includes but not limited to acetylizing, carboxylated, glycosylation, phosphorylation, fatization and acylation.The translation post-treatment of the preceding former form of scinderin matter also can be used for promoting correct insertion, folding and/or function.Can select this type of is translated the different host cells that the back activity has specific cell machine (cellular machinery) and feature mechanism, as CHO, COS, HeLa, MDCK, HEK293 and W138, to guarantee the correct modification and the processing of exogenous protein.

The mammalian cell of cultivating is preferably used as host cell of the present invention.The method of foreign DNA being introduced mammalian host cell comprises the transfection of calcium phosphate mediation, the transfection of DEAE-dextran mediation and liposome-mediated transfection.The generation of recombinant polypeptide is that this area is well-known in the mammalian cell of cultivating.The mammalian cell that is fit to cultivate comprises COS-1 (ATCC No.CRL1650), COS-7 (ATCC No.CRL1651), BHK (ATCC No.CRL1632), BHK570 (ATCC No.CRL10314), 293 (ATCC No.CRL1573; People such as Graham, J.Gen.Virol.36:59-72,1977) and Chinese hamster ovary line (CHO-K1 for example, ATCC No.CCL61; Or CHO DG44, people such as Chasin, Som.Cell.Molec.Genet.12:555,1986).Other the clone that is fit to is known in the art and can be from disclosed preservation neutrality, and as American Type Culture Collection (American type culture collection), Manassas obtains among the Va.The promotor that is fit to comprises those promotors, the adenovirus major late promoter from metallothionein gene, and from the promotor of SV-40 or cytomegalovirus.

For generation recombinant protein long-term, high yield, stably express is normally preferred.For example, can transform the clone of stably express polynucleotide of interest with expression vector, described expression vector can comprise the replication orgin and/or the endogenous Expression element of virus, and comprises the selected marker on same or another carrier.After introducing carrier, allow cell in enriched medium, to grow 1-2 days, change them over to selective medium afterwards.The purpose of selected marker is to give cell resistance to select the cell growth and the recovery of institute's calling sequence that its existence can be used for successful expression.Can use the tissue culture technique that is suitable for this cell type to breed the resistance clone of the cell of stable conversion.

Many selective systems can be used for reclaiming cell transformed system.Metabolic antagonist resistance, antibiotics resistance or Herbicid resistant can be with the bases that elects, for example, provide dhfr at the methotrexate resistance, provide at the npt of aminoglycoside, Xin Meisu and G-418 resistance and als or the pat that pin chlorine sulphur grand (chlorsulfuron) and phosphinothricin acetyl transferase resistance are provided respectively.Described other selected genes and utilized indoles to replace the trpB of tryptophane, or allowed cell to utilize histinol to replace the hisD of Histidine as allowing cell.The use of witness marking is popularized, described mark such as anthocyanin, β-glucuronidase and substrate GUS thereof and luciferase and substrate fluorescein thereof, they are used widely, not only be used for identifying transformant, also be used for the amount that the instantaneous or stabilizing protein of quantitative idiosyncratic carrier system expresses.

Although existence/shortage that marker gene is expressed has shown that also goal gene exists, also need to determine its existence and expression.For example, if the sequence of coded polypeptide is inserted in the marker gene sequence, can identify the reconstitution cell that contains sequence by the shortage of marker gene function so.Alternative, the placement of the sequence of marker gene and coded polypeptide can being contacted under the regulation and control of single promotor.Response is induced or the expression of the marker gene selected shows that usually tandem gene also expresses.

Alternative, comprise and the host cell of expressing required polynucleotide sequence can be identified by several different methods known to those skilled in the art.These methods comprise but and being not limited to, DNA-DNA hybridization or DNA-RNA hybridization and protein biological assay or immunoassay (comprise as be used to detect and/or quantitative nucleic acid or proteinic technology based on film, solution or chip).

Multiple mark and interconnection technique are known and can be used for multiple nucleic acid and determined amino acid for those skilled in the art.Generation is used to detect the mark hybridization of polynucleotide correlated series or the method for PCR probe comprises that the Nucleotide of oligonucleotide mark, nick translation, end mark or applying marking carries out pcr amplification.Alternative, sequence or its any part can be cloned in the carrier to produce the mRNA probe.Examples of such carriers is commercially available known in the art, and by adding the suitable RNA polymerase such as the Nucleotide of T7, T3 or SP6 and mark, and it can be used for the vitro synthesized RNA probe.Can use multiple commercially available test kit to carry out these methods.Operable suitable reporter molecule or mark comprise radionuclide, enzyme, fluorescent agent, chemoluminescence agent or developer and substrate, cofactor, inhibitor, magnetic-particle etc.

Can under the condition that is fit to protein expression and from cell culture, reclaims, cultivate with polynucleotide of interest sequence transformed host cells.According to used sequence and/or carrier, the protein secreting that reconstitution cell can be produced or be included in the cell.As the skilled personnel can understand, the expression vector that contains polynucleotide of the present invention can be designed as and comprises the sort signal sequence, and promptly described signal sequence can instruct encoded polypeptide to pass protokaryon or eukaryotic cell membrane secretion.Other recombinant precursors can be used for the nucleotides sequence that sequence with the coding desired polypeptides is connected to the coded polypeptide structural domain and list, and described polypeptide structure territory can promote the purifying of soluble protein.This type of purifying promotes that structural domain includes but not limited to, metal chelating peptide, as allowing the Histidine-tryptophane assembly of purifying on the affine resin of metal, and at (the FLAGS extension/affinitypurification system of FLAGS diffusion/affinity purification system, Immunex Corp., Seattle, Wash.) in employed structural domain.

Except the reorganization production method, MAG of the present invention and fragment thereof also can be synthesized by the direct peptide that uses solid phase technique and produced.Protein synthesis can use manual technique or be undertaken by automatic control.Automatically synthetic can the use, for example Applied Biosystems 431A Peptide Synthesizer (Perkin Elmer) finishes.Alternative, a plurality of fragments of chemosynthesis and use chemical process couple together to produce full-length molecule respectively.

Can use will recombinate MAG and MAG fragment of the combination of centrifugal, ultrafiltration and chromatography from the exhausted substratum, to extract.In certain embodiment, the substratum of Chinese hamster ovary celI is by the charged affine resin of metal.Can pass through pillar with no charged chelating matrix filling so that the affine resin of metal is charged by making metal salt solution.PH can influence protein bound.Can in binding buffer liquid, add other reagent such as urea, salt or stain remover.Should thoroughly wash bonded MAG fragment and use certain methods that it is eluted from the affine resin of metal subsequently, described method comprises as passing through to use the pH gradient, use competitive part such as imidazoles, histamine, glycine or ammonium chloride, perhaps use sequestrant such as EDTA or EGTA.

Can use any method known in the art to measure the MAG or the segmental relative quantity of MAG of purifying.The typical method that is used for protein detection comprises from the cell or tissue sample and extracts protein, subsequently the specific label probe of target proteins (as antibody) hybridized on the protein example, and detection probes.Labelling groups can be the cofactor of radio isotope, fluorescent chemicals, enzyme or enzyme.Except the well-known other technologies of those skilled in the art, the detection of concrete protein and polynucleotide can also be by gel electrophoresis, column chromatography, directly check order or quantitative PCR (under the situation of polynucleotide) is assessed.

Can be by allowing highly sensitive and repeatable direct measurement, mass spectrometry is measured MAG protein of the present invention.Available many mass spectrometries.For example electrospray ionization (ESI) can be used for the difference of the multiple kind relative concentration in a quantitative sample and another sample; May carry out absolute quantitation by normalization method technology (mark in for example using).The mass spectrophotoneter that allows the flight time (TOF) to measure has high tolerance range and resolving power, and can measure low-abundance kind.

The compositions and methods of the invention have been described in an embodiment.Use the myelin associated glucoprotein (MAG) of two kinds of forms: MAG (1-3) (SEQ ID NO:3) and MAG (1-5) (SEQ ID NO:2) illustrate purification process of the present invention.Use one group of technology, determined purity and the biological activity of the MAG (1-3) and the MAG (1-5) of purifying.Illustrated that also condition of storage of the present invention and working method are to the influence of product stability under multiple condition.

III. the MAG of purifying and segmental purposes thereof

On the one hand, method of the present invention and construct have diagnosis and/or therepic use in sacred disease.Term " sacred disease " or " CNS disease " refer to patient's normal neuro-function infringement or lack, or there is unusual neural function in the patient.For example sacred disease can be disease, damage and/or aged result.The sacred disease that this paper uses also comprises neurodegeneration, and it causes the form and/or the dysfunction of a neurocyte or one group of neurocyte.Form and/or parafunctional limiting examples comprise physical connection between the misgrowth pattern, neurocyte of death, the neurocyte of the physical degradation of neurocyte and/or neurocyte unusual, neurocyte is not enough or a kind of material of excessive generation or multiple material such as neurotransmitter, neurocyte can not produce its normal a kind of material that produces or multiple material, produce material such as neurotransmitter with unusual pattern or at abnormal time, and/or transmit the electricity impulsion.Sacred disease includes but not limited to dysmnesia, dementia, the loss of memory, epilepsy and local asphyxia.Sacred disease also comprises neurodegenerative disease.Neurodegeneration can occur in any zone of patient's brain, and can see in numerous disease, described disease includes but not limited to alzheimer's disease, amyotrophic lateral sclerosis (ALS), multiple sclerosis, Huntington Chorea and Parkinson's disease.

Comprise that in the present invention the energy specificity is attached to the molecule of MAG and blocking-up MAG inhibit feature.In some embodiments, this binding molecule is antibody or antibody fragment.In other embodiments, this binding molecule is non-antibody type.Therefore, for example, this binding molecule can be that MAG is the enzyme of substrate.This binding molecule can be discerned any epi-position of MAG.Can identify and produce this binding molecule by any method of this area available.The method of identifying and producing specific antibody of analyte and antibody fragment is well-known.The example that is used to identify the additive method of this binding molecule comprise with random peptide library (for example phage display) in conjunction with measuring and according to MAG structural analysis method of design.

On the other hand, MAG of the present invention and MAG fragment can be used for carrying out the structure-functional analysis of MAG acceptor, and the MAG acceptor includes but not limited to NOGO acceptor (NgR) and p75 (NTR), and LINGO-1.Use new segment of the present invention, can explore specificity structure territory-domain interaction, and can instruct the exploitation of new therapeutics.

In another aspect of this invention, can block the inhibit feature of MAG protein and/or MAG acceptor with antibody or peptide.Reorganization MAG protein of the present invention and fragment thereof can be used as immunogen or select target in generating the MAG specific antibody.In addition, reorganization MAG protein of the present invention and fragment thereof can be used to study the mensuration of NoGo acceptor and ligand interaction thereof, and the exploitation that is used for the treatment of agent, described therapeutical agent blocking-up interacts with treatment Spinal injury and cerebral ischemia and sacred disease.

Axon regeneration among the adult CNS is subjected to the protein restriction at least three myelins, and described three protein are myelin associated glucoprotein (MAG), NoGo and oligodendrocyte myelin glycoprotein (Omgp).Identified that NOGO acceptor (NgR) is as aixs cylinder GPI anchorin matter, unclear but the MAG acceptor is still.Shown the MAG high-affinity directly in conjunction with NgR (Liu, people such as B.P., Myelin-associated gylcoprotein as a functional ligand forthe Nogo-66 receptor.Science 297:1190-1193,2002.).GPI is connected protein protected growing tip can not produce from aixs cylinder excision to wither, and dominant negative NgR has eliminated the inhibition of MAG to neurite outgrowth by the MAG inductive.Make embryo's neurone of MAG resistance to the MAG sensitivity by expressing NgR.MAG and Nogo-66 independently activate NgR, and act as and can limit CNS damage back aixs cylinder regenerated Feng Yu NgR part.

Recently, illustrated that MAG suppresses axon regeneration (Domeniconi by interacting with NgR, M. wait the people, Myelin-associated glycoprotein interacts with the Nogo66 receptorto inhibit neurite outgrowth.Neuron 35:283-290,2002).MAG is to rely on GPI and not rely on that sialic mode is specific in conjunction with the NgR express cell to be.Is that MAG precipitates NgR with MAG from NgR express cell, dorsal root ganglion and cerebellar neuron with the NgR direct interaction conforms to.Blocking-up NgR and the interactional experiment of MAG have prevented the inhibition of MAG to neurite outgrowth.Combine (Domeniconi, people such as M., Neuron 35:283-290,2002) of MAG and NOGO-66 direct competitive and NgR.

In suppressing neurite outgrowth, comprise that some myelin compositions of the extracellular domain of NOGOA, OMGP and MAG are brought into play their effect by identical NOGO acceptor.The glycosyl-phosphatidyl inositol of NOGO acceptor (GPI) grappling character explanation needs other transmembrane protein to be transmitted to and to reply in the neurone will suppress signal.P75 is the transmembrane protein of known neurotrophin family receptors as somatomedin, its specific and NOGO acceptor interaction.The receptor-mediated signal conduction of NOGO needs p75, because no longer the part of myelin or any known NOGO acceptor is replied from the neurone of p75 knock-out mice.Blocking-up p75-NOGO interacts and has also reduced the activity of these inhibitor.In addition, when the brachymemma p75 protein that lacks born of the same parents' internal area during overexpression, has weakened same group inhibition activity in primary neuronal, this shows that p75 is the signal transmitter of NOGO acceptor-p75 receptor complex.The aixs cylinder of interfering p75 and its downstream signal pathway can allow to damage overcomes and the relevant overwhelming majority inhibition activity of nervous center system myelin.

On the other hand, the inhibit feature of MAG can be used antibody or the peptide blocking-up in conjunction with p75.P75 (NTR) is coreceptor (Wong, the S.T. that is used for the NOGO acceptor of MAG signal conduction; Deng the people, A p75 (NTR) and Nogo receptor complex mediates repulsive signalingby myelin-associated glycoprotein.Nature Neurosci.5:1302-1308,2002).In human embryo kidney (HEK) cell of the expression NOGO acceptor of cultivating, need p75 (NTR) to be used for MAG inductive cellular calcium and rise.Co-immunoprecipitation has shown and can have been destroyed by the antibody of p75 (NTR) being connected of NOGO acceptor and p75 (NTR), and can observe the coexpression of expansion in the rat nervous system of growing.In addition, in neurone and in the HEK cell that NOGO acceptor/p75 (NTR) expresses, mutual exclusion rotation (repulsive turning) and calcium that p75 (NTR) antibody has all destroyed MAG inductive Xenopus laevis axon growth awl rise.

In another aspect of this invention, the MAG carrier can be used as gene vaccine.The coding DNA of the ORF of the people MAG of total length can directly be used in immune object in the particle gun in adenovirus carrier.At the cell surface expression MAG protein of accepting from the DNA of particle gun.In external transient expression is measured, can detect protein at cell surface.In addition, the people MAG Ig spline structure territory I-III that has merged TM-ICD in adenovirus carrier can directly be used in immune object in the particle gun.With MAG structural domain I-III protein at cell surface expression.Gene vaccine can be expressed and be used as to disclosed in the present invention all MAG fragments in adenovirus carrier.

Embodiment

The following example has illustrated method of the present invention.These embodiment only are used for illustration purpose, and do not limit the present invention in any way the scope of requirement.

Myelin associated glucoprotein (MAG) is that film is in conjunction with cell adhesion molecule and belong to IgG-gene superfamily.It is made up of Ig sample G structural domain outside the born of the same parents of multiple function in myelin forms and keeps by 5.Acceptor interaction on MAG and its neurone causes spinous process to wither and axon regeneration suppresses.For method of the present invention is described, studied expression and the purifying of dissimilar recombinant human MAG.Embodiment 1-3 has described vector construction, MAG (1-3) (1-325 amino acids in detail, SEQ ID3 and SEQ ID 6) and MAG (1-5) (1-516 amino acids, SEQ ID NO:2 and SEQID NO:5) expression and purifying, described MAG (1-3) and MAG (1-5) have merged His6 and FLAG mark at the C end, and express in the Chinese hamster ovary celI system of stable transfection.Cell is cultured in the defined medium that contains 10%FBS and 100nM methotrexate converges, and transferred in the defined medium that does not add serum in preceding 48 hours in results.The purification technique that uses multiple metal affinity column is disclosed.The product of purifying characterizes with multiple technologies.Keeping the stability of protein purification and the effective storage and the operational condition of function is described in embodiment 5.

Embodiment 1:MAG protein and segmental generation

In order to generate MAG and MAG fragment, use this IMAGE consortium clone (5194207) as template.Be used to use the pcr amplification of following primer, described consortium clone comprises the amino acid whose total length readable sequences (open reading) of coding corresponding to GenBank accession number P20916 (SEQ ID NO:1).

1) pADORI-MAG FL clone aa 1-626

(SEQ ID NO.7) 5 ' widow:

5 ' gatcgatcagatctgccgccatgatattcctcacggcact BglII site

(SEQ ID NO.8) 3 ' widow:

5 ' tagtactagaattctcatcacttgacccggatttcagcatactca EcoRI site

2) pED6 and pTDMEDL-MAG-ECD 6His-FLAG (MAG aa 1-516)

(SEQ ID NO.9) 5 ' widow:

5 ' gatcgatctctagagccgccatgatattcctcacggcact XbaI site

(SEQ ID NO.10) 3 ' widow:

5’tagtactagaattctcatcagatcttatcgtcgtcatccttgtaatcatggtgatgatggtgatgag

Gcccgatcttggcccacat EcoRI site

3) pED6 and pTDMEDL-MAG-I-III 6His-FLAG (MAG aa 1-325)

(SEQ ID NO.11) 5 ' widow:

5 ' gatcgatctctagagccgccatgatattcctcacggcact XbaI site

(SEQ ID NO.12) 3 ' widow:

5’tagtactagaattctcatcagatcttatcgtcgtcatccttgtaatcatggtgatgatgg

Tgatgtgcatacatgacactgagccc EcoRI site

4)pADORI-MAG?aa?1-325/508-626：

Primer collection 1:

(SEQ ID NO.13) few A (5 '-3 '): tcagcgatcactcactcgctgtacaga

(SEQ ID NO.14) few B:aggcccgatcttggcccacatcagtcgtgcatacatgacactgagccccac

Primer collection 2:

(SEQ ID NO.15) few C:ggggctcagtgtcatgtatgcacgactgatgtgggccaagatcggg

(SEQ ID NO.16) few D:gggtcagccacgcaggctgcccccagctcct

Primer collection 3:

(SEQ ID NO.17) few A ': 5 ' gatcgatcagatctgccgccatgatattcctcacggcact

(SEQ ID NO.18) few D ': gatcgatcgaattctcatcacttgacccggatttcagcatactc

Fig. 1 has identified the amino acid that comprises per 5 Ig structural domains.Use is disclosed dna sequence dna in SEQ ID NO:4-6, and those skilled in the art can design primer, and the MAG fragment that obtains comprises 1,2,3,4 or 5 Ig structural domain.In some instances, help designing primer, calling sequence is extended in the adjacent Ig structural domain to allow appropriate secondary structure.

As the representational example of foregoing invention, segmental generation of some MAG and purifying are discussed in more detail below.DNA is amplification from IMAGE consortium clone (5194207).Can in Genbank accession number BI755065, find this clone's partial sequence.This clone comprises the corresponding total length readable sequences of amino acid no of the amino acid no that has and GenBank accession number P20916 (SEQ ID NO:1).In order to make up MAG (1-5) carrier,, be fused on the 6His-FLAG flag sequence and use the XbaI/EcoRI site to be connected with pTMEDL (Chinese hamster ovary celI and COS fibrocyte expression vector) with pED6 with the DNA cloning of coding 1-516 position residue.In order to make up the expression vector of MAG (1-3), to the encode DNA cloning of-325 amino acids (aa) residues 1, be fused on the 6His-FLAG flag sequence, and use the XbaI/EcoRI site to be connected with pTMEDL (Chinese hamster ovary celI and COS fibrocyte expression vector) with pED6.In order to make up the MAG-FL expression vector,, and use the BgIII/EcoRI site to be connected with pADORI (adenovirus carrier) with the DNA cloning of coding 1-626 position aa residue.In order to make up MAG-(1-3/TM-ICD) expression vector, the DNA of coding 1-325 position aa residue is fused to the 508-626 amino acids residue that comprises people MAG membrane spaning domain (TM) and born of the same parents' internal area (ICD), and is cloned on the BglII/EcoRI site of pADORI (adenovirus carrier).Use IMAGE consortium clone (5194207) to make up MAG-(1-3/TM-ICD) as the twice PCR amplification of template.Primer collection 1 and primer collection 2 (showing above) are with generating PCR reaction product 1 and 2.Secondly, use primer collection 3, with pcr amplification reaction mix products 1 and 2, with formation reaction product 3.Reaction product 3 usefulness BglII/EcoRI digestion, and be cloned among the pAdori1-3 that cuts with BglII/EcoRI.All MAG protein produces and uses multiple metal affinity column purifying described below by the Chinese hamster ovary celI of stable transfection.

Embodiment 2: express recombinant MAG in Chinese hamster ovary cell (CHO)

This embodiment relates to from the stable mammalian expression system of Chinese hamster ovary celI secretion MAG.

For the stably express in Chinese hamster ovary celI, (Cat#:MIR 2170 to use TransIT-CHO Transfection Kit, from Mirus Corporation Madison, WI 53719-1267, the U.S.), and with the method that test kit provided, with the transfection of Chinese hamster ovary celI carrier to the 100mm flat board, in duplicate, what described Chinese hamster ovary celI carrier comprised that embodiment 1 described in detail has merged people MAG fragment MAG (1-3) (the 1-325 amino acids of His6 and FLAG mark at the C end, SEQID NO:2) and MAG (1-5) (1-516 amino acids, SEQ ID NO:3).With the MAG-TMED plasmid transfection Chinese hamster ovary celI that comprises selected marker (DHFR gene).Methotrexate is joined in the substratum to select the Chinese hamster ovary celI of transfection.In contrast, also transfection do not insert segmental carrier.

After transfection in 24 hours, MAG cells transfected and carrier cells transfected are assigned in 6 100mm flat boards from bipartite 100mm flat board.Hot deactivation FBS (Gibco with Alpha substratum (Wyeth)+10% dialysis, U.S. Cat#:26400-044) and penicillin-Streptomycin sulphate (PenStrep Gibco U.S. cat#:15070-063)/L-glutaminate (the Gibco U.S. cat#25030-140) cultivates.Per two dull and stereotyped alternative medicine methotrexate (MTX, Sigma, GA, U.S. that add different concns; Cat#:M9929): 20nM (MTX), or 50nM (MTX), or 100nM (MTX).Dull and stereotyped at 37 ℃, 5%CO ₂Under hatch.When the clone forms and seems enough big and healthy (about 2 weeks), the clone that picking is independent and putting it in 96 orifice plates of the 50nM MTX selective medium that contains 150 μ l transfers in 24 orifice plates wherein 25 μ l as viable cell storage (bank).The carrier cells transfected does not form the clone in the selective medium of different concns, and perhaps in 100nM MTX substratum, the MAG cells transfected does not form the clone.

Cell cultures in 96 orifice plates to approximately converging, was transferred in the R5 CD1 substratum (Wyeth) that does not add serum in results then in preceding 48 hours.With conditioned medium (CM) electrophoresis on the 4%-20%SDS gel, and with anti-MAG antibody (the anti-MAG of Cat#:sc-15324 rabbit (H-300) the polyclonal antibody Santa Cruz Biotechnology U.S.) by the Western engram analysis to select the more clone of high expression level.To assign in the 100nMMTX selective medium from the selected clone of 24 orifice plate cell storages, cultivate approximately and converge, transferred in preceding 48 hours in the R5 CD1 substratum that does not add serum in results then.With CM electrophoresis and analyze once more by the Western trace on the 4%-20%SDS gel with anti-MAG antibody.Selection is secreted more a large amount protein, health and growth and is cloned as stable cell lines faster.Selected stable cell lines remains in the FBS alpha substratum and PenStrep/Glutamine of 100nMMTX and 10% dialysis.

Embodiment 3:MAG protein and segmental purifying

Behind Chinese hamster ovary celI results conditioned medium, the filter of substratum by 0.2 μ M can be filtered and interpolation NaAzide to 0.01%.About the pH regulator to 8.0 of 2M Tris with conditioned medium with pH8.5, and the nickel post of the HPLC that packs into (Ni-NTA, Qiagen, CA) or cobalt post (TALON ^TM, BD Biosciences Clontech, Canada) on, flow velocity is 2-4ml/ minute.The washing pillar, and used following gradient elution bonded protein down at flow velocity 8ml/ minute: 100% buffer B of the 0-10% buffer B of 1.5 column volumes (cv), 50% buffer B of 0.1cv, 5cv, wherein buffer A is 300mM NaCl, 50mM Na ₂HPO ₄, pH8.0, and buffer B is 500mM imidazoles A, 300mM NaCl, 50mM Na ₂HPO ₄, pH8.0.The TALON of MAG1-5 ^TMShow that with the purifying chromatography spectrogram of Ni-NTA column purification branch is shown in Fig. 2 A and 2B.SDS PAGE is used for assessing the proteinic purity of wash-out.Fig. 3 has shown from TALON ^TMAdvantage band with the MAG1-3 of purifying in the Ni-NTA column purification.SDS PAGE has proved that the MAG1-5 of purifying has only a main band.

Determined that by other features the purity of MAG (1-5) and MAG (1-3), described feature comprise the order-checking of N end, Western engram analysis, LC/MS, size exclusion chromatography (SEC), isoelectrofocusing (IEF) and UV analysis.SEC has determined purity＞96% of the MAG (1-5) of purifying.LC/MS determines that CHO protein is the main contaminating protein matter of the MAG (1-3) of the MAG (1-5) of purifying and purifying.IEF finds that the PI of MAG (1-5) is 4.4, and is basic identical with the value of report.The Western trace has determined that main band and following minor band all are MAG (1-3).SEC has determined purity＞99% of MAG (1-3).

Embodiment 4:MAG protein and segmental biological assay

I) external in conjunction with measuring

To be fixed on Ni ²⁺⁺MAG on the resin separately with damping fluid incubation 1 hour or with the NgR-ecto that has 1%BSA (27-310 position residue) incubation 1 hour, and with the protein of the imidazoles elution of bound of 500mM.The also independent and Ni of NgR-ecto ²⁺⁺The resin incubation is with the non-specific binding of eliminating with affine resin.(referring to people such as Liu, the method described in the Science, 297:1190-1193 (2002)).

Ii) neurite outgrowth is measured

For the MAG and the segmental restraining effect of MAG of testing purifying, isolating neurone is placed on (the MAG fragment of purifying or Fc are in contrast) on the cumulative inhibition substrate of concentration.Make neure growth 4-8 hour afterwards, fix and dye, with the length of NIH image evaluation neurite outgrowth with the rhodamine phalloidin.

In other experiments, handled rat cerebellum particle neurone 24 hours with the reorganization MAG or the contrast (Fc structural domain) of 25 μ g/ml purifying.Neurone is grown on the 3T3 of individual layer cell and neurite lengths is estimated in hand computation.Fig. 5 has shown that MAG1-5 has the inhibition of about 45-50% to neurite outgrowth.Presentation of results is suppressing on the neurite outgrowth, even the MAG1-5 of use nickel post or cobalt column purification is unlike commercially available Fc-MAG (cat.no.538-MG-100, R﹠amp; D Systems, Minneapolis, MN) good, also be equally effective at least.

The segmental stability of embodiment 5:MAG and MAG

This embodiment has proved that MAG1-3 and MAG1-5 are metastable.Fig. 5 A and 6A show ,-80 ℃ behind 3 freeze-thaw cycle of room temperature, in the MAG1-3 of purifying or MAG1-5, all do not have the sign that absorbancy changes under protein instability, precipitation or the 320nm respectively.SEC analyzes and has further shown not gathering (seeing Fig. 5 B and 6B).Therefore, many freeze-thaw cycle are for the not influence of stability of MAG (1-3) and MAG (1-5).

Fig. 7 illustrates that MAG1-3 is very stable protein.The purity of MAG1-3 is not subjected to the influence of storing temp, the affine resin of metal or salt concn.Fig. 7 has shown the % purity with the MAG1-3 of SEC, and described MAG1-3 uses Ni-NTA or TALON ^TMResin is in multiple salt condition [(1): 50mM Na ₂HPO ₄, pH7.2, low NaCl (150mM); (2): 50mM Na ₂HPO ₄, pH7.2, high NaCl (500mM)] down purifying and be stored in room temperature or 4 ℃ under.

Fig. 8 A has illustrated that MAG1-5 is subjected to the faint influence of damping fluid composition and storing temp.The damping fluid that comprises imidazole buffer omits stablizing MAG1-5.Tween20 has some limited effects in keeping the stability of MAG1-5.Fig. 8 B shows after MAG1-5 at room temperature stored for 12 weeks to be increased than the gathering that is stored under 4 ℃.Fig. 8 has shown the % purity with the MAG1-5 of SEC, and described MAG1-5 uses Ni-NTA or TALON ^TMResin is in multiple buffer conditions [(1): Na-PBS:50mM Na ₂HPO ₄, 150mM NaCl, pH7.2; (2): Ni damping fluid: 50mMNa ₂HPO ₄, 300mM NaCl ,～250 imidazoles, pH8.0; (3): Na-PBS:50mMNa ₂HPO ₄, 150mM NaCl, 0.1﹠amp; Tween20, pH7.2] down purifying and be stored in room temperature or 4 ℃ under.

In a word, be the good method of purifying MAG1-3 and MAG1-5 with size exclusion chromatography (SEC) behind the metal affinity chromatography.Ni-NTA and TALON ^TMThere is not significant difference.The various features descriptive study has illustrated that two kinds of purifying types of MAG all have high purity, and MAG1-5 has high biological activity.Many freeze-thaw cycle are to the not influence of stability of MAG1-3 and MAG1-5.When under 4 ℃ or envrionment conditions, when storing in Na-PBS, MAG1-3 is stable in the time period in 12 weeks.The stability of MAG1-5 depends on condition of storage.In imidazole buffer, when being stored in 4 ℃, MAG1-5 stablized for 12 weeks at least.In Na-PBS, MAG1-5 stablized for 9 weeks at least when being stored in 4 ℃, but MAG1-5 can only stablize about 1 week when being stored in envrionment conditions.In Na-PBS/Tween20, under envrionment conditions, MAG1-5 stablized for 6 weeks.

Although the purifying illustration of the MAG that transformed host cells reorganization produces method of the present invention, this method also is applicable to the purifying of naturally occurring MAG in the cell and can be used for protein purification from solution, cell homogenates, cell culture supernatant or isolated cells subfraction.Although described the present invention, be appreciated that according to the present invention, those skilled in the art knows multiple variation and modification according to concrete method and composition.

Only be to use normal experiment, those skilled in the art will recognize of the present invention more feature and the advantage that maybe can determine based on above-mentioned embodiment.Therefore, illustrated except appended claim, the aspect that has specified and described does not limit the present invention.All publications and reference are definitely quoted as a reference with it in full at this.

Sequence table

＜110〉Wyeth

＜120〉composition and the method for purifying myelin-associated glycoprotein white (MAG)

<130>102729-30

<140>PCT/US2005/024830

<141>2005-07-13

<150>US?60/587,893

<151>2004-07-14

<150>US?60/588,239

<151>2004-07-15

<160>18

＜170〉PatentIn version 3 .2

<210>1

<211>626

<212>PRT

＜213〉people (Homo sapiens)

<400>1

Met?Ile?Phe?Leu?Thr?Ala?Leu?Pro?Leu?Phe?Trp?Ile?Met?Ile?Ser?Ala

1 5 10 15

Ser?Arg?Gly?Gly?His?Trp?Gly?Ala?Trp?Met?Pro?Ser?Ser?Ile?Ser?Ala

20 25 30

Phe?Glu?Gly?Thr?Cys?Val?Ser?Ile?Pro?Cys?Arg?Phe?Asp?Phe?Pro?Asp

35 40 45

Glu?Leu?Arg?Pro?Ala?Val?Val?His?Gly?Val?Trp?Tyr?Phe?Asn?Ser?Pro

50 55 60

Tyr?Pro?Lys?Asn?Tyr?Pro?Pro?Val?Val?Phe?Lys?Ser?Arg?Thr?Gln?Val

65 70 75 80

Val?His?Glu?Ser?Phe?Gln?Gly?Arg?Ser?Arg?Leu?Leu?Gly?Asp?Leu?Gly

85 90 95

Leu?Arg?Asn?Cys?Thr?Leu?Leu?Leu?Ser?Ash?Val?Ser?Pro?Glu?Leu?Gly

100 105 110

Gly?Lys?Tyr?Tyr?Phe?Arg?Gly?Asp?Leu?Gly?Gly?Tyr?Asn?Gln?Tyr?Thr

115 120 125

Phe?Ser?Glu?His?Ser?Val?Leu?Asp?Ile?Val?Asn?Thr?Pro?Asn?Ile?Val

130 135 140

Val?Pro?Pro?Glu?Val?Val?Ala?Gly?Thr?Glu?Val?Glu?Val?Ser?Cys?Met

145 150 155 160

Val?Pro?Asp?Asn?Cys?Pro?Glu?Leu?Arg?Pro?Glu?Leu?Ser?Trp?Leu?Gly

165 170 175

His?Glu?Gly?Leu?Gly?Glu?Pro?Ala?Val?Leu?Gly?Arg?Leu?Arg?Glu?Asp

180 185 190

Glu?Gly?Thr?Trp?Val?Gln?Val?Ser?Leu?Leu?His?Phe?Val?Pro?Thr?Arg

195 200 205

Glu?Ala?Asn?Gly?His?Arg?Leu?Gly?Cys?Gln?Ala?Ser?Phe?Pro?Asn?Thr

210 215 220

Thr?Leu?Gln?Phe?Glu?Gly?Tyr?Ala?Ser?Met?Asp?Val?Lys?Tyr?Pro?Pro

225 230 235 240

Val?Ile?Val?Glu?Met?Asn?Ser?Ser?Val?Glu?Ala?Ile?Glu?Gly?Ser?His

245 250 255

Val?Ser?Leu?Leu?Cys?Gly?Ala?Asp?Ser?Asn?Pro?Pro?Pro?Leu?Leu?Thr

260 265 270

Trp?Met?Arg?Asp?Gly?Thr?Val?Leu?Arg?Glu?Ala?Val?Ala?Glu?Ser?Leu

275 280 285

Leu?Leu?Glu?Leu?Glu?Glu?Val?Thr?Pro?Ala?Glu?Asp?Gly?Val?Tyr?Ala

290 295 300

Cys?Leu?Ala?Glu?Asn?Ala?Tyr?Gly?Gln?Asp?Asn?Arg?Thr?Val?Gly?Leu

305 310 315 320

Ser?Val?Met?Tyr?Ala?Pro?Trp?Lys?Pro?Thr?Val?Asn?Gly?Thr?Met?Val

325 330 335

Ala?Val?Glu?Gly?Glu?Thr?Val?Ser?Ile?Leu?Cys?Ser?Thr?Gln?Ser?Asn

340 345 350

Pro?Asp?Pro?Ile?Leu?Thr?Ile?Phe?Lys?Glu?Lys?Gln?Ile?Leu?Ser?Thr

355 360 365

Val?Ile?Tyr?Glu?Ser?Glu?Leu?Gln?Leu?Glu?Leu?Pro?Ala?Val?Ser?Pro

370 375 380

Glu?Asp?Asp?Gly?Glu?Tyr?Trp?Cys?Val?Ala?Glu?Asn?Gln?Tyr?Gly?Gln

385 390 395 400

Arg?Ala?Thr?Ala?Phe?Asn?Leu?Ser?Val?Glu?Phe?Ala?Pro?Val?Leu?Leu

405 410 415

Leu?Glu?Ser?His?Cys?Ala?Ala?Ala?Arg?Asp?Thr?Val?Gln?Cys?Leu?Cys

420 425 430

Val?Val?Lys?Ser?Asn?Pro?Glu?Pro?Ser?Val?Ala?Phe?Glu?Leu?Pro?Ser

435 440 445

Arg?Asn?Val?Thr?Val?Asn?Glu?Ser?Glu?Arg?Glu?Phe?Val?Tyr?Ser?Glu

450 455 460

Arg?Ser?Gly?Leu?Val?Leu?Thr?Ser?Ile?Leu?Thr?Leu?Arg?Gly?Gln?Ala

465 470 475 480

Gln?Ala?Pro?Pro?Arg?Val?Ile?Cys?Thr?Ala?Arg?Asn?Leu?Tyr?Gly?Ala

485 490 495

Lys?Ser?Leu?Glu?Leu?Pro?Phe?Gln?Gly?Ala?His?Arg?Leu?Met?Trp?Ala

500 505 510

Lys?Ile?Gly?Pro?Val?Gly?Ala?Val?Val?Ala?Phe?Ala?Ile?Leu?Ile?Ala

515 520 525

Ile?Val?Cys?Tyr?Ile?Thr?Gln?Thr?Arg?Arg?Lys?Lys?Asn?Val?Thr?Glu

530 535 540

Ser?Pro?Ser?Phe?Ser?Ala?Gly?Asp?Asn?Pro?Pro?Val?Leu?Phe?Ser?Ser

545 550 555 560

Asp?Phe?Arg?Ile?Ser?Gly?Ala?Pro?Glu?Lys?Tyr?Glu?Ser?Glu?Arg?Arg

565 570 575

Leu?Gly?Ser?Glu?Arg?Arg?Leu?Leu?Gly?Leu?Arg?Gly?Glu?Pro?Pro?Glu

580 585 590

Leu?Asp?Leu?Ser?Tyr?Ser?His?Ser?Asp?Leu?Gly?Lys?Arg?Pro?Thr?Lys

595 600 605

Asp?Ser?Tyr?Thr?Leu?Thr?Glu?Glu?Leu?Ala?Glu?Tyr?Ala?Glu?Ile?Arg

610 615 620

Val?Lys

625

<210>2

<211>531

<212>PRT

＜213〉people

<400>2

Met?Ile?Phe?Leu?Thr?Ala?Leu?Pro?Leu?Phe?Trp?Ile?Met?Ile?Ser?Ala

1 5 10 15

Ser?Arg?Gly?Gly?His?Trp?Gly?Ala?Trp?Met?Pro?Ser?Ser?Ile?Ser?Ala

20 25 30

Phe?Glu?Gly?Thr?Cys?Val?Ser?Ile?Pro?Cys?Arg?Phe?Asp?Phe?Pro?Asp

35 40 45

Glu?Leu?Arg?Pro?Ala?Val?Val?His?Gly?Val?Trp?Tyr?Phe?Asn?Ser?Pro

50 55 60

Tyr?Pro?Lys?Asn?Tyr?Pro?Pro?Val?Val?Phe?Lys?Ser?Arg?Thr?Gln?Val

65 70 75 80

Val?His?Glu?Ser?Phe?Gln?Gly?Arg?Ser?Arg?Leu?Leu?Gly?Asp?Leu?Gly

85 90 95

Leu?Arg?Asn?Cys?Thr?Leu?Leu?Leu?Ser?Asn?Val?Ser?Pro?Glu?Leu?Gly

100 105 110

Gly?Lys?Tyr?Tyr?Phe?Arg?Gly?Asp?Leu?Gly?Gly?Tyr?Asn?Gln?Tyr?Thr

115 120 125

Phe?Ser?Glu?His?Ser?Val?Leu?Asp?Ile?Val?Asn?Thr?Pro?Asn?Ile?Val

130 135 140

Val?Pro?Pro?Glu?Val?Val?Ala?Gly?Thr?Glu?Val?Glu?Val?Ser?Cys?Met

145 150 155 160

Val?Pro?Asp?Asn?Cys?Pro?Glu?Leu?Arg?Pro?Glu?Leu?Ser?Trp?Leu?Gly

165 170 175

His?Glu?Gly?Leu?Gly?Glu?Pro?Ala?Val?Leu?Gly?Arg?Leu?Arg?Glu?Asp

180 185 190

Glu?Gly?Thr?Trp?Val?Gln?Val?Ser?Leu?Leu?His?Phe?Val?Pro?Thr?Arg

195 200 205

Glu?Ala?Asn?Gly?His?Arg?Leu?Gly?Cys?Gln?Ala?Ser?Phe?Pro?Asn?Thr

210 215 220

Thr?Leu?Gln?Phe?Glu?Gly?Tyr?Ala?Ser?Met?Asp?Val?Lys?Tyr?Pro?Pro

225 230 235 240

Val?Ile?Val?Glu?Met?Asn?Ser?Ser?Val?Glu?Ala?Ile?Glu?Gly?Ser?His

245 250 255

Val?Ser?Leu?Leu?Cys?Gly?Ala?Asp?Ser?Asn?Pro?Pro?Pro?Leu?Leu?Thr

260 265 270

Trp?Met?Arg?Asp?Gly?Thr?Val?Leu?Arg?Glu?Ala?Val?Ala?Glu?Ser?Leu

275 280 285

Leu?Leu?Glu?Leu?Glu?Glu?Val?Thr?Pro?Ala?Glu?Asp?Gly?Val?Tyr?Ala

290 295 300

Cys?Leu?Ala?Glu?Asn?Ala?Tyr?Gly?Gln?Asp?Asn?Arg?Thr?Val?Gly?Leu

305 310 315 320

Ser?Val?Met?Tyr?Ala?Pro?Trp?Lys?Pro?Thr?Val?Asn?Gly?Thr?Met?Val

325 330 335

Ala?Val?Glu?Gly?Glu?Thr?Val?Ser?Ile?Leu?Cys?Ser?Thr?Gln?Ser?Asn

340 345 350

Pro?Asp?Pro?Ile?Leu?Thr?Ile?Phe?Lys?Glu?Lys?Gln?Ile?Leu?Ser?Thr

355 360 365

Val?Ile?Tyr?Glu?Ser?Glu?Leu?Gln?Leu?Glu?Leu?Pro?Ala?Val?Ser?Pro

370 375 380

Glu?Asp?Asp?Gly?Glu?Tyr?Trp?Cys?Val?Ala?Glu?Asn?Gln?Tyr?Gly?Gln

385 390 395 400

Arg?Ala?Thr?Ala?Phe?Asn?Leu?Ser?Val?Glu?Phe?Ala?Pro?Val?Leu?Leu

405 410 415

Leu?Glu?Ser?His?Cys?Ala?Ala?Ala?Arg?Asp?Thr?Val?Gln?Cys?Leu?Cys

420 425 430

Val?Val?Lys?Ser?Asn?Pro?Glu?Pro?Ser?Val?Ala?Phe?Glu?Leu?Pro?Ser

435 440 445

Arg?Asn?Val?Thr?Val?Asn?Glu?Ser?Glu?Arg?Glu?Phe?Val?Tyr?Ser?Glu

450 455 460

Arg?Ser?Gly?Leu?Val?Leu?Thr?Ser?Ile?Leu?Thr?Leu?Arg?Gly?Gln?Ala

465 470 475 480

Gln?Ala?Pro?Pro?Arg?Val?Ile?Cys?Thr?Ala?Arg?Asn?Leu?Tyr?Gly?Ala

485 490 495

Lys?Ser?Leu?Glu?Leu?Pro?Phe?Gln?Gly?Ala?His?Arg?Leu?Met?Trp?Ala

500 505 510

Lys?Ile?Gly?Pro?His?His?His?His?His?His?Asp?Tyr?Lys?Asp?Asp?Asp

515 520 525

Asp?Lys?Ile

530

<210>3

<211>340

<212>PRT

＜213〉people

<400>3

Met?Ile?Phe?Leu?Thr?Ala?Leu?Pro?Leu?Phe?Trp?Ile?Met?Ile?Ser?Ala

1 5 10 15

Ser?Arg?Gly?Gly?His?Trp?Gly?Ala?Trp?Met?Pro?Ser?Ser?Ile?Ser?Ala

20 25 30

Phe?Glu?Gly?Thr?Cys?Val?Ser?Ile?Pro?Cys?Arg?Phe?Asp?Phe?Pro?Asp

35 40 45

Glu?Leu?Arg?Pro?Ala?Val?Val?His?Gly?Val?Trp?Tyr?Phe?Asn?Ser?Pro

50 55 60

Tyr?Pro?Lys?Asn?Tyr?Pro?Pro?Val?Val?Phe?Lys?Ser?Arg?Thr?Gln?Val

65 70 75 80

Val?His?Glu?Ser?Phe?Gln?Gly?Arg?Ser?Arg?Leu?Leu?Gly?Asp?Leu?Gly

85 90 95

Leu?Arg?Asn?Cys?Thr?Leu?Leu?Leu?Ser?Asn?Val?Ser?Pro?Glu?Leu?Gly

100 105 110

Gly?Lys?Tyr?Tyr?Phe?Arg?Gly?Asp?Leu?Gly?Gly?Tyr?Asn?Gln?Tyr?Thr

115 120 125

Phe?Ser?Glu?His?Ser?Val?Leu?Asp?Ile?Val?Asn?Thr?Pro?Asn?Ile?Val

130 135 140

Val?Pro?Pro?Glu?Val?Val?Ala?Gly?Thr?Glu?Val?Glu?Val?Ser?Cys?Met

145 150 155 160

Val?Pro?Asp?Asn?Cys?Pro?Glu?Leu?Arg?Pro?Glu?Leu?Ser?Trp?Leu?Gly

165 170 175

His?Glu?Gly?Leu?Gly?Glu?Pro?Ala?Val?Leu?Gly?Arg?Leu?Arg?Glu?Asp

180 185 190

Glu?Gly?Thr?Trp?Val?Gln?Val?Ser?Leu?Leu?His?Phe?Val?Pro?Thr?Arg

195 200 205

Glu?Ala?Asn?Gly?His?Arg?Leu?Gly?Cys?Gln?Ala?Ser?Phe?Pro?Asn?Thr

210 215 220

Thr?Leu?Gln?Phe?Glu?Gly?Tyr?Ala?Ser?Met?Asp?Val?Lys?Tyr?Pro?Pro

225 230 235 240

Val?Ile?Val?Glu?Met?Asn?Ser?Ser?Val?Glu?Ala?Ile?Glu?Gly?Ser?His

245 250 255

Val?Ser?Leu?Leu?Cys?Gly?Ala?Asp?Ser?Asn?Pro?Pro?Pro?Leu?Leu?Thr

260 265 270

Trp?Met?Arg?Asp?Gly?Thr?Val?Leu?Arg?Glu?Ala?Val?Ala?Glu?Ser?Leu

275 280 285

Leu?Leu?Glu?Leu?Glu?Glu?Val?Thr?Pro?Ala?Glu?Asp?Gly?Val?Tyr?Ala

290 295 300

Cys?Leu?Ala?Glu?Asn?Ala?Tyr?Gly?Gln?Asp?Asn?Arg?Thr?Val?Gly?Leu

305 310 315 320

Ser?Val?Met?Tyr?Ala?His?His?His?His?His?His?Asp?Tyr?Lys?Asp?Asp

325 330 335

Asp?Asp?Lys?Ile

340

<210>4

<211>1878

<212>DNA

＜213〉people

<400>4

atgatattcc?tcacggcact?gcctctgttc?tggattatga?tttcagcctc?ccgagggggt 60

cactggggtg?cctggatgcc?ctcgtccatc?tcggccttcg?aaggcacgtg?cgtctccatc 120

ccctgccgct?ttgacttccc?ggatgagctg?cggcccgctg?tggtgcatgg?tgtctggtac 180

ttcaatagcc?cctaccccaa?gaactacccc?ccggtggtct?tcaagtcgcg?cacccaagta 240

gtccacgaga?gcttccaggg?ccgcagccgc?ctcctggggg?acctgggcct?gcgaaactgc 300

accctcctgc?tcagcaacgt?cagccccgag?ctgggcggga?agtactactt?ccgtggggac 360

ctgggcggct?acaaccagta?caccttctca?gagcacagcg?tcctggatat?cgtcaacacc 420

cccaacatcg?tggtgccccc?agaggtggtg?gcaggcacgg?aagtggaggt?cagctgcatg 480

gtgccggaca?actgcccaga?gctgcgccct?gagctgagct?ggctgggcca?cgaggggctg 540

ggggagcccg?ctgtgctggg?ccggctgcgg?gaggacgagg?gcacctgggt?gcaggtgtca 600

ctgctgcact?tcgtgcccac?gagggaggcc?aacggccaca?ggctgggctg?ccaggcctcc 660

ttccccaaca?ccaccctgca?gttcgagggc?tacgccagca?tggacgtcaa?gtaccccccg 720

gtgattgtgg?agatgaactc?ctcggtggag?gccatcgagg?gctcccacgt?gagcctgctc 780

tgtggggctg?acagcaaccc?cccgccgctg?ctgacctgga?tgcgggacgg?gacagtcctc 840

cgggaggcgg?tggccgagag?cctgctcctg?gagctggagg?aggtgacccc?cgccgaagac 900

ggcgtctatg?cctgcctggc?cgagaatgcc?tatggccagg?acaaccgcac?cgtggggctc 960

agtgtcatgt?atgcaccctg?gaagccaaca?gtgaacggga?caatggtggc?cgtagagggg 1020

gagacggtct?ctatcttgtg?ctccacacag?agcaacccgg?accctattct?caccatcttc 1080

aaggagaagc?agatcctgtc?cacggtcatc?tacgagagcg?agctgcagct?ggagctgccg 1140

gccgtgtcac?ccgaggatga?tggagagtac?tggtgtgtgg?ctgagaacca?gtatggccag 1200

agggccaccg?ccttcaacct?gtctgtggag?ttcgcccctg?tgctcctcct?ggagtcccac 1260

tgcgcggcag?cccgagacac?ggtgcagtgc?ctgtgcgtgg?tgaagtccaa?cccggagccg 1320

tccgtggcct?ttgagctgcc?atcgcgcaat?gtgaccgtga?acgagagcga?gcgggagttc 1380

gtgtactcgg?agcgcagcgg?cctcgtgctc?accagcatcc?tcacgctgcg?ggggcaggcc 1440

caggccccgc?cccgcgtcat?ctgcaccgcg?aggaacctct?atggcgccaa?gagcctggag 1500

ctgcccttcc?agggagccca?tcgactgatg?tgggccaaga?tcgggcctgt?gggcgccgtg 1560

gtcgcctttg?ccatcctgat?tgccatcgtc?tgctacatta?cccagacacg?caggaaaaag 1620

aacgtgacag?agagccccag?cttctcggca?ggggacaacc?ctcccgtcct?gttcagcagc 1680

gacttccgca?tctctggggc?accagagaag?tacgagagcg?agaggcgcct?gggatctgag 1740

aggaggctgc?tgggccttcg?gggtgagccc?ccagagctgg?acctgagcta?ttctcactcg 1800

gacctgggga?aacggcccac?caaggacagc?tacacgctga?cggaggagct?agctgagtat 1860

gctgaaatcc?gggtcaag 1878

<210>5

<211>1593

<212>DNA

＜213〉people

<400>5

atgatattcc?tcacggcact?gcctctgttc?tggattatga?tttcagcctc?ccgagggggt 60

cactggggtg?cctggatgcc?ctcgtccatc?tcggccttcg?aaggcacgtg?cgtctccatc 120

ccctgccgct?ttgacttccc?ggatgagctg?cggcccgctg?tggtgcatgg?tgtctggtac 180

ttcaatagcc?cctaccccaa?gaactacccc?ccggtggtct?tcaagtcgcg?cacccaagta 240

gtccacgaga?gcttccaggg?ccgcagccgc?ctcctggggg?acctgggcct?gcgaaactgc 300

accctcctgc?tcagcaacgt?cagccccgag?ctgggcggga?agtactactt?ccgtggggac 360

ctgggcggct?acaaccagta?caccttctca?gagcacagcg?tcctggatat?cgtcaacacc 420

cccaacatcg?tggtgccccc?agaggtggtg?gcaggcacgg?aagtggaggt?cagctgcatg 480

gtgccggaca?actgcccaga?gctgcgccct?gagctgagct?ggctgggcca?cgaggggctg 540

ggggagcccg?ctgtgctggg?ccggctgcgg?gaggacgagg?gcacctgggt?gcaggtgtca 600

ctgctgcact?tcgtgcccac?gagggaggcc?aacggccaca?ggctgggctg?ccaggcctcc 660

ttccccaaca?ccaccctgca?gttcgagggc?tacgccagca?tggacgtcaa?gtaccccccg 720

gtgattgtgg?agatgaactc?ctcggtggag?gccatcgagg?gctcccacgt?gagcctgctc 780

tgtggggctg?acagcaaccc?cccgccgctg?ctgacctgga?tgcgggacgg?gacagtcctc 840

cgggaggcgg?tggccgagag?cctgctcctg?gagctggagg?aggtgacccc?cgccgaagac 900

ggcgtctatg?cctgcctggc?cgagaatgcc?tatggccagg?acaaccgcac?cgtggggctc 960

agtgtcatgt?atgcaccctg?gaagccaaca?gtgaacggga?caatggtggc?cgtagagggg 1020

gagacggtct?ctatcttgtg?ctccacacag?agcaacccgg?accctattct?caccatcttc 1080

aaggagaagc?agatcctgtc?cacggtcatc?tacgagagcg?agctgcagct?ggagctgccg 1140

gccgtgtcac?ccgaggatga?tggagagtac?tggtgtgtgg?ctgagaacca?gtatggccag 1200

agggccaccg?ccttcaacct?gtctgtggag?ttcgcccctg?tgctcctcct?ggagtcccac 1260

tgcgcggcag?cccgagacac?ggtgcagtgc?ctgtgcgtgg?tgaagtccaa?cccggagccg 1320

tccgtggcct?ttgagctgcc?atcgcgcaat?gtgaccgtga?acgagagcga?gcgggagttc 1380

gtgtactcgg?agcgcagcgg?cctcgtgctc?accagcatcc?tcacgctgcg?ggggcaggcc 1440

caggccccgc?cccgcgtcat?ctgcaccgcg?aggaacctct?atggcgccaa?gagcctggag 1500

ctgcccttcc?agggagccca?tcgactgatg?tgggccaaga?tcgggcctca?tcaccatcat 1560

caccatgatt?acaaggatga?cgacgataag?atc 1593

<210>6

<211>1020

<212>DNA

＜213〉people

<400>6

atgatattcc?tcacggcact?gcctctgttc?tggattatga?tttcagcctc?ccgagggggt 60

cactggggtg?cctggatgcc?ctcgtccatc?tcggccttcg?aaggcacgtg?cgtctccatc 120

ccctgccgct?ttgacttccc?ggatgagctg?cggcccgctg?tggtgcatgg?tgtctggtac 180

ttcaatagcc?cctaccccaa?gaactacccc?ccggtggtct?tcaagtcgcg?cacccaagta 240

gtccacgaga?gcttccaggg?ccgcagccgc?ctcctggggg?acctgggcct?gcgaaactgc 300

accctcctgc?tcagcaacgt?cagccccgag?ctgggcggga?agtactactt?ccgtggggac 360

ctgggcggct?acaaccagta?caccttctca?gagcacagcg?tcctggatat?cgtcaacacc 420

cccaacatcg?tggtgccccc?agaggtggtg?gcaggcacgg?aagtggaggt?cagctgcatg 480

gtgccggaca?actgcccaga?gctgcgccct?gagctgagct?ggctgggcca?cgaggggctg 540

ggggagcccg?ctgtgctggg?ccggctgcgg?gaggacgagg?gcacctgggt?gcaggtgtca 600

ctgctgcact?tcgtgcccac?gagggaggcc?aacggccaca?ggctgggctg?ccaggcctcc 660

ttccccaaca?ccaccctgca?gttcgagggc?tacgccagca?tggacgtcaa?gtaccccccg 720

gtgattgtgg?agatgaactc?ctcggtggag?gccatcgagg?gctcccacgt?gagcctgctc 780

tgtggggctg?acagcaaccc?cccgccgctg?ctgacctgga?tgcgggacgg?gacagtcctc 840

cgggaggcgg?tggccgagag?cctgctcctg?gagctggagg?aggtgacccc?cgccgaagac 900

ggcgtctatg?cctgcctggc?cgagaatgcc?tatggccagg?acaaccgcac?cgtggggctc 960

agtgtcatgt?atgcacatca?ccatcatcac?catgattaca?aggatgacga?cgataagatc 1020

<210>7

<211>40

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>7

gatcgatcag?atctgccgcc?atgatattcc?tcacggcact 40

<210>8

<211>45

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>8

tagtactaga?attctcatca?cttgacccgg?atttcagcat?actca 45

<210>9

<211>40

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>9

gatcgatctc?tagagccgcc?atgatattcc?tcacggcact 40

<210>10

<211>86

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>10

tagtactaga?attctcatca?gatcttatcg?tcgtcatcct?tgtaatcatg?gtgatgatgg 60

tgatgaggcc?cgatcttggc?ccacat 86

<210>11

<211>40

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>11

gatcgatctc?tagagccgcc?atgatattcc?tcacggcact 40

<210>12

<211>86

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>12

tagtactaga?attctcatca?gatcttatcg?tcgtcatcct?tgtaatcatg?gtgatgatgg 60

tgatgtgcat?acatgacact?gagccc 86

<210>13

<211>27

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>13

tcagcgatca?ctcactcgct?gtacaga 27

<210>14

<211>51

<212>DNA

＜213〉artificial

<220>

＜223〉artificial constructed thing

<400>14

aggcccgatc?ttggcccaca?tcagtcgtgc?atacatgaca?ctgagcccca?c 51

<210>15

<211>46

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>15

ggggctcagt?gtcatgtatg?cacgactgat?gtgggccaag?atcggg 46

<210>16

<211>31

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>16

gggtcagcca?cgcaggctgc?ccccagctcc?t 31

<210>17

<211>40

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>17

gatcgatcag?atctgccgcc?atgatattcc?tcacggcact 40

<210>18

<211>44

<212>DNA

＜213〉artificial

<220>

＜223〉synthetic construction

<400>18

gatcgatcga?attctcatca?cttgacccgg?atttcagcat?actc 44

Claims (37)

1. the method for extracellular domain myelin associated glucoprotein (MAG) construct of a purification of Recombinant, it may further comprise the steps:

Use the carrier transfectional cell, described carrier has the nucleotide sequence of the MAG construct of coding affinity labelling, and can express the described MAG construct that comprises the affinity labelling of at least one Ig structural domain;

In substratum, cultivate described cells transfected, so that the MAG construct of described cell expressing affinity labelling;

Make the conditioned medium contact that contains the MAG construct make its charged metal ion affinity chromatography resin with divalent-metal ion; And

The affinity labelling MAG construct of wash-out purifying.

2. the process of claim 1 wherein that the step of described transfectional cell further comprises transfection Chinese hamster ovary cell (CHO).

3. the process of claim 1 wherein that described method further comprises stable transfected cells.

4. the process of claim 1 wherein that described method further comprises the resin of selecting to have at least a divalent-metal ion, described divalent-metal ion is selected from nickel, cobalt, copper, cadmium, calcium, iron, zinc and strontium.

5. the method for claim 4, wherein said divalent-metal ion is a nickel.

6. the method for claim 4, wherein said divalent-metal ion is a cobalt.

7. the process of claim 1 wherein that described method further comprises from nickel-nitrilotriacetic acid(NTA) resin or TALON ^TMSelect resin in the resin.

8. the process of claim 1 wherein that described method comprises that further expression has the affinity labelling MAG of polyhistidyl tail.

9. the process of claim 1 wherein that described method comprises that further the express amino acid sequence is the affinity labelling MAG of the FLAG mark of DYKDDDDK.

10. the process of claim 1 wherein that the step of described cultivation transfectional cell comprises that further expression comprises the affinity labelling MAG of 2 Ig structural domains at least.

11. the process of claim 1 wherein that the step of described cultivation transfectional cell comprises that further expression comprises the affinity labelling MAG of 3 Ig structural domains at least.

12. the process of claim 1 wherein that the step of described cultivation transfectional cell comprises that further expression comprises the affinity labelling MAG of 4 Ig structural domains at least.

13. the process of claim 1 wherein that the step of described cultivation transfectional cell further comprises the glycosylated MAG of expression.

14. the process of claim 1 wherein that the step of described cultivation transfectional cell is included in further that culturing cell changes in the serum free medium then to converging in the substratum that contains FBS.

15. the process of claim 1 wherein that the step of described cultivation transfectional cell further is included in culturing cell in the substratum that contains methotrexate.

16. the process of claim 1 wherein that the step of affinity labelling MAG of described wash-out purifying further comprises changes at least a in pH, sequestrant and the competitive part.

17. the method for claim 16 is an ethylenediamine tetraacetic acid (EDTA) greater than the described sequestrant in 7 the elute soln at pH approximately wherein.

18. the method for claim 16, wherein said competitive part is an imidazoles.

19. the process of claim 1 wherein that described method further is included in contains Na ₂PO ₄, NaCl and pH be approximately greater than the affinity labelling MAG that stores purifying in 7 the damping fluid.

20. the method for claim 19, wherein said method further are included in the affinity labelling MAG that stores purifying in the damping fluid that contains imidazoles.

21. the method for claim 19, wherein said method further are included in the affinity labelling MAG that stores purifying in the damping fluid that contains stain remover.

22. the method for claim 19, wherein said method further are included in the affinity labelling MAG that stores purifying in the damping fluid that contains the 0.1%Tween20 that has an appointment.

23. a purifying, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, it is with the method preparation that comprises the following step:

Cultivate cells transfected, so that the MAG construct of described cell expressing affinity labelling;

Make the conditioned medium contact that contains the MAG construct make its charged metal ion affinity chromatography resin with divalent-metal ion; And

The affinity labelling MAG construct of wash-out purifying, the affinity labelling MAG construct purity of the purifying of wherein said wash-out is greater than 90%.

24. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, wherein said cells transfected is the Chinese hamster ovary cell (CHO) of transfection.

25. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, the step of the affinity labelling MAG construct of wherein said wash-out purifying further comprises the affinity labelling MAG construct of wash-out purity greater than 95% purifying.

26. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, wherein said MAG construct comprise with at the basic homologous aminoacid sequence of aminoacid sequence described in the SEQ ID NO:2.

27. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, wherein said MAG construct comprise with at the basic homologous aminoacid sequence of aminoacid sequence described in the SEQ ID NO:3.

28. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, wherein said MAG construct comprises at least two N-and connects glycosylation sites.

29. the purifying of claim 23, glycosylated human reorganization extracellular domain myelin associated glucoprotein (MAG) construct, wherein said MAG construct comprises the carbohydrate of 5wt% at least.

30. produce the method for extracellular domain myelin associated glucoprotein (MAG), it comprises:

Make the substratum contact that contains MAG make its charged immobilized metal affinity chromatography (IMAC) resin with divalent-metal ion;

With at least a IMAC washing soln washing IMAC resin; And

With elute soln wash-out IMAC resin to obtain the MAG solution of purifying.

31. further comprising from nickel, cobalt, copper, iron, calcium and zinc, the method for claim 30, wherein said method select divalent-metal ion.

32. the method for claim 31, wherein said divalent-metal ion is a nickel.

33. the method for claim 31, wherein said divalent-metal ion is a cobalt.

34. the method for claim 30, wherein said method further may further comprise the steps: cultivate cells transfected to converging, so that described cell expressing comprises the MAG construct of an Ig structural domain at least in the substratum that contains have an appointment 10%FBS and about 100nM methotrexate.

35. the method for claim 30, the MAG solution of wherein said purifying comprises the MAG of affinity labelling.

36. the method for claim 30, the MAG solution of wherein said purifying comprises the MAG with polyhistidyl tail.

37. the method for claim 30, the MAG solution of wherein said purifying comprises the MAG with FLAG mark.

Images