CN1984920A - Adapter therapeutics useful in ocular pharmacotherapy - Google Patents

Adapter therapeutics useful in ocular pharmacotherapy Download PDF

Info

Publication number
CN1984920A
CN1984920A CN 200480004842 CN200480004842A CN1984920A CN 1984920 A CN1984920 A CN 1984920A CN 200480004842 CN200480004842 CN 200480004842 CN 200480004842 A CN200480004842 A CN 200480004842A CN 1984920 A CN1984920 A CN 1984920A
Authority
CN
China
Prior art keywords
composition
fit
suitable body
target molecule
peg
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200480004842
Other languages
Chinese (zh)
Inventor
大卫·爱泼斯坦
迪拉尔·格拉特
杰弗里·库尔兹
尼古拉斯·玛莎
托马斯·G·卡尤利
查尔斯·威尔逊
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Archemix Corp
Original Assignee
Archemix Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Archemix Corp filed Critical Archemix Corp
Publication of CN1984920A publication Critical patent/CN1984920A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention provides nucleic acid therapeutic compositions capable of binding to cytokines, growth factors and cell surface proteins, individually or in combinations of two or more, and methods for delivering these nucleic acid therapeutics in the treatment of glaucoma and other proliferative diseases of the eye.

Description

Be applied to the suitable body therapeutical agent in the pharmacotherapy of eye illness
FIELD OF THE INVENTION
The present invention relates generally to exonuclease treatment agent field, more specifically, relate to can with cytokine, one, two or more bind nucleic acid therapeutic composition in somatomedin and the cell surface receptor further relate to the transmission method of these exonuclease treatment agent in glaucoma and other eye hyperplasia class treatment of diseases processes.
The background of invention
Suitable body is a kind of nucleic acid molecule, has special affinity interaction power with molecular interaction, and this avidity is different with the Watson-Crick base pair reactive force of classics.
Be fit to body, the polypeptide or the monoclonal antibody (MAbs) that produce with phage are the same, can be special be attached to the selectivity target site and the physiological function of inhibition target site.Through in-vitro screening (Fig. 1), 100 multiple proteins comprise somatomedin from the oligonucleotide library of stochastic sequence, transcription factor, and enzyme, immunoglobulin (Ig) and receptor protein can produce suitable body.The typical body that is fit to has 10-15kDa size (30-45 Nucleotide), rely on inferior mol avidity with combining of target site, to target site have very strong recognition capability (for example: can with special target site combination, but can not with the protein binding of the same gene family of this target site).Make the antigen-antibody conjugate have affinity and specific interaction and comprise hydrogen bond action, electrostatic Compensation, hydrophobic interaction and sterically hindered etc., a series of studies show that, suitable body also can combine with target site with the interaction of these types.
Being fit to body has a lot of valuable characteristics in treatment and diagnosis, comprise high affinity and specificity, and biological effectiveness and fabulous pharmacokinetics are worth.In addition, they also be provided at antibody and other biological protein competition in specific competition superiority, for example:
1) speed and control.Suitable body is produced by external process fully, allows the quick generation of initial therapy precursor.The specificity of the suitable body of external selection permission and affinity are allowed the target site generation precursor substance of corresponding toxic and non-immunogenic by better controlled.
2) toxicity and immunogenicity.Suitable body has been illustrated does not have or does not almost have toxicity or immunogenicity.Mouse and marmot are carried out at a slow speed the high dosage horizontal injection be fit to body (10mg/kg every day, inject 90 days), from clinically, any toxicity is not all observed in molecular level or biochemical measurement.And the effectiveness of a lot of monoclonal antibodies can by with the restriction of the immune response strictness of antibody self, be difficult to induce the antibody (most likely because being fit to body can not be presented through major histocompatibility complex (MHC) by the T-cell, so immune response can not be discerned nucleic acid fragment) that produces suitable body.
3) Administration.The antibody of at present having ratified to be used for the treatment of all is that being fit to body can also the subcutaneous injection administration by intravenous injection (general more than 2-4 hour) administration.This difference at first depends on the solubleness that most of monoclonal antibodies are quite low, therefore needs a large amount of dissolution with solvents when treatment.And be fit to body have good solubility (＞150mg/mL) and quite low molecular weight (be fit to body: 10-50kDa; Antibody: 150kDa), the injected dose that is fit to one week of body is lower than 0.5mL, in the monkey experiment, through hypodermic bioavailability＞80%.(Tucker et.al., J.Chromatography B.732:203-212,1999) in addition, it is little to be fit to the body molecule, can pass hard-packed weave construction, antibody or antibody fragment then can not pass, and this has also shown another advantage of suitable body treatment and prevention.
4) industrial scale and cost.It is chemosynthesis that therapeutic is fit to body, thereby can be easy to go to control industrial scale according to the production demand.And the difficulty of large-scale production is just limiting the throughput of a lot of biological products at present; and the capital consumption of large-scale protein matter production plant is huge; an independent extensive synthesizer can be produced 100kg oligonucleotide at least every year, and initial investment need need less.Be fit to the synthetic of body by multikilogram at present, cost is to be comparable to the high antibody producing of optimizing.Continuation improvement to the process development is expected to make in 5 years production cost to be reduced to＜$100/g.
5) stability.It is chemically stable that therapeutical agent is fit to body.They can be in being exposed to thermal environment and denaturing agent after very fast recovery active, its lyophilized powder standing storage at room temperature (＞1 year).On the contrary, antibody must be stored in the cold storage environment.
Glaucoma
The two big reasons that cause losing one's sight are glaucoma and age-related macular degeneration (AMD).Glaucoma is a kind of proliferative disease, is perplexing that 2,200,000 U.S. are tried body and body is tried in the whole world 65,000 ten thousand.The glaucoma disease is discharged to reduce with aqueous humor and is raise relevant with intraocular pressure (IOP).When intraocular pressure raises, tried the nerve fiber necrocytosis of body, cause losing one's sight.Still there is not at present the method that stops glaucoma to take place, but can be by pharmacological agent, aqueous humor generates and intraocular pressure slows down its generation by adjusting.At present the treatment glaucoma is treated by trabecular resection and peripheral iris resection operation, and annual have 120,000 routine glaucomas to be tried body in the U.S. to have carried out this and perform the operation approximately.
The first step of glaucoma treatment is with medicament adjusting intraocular aqueous humor level.Glaucomatous filtration micrurgy, or trabecular resection operation is second step of treatment, and it discharges aqueous humor by micropuncture on sclera, thereby reduces intraocular pressure.However, postoperative complication can not be ignored, even can cause losing one's sight.Post-operative wound does not heal fully and scar will cause intraocular pressure to raise, thereby needs operation once more.In trabecular resection, can be in arched roof injection of antibiotics and reflunomide, perhaps cover eyes, with the expansion of control operation back scar with collagen protein.Can use antimetabolite, for example the expansion of control such as ametycin and Fluracil postoperative scar.Back intraocular pressure reduction is less than 25% if trabecular resection is performed the operation, and then can think failure needs the operation of aqueous humor discharge for the second time.
In order to ensure the success of trabecular resection operation, to use steroid and antibiotic medicine usually.Generally put on the skin 4-6 time every day with 1% prednisolone acetic ester, 4-8 reduces after week gradually.Every day, the ciliary muscle narcotic with 1% coromegine and so on acted on the anterior chamber of eyeball.In order to prevent postoperative conjunctiva fibrosis, need with antimetabolites such as ametycin and Fluracils.They can be suppressed to fibroblast proliferation, make further to form scar tissue.The drug effect of ametycin is 100 times of Fluracil, but also follows high complication probability when high success ratio is arranged, and therefore will select according to practical situation.Gauze or the cotton that can soak 1-5 minute with ametycin (0.2-0.5mg/mL solution) or Fluracil (25-50mg/mL solution) earlier before operation on sclera cover episclera, and the time is depended on expection fibrosis risk factor.In the operation, protect conjunctiva, avoid contacting with edge of wound with gauze.After the excision, wholely thoroughly clean with physiological saline.Fluracil can be expelled to the dosage of each 5mg under the conjunctiva, and total amount depends on the tolerance of corneal epithelium and the function of filter blister.The complication relevant with Fluracil comprises: cornea and conjunctival epithelium toxicity, keratohelcosis, conjunctiva wound seepage, subconjunctival hemorrhage and the diffusion of unintentional Fluracil intraocular.
The use that repeats trabecular resection operation and antimetabolite can increase the severity of complication, comprises that aqueous humor leaks, and intraocular pressure is crossed toxicity (Blindish, et al., Ophthalmology (2002), 109:1336-1341 low and main tissue; Belyea, et al., Am J Ophthalmol (1999), 124:40-45; Kupinet al., Am J Ophthamol (1995), 119:30-39).The further harmed eye tissue of antimetabolite meeting causes intraocular pressure low excessively, even blind.The standard of in glaucoma treatment, using the antimetabolite failure by visual acuity testing stipulated (Membrey, et al., (2000) .Br JOphthalmology, 84:1154-58).
Glaucomatous pathogenic process rises relevant with intraocular transforming growth factor level.Transforming growth factor-beta comprises three kinds: transforminggrowthfactor-(TGF β 1), transforming grouth factor beta 2 (TGF β 2), transforming growth factor-beta 3 (TGF β 3).Transforming growth factor is the multifunctional cytokine of control growing, differentiation and development.It can be by polytype cell expressing, and most cells is to the transforming growth factor sensitivity.Transforming grouth factor beta 2 is the homodimer cell growth factor of a kind of 25kD, forms relevant with hyperplasia, differentiation and extracellular matrix.The reaction of multiple acceptor (I-V type) various cells of mediation and transforming grouth factor beta 2 and isomers transforminggrowthfactor-thereof, transforming growth factor-beta 3.The II receptor is and the main frizzled receptor of transforming grouth factor beta 2 reaction, though strong avidity is arranged between III receptor and transforming grouth factor beta 2, does not have frizzled receptor.
In a lot of parts of health, transforminggrowthfactor-is in the highest flight, but in eyes, transforming grouth factor beta 2 is a principal mode.Transforming grouth factor beta 2 has influence on the healing of eyes wound, and is relevant with the formation of scar in operation for glaucoma.The formation of eye scar by transforming grouth factor beta 2 mediation (Corderio, et al., Invest Ophthalmol.Vis.Sci. (1999), 40:1975-19982).Detected transforming grouth factor beta 2 level higher (21pM) in the glaucoma aqueous humor, normal eye then can better controlled (12pM) (Ochiai, et al., Jpn J.Ophthalmol (2002), 46:249-253).Transforming grouth factor beta 2 can both be expressed and secrete to tm cells and ciliary body cell.This shows that the elderly and glaucoma are tried in the aqueous humor discharge system of body, the excess accumulation of the outer component of born of the same parents relevant with transforming grouth factor beta 2 (Tripathi, et al., Exp.Eye Res (1994), 58:523-528).
Replaceable medicine is carried out clinical trial now, for example: the specific antibody of transforming grouth factor beta 2, it can avoid the cicatrization (Broadway behind the operation for glaucoma, et al., Adjunctive anti-TGF β 2 humanMab as a novel agent to prevent scarring followingphacotrabeculectomy.May 2002, ARVO MeetingPoster#3331), however, inflammation is still arranged or negative reactions such as the rejection of external antibody are existed, can cause glaucomatous intraocular pressure to raise once more.Have in rabbit model to the expression that is suppressed at TGF β 2 in the eye cause the research that reduces the operation scar and improve the antisense nucleic acid of surgical effect (Corderio, et al., Gene Therapy (2003), 10:59-71).But this medicine can hinder the healing and the tissue regeneration of general wound.Therefore, these replace the negative impact that medicine can not be got rid of present glaucoma medicine fully.
Age-related macular degeneration (AMD)
[0017] age-related macular degeneration (AMD) is a kind of macular degeneration.In the U.S., it is a major cause that causes the people more than 50 years old to lose one's sight, and also increases with the ill probability of age growth.Only just there are 1.5 thousand ten thousand people to be subjected to the influence of this disease in the U.S..Age-related macular degeneration is caused by retinal arteriosclerosis, makes retinal tissue oxygen and nutrition supply deficiency, thus central light loss.Age-related macular degeneration is divided into moist (new vessel net) and dryness (no new vessel net), The classification basis is the irregular growth whether blood vessel is arranged under the retina.
Moist age-related macular degeneration accounts for 10% of macular degeneration.When the retina oxygen supply was not enough, new blood vessel had just generated, and with the raising amount of blood supply, thereby caused moist age-related macular degeneration.But the new vessel very thin breaks easily, causes hemorrhage and damage surrounding tissue.Now confirmed moistly to divide two types again: typicalness and concealed.The moist examination belongs to concealed again in the body more than 70%.Up to the present, only be typical moist can be with conventional laser coagulation treatment, can stabilizing vision or limit improper angiogenic growth.Remaining great majority are tried body and can not be used laser therapy.Present laser therapy can not improve eyesight concerning the eyes that great majority had been treated, because laser not only damages improper blood vessel, also damaged normal blood vessels.
The dryness age-related macular degeneration is more general, causes chronic visual loss usually.It is a feature with druse and retinochrome forfeiture.Druse is a kind of very little flaxen throw out that forms on the retina top layer.At present not confirmed method can be treated the dryness age-related macular degeneration, but its pathogenic process will be slowly many, it is much gentle that visual loss is wanted.There is not confirmed pharmacotherapy can treat macular degeneration at present yet.
Proliferative vitreoretinopathy (PVR)
Causing one of other reasons of losing one's sight is retina shedding.Approximately each ten thousand philtrum has a people to have the probability of retina shedding annually.Various associated eye conditions and whole body other diseases can increase the chance of retina shedding, comprising: diabetes, high myopia, pseudophakia or aphakia, passivity and perviousness ocular injury, the cmv retinitis that acquired immune deficiency syndrome (AIDS) causes etc.Vitrectomy is the standard approach of treatment retina shedding.Annual have 200,000 routine vitreous excision operations approximately in the U.S., and 300,000 examples are arranged except that the U.S..Proliferative vitreoretinopathy betides about 10% retina shedding and is tried in the body, and there are 62,600 examples in the annual whole world, about 2800 examples of the U.S..Proliferative vitreoretinopathy is to cause retina to adhere to the common reason of operative failure again.
Platelet derived growth factor (PDGF) is a kind of mitogenic factor that has decisive role in hyperplasia class disease.It is relevant with the regulation and control of retinal pigment epithelium and the neuroglial improper growth of transitivity in the proliferative vitreoretinopathy that PDGF is considered to.
PDGF subunit A and B form dimer, that is, and and AB heterodimer and AA, BB homodimer.PDGF plays key effect in the growth regulating of the regulation and control of ordinary cells propagation and diseased cells (as: tissue, fibrosis, hyperplasia disorder, vasculogenesis), it and kidney cicatrization, wound healing and related to cancer.Most of tumor cell secretion PDGF, and overexpression pdgf receptor.Aminoacid sequence and the oncogene of PDGF are similar.
Retina high expression level PDGF causes blood vessel and the outgrowth tractive retina shedding of non-vascular cell.PDGF promotes the tm cells hyperplasia, and strengthening retinal pigment epithelium is pinacocyte by the sexangle dedifferentiation, increases the expression of α-smooth muscle actin, strengthens myoid differentiation and collagen protein colloid and shrinks.It is higher that age-related macular degeneration is tried in the vitreum of body the PDGF level.
A lot of somatomedins are considered to relevant with proliferative vitreoretinopathy, comprise transforming growth factor-beta, VEGF, and BFGF, HGF and IL-6P, wherein PDGF plays an important role in proliferative vitreoretinopathy.
After the retina perforation and the relevant retina shedding of breaking, most common complication is exactly a proliferative vitreoretinopathy..Relevant in proliferative vitreoretinopathy and the vitreous space with the growth of the cytolemma (mainly comprise spongiocyte and retinal pigment epithelium, inoblast and inflammatory cell are also arranged) of retina front and rear surfaces.These films are basic scar tissues, and retina is had extra traction force, can cause the recurrence of retina shedding, even former retina shedding also may take place after performing the operation successfully.Proliferative vitreoretinopathy also can cause other complication after retinal rupture is treated successfully, even can cause and amphiblestroidly break again.It also with amphiblestroid serious distortion and ossify relevant, thereby cause the film atrophy, cause blind.
PDGF promotes the tm cells hyperplasia, and strengthening the retinal epithelium cell is pinacocyte by the sexangle dedifferentiation, increases α-smooth muscle actin and expresses, and strengthens myoid differentiation and collagen protein colloid and shrinks.It is higher that proliferative vitreoretinopathy is tried in the vitreum of body and the preretinal membrane PDGF level.In experiment model, not having the cell of pdgf receptor is invalid to what induce proliferative vitreoretinopathy.Especially, PDGF-AA can cause the tractive retina shedding that the extensive hyperplasia of spongiocyte is relevant with non-blood vessel.PDGF-α acceptor can impel its generation and then cause proliferative vitreoretinopathy.The PDGF mutant all may be blocked the circulation of PDGF irritation cell and carry out, and changes kinase activity, the generation of blocking-up proliferative vitreoretinopathy.The acceptor that truncates can be blocked the generation of proliferative vitreoretinopathy.
The proliferative vitreoretinopathy generating process can be divided into following several stages: 1) break through blood-retinal barrier; 2) chemotaxis and cell move; 3) hyperplasia; 4) extracellular matrix is rebuild, and film forms; 5) infect.PDGF has play a part importantly in each step, below substep is set forth in PDGF role in this five stages.
RPE forms mosaic between choroid and neural retina cell, as peripheral blood-retinal barrier, keep the stable and visual function of amphiblestroid ecology.The proliferative vitreoretinopathy initial period is exactly the dedifferentiation of RPE cell: the modal alteration of mitotic division resting stage, become flats from hexangle type, and lose epithelial feature.In addition, the RPE cell reduces the expression of keratoprotein, and beginning express alpha-smooth muscle actin (α-SMA).α-SMA is very important to shrinking activity, and its increase is a time-dependent manner.PDGF promotes the expression of dedifferentiation, myoid differentiation and the α-SMA of RPE cell.
Broken through blood-retinal barrier, the cell of a lot of types just can enter vitreum and Asian TV Station nethike embrane space fully, comprises the RPE cell, spongiocyte, inoblast, scavenger cell, white corpuscle and serum component.RPE and spongiocyte are main types wherein.These cell attachment are on retina and vitreous gel.PDGF is the potential stimulus person of RPE and spongiocyte migration.
In case on retina and vitreous gel, these cells just begin large-scale propagation.PDGF triggers the propagation of RPE and spongiocyte, and inducing DNA is synthetic.
Anti-myofibroblast or the class mesenchymoma cell of breaking up of RPE cell forms film at retinal surface or vitreum the inside, begins synthetic extracellular matrix.Common RPE cell can not PDGF-B expression or its acceptor.However, PDGF and its acceptor high expression level on the RPE cell have formed the proliferative vitreoretinopathy membrane structure.PDGF stimulates the synthetic and precipitation collagen protein of inoblast.At last, film applies traction force, and rent is split and retina shedding once more.PDGF strengthens the contractility of RPE, stimulates inoblast and collagen gel to shrink.
Proliferative diabetic retinopathy (PDR)
Proliferative diabetic retinopathy (PDR) is a kind of complication of diabetes, and it is caused by the variation of retinal vessel.When the blood vessel in the retina damages, will blood leakage, grow frangible brush shape branch vessel and scar tissue.Can cause sending into the dimness of vision and the distortion of brain like this.In developing country, diabetic retinopathy is the major cause of blinding, is more common in the diabetes in 25-74 year and is tried in the body.Annual have 12,000 to 24,000 people therefore to lose one's sight in the U.S..Estimate at 25% diabetes at present and tried body and suffered from diabetic retinopathy again, estimate to be tried in the body at type i diabetes, this ratio can rise to 60% after 5 years, can rise to 80% behind the 10-15.In the U.S., have 5,000,000 to be tried body, have 5,000,000,000 dollars market.This sick feature shows as hyperglycemia, basement membrane thickening, pericyte loss, microaneurysm and retina neovascularization (can cause losing one's sight by hemorrhage and tractive retina shedding).
The feature of non-proliferative diabetic retinopathy shows as retinal microaneurysm, and is hemorrhage, the nerve fiber infraction, and hard exudate and capillary blood vessel are undesired.Macular edema is the principle mechanisms of visual deprivation.It is caused by the microaneurysm vascular leakage in macula lutea (foveal region of retina zone) capillary vessel.Seepage can develop into the macula lutea relevant with hard exudate or cystoid and thicken, and it can cause the central light loss of various degree usually.The feature of proliferative diabetic retinopathy shows as the retina neovascularization.Its ill degree is judged according to the hemorrhage position and the severity of retina neovascularization.It can cause serious visual deprivation usually.The diabetic retinopathy pathology are relevant with following disease condition: retina anoxic or local anemia that circulation does not freely cause; Neovascularity growth and cause oxygen level surplus in the vitreum in the vitreum that neovascularization causes; The formation of blood leakage and macula lutea tissue causes the retina tractive and causes shedding tears in the new capillary vessel.Between layer of retina or the formation of following flow state and retina shedding caused shedding tears.The body eye is hemorrhage when being tried, when oedema and macula lutea tissue form, the dimness of vision, drift, glittering and blind suddenly will occur.
Vitrectomy is a kind of miniature operation that is used for the repairing retina pathology, thinks in the past that a lot of retinopathys can not use operative treatment.As long as retina is not badly damaged, vitrectomy has 90% success ratio.
PDGF-B has played the part of the key player in proliferative diabetic retinopathy and other somatomedin synergy.Anoxic has increased the expression of PDGF-B.Retina high expression level PDGF-B can cause blood vessel and non-vascular cell hyperplasia, thereby causes the tractive retina shedding.PDGF-B induces the hyperplasia of various kinds of cell in the retina, comprises stellate cell, perithelial cells and endotheliocyte.Length can be moved to the nucleus nexine in the hyperplasia of retinal surface and cell surface, and retina is applied traction force, causes the ectoretina pleat, and the retina shedding focus enlarges, and finally causes retina to come off fully.
The characteristics of proliferative diabetic retinopathy film have determined the difficulty of treatment, need scale off film fully from retinal surface usually and remove, rather than simply peel off.PDGF directly acts on the endotheliocyte induction of vascular by pdgf receptor and generates.PDGF plays an important role in the ordinary cells multiplication regulatory, also regulates and control the growth of diseased cells, as tissue, fibrosis, hyperplasia sexual disorder and vasculogenesis.It also with kidney scar, wound healing and related to cancer.PDGF acts on inoblast, smooth muscle cell, neurogliocyte, and the hyperplasia of stimulation reticular tissue.
Other cell growth factors and cell surface protein
Other somatomedins, cytokine is relevant with the eye wound healing with cell surface protein, works in the cicatrization behind operation for glaucoma.These cytokines, cell surface protein and somatomedin are relevant with multiple eye illness, comprise ICAM-1, IGF-1, VEGF/VEGF-R, TNF-α, α 5 β 3 etc.Cytokine, cell surface protein is relevant with multiple eye disease with somatomedin, comprises ICAM-1, transforminggrowthfactor-, transforming grouth factor beta 2, transforming growth factor-beta 3, IGF-1, VEGF/VEGF acceptor, TNF-α, the blood vessel factor and α 5 β 3.Adhesion molecule 1 (ICAM-1) is the surface glycoprotein of a 76-115kD in the born of the same parents, has the outer immunoglobulin like domain of 5 born of the same parents, plays an important role in diabetic retinopathy.The white corpuscle alluvial of ICAM-1 mediation is the pathogenic origin cause of formation of diabetic retinopathy.The β 2 on ICAM-1 and white corpuscle (neutrophilic granulocyte, basophilic granulocyte, lymphocyte, eosinophilic granulocyte, monocyte) surface integrates plain combination, firm sticks on the endothelium and to pass endothelial migration extremely important to inflamed sites to them.In diabetic retinopathy, ICAM-1 has strengthened the adhesion of white corpuscle and retinal blood guard system, it is also relevant with death with the damage of retina endotheliocyte, can cause the capillary blood irreversible ischemic that circulates, suppress the ICAM-1 biologic activity, stop the alluvial of diabetic retinopathy white corpuscle, and stoped blood-retinal barrier to be broken.
Insulin-like growth factor-1 (IGF-1) is the polypeptide of a 7.5kD, and the homology with Regular Insulin original 50% mainly results from liver, is regulated and control by tethelin.IGF-1 is a potential hyperplasia yield stimulant/mitogenic factor, is a kind of strong anti-cell programmed death factor.Its function is regulated and control by 6 igf binding proteins, and its level is subjected to the influence of developmental stage and nutritional status.The physiological action of IGF-1 comprises cell growth, protection, opposing oxidative pressure, promotes bone and muscle growth, neuroprotective cell etc.IGF-1 is relevant with revascularization, and being combined in the proliferative diabetic retinopathy of IGF-1 and VEGF plays an important role.Proliferative diabetic retinopathy is the complication of diabetes, is caused by retina medium vessels pathology.After the blood vessel in the retina damages, will cause blood leakage, bear breakable brush shape branch and scar tissue again, make the fuzzy distortion of the cerebripetal vision imaging of retina.
Regular Insulin exist and the effect of glycosyl end secondary species under, vascular endothelial growth factor and acceptor thereof (VEGF and VEGF/R) transcribe reinforcement.The accumulation of glycosyl end secondary species can cause neovascularization in the diabetic retina, and then causes visual loss.Insulin stimulating VEGF's is synthetic, can make diabetes be tried body instantaneous aggravation of retina neovascularization degree after insulinize.
In retina inflammation and revascularization process, tumor necrosis factor alpha (TNF-α) level can raise in the eye.TNF-α promotes the hyperplasia of tm cells, regulation and control trabecular network, matrix metalloprotease kinases and organize the expression of inhibition.Integrin alpha 5 β 3 promote the revascularization of proliferative diabetic retinopathy and age-related macular degeneration.
Therefore need be at cytokine, somatomedin, cell surface receptor carries out pharmacological agent, with the negative impact of minimizing or eliminating Eye disease treating, even disease is no longer taken place.
Brief description
Fig. 1 has described at the suitable body (SELEX of external use oligonucleotide stochastic sequence storehouse selection TM) process.
Fig. 2 has set forth the various strategies of synthetic macromolecule amount PEG-nucleic acid conjugate.
Fig. 3 A describes ARC82 transforming grouth factor beta 2 therapeutical agent and is fit to body (sequence number 151); Fig. 3 B has described the transformation period overview of ARC82 in blood.
Fig. 4 A is a S75 chromatographic separation wiring diagram; Fig. 4 B is a transforming grouth factor beta 2 wash-out overview in the S75 chromatographic separation; What Fig. 4 C described is to contain the dimeric electrophoretic band of transforming grouth factor beta 2 on polyacrylamide gel electrophoresis (PAGE) gel.
Fig. 5 A describes is a chart on the suitable body of APC77 transforming grouth factor beta 2 specificity that increases to concentration of the transforming grouth factor beta 2 protein binding of people (●) or mouse (mouth); Fig. 5 B describes be not radiolabeled ARC77 (△) and ARC81 (■) (be suitable for estimating and be fit to the body dissociation constant in the equation 2) and 32The ARC77 of P mark is to the competitiveness combination of human transforming growth factor β 2.
Fig. 6 A describes be transforming grouth factor beta 2 by ARC77, ARC78 and ARC81 are fit to the chart that body suppresses; What Fig. 6 B described is that people and rodent kind ARC77 are fit to the inhibition of body to the anti-proliferative effect of transforming grouth factor beta 2; Fig. 6 C has described ARC77 people's wild-type, the dissociation constant of mouse and people's transforming grouth factor beta 2 N-end Histidine tail.
Fig. 7 A is a graphic representation, describes the proliferative effect that ARC81 is fit to the rabbit aqueous humor of body and anti-transforming grouth factor beta 2 antibody inhibition lower concentration; Fig. 7 B and 7C describe the graphic representation that ARC81 is fit to body and anti-transforming grouth factor beta 2 antibody inhibition MLEC proliferative effect.This restraining effect is to be mediated by the 15% rabbit aqueous humor that the drug dose dependency is repaired.
Fig. 8 A describes is that the transforming grouth factor beta 2 of improvement is fit to the minimizing of body (sequence number 1), mutagenesis and modification; Fig. 8 B is a form, has shown transforming grouth factor beta 21 among Fig. 8 A, transforming grouth factor beta 2, and the improvement transforming grouth factor beta 2 of transforming growth factor-beta 3 correspondences is fit to the dissociation constant (Kd) of body; Fig. 8 C is a graphic representation, description be that improvement transforming grouth factor beta 2 among Fig. 8 A is fit to body the transforming grouth factor beta 2 in the MLEC hyperplasia is reversed retarding effect.
Fig. 9 A is a graphic representation, has described the stechiometry of the suitable body of transforming grouth factor beta 2-transforming grouth factor beta 2 complex body; Fig. 9 B has set forth the suitable body of transforming grouth factor beta 2 of detectability mark and the interaction between the transforming grouth factor beta 2 homodimer.
The transforming grouth factor beta 2 wild-type of Figure 10 A personnel selection, N-end long-tail and N-end short-tail variant have been described the collection of illustrative plates of suitable body binding site; Figure 10 B is a form, enumerated the wild-type transforming grouth factor beta 2, human transforming growth factor β 2 N-end long-tail variant, human transforming growth factor β 2 N-end short-tail variant and two transforming grouth factor beta 2 mutant (K94N, EC100 value 859T/R60K/K94N), dissociation constant and IC50 value.
What Figure 11 A described is that a dot hybridization analysis and a transforming growth factor III receptor are blocked in the chart that is fit to the body binding site; What Figure 11 B described is be fit to body and transforming growth factor III receptor binding site potential overlapping.
Figure 12 has set forth the modified regions of the suitable body ARC77 (sequence number 1) of transforming grouth factor beta 2.
That Figure 13 A chart is described is the isomers AA of ARC127 (No. 19 sequence-PEG-35 sequence-PEG-36 sequences) and human PDGF, BB, the binding curve of AB, the right form has been enumerated ARC127 (No. 19 sequence-PEG-35 sequence-PEG-36 sequences-3T) and PDGF isomers AA, BB, the Kd value of AB;
Figure 13 B describes is that (No. 19 sequence-PEG-35 sequence-PEG-36 sequences-3T) and the human BB isomers of PDGF and the binding curve of mouse BB isomers, the right form have been enumerated ARC127 (the Kd value of the PDGF isomers BB of No. 19 sequence-PEG-35 sequence-PEG-36 sequences-3T) and human, mouse and mouse to ARC127.
Figure 14 A has described ARC127, and (No. 19 sequence-PEG-35 sequence-PEG-36 sequences-3T) are fit to combining of body and people and mouse PDGF; Figure 14 B is a chart, ARC127 is fit to body the restraining effect of PDGF inductive 3T3 hyperplasia has been done contrast with control antibody to the restraining effect of PDGF inductive 3T3 hyperplasia.
Figure 15 A has described the transition graph picture of retinal pigment epithelium when not having PDGF to exist; Figure 15 B has described the transition graph picture of RPE cell when 100ng/mL PDGF exists; Figure 15 C has described the transition graph picture of RPE cell when PDGF and ARC127 are fit to body and exist; Figure 15 D has described the transition graph picture of RPE cell when PDGF and ARC128 are fit to body and exist; Figure 15 E and 15F have described the influence of PDGF concentration increase to the RPE cell migration.
Figure 16 has described ARC127, and (No. 19 sequence-PEG-35 sequence-PEG-36 sequences-3T) are fit to the stability of all dna structures in external serum that body and improvement ARC127 are fit to body.
Figure 17 has set forth through vein, and ARC127 is fit to the concentration of body after abdominal cavity and 50 hours the overtreatment administration of subcutaneous three kinds of route of administration.
Figure 18 has shown that ARC127 also has detectable activity in vivo after 48 hours.
Figure 19 A and 19B have showed that the transforming grouth factor beta 2 of enumerating is fit to the binding curve figure of body in table 5.
Figure 20 A, 20B and 20C have showed that the transforming grouth factor beta 2 of enumerating in the table 7 that truncates is fit to the binding curve figure of body.
Figure 21 A, 21B and 21C have showed that ARC117, ARC119 were fit to body and also had detectable activity in vivo after 48 hours.
Figure 22 A, 22B and 22C have showed that ARC126, ARC127 and NX1838 are fit to body and also had detectable activity in vivo at least 25 days later on.
Summary of the invention
Cytokine, somatomedin or cell surface protein promote scar tissue to form or other cytopathies, cause intraocular pressure rising glaucoma.The specificity that is fit to body allows them to combine with these cytokines, somatomedin or cell surface protein, with being such treatment of diseases agent.This invention provides a kind of suitable body therapeutical agent, and transforming grouth factor beta 2 and PDGF cytokine specificity that it can be relevant with the formation of postoperative scar tissue are affine, therefore can stop the generation of the rising of glaucoma intraocular pressure and other glaucomatous pathogenic courses.
In one embodiment, suitable body composition provided by the invention can with transforminggrowthfactor-, transforming grouth factor beta 2 or transforming growth factor-beta 3 combinations are very useful in the treatment of eye illness.
In one embodiment, suitable body composition provided by the invention can combine with platelet derived growth factor (PDGF), is very useful in the treatment of eye illness.
In one embodiment, suitable body composition provided by the invention can combine with ICAM-1, is very useful in the treatment of eye illness.
In one embodiment, suitable body composition provided by the invention can combine with IGF-1, is very useful in the treatment of eye illness.
In one embodiment, suitable body composition provided by the invention can with the VEGF/VEGF receptors bind, in the treatment of eye illness, be very useful.
In one embodiment, suitable body composition provided by the invention can combine with TNF-α, is very useful in the treatment of eye illness.
In one embodiment, suitable body composition provided by the invention can combine with α 5 β 3, is very useful in the treatment of eye illness.
In one embodiment, the invention provides a kind of method, the proliferative disease that the hyperplasia that mediates with combination treatment transforming grouth factor beta 2 of the present invention causes.
In one embodiment, the invention provides a kind of method, the proliferative disease that the hyperplasia that mediates with combination treatment PDGF of the present invention causes.
In one embodiment, the invention provides a kind of method, the proliferative disease that the hyperplasia that mediates with combination treatment ICAM-1 of the present invention causes.
In one embodiment, the invention provides a kind of method, the proliferative disease that the hyperplasia that mediates with combination treatment IGF-1 of the present invention causes.
In one embodiment, the invention provides a kind of method, the proliferative disease that causes with the receptor-mediated hyperplasia of combination treatment VEGF/VEGF of the present invention.
In one embodiment, the invention provides a kind of method, the proliferative disease that causes with the alpha mediated hyperplasia of combination treatment TNF-of the present invention.
In one embodiment, the invention provides a kind of method, the proliferative disease that the hyperplasia that mediates with combination treatment α V β 3 of the present invention causes.
In one embodiment, this invention provides a kind of exonuclease treatment agent composition and a kind of transmission energy and cytokine, and somatomedin and cell surface receptor be combination or energy and PDGF separately, transforminggrowthfactor-, transforming grouth factor beta 2, transforming growth factor-beta 3, ICAM-1, IGF-1, VEGF, vegf receptor, the method for the two or more bonded exonuclease treatment agent among TNF-α and α 5 β 3 is used for treating glaucoma and other proliferative diseases.
In one embodiment, this invention provide a kind of exonuclease treatment agent composition and a kind of transmit can with the method for PDGF and the agent of VEGF bonded exonuclease treatment.In one embodiment, the exonuclease treatment agent is that single nucleic acid is fit to body and has a structural domain and have and PDGF bonded ability, and second structural domain has and VEGF bonded ability.In one embodiment, this exonuclease treatment agent is to contain a kind of solution that can be fit to body with PDGF bonded first nucleic acid and can be fit to body with VEGF bonded second nucleic acid, and the suitable body of these two kinds of nucleic acid is not to be fit to body with a kind of nucleic acid.
In one embodiment, the invention provides and a kind ofly have the pharmacology of improvement and the high molecular weight PEGs derivative nucleic acids of pharmacokinetic property (as: being fit to body) conjugate, and the production method of this conjugate.
In one embodiment, the invention provides high molecular weight PEGs-nucleic acid (as: being fit to body) conjugate, and generate high molecular complex body (that is: PEG-nucleic acid-PEG-nucleic acid-PEG-nucleic acid conjugate), thereby the method for producing this conjugate with the dual functional PEG of homology.
In one embodiment, the invention provides high molecular weight PEGs-nucleic acid (as: being fit to body) conjugate, and generate many PEG conjugate (that is: PEG-nucleic acid-PEG conjugate), the method for producing this conjugate with dual-active nucleic acid (that is: a nucleic acid has two avtive spots) and difunctionality PEG.
In one embodiment, the invention provides high molecular weight PEGs-nucleic acid conjugate can be as the therapeutical agent that prevents and/or treats eye illness.
An aspect, the high molecular weight PEGs among the present invention-suitable body composition comprises nucleic acid and stable integral part---connect to form part, this connects to form part is not nucleic acid molecule.In one embodiment, this connection portion is poly-alkylene ethylene glycol.Stable poly-alkylene ethylene glycol comprises polyoxyethylene glycol (PEG).In one embodiment, polyoxyethylene glycol connect to form the part how actively be.For example, to connect to form part be two active to PEG.In one embodiment, first and second parts that are fit to body connect to form part by PEG and connect, the primary structure that promptly is fit to the body composition is that linear arrangement---first integral part is connected to first end that PEG connects to form part, and second integral part is connected to second end that PEG connects to form part.In some aspects, more than one PEG integral part separates plural nucleic acid and is fit to the body integral part, and for example: the linear array that high molecular is fit to the body composition is: nucleic acid-PEG-nucleic acid-PEG-nucleic acid.In one embodiment, the linear array of the suitable body composition of high molecular is: PEG-nucleic acid-PEG-nucleic acid-PEG-nucleic acid.In one embodiment, high molecular is fit to the body composition has one to be higher than 20kD from by being higher than 10kD,, be higher than 40kD and be higher than molecular weight chosen process in the combination that 80kD forms.According to these aspects of invention, some high molecular are fit to the body composition and can combine with platelet derived growth factor (PDGF), and some high molecular are fit to the body composition and can combine with transforming grouth factor beta 2.
On the other hand, the invention provides high molecular weight PEGs-suitable body composition, comprise suitable body, two or more non-nucleic acid stability integral parts.Suitable stable integral part comprises poly-alkylene ethylene glycol.In one embodiment, stable integral part is polyoxyethylene glycol (PEG).In one embodiment, be fit to body for how active.For example, suitable body is a dual-active.
The present invention also provides a kind of therapeutic agent compositions, comprises high molecular weight PEGs described herein-suitable body composition.
On the other hand, the invention provides the method that a kind of treatment is tried the body disease, comprise and take the step that the high molecular weight PEGs described herein of significant quantity-suitable body composition is gone up in treatment.
The detailed description of invention
The statement one by one in the back of the details of one or more embodiments of the present invention.Though can be used for practice of the present invention and checking with those similar or identical methods described herein and material, still best practice and material be done a description now.Other features of the present invention, target and advantage will be described later clear.In detailed description, unless clear regulation in the literary composition, singulative also comprises plural number.Cross unless otherwise defined, all the used here terms all generic definition with field of the present invention are consistent.If the situation of conflict is arranged, is as the criterion with this specification sheets.
Here all mentioned publications, patent application, patent and other reference are all taken in as a reference.Quoting of publication and patent documentation is not to recognize that any one piece is relevant prior art, neither admit that date or content are identical.If any conflict, be as the criterion with this specification sheets, comprise definition.In addition, material described below, method and embodiment only with explaining, do not have restriction.
SELEX TMProcess
The method that suitable generation is fit to body is with a kind of " index concentrates the ligand phylogeny " (" SELEX by name TM") method, Fig. 1 is described this method.SELEX TMProcess be can with the external evolutionary process of target molecule high degree of specificity bonded nucleic acid molecule, description is all arranged in the following document: No. 07/536,428, U.S. Patent application, submit to January 11 nineteen ninety, now abandon; United States Patent (USP) 5,475, No. 096, " nucleic acid ligands "; United States Patent (USP) 5,270, No. 163 (also seeing wo91/19813), " nucleic acid ligands ".The nucleic acid ligands of each SELEX type all is and given target molecule or the corresponding ligands specific of component.SELEX TMProcess is based on nucleic acid has enough abilities to remove to form various 2 and 3 dimensional organizations, also can obtain enough chemically reactives from their monomer, as the part of nearly all chemical ingredients (no matter monomer or polymkeric substance) (form specificity in conjunction with to).The molecule of any size or component can be as target molecule.
SELEX TMThe single stranded oligonucleotide template library that relies on a very big stochastic sequence composition that derives from the chemosynthesis of standard DNA synthesizer is as starting point.In some examples, 100% random oligonucleotide group is used to screening.In other, each oligonucleotide in the colony is formed a stochastic sequence, has 5 ' and/or a 3 ' suitable-end sequence at least, forms the sequence that all molecules are shared in the oligonucleotide colony.Should be fit to the hybridization site that sequence comprises the PCR primer, the promoter sequence of RNA polymerase (T3 for example, T4, T7, SP6 and so on), restriction enzyme site, or homopolymer sequence, as poly A tail, poly T fragment, with the catalytic core and the site of affinity post selective binding, and other help the sequence of the clone and/or the required oligonucleotide that checks order.
The stochastic sequence part of oligonucleotide can be any length, can form ribonucleotide and/or deoxyribonucleotide, can comprise and modifying or non-natural Nucleotide or nucleotide analog.See United States Patent (USP) 5,958,691; 5,660,985; 5,958,691; 5,698,687; 5,817,635 and 5,672, No. 695, PCT publication Wo92/07065.Random oligonucleotide can be synthetic by the Nucleotide that phosphodiester connects, and synthetic method is known solid phase oligonucleotide synthetic technology (Froehler et al., Nucl.Acid Res.14:5399-5467 (1986) in the industry; Froehler et al., Tet lett27:5575-5578 (1986)).Oligonucleotide also can be synthetic with solid phase method, for example three ester synthesis methods (Sood et al., Nucl.Acid Res.4:2557 (1977); Hirose et al., Tet.Lett., 28:2449 (1978)).The synthetic of classics carries out with the automatization dna synthesizer, can produce 10 15-10 17Individual molecule.During sequences Design, design enough big stochastic sequence district, can increase the conservative property of each synthetic molecules, make it can represent a special sequence exactly.
When synthesizing stochastic sequence, each adds the mixture that step all needs to add four kinds of Nucleotide in building-up process.Specialize for one and embody, random oligonucleotide is formed complete stochastic sequence, and however, random oligonucleotide can also be formed nonrandom or part stochastic sequence one section.Adding 4 kinds of Nucleotide in each interpolation stage by different mol ratio can the composite part sequence.
Template molecule generally comprises 30-50 the random nucleotide of interior region and the pairing 5 ' and the 3 ' end sequence of both sides.A standard synthetic (1 μ mol) can produce 10 15-10 16Individual independent template molecule, the usefulness of enough most of SELEX experiments.The RNA library obtains with reorganization t7 rna polymerase in-vitro transcription by this initial library.Then that this library and target molecule is admixed together, substep repeats combination under the best combination condition, distributes, and amplification with identical selection scheme, is finished the almost affinity and the selective binding of any standard.Form SELEX from the mixture and the better stochastic sequence fragment of nucleic acid TMMethod comprises the following steps: contacting of under the best combination condition mixture and target molecule, from with accounting the target molecule specificity combines in distribute free nucleic acid, be that nucleic acid-target molecule complex body dissociates, amplification produces the nucleic acid solution of rich part from the nucleic acid that nucleic acid-the target molecule complex body disintegrates down, and then repeats combination recited above, distribute, dissociate, the circulation step of amplification produces the nucleic acid ligands with target molecule high specific, high-affinity.
In the nucleic acid mixture that has comprised a large amount of possible sequences and structure, given target molecule there is the binding affinity of a broad range.Nucleic acid mixture is formed, as: one has the random fragment of 20 Nucleotide can have 4 20Individual alternative possibility.Be higher than can combining of affinity costant with the avidity of target molecule with target molecule.Distribute, dissociate, after the amplification, obtain second nucleic acid mixture, enrichment the nucleic acid of high-affinity, carry out repeatedly such chosen process again and select best part, be evident as one or more sequences until the nucleic acid mixture that obtains at last and form.
Selection and amplification cycles repeat till reaching desired destination always.In most cases, selection/amplification can continue until that bonding force no longer included material alterations when circulation repeated again.This method can be used to contain about 10 18In the sample of individual not nucleic acid of the same race.The nucleic acid mixture of experiment preferably includes the stochastic sequence part and protects sequence to guarantee expanding effect.The varient of nucleotide sequence also can be produced by number of ways, comprises that the size in the synthetic and nucleus random splitting of random nucleic acid sequence is selected.Variable sequence partly comprises all or part of stochastic sequence, also comprises the part with stochastic sequence blended protection sequence.The sequence mutability of test in the nucleic acid can be before selections/amplification repeats or among by mutagenesis introducing or increase.
SELEX TMAn embodiment in be that this chosen process is very effective with separating of the strong bind nucleic acid part of selecting of target molecule for those, only needs one to select and amplification cycles.Available this effective choice method in chromatographic separation for example.Nucleic acid combines with target on chromatographic column by this way.Chromatographic column has enough abilities to separate the highest nucleic acid ligands of avidity.
Under many circumstances, do not need through a plurality of repetition SELEX TMStep is until obtaining single nucleic acid.Target-specific nucleic acid ligands solution comprises a nucleic acid construct or die body family.There are a large amount of protection sequences and a large amount of replaceable or adding backs nucleic acid ligands not to be had the sequence of great effect to the avidity of target molecule.At SELEX TMProcess stops before finishing, and may determine the sequence of a lot of members in the nucleic acid ligands solution family.
Known have various nucleic acid one-levels, and secondary and tertiary structure exist.Prevailing interactional structure of non-Waston-Crick class and die body are meant the combination of those hair fastener ring structures, symmetry and asymmetric projection, false knot and a plurality of same structures.Almost all known situations of these die bodys show that all they can form nucleotide sequence less than 30 Nucleotide.For this reason, the SELEX of adjacent random fragment TMIt is reasonable that program begins from the nucleotide sequence of the random fragment that comprises 20-50 Nucleotide.
SELEX TMCore methed improved, finished some specific targets.For example, at United States Patent (USP) 5,707, talk about SELEX No. 796 TMCombine with gel electrophoresis, be used to select to have the nucleic acid molecule of certain structural features, as cyclic DNA; United States Patent (USP) 5,763 is talked about in No. 177, uses based on SELEX TMMethod select to comprise the nucleic acid ligands of photosensitive group, it has and combines with target molecule and/or the ability of photo-crosslinking; United States Patent (USP) 5,567, No. 08/792,075, No. 588 and U.S. Patent application, on January 31st, 1997 submitted to, was entitled as " wandering cells SELEX " and talked about: based on S ELEX TMMethod can efficient allocation and target molecule have the oligonucleotide of high-affinity and low-affinity, United States Patent (USP) 5,496 has been described a kind of SELEX of passing through No. 938 TMThe method of the nucleic acid ligands that is improved.United States Patent (USP) 5,705 has been described a kind of and the covalently bound method of target molecule for No. 337.
SELEX TMAlso can be used for obtaining and a plurality of site of target molecule bonded nucleic acid ligands, also can be used for obtaining nucleic acid ligands with the non-nucleic acid species of target molecule specificity site bonded.SELEX TMA kind of separation and differentiation and any expection target molecule bonded nucleic acid ligands are provided, comprise various big and little biomolecules, comprise protein (comprise nucleic acid binding protein and combine agnoprotein with nucleic acid), cofactor and other small molecules as the part of its biological function.For example, United States Patent (USP) 5,580 in No. 737, passes through SELEX TMDisclosed the nucleotide sequence that has high-affinity with caffeine and analogue theophylline thereof.
Reverse SELEX TMBe a kind of, improve specific method between nucleic acid ligands and target molecule by the nucleic acid molecule of eliminating with one or more non-target molecule tool cross reactivities.Reverse SELEX TMForm by the following step: a) preparing nucleic acid mixture to be selected; B) mixture to be selected mixes with target molecule, and the nucleic acid that the avidity of the target molecule relevant with mixture to be selected increases will be separated from the container of mixture to be selected; C) from mixture container to be selected, isolate the nucleic acid that avidity increases; D) nucleic acid that avidity is increased mixes with one or more non-target molecules, and the nucleic acid ligands that has specificity avidity with non-target molecule is removed; E) the amplification nucleic acid that has specificity avidity with target molecule obtains the enrichment solution with the special high-affinity bonded nucleic acid of target molecule.
Nucleic acid has run into potential problems during as medicine and vaccine, and the oligonucleotide of phosphodiester form was easy to before its effect of performance in vivo in the liquid by the enzyme liberating inside and outside the cell, for example endonuclease and exonuclease.Therefore the SELEX method is carried out round identification high-affinity nucleic acid ligands, and this part comprises adorned Nucleotide, grants part some improved characteristics, for example improves the body internal stability or improves its transportation feature.The example of this modification comprises: in ribose and/or phosphoric acid ester and/or the replacement of base position.The nucleic acid ligands that comprises the SELEX identification of modified nucleotide all has description in following patent: United States Patent (USP) 5,660, the oligonucleotide that comprises the chemical derivatized nucleotide has been described in No. 985, it is at ribose 2,5 of pyrimidine, 8 modifieds of purine, United States Patent (USP) 5, the nucleotide ligand of describing high degree of specificity 756, No. 703 comprises one or more at 2 '-NH 2, adorned Nucleotide on 2 '-F and/or the 2-O-methyl substituents.
In the present invention, the modification repeatedly of nucleic acid ligands is comprised, but be not limited to comprise extra charge effect, polarity, hydrophobicity, hydrogen bond action, electrostatic interaction, other mobile chemical group for nucleic acid ligands base or whole nucleic acid ligands provide.This modification comprises, but it is glycosyl modified to be not restricted to 2 '-position, and 5 '-position pyrimidine is modified, 8 '-position purine is modified, and the outer shroud amido is modified, and 4 '-position thio uridine replaces, 5 '-position bromine or 5 '-iodo-uridylic replaces, trunk is modified, and phosphorus sulfuration or alkylphosphonic acid carboxylic acid modification methylate, rare base are to combination, as base of the same clan, cytidine of the same clan, guanidine of the same clan etc.Modify the modification that also comprises 3 ', 5 ' end, as add cap.At present should invention one preferably in the pre-ferred embodiment, nucleic acid ligands carries out the RNA molecule that 2 '-F modifies for the glycosyl part at the pyrimidine residue.
Modification can be the front or rear modification of SELEX.Modify before the SELEX and produce the nucleic acid ligands that has SELEX target molecule high degree of specificity and strengthen the body internal stability.The body internal stability is strengthened and the binding ability of nucleic acid ligands is not had negative impact modification behind the SELEX of 2 '-OH nucleic acid ligands.
Other modification all is known several common technology in the field.This modification can be as modifying (modifying the previous part of determining unmodified) behind the SELEX or being included in the SELEX process.
The SELEX method selects oligonucleotide and combining of non-oligonucleotide functional unit to carry out around the oligonucleotide of selecting and other, at United States Patent (USP) 5,637, No. 459 with No. 5,683,867, United States Patent (USP) in description is all arranged.The SELEX method further is centered around the diagnosis and the selective nucleic acid part of treatment and the combination of lipophilic or nonimmunogenic high molecular conjugate carries out, and this is at United States Patent (USP) 6,011, description is arranged in No. 020.United States Patent (USP) 5,859 has been described the VEGF nucleic acid ligands relevant with the lipophilic conjugate No. 228.As triglyceride or dialkyl group glycerine, be applied to diagnosis and treatment ligand compound.
The VEGF nucleic acid ligands relevant with lipophilic compound, as glycerolipid, or non-immunogen high molecular weight molecules., further describe in No. 698 at United States Patent (USP) 6,051 as polyalkylene glycols.The VEGF nucleic acid ligands relevant with non-immunogen high-molecular weight compounds or lipophilic compound further describes in PCT publication WO98/18480 number.These patents and application allow a large amount of shapes and other characteristic, the effective permutation and combination of amplification and duplication characteristic, allow to have the combination of the oligonucleotide of the desired characteristic that other molecule has.
The method of being discerned nucleic acid ligands by SELEX from little variable polypeptide has also found out.Little peptide has varied texture, exists in solution with multiple balanced conformation usually.Therefore, think that at first the conformational entropy that the combined variable polypeptide of binding affinity possibility is lost limits.However, the feasibility of identification nucleic acid ligands has been set forth in 214 at United States Patent (USP) 5,648 from variable polypeptide solution.The high-affinity RNA nucleic acid ligands of Substance P in this patent---11 amino acid whose polypeptide, identified.
In order to produce the oligonucleotide group that can resist nuclease and hydrolytic action, can use the oligonucleotide of modifying, this oligonucleotide can comprise alternative key, variable sugar, variable base or its combination in one or more Nucleotide.In one embodiment, the P of oligonucleotide (O) O group is by (O) S (" sulfuration "), P (S) S (" two sulfuration "), P (O) NR 2(" amination "), P (O) R, P (O) OR ', CO or CH 2(" formyl acetalation ") or 3 '-amine (NH-CH 2-CH 2-) replace, here each R or R ' they are the alternative or non-alternative alkyl of H independently.Linking group can be by-O-,-N-or-the S-key be close to Nucleotide and be connected.Be not in the oligonucleotide all keys all to need be identical.
[00112] in one embodiment, oligonucleotide comprises the glycosyl of modification, and for example, one or more hydroxyls are by halogen, and the group of aliphatics or ether and amine functions replaces.In the embodiment, 2 '-position of furans residue is by the O-methyl, the O-alkyl, and the O-propenyl, the S-alkyl, S-propenyl or halogen group replace.Synthetic 2 '-sugared method modified at Sproat, et al., Nucl.AcidRes.19:733:738 (1991); Cotton, et al., Nucl.Acid Res.19:2629-2635 (1991); And Hobbs, describe among the et al., Biochemistry12:5139-5145 (1973).The use of 2-fluoro-ribonucleotide oligomer molecule, can increase the susceptibility (Pagratis of nucleic acid donor molecule to target molecule, et al., Nat.Biotechnol.15:68-73:1997), compare with the susceptibility that produces with the ribose of non-replacement or deoxyribose oligonucleotide, the former is 10 to 100 times of the latter, therefore, the binding interactions extra with target molecule is provided, increased the stability (Kraus of nucleic acid donor molecule secondary structure, et al., Journal of Immunology160:5209-5212 (1998); Pieken, et al .Science253:314-317 (1991); Lin, et al., Nucl.Acids Res.22:5529-5234 (1994); Jellinek, et al., Biochemistry34:11363-11372 (1995); Pagratis, et al .Nat.Biotechnol15:68-73 (1997)).
Nucleic acid is fit to the body molecule and goes out through 5 to 20 circulation step screenings usually.In the embodiment be, heterogeneous only import, and can in reproduction process, not take place by originally choice phase.
Initiate dna sequence library produces by the dna synthesizer robotics is synthetic.This sequence library is at external use T 7The T of RNA polymerase or modification 7Rna polymerase transcribe becomes RNA and purifying.For example, 5 '-and be fit to: at random: the 3 ' sequence that is fit to is had the stochastic sequence separation of 30-50 Nucleotide.
2 ' oxygen-methyl SELEX TM(2 '-OMe SELEX TM)
In addition, SELEX TMMethod can be used to produce the suitable body of 2 '-modification.Description is all arranged: United States Patent (USP) 60/430 in following patent application, No. 761, on December 3rd, 2002 submitted to, No. 60/487,474, U.S. Provisional Patent Application, on July 15th, 2003 submitted to and U.S. Provisional Patent Application 60/517, No. 039, submitted in 2003 11 years 4 days, and reached No. 10/729,581, U.S. Patent application.On December 3rd, 2003 submitted to.Each is all included in the reference in full at this.
The present invention also provides and produces material and the method for stablizing oligonucleotide, comprises suitable body, and it includes the Nucleotide (for example Nucleotide of modifying in 2 ' position) of modification, can make oligonucleotide more stable than the oligonucleotide of unmodified.The stable oligonucleotide of method of the present invention and material produce also shows better stability at enzyme and chemical degradation in heat and the mechanical degradation.For example, the oligonucleotide that comprises 2 '-O-methyl nucleotide is a nuclease-resistant, and is synthetic also inexpensive.Though 2 '-O-methyl nucleotide is common existence in biosystem, but natural polysaccharase can not be accepted 2 '-O-methyl N TP as substrate under physiological situation, therefore, need not consider 2 '-O-methyl nucleotide relevant matters of security that are recycled when host DNA.
In the embodiment, the invention provides ATP, GTP, CTP, 2 '-OH of TTP and UTP Nucleotide, 2 '-F, 2 '-deoxidation, 2 '-oxygen methyl, 2 '-NH 2Combination with the modification of 2 '-methylethyl.In the embodiment, the invention provides ATP, GTP, CTP, 2 '-hydroxyl of TTP and UTP Nucleotide, 2 '-fluorine, 2 '-deoxidation, 2 '-oxygen methyl, 56 combinations that 2 '-amino and 2 '-methoxyethyl are modified.
The T that the polysaccharase that the suitable body and function of 2 '-modification is modified in the invention produces as modifies 7Polysaccharase is compared with the wild-type polysaccharase, has the combination rate higher with modified nucleotide, and this modified nucleotide has excessive substituting group on 2 ' of furanose.For example, T 7Polysaccharase double-mutant (Y639F/H784A), the Histidine of No. 784 positions sport L-Ala or other amino acid, residue.In addition, the Y639F mutant is considered to comprise huge 2 ' surrogate, is used in conjunction with the pyrimidine NTP that modifies.A single mutation T 7The Histidine that polysaccharase (H784A) is 784 be mutated into alanine residue (Padilla et al., Nucleic Acids Research, 2002,30:138).In the T7 polysaccharase of two sudden changes of Y639F/H784A and H784 single mutation, sport the combination that littler amino-acid residue allows bigger Nucleotide substrate, for example, the Nucleotide that 2 '-oxygen methyl is replaced.
Aborning another important factor of suitable body of 2 '-modification is exactly magnesium and the manganese that adds divalence in the mixing solutions of responsive transcription.Different sodium-chlor and Manganous chloride tetrahydrate concentration are formed can influence 2 '-O-and methylate and transcribe the concentration that magnesium chloride of the best and Manganous chloride tetrahydrate concentration depend on NTP complexing divalent-metal ion in the responsive transcription solution.
GMP or guanosine are initial also extremely important to what transcribe.This influence is caused by the polysaccharase specificity of nuclei originis thuja acid.As a result, as if any of generation transcribes to such an extent that 5 ' terminal nucleotide all is 2 '-hydroxyl G by this way.The concentration that GMP (or guanosine) is more suitable is 0.5mM, and 1mM is better.Research is also found, adds PEG in the responsive transcription, and preferably PEG8000 is very useful to the Nucleotide combination that maximization is modified.
With transforming grouth factor beta 2 and PDGF the suitable body of binding affinity is arranged
The invention provides nucleic acid ligands medicine modification and non-modification.It can the human cell factor relevant with eye illness, somatomedin or cell surface protein combination.In the embodiment be, suitable body of the present invention can combine with the transforming grouth factor beta 2 high-affinity, external can reverse transforming grouth factor beta 2 mediation to mink pulmonary epithelial cells (MLEC) hyperplasia or restraining effect.These suitable bodies can be by " part index concentration the phylogeny " (SELEX that describes among Fig. 1 TMProcess) produces.
The RNA of the modification among the present invention is fit to body in conjunction with people's transforming grouth factor beta 2.In view of the biochemical character of these suitable bodies, in intestinal bacteria, produced the ripe transforming grouth factor beta 2 of two kinds of forms, natural and the terminal Histidine tailing of N-form.Again folding closing after the purifying obtained meritorious transformation of energy grouth factor beta 2.These transforming grouth factor beta 2 albumen are activated in the analysis of cell level.Active and the suitable body combination of N-terminal tail influence, and the affinity of suitable body has reduced significantly.Further produced transforming grouth factor beta 2 two mutant (K94N, S59T/R60K/K94N).The K94N mutant can be incorporated into and is fit on the body, and this avidity and its follow natural transforming grouth factor beta 2 bonded avidity similar.And the avidity of S59T/R60K/K94N mutant and suitable body reduces greatly.Similarly, in the cell step analysis, be fit to body natural wanted high with the bioactive ability that checks that checks comparison S59T/R60K/K94N mutant of K94N transforming grouth factor beta 2.Based on the crystalline structure of having delivered, two surrogates on 59 and No. 60 positions are positioned at the next door of dimer combining site, adjacent with transforming grouth factor beta 2 N-end, another surrogate is on No. 94 positions, next door at II receptor binding site, to finding that with the analysis that combines competition of soluble transform growth factor-beta receptor III receptor and suitable body binding substances compete, but the II receptor is not.We have also illustrated a kind of combination the in the dimer of two suitable bodies and transforming grouth factor beta 2, and do not combine with other two kinds of dimers.Suitable body among the present invention on the transforming growth factor-beta III receptor binding site or near combine with transforming grouth factor beta 2, and check its biological function.
Suitable body among the present invention has specificity and has and transforming grouth factor beta 2 bonded avidity, and it is by above-mentioned SELEX process screening.Some as the SELEX process, screening the sequence that is attached to transforming grouth factor beta 2 is minimized, to determine to have the minmal sequence of binding affinity, then by to minmal sequence at random or rite-directed mutagenesis be optimized, to determine whether avidity increases, and which site is crucial for keying action in the sequence.In addition, screening can be carried out with sequence and modification sequence bonded process, makes suitable body stable, the opposing vivo degradation.
Set forth in the bioanalysis of describing in the example described below to have the suitable body that high-affinity and specificity bonded filter out be the appropriate therapeutic medicine of treatment transforming grouth factor beta 2 as the disease of cause of disease.Replacing, is the appropriate therapeutic medicine of treatment PDGF as the disease of cause of disease at the suitable body of PDGF specificity screening.
Suitable body component among the present invention has the specific dimer binding affinity with PDGF, and the suitable component among the present invention has and PDGF BB homodimer and AB heterodimer binding affinity, and can not combine with the AA homodimer is affine.
Suitable body composition among the present invention can be as the medicine of the hyperplasia class eye illness for the treatment of transforming grouth factor beta 2 or PDGF-mediation, for example, the suitable body that filters out at PDGF can be used for the treatment of eye illness, for example proliferative vitreoretinopathy, proliferative diabetic retinopathy and age-related macular degeneration.In addition, PDGF is fit to body can be used separately, also can combine use with other known therapies, as anti-VEGF therapy, and anti-inflammatory therapy, anti-hyperplasia treatment, antibacterium treatment, antifungal therapy and antimicrobial therapy.Transforming grouth factor beta 2 is fit to body can be used for the treatment of the postoperative damage of trabecular resection, as scar.Therefore, transforming grouth factor beta 2 be fit to body can be before the trabecular resection operation or during use.Transforming grouth factor beta 2 is fit to body can be used separately, also can combine use with other known treatment methods, as anti-inflammatory therapy, and anti-hyperplasia treatment, antibacterium treatment, antifungal therapy and antimicrobial therapy.
The transforming grouth factor beta 2 specificity is fit to autogenic therapy in the trabeculectomy Use
Transforming grouth factor beta 2 among the present invention is fit to body can be used with the form of eye drop.This method is not had a diffustivity, can make that to be tried body more comfortable.If by micromodule equipment, micropartical or gauze use.In above-mentioned operation, just adopt the mode of application.
Transforming grouth factor beta 2 is fit to body when using, freeze dried polymkeric substance as the doser of upholder with mix to drug solns, discharge then pleasing to the eye in.Sustained-release administration has an advantage from the polymeric matrix, promptly can specificity be tried the comfortableness and the conformability of body at target tissue and increase.Poly-newborn two alkyd (PLGA) are the optimal selections of capsule matrix, have obtained the authentication of FDA, and use since 1970 as a kind of suture material, and as the scaffold in the tissue kinetics.A lot of correlative studys are being arranged aspect its toxicology and the degradation kinetics.
In addition, the suitable body of transforming grouth factor beta 2 can also be by the doser administration of freeze dried polymkeric substance contact lense support.Contact lense is fit to body treatment doser increase is tried the dosage conformability of body, makes care-giver's application in suitable body therapeutic process more convenient, and guarantees suitable body administration constant zero-order.
Administration use volume is 100 μ l under the conjunctiva, operates with aforesaid method.
The use of the suitable body of transforming grouth factor beta 2 depends on that by microdevice near the conjunctiva micropartical or gauze or the preceding fragment uses the effective dose of eye drop down.Its freeze-drying is preserved, and restores with aseptic protectant bicarbonate buffer dissolving that do not have during use.The dosage range that transforming grouth factor beta 2 is fit to body is 0.1-200mg/kg.What be used for animal is 0.1-100mg/kg than the suitable dose scope, is more preferably 0.1-10mg/kg, and only is 0.1-1mg/kg.People's using dosage scope is 7-70mg/kg.
PDGF is fit to body in age-related macular degeneration (AMD) treatment Application
PDGF and other somatomedin, as VEGF, synergy has played vital role in the causing a disease of age-related macular degeneration.Anoxic has increased the expression of PDGF, and PDGF is direct and endotheliocyte effect by pdgf receptor b, thereby induces it pathogenic.PDGF acts on inoblast, smooth muscle cell, and neurogliocyte, and stimulate phorocytosis.
The suitable body of PDGF is 0.1-200mg/kg to the dosage range of animal, is suitable for 0.1-100mg/kg, better is 0.1-10mg/kg, and that best is 0.1-11mg/kg.People's using dosage scope is 7-70mg/kg.
PDGF is fit to body can carry out intravitreal injection by effective concentration 100 μ l administration volumes.Toponarcosis is carried out in earlier all tuberculin flushings again, passes the ciliary body plat part with the needle of 30 specifications and injects.Before administration, the bottle stopper is cleaned with 70% alcohol.
PDGF is fit to body and can freeze-drying preserves, and is dissolved in the sterile solution that 10 μ l sodium phosphates and 0.9% sodium-chlor damping fluid are formed.Be administered for a lot of ophthalmic diseases under the vitreum.Arrive intraocular by effective penetration.The tight complex body that retinal pigment epithelium and retinal capillary are formed forms blood-eyes barrier, stops medicine to infiltrate vitreum.This route of administration has been avoided a kind of potential side effect, has avoided the whole body administration, can be effectively at the target site administration.
In addition, the suitable body of PDGF can pass the sclera administration.Pass the sclera administration and be a kind of practicable mode of administration to the part administration of back.A big surf zone that can enter is arranged on the sclera, has the hydration of height, the combination that helps water-soluble substances with enter.Comparatively speaking, it lacks cell, therefore, almost there are not proteolytic ferment or protein binding site, can not in conjunction with or the chelating pharmaceutical compositions, sclera infiltration allows little seeing through with the macromolecule medicine, and infiltration dosage can not descend with the age, and is very effective for the treatment of the chronic disease of the elderly's pilositys such as age-related macular degeneration.It does not have pungency, and side effect is little, can be at the target site administration.In addition, the slow release of passing the sclera device makes PDGF be fit to body can to continue to discharge.
PDGF is fit to body and is applied to proliferative vitreoretinopathy (PVR)
The proliferative vitreoretinopathy surgical operation is slowly injected specific gas or liquid then from vitreous excision (ciliary body plat part vitreous excision) in eye, help amphiblestroid flattening and fit again with the eye outer wall.PDGF be fit to body can vitreous excision before or after or front and back all carry out intravitreal injection, dosage is 100 μ l administration volumes of effective concentration.Earlier, carry out toponarcosis again, pass the ciliary body plat part with the needle of 30 specifications and inject with the tuberculin flushing.Before administration, the bottle stopper is cleaned with 70% alcohol.PDGF is fit to body and can freeze-drying preserves, and is dissolved in the sterile solution that 10 μ l sodium phosphates and 0.9% sodium-chlor damping fluid are formed.Be administered for a lot of ophthalmic diseases under the vitreum.Arrive intraocular by effective penetration.The tight complex body that retinal pigment epithelium and retinal capillary are formed forms blood-eyes barrier, stops medicine to infiltrate vitreum.This route of administration has been avoided a kind of potential side effect, has avoided the whole body administration, can be effectively at the target site administration.
PDGF is fit to body can carry out administration by biodegradable micro-polymer system.Suitable body can wrap up into polymkeric substance and by predetermined speed and discharging.This point has been guaranteed the fixed point administration, dosage constant, and guaranteed conformability.The administration process is through having the piller of variable chemosmotic polymer coating to suitable body and carrying out.This implantation can be inserted into by passing the ciliary body plat part in vitreous excision.
In addition, the suitable body of PDGF can pass the sclera administration.Pass the sclera administration and be a kind of practicable mode of administration to the part administration of back.A big surf zone that can enter is arranged on the sclera, has the hydration of height, the combination that helps water-soluble substances with enter.Comparatively speaking, it lacks cell, therefore, almost there are not proteolytic ferment or protein binding site, can not in conjunction with or the chelating pharmaceutical compositions, sclera infiltration allows little seeing through with the macromolecule medicine, and infiltration dosage can not descend with the age, and is very effective for the treatment of the chronic disease of the elderly's pilositys such as age-related macular degeneration.It does not have pungency, and side effect is little, can be at the target site administration.In addition, the slow release of passing the sclera device makes PDGF be fit to body can to continue to discharge.
PDGF is fit to body and is applied to treat proliferative diabetic retinopathy
PDGF is fit to body can carry out intravitreal injection by effective concentration 100 μ l administration volumes.Earlier, carry out toponarcosis again, pass the ciliary body plat part with the needle of 30 specifications and inject with the tuberculin flushing.Before administration, the bottle stopper is cleaned with 70% alcohol.PDGF is fit to body and can freeze-drying preserves, and is dissolved in the sterile solution that 10 μ l sodium phosphates and 0.9% sodium-chlor damping fluid are formed.Be administered for a lot of ophthalmic diseases under the vitreum.Arrive intraocular by effective penetration.The tight complex body that retinal pigment epithelium and retinal capillary are formed forms blood-eyes barrier, stops medicine to infiltrate vitreum.This route of administration has been avoided a kind of potential side effect, has avoided the whole body administration, can be effectively at the target site administration.
And PDGF is fit to body can pass the sclera administration.Pass the sclera administration and be a kind of practicable mode of administration to the part administration of back.A big surf zone that can enter is arranged on the sclera, has the hydration of height, the combination that helps water-soluble substances with enter.Comparatively speaking, it lacks cell, therefore, almost there are not proteolytic ferment or protein binding site, can not in conjunction with or the chelating pharmaceutical compositions, sclera infiltration allows little seeing through with the macromolecule medicine, and infiltration dosage can not descend with the age, and is very effective for the treatment of the chronic disease of the elderly's pilositys such as age-related macular degeneration.It does not have pungency, and side effect is little, can be at the target site administration.In addition, the slow release of passing the sclera device makes PDGF be fit to body can to continue to discharge.
With cytokine, somatomedin and cell surface protein have in conjunction with special The suitable body of property
Cytokine, cell surface protein is relevant with multiple eye disease with somatomedin, comprises ICAM-1, transforminggrowthfactor-, transforming grouth factor beta 2, transforming growth factor-beta 3, IGF-1, VE GF/VEGF acceptor, TNF-α, the blood vessel factor and α 5 β 3.Adhesion molecule 1 (ICAM-1) is the surface glycoprotein of a 76-115kD in the born of the same parents, has the outer immunoglobulin like domain of 5 born of the same parents, plays an important role in diabetic retinopathy.The white corpuscle alluvial of ICAM-1 mediation is the pathogenic origin cause of formation of diabetic retinopathy.The β 2 on ICAM-1 and white corpuscle (neutrophilic granulocyte, basophilic granulocyte, lymphocyte, eosinophilic granulocyte, monocyte) surface integrates plain combination, firm sticks on the endothelium and to pass endothelial migration extremely important to inflamed sites to them.In diabetic retinopathy, ICAM-1 has strengthened the adhesion of white corpuscle and retinal blood guard system, it is also relevant with death with the damage of retina endotheliocyte, can cause the capillary blood irreversible ischemic that circulates, suppress the ICAM-1 biologic activity, stop the alluvial of diabetic retinopathy white corpuscle, and stoped blood-retinal barrier to be broken.
Insulin-like growth factor-1 (IGF-1) is the polypeptide of a 7.5kD, and the homology with Regular Insulin original 50% mainly results from liver, is regulated and control by tethelin.IGF-1 is the yield stimulant/mitogenic factor of a potential hyperplasia, is a kind of strong anti-cell programmed death factor.Its function is regulated and control by 6 igf binding proteins, and its level is subjected to the influence of developmental stage and nutritional status.The physiological action of IGF-1 comprises cell growth, protection, opposing oxidative pressure, promotes bone and muscle growth, neuroprotective cell etc.IGF-1 is relevant with revascularization, and being combined in the proliferative diabetic retinopathy of IGF-1 and VEGF plays an important role.The complication of proliferative diabetic retinopathy city diabetes is caused by retina medium vessels pathology.After the blood vessel in the retina damages, will cause blood leakage, bear breakable brush shape branch and scar tissue again, make the fuzzy distortion of the cerebripetal vision imaging of retina.
Regular Insulin exist and the effect of glycosyl end secondary species under, vascular endothelial growth factor and acceptor thereof (VEGF and VEGF/R) transcribe reinforcement.The accumulation of glycosyl end secondary species can cause neovascularization in the diabetic retina, and then causes visual loss.Insulin stimulating VEGF's is synthetic, can make diabetes be tried body instantaneous aggravation of retina neovascularization degree after insulinize.Dissociation constant (Kd) at the suitable body of VEGF-165 is 300pM, and the IC50 value is 1nM.
In retina inflammation and revascularization process, tumour necrosis factor (TNF-α) level can raise in the eye.TNF-α promotes the hyperplasia of tm cells, and regulation and control trabecular network, matrix metalloprotease kinases and organize the expression of inhibition increases MMP-1,3,9 and the expression of TIMP-1, reduce the expression of TIMP-2.Angiogenin is an angiogenesis factor, and two kinds of forms of Ang-1 and Ang-2 are arranged.Dissociation constant (Kd) at the suitable body of angiogenin is 10nM, and finds that it has the ability that the programmed death of blocking-up Ang-1 and Ang-2 mediation suppresses in the HUVEC cell that TNF-α handles.Integrin alpha 5 β 3 promote the revascularization (Enaida, et al., Fubushina J Med Sci.44 (1): 43-52 (1998)) of proliferative diabetic retinopathy and age-related macular degeneration.
Suitable body among the present invention can with ICAM-1, transforminggrowthfactor-, transforming grouth factor beta 2, transforming growth factor-beta 3, IGF-1, VEGF/VEGF acceptor, TNF-α and α 5 β 3 combinations respectively, or combine with wherein one or more, suppress their signal activity, therefore in the eye illness pathogeny, work.
The PEG derivative nucleic acids
With the feature of nucleic acid on pharmacokinetics and pharmacokinetics of the polymer-derived of high molecular non-immunogenic change having taken place all, makes it become more effective medicine.On activity, change the resistivity that can increase preferably, reduce kidney, reduce the immune degree that is exposed to, change curative effect in vivo its filteration to nuclease degradation.
Suitable body composition among the present invention may be to derive with poly-alkyl ethylene glycol (PAG).The example of the Nucleotide of PAG derivative is seen U.S. Patent application 101,718, and No. 833, on November 21st, 2003 submitted to, and entire chapter is incorporated into own forces in the reference.The typical polymers that is used for the present invention comprises polyoxyethylene glycol (PEG), polyoxyethylene (PED), glycol polypropylene (comprising polyisobutylene ethylene glycol).In addition, at random or the multipolymer of the different alkene oxide compound of monoblock (as: ethylene oxide, propylene oxide) can be used for a lot of the application.During their prevailing form, polyolefin glycol as PEG, is the polymkeric substance of a linearity, and each end stops with hydroxyl: HO-CH2CH2O-(CH2CH2O) n-CH2CH2-OH.This polymkeric substance, α-, Ω-dihydroxyl gathers (ethylene glycol), also can be expressed as HO-PEG-OH, the following structure of this symbology of PEG :-CH2CH2O-(CH2CH2O) n-CH2CH2-, the scope of n from 4 to 10,000.
The PEG molecule is bifunctional, sometimes also is called " PEG glycol ".PEG molecular end part is the non-activity hydroxylic moiety comparatively speaking, and-OH can be activated or be converted into the form of function, and PEG is combined with the avtive spot of other components.This activated PEG glycol is considered to two activated PEG.For example, PEG glycol terminal portions is exercised the function of activated carbon acid esters, with optionally with amino partial reaction, the succinimide active ester of N-hydroxy-succinamide partly replaces corresponding non-activity hydroxyl.
In a lot of the application, need add a cap sequence with the component of non-activity to it at an end of PEG molecule, make the PEG molecule become single function (or single activity).Under the situation of protein therapeutic method, a plurality of avtive spots are generally arranged at active PEG, dual-active PEG can cause a large amount of intersections, produces active very low polymkeric substance.In order to produce single active PEG, there is not the active oxygen methyl (OCH3) hydroxyl of replacement PEG glycol molecules one end with one.Another end that does not add cap of PEG molecule is converted into reactive end, thereby can contact with surfactivity site or protein molecular and react.
PAG typically has water-soluble and is dissolved in a lot of organic solvents, lacks toxicity, does not have the polymkeric substance of features such as immunogenicity.The purposes of PAG promptly with the shla molecule covalent attachment, obtain soluble PAG-molecule " combination ".For example, have been found that water-insoluble drug taxol, when it with after PEG combines, just become water miscible.The PAG combination not only is used to add strong water-soluble and stability, also is used for prolonging the transformation period of molecule in blood circulation.
The general 5-80kD size of poly-alkyl compound among the present invention.Other compound sizes are 10-80kD among the present invention, also have 10-60kD's.For example, the big or small minimum of a PAG polymkeric substance can be 10,2030,40,50,60 or 80kD.This polymkeric substance can for linearity or divide dendritic.
Compare with biological expressed protein medicine, nucleic acid drug generally is synthetic by reactive monomer Nucleotide chemistry.PEG-nucleic acid conjugate is to combine with PEG and prepare with same multiple monomer.For example, PEG can combine with the oligonucleotide that dissolves in liquid phase after changing the activation of phosphamide form into.In other words, oligonucleotide is synthetic can finish by the locus specificity combination that contacts the site with active PEG.The most generally it realizes (in the final step of solid phase synthesis coupled, with the phosphamide of modifying combination with it) by adding free amine on 5 '-end.In this approach, active PEG (as: activated, as can to react, and form associative key with amine molecule) combines with the oligonucleotide of purifying, and this is reflected in the solution and carries out.
PEG is relevant with several factors in conjunction with the ability that changes drug distribution, comprises the size (for example: according to grain diameter measurement) of conjugate.Bigger conjugate (＞10kDa) can more effective blocking-up through the filteration of kidney, the transformation period of macromole (as: polypeptide, antisense oligonucleotide) in serum that indirect increase is little.The ability of PEG conjugate blocking-up filteration increases with the size of PEG, till the about 50kD of diameter (it is very little further to increase influence, determines because the transformation period is changed into by macrophage-mediated metabolism, rather than has been discharged by kidney).
The production high molecular weight PEGs (＞10kDa) being difficult to, efficient is low and expensive.As an approach of synthetic macromolecule amount PEG-nucleic acid conjugate, at first work to focus on and produce the active PEG of high-molecular weight.A kind of method of producing this molecule is exactly to claim a kind of active PEG of branch-like, is that two or more PEG carry active group and are attached on the centronucleus.These high molecular weight PEGs molecular end parts promptly can be activated during the hydroxylic moiety of non-activity, perhaps can be converted into the part of function, and one or more PEG are combined with avtive spot on other conjugate.The active PEG of branch-like has 2 ends at least, if two or more ends have been activated, this living polymer amount PEG molecule will become how active PEG.In some cases, be not that all ends of molecularity PEG molecule all are activated.In case any two ends are activated, this PEG molecule has been exactly two active PEG, and in some cases, it is activated that branch-like PEG molecule only has an end, and this PEG molecule is exactly single active.An example of this respect research is: two single oxygen methyl PEG with activate the Methionin that is used to react subsequently and examine and combine and prepared active PEG (Harris et al .Nature, vol.2:214-221,2003).
The invention provides the approach that another saves the effective again synthetic macromolecule amount PEG-nucleic acid of cost (especially being fit to body) conjugate, also comprise synthetic (in Fig. 2, the setting forth) of the nucleic acid of a plurality of PEGization.The present invention has also done elaboration to the poly oligonucleotide that PEG connects.Be fit to body (also in Fig. 2, setting forth) as dimerization.The present invention also talks about in the high molecular weight component, and PEG is stable part, is the connectionist, it has separated the different piece of suitable body, for example, PEG is connected in the independent suitable body sequence, and the linear array that this high molecular is fit to body is: nucleic acid-PEG-nucleic acid-PEG nucleic acid.
High molecular weight component among the present invention comprises those molecules greater than 10KDa.General molecular weight is between 10-80KDa.High molecular weight component size among the present invention is at least 10,20,30,40,50,60, or 80KDa.
Steady component is the part of a molecule or molecule, has improved the pharmacokinetics and the pharmacodynamic profile of the suitable body of high molecular among the present invention.In some cases, steady component is to carry two or more suitable bodies or the molecule in suitable body structure territory or the part of molecule, makes the high molecular among the present invention be fit to the overall rotary freedom decline of body.Steady component can be poly-alkyl ethylene glycol, can for linearity or branch-like.Can also can be heterodimer for homodimer.Other the polymkeric substance such as peptide nucleic acid(PNA) (PNA) of having that can be used as steady component.Oligonucleotide also can be used as steady component, comprises the Nucleotide of modification and/or the chemical bond of modification.Be fit to the part in the body integral body during steady component, that is, and it and suitable body covalent attachment.
The present invention includes high molecular and be fit to the body composition, on two or more Nucleotide covalent attachment and at least one the poly-alkyl ethylene glycol.Poly-alkyl ethylene glycol is as steady component, and it is in the arbitrary end and its covalent attachment that are fit to body, and nucleic acid molecule is combined becomes a macromole, and therefore gathering alkyl ethylene glycol also has been the part of ligation.In this complex body, the primary structure of covalent attachment molecule comprises linearly aligned nucleic acid-PAG-nucleic acid.For example, the primary structure that has of conjugate is nucleic acid-PEG-nucleic acid.Another example is a linear array: nucleic acid-PEG-nucleic acid-PEG-nucleic acid.
In order to produce nucleic acid-PEG-nucleic acid covalent combination, nucleic acid should have only a reactive behavior site (for example, single active) when synthetic.One preferably pre-ferred embodiment be that this avtive spot is an amino, when the final step of oligonucleotide solid phase synthesis, introduces the phosphamide of a modification.Oligonucleotide goes to concentrate at the solution camber after protection and the purifying, and the spontaneous hydrolysis of active PEG is minimized.In the embodiment, the oligonucleotide of 1mM, his reconstituted solution is 200mM NaHCO 3Buffered soln, PH8.3.Covalent combination synthetic is by step by step the highly purified bifunctional PEG of interpolation is initial slowly.In the embodiment, PEG glycol two ends all have activity (two activated).Ensuing reaction is process gel electrophoresis of PEG-nucleic acid covalent conjunct agent or liquid chromatography purifying, isolates several classes such as complete, part or not covalently bound.A plurality of PAG molecules connect the polymkeric substance that (as: at random or interrupt multipolymer) or little PAG chain can connect into all lengths (or molecular weight is little), and non-PAG connects the PAG chain that can be used for all lengths.
A high molecular composition of the present invention has the structure shown in figure below:
Figure A20048000484200511
(the branched PEG-19 sequence of 40K-0.1KDa PEG-35 sequence-0.1KDa PEG-36 sequence).The Nucleotide that 2 '-O-methyl is modified represents with underscore, 3, and the Nucleotide that 2 '-fluorine is modified is represented with italics.2 '-O-methyl is fit to the degraded of physical efficiency opposing nuclease when 2 '-fluorine is modified, increase the transformation period in its body.3 '-3 '-dT cap sequence also can increase the activity to exonuclease.See United States Patent (USP) 5,674,685; 50,668,264; 6,207,816 and 6,229,002, their entire chapters are with reference to income.
The PAG active nucleic acid of deriving.High molecular PAG-nucleic acid-PAG covalent conjugates can be obtained with the nucleic acid reaction that comprises 1 avtive spot by single functionally active PEG at least.In the embodiment, nucleic acid is two active or two reaction site.Include two reaction site: 5 '-amino and 3 '-amino, they are incorporated in the oligonucleotide by the phosphamide of covalency is synthetic, and for example, 3 '-5 '-two PEGization are described in Fig. 2.Another example is to introduce reaction site in the mid-way.For example, No. 5 positions of pyrimidine, No. 8 positions of purine, or 2 ' of ribose can be as binding site.In this example, nucleic acid can have a plurality of activity or reaction site, for how active.In the ensuing synthetic and purifying, the oligonucleotide of modification combines with single active PEG under selective pressure, and the spontaneous hydrolysis reaction is minimized.In the embodiment, activated by the succinimide propionic salt at single methoxy-PEG, match reaction carries out when pH8.3.In order to promote the synthetic of two PEG of replacement, provide excessive PEG to oligonucleotide.Next, PEG-nucleic acid covalent conjunct agent separates kinds such as complete, part and not covalently bound by gel electrophoresis or hplc chromatography purifying.Fig. 2 has described two kinds of strategies that synthetic PEGization nucleic acid is fit to body.
Also can there be one or more poly-alkyl ethylene glycol component in the syndeton territory.This PAG can be an all lengths.Can be used for suitable combination, to obtain desired molecule amount composition.
The efficient of specificity linker can be influenced by its chemical composition and length.Oversize, too short or and the target molecule linker that formed unfavorable spatial disposition and/or ionic interaction all will hinder between suitable body and the target molecule and form complex body.If linker than the necessary distance between nucleic acid molecule, then can reduce the effective concentration of part, thereby reduce combination stability.Therefore, need to optimize linker component and length usually, with the avidity of maximization with target molecule.
Pharmaceutical composition
The present invention has also comprised the pharmaceutical composition that comprises suitable body molecule.In the embodiment, said composition is suitable for taking orally, and the pharmaceutical active compounds of the present invention that comprises enough effective doses is no matter with independent form or with the form of combination, and one or more proper drug carriers.These compounds whatsoever virulence are all very low.
Composition among the present invention can be used for treatment or prevention pathology, such as disease or disorder, perhaps relaxes disease or the disorderly symptom of being tried body.Be fit to cause or the relevant disease or the disorder of target molecule of body specific combination, composition of the present invention is very useful to it, to its prevention also of great use.
For example, target molecule is and pathogenic relevant albumen, as causes the target protein of disease.
Composition among the present invention can be used for the treatment of in the patient's that pathology is arranged the method.This method relates to and concerns to such an extent that target (as, albumen) bonded is fit to the composition that body is formed for patient uses by having with pathology, and composition has changed the biological function of target molecule with combining of target molecule, so can treat pathology.
Pathology tried body, as, with the body that tried of method treatment of the present invention, can be Mammals, more stably be human.
In practice, the salt of being accepted on this complex body or their medicament, dosage is advisable with enough inhibition production factor activity, as the transforming grouth factor beta 2 of mediated cell hyperplasia in the glaucoma and other proliferative disease.
Suitable body composition of the present invention combines with other treatment when the treatment eye illness.The body composition should be fit to and at least two suitable bodies can be comprised.In some example, combine administration with surgical operation, or use with other useful medicine, as anti-inflammatory medicaments, immunosuppressor, antiviral etc.In addition, composition of the present invention can be used with chemotherapeutic agent, as the alkyls medicine, and antimetabolic, mitotic division suppresses medicine, or the cell toxicant microbiotic etc.Generally speaking, the available combining form that is used for this bonded known treatment medicine at present all is suitable.
" drug combination " comprises the administration of suitable body composition of the present invention and at least a other medicines some as particular treatment.Thereby these medicine actings in conjunction provide better therapeutic.Drug combination shows as (but being not limited to) to the enhancing of curative effect, and the combined action of medicine kinetics and pharmacodynamics combines the pharmacological agent composition.The administration in a time of defining usually of these combined treatment compositions (select according to combination, be generally several minutes, hour or week).
" drug combination " can, do not finish administration separately but usually can two or more medicines do not separate, can at random not combine and administration by accident with the present invention.The administering mode that " drug combination " prepare to adopt is, these medicines are with orderly pattern administration, that is, every kind of medicine is at different time administrations, perhaps at least two kinds of synchronous administrations of medicine.In fact, administration synchronously can be finished the administration process by a plurality of pills that a pill is equipped with a certain proportion of mixture or contains different pharmaceutical separately.
Can finish orderly or synchronous administration by following approach: local approach, oral route, intravenous route, intramuscular approach reach and directly absorb by mucosal tissue.The administration of medicine can be passed through with one or more different approaches.For example, first kind of treatment reagent is selected drug administration by injection, and the administering mode of other medicament then is a topical.
In other words, all medicament can topical or all medicaments can drug administration by injection.The order of administration of medicament does not have strict qualification." drug combination " also can adopt above-mentioned medicament administration further with other bioactive ingredients and non-drug therapy (as, surgical operation) mode that combines, this combined therapy has further comprised non-drug therapy, it can be implemented in any suitable time, finished non-drug therapy during medicine acting in conjunction generation drug effect.For example, under suitable situation, when non-drug therapy temporarily removed from pharmacological agent several days or a few week still can keep good therapeutic action.
The medicament of compound of the present invention and other tool pharmaceutical active can be synchronously, sequentially or combine to being tried the body administration.When compound of the present invention uses.Compound and other pharmaceutical active medicament can be with receivability bearer synchronization of the same race administrations.They also can be with different pharmaceutical carriers, as oral dosage form easily.Drug combination refers to that further compound is with the administration in sequence of different medicine types.
Preferably, ocular drug topical or by the subconjunctival injection administration.The application repeatedly of most of medicine portion medicine can make the last subconjunctival injection of the levels of drugs ratio of intraocular, but subconjunctival injection has superiority in the administration of hyposmosis medicine (as, microbiotic) within the eye.By subconjunctival injection, just can have concentrated higher drug level with a spot of medicine at agents area, avoided the medication of deleterious whole body system.High tissue concentration also can obtain the medicine in cornea or conjunctival epithelium layer penetrating power difference.This method can not use the patient of local application very useful to those reliably.Intraocular drug can be injected after surgical operation, to avoid part or system's pharmacological agent.Conjunctiva and fascia bulbi before subconjunctival injection need be passed pin.This operation can directly be passed eyelid or directly be entered into space under the conjunctiva.Therefore fascia bulbi is between the medicine and eyeball of injection, and the amount of the medicine that absorbs by sclera has minimized.In fact, the mechanism of drug absorption may be that medicine permeates by the acupuncture site after the subconjunctival injection, is absorbed through cornea subsequently.
Various eye diseases are treated with the subconjunctival injection reflunomide.Reflunomide is the medicine of administration under a kind of conjunctiva, and it is penetrated under the sclera, and medicine is directly delivered to inflamed sites, rather than injection at random.Subconjunctival injection 5 '-Fluracil, a kind of fibrosis medicament that resists into is generally used for after the high risk trabeculectomy for glaucoma operation.Conjunctiva anesthesia down is used as the method for anaesthetizing behind the eyeball periphery of replacing now.Be used for trabecular resection operation or cataract operation.
Drug administration is very useful in the treatment of a lot of keratopathy under the conjunctiva, as bacterial canker.Cornea tissue can obtain the microbiotic of greater concn by subconjunctival injection, than whole body administration height.Antibiotic use also can be used as the useful additional of system's antibiotic therapy bacterial endophthalmitis under the conjunctiva.
Composition of the present invention need combine use with various pharmaceutical excipients, comprises stablizer, and carrier is or/and wrap etc.
The medicine type that is fit to injection must be aseptic liquid, is convenient to the suction of syringe.Under the situation of making and storing all must be stable, must prevent the pollution of microorganism (as bacterium, fungi etc.).
Composition medicable or pharmacology has been formed the active principle of combination therapy among the present invention, dissolving or launch in the suitable medium on pharmacology.Medium or carrier suitable on the pharmacology comprise any and all organic solvents, dispersion medium, and dressing, antibacterium and anti-mycotic agent wait to blend absorption delay agent etc.The medium of these pharmacological active substances and the use of formulation are for the people is known in the industry.These are augmented activeconstituents and also may be mixed in in the effective composition of the present invention.
Those skilled in the art can prepare the composition of effective pharmacology by the invention of this announcement.In general, this composition should be prepared into injected material, or is liquor, or is liquid suspension; Perhaps be the easily molten suspensible solid form of work, injection again after the dissolving; Also can be oral tablet or other solid form; It also can be slow releasing capsule; Or other form of using at present, comprise eye drop, lotion, ointment, inhalation etc.The medical worker cleans field of operation with aseptic physiological saline earlier during use.Said composition also can be by microdevice, and micropartical or cotton balls are transported to and are subjected to the medicine position.
In the treatment, dosage should be consistent with the dosage formula, is only medicable under this dosage.Administration can be with various formulations, and as above-mentioned injection solution type, medicament slow release capsule etc. also can.
In this article, the active principle of administration and composition volume depend on the host animal of treatment.Accurate active ingredient dosage depends on doctor's judgement, and everyone understands different.
Usually utilize the composition of minimum volume to go to launch active ingredient.We also have suitable administration rule, but will determine by initial administration and detected result, carry out dosage control every the regular hour then.
With tablet or capsular form oral administration (as: gelatine capsule), the active ingredient of medicine can be with oral, and atoxic, unvital carrier combination on the pharmacology is as ethanol, glycerine, water etc.In addition, suitable as required wedding agent, lubricant, decomposition agent and tinting material also can add in the medicine.Suitable wedding agent comprises the silicate of starch, magnalium, amylodextrin, gelatin, methylcellulose gum, sodium carboxy methyl cellulose.And/or polyvinylpyrrolidone, natural carbohydrate, as glucose, beta lactose, corn sweetener, natural and synthetic resin, as Sudan Gum-arabic, tragacanth or sodiun alginate, macrogol, wax etc.The lubricant that uses in these medicaments comprises sodium oleate, sodium stearate, Magnesium Stearate, Sodium Benzoate, sodium acetate, sodium-chlor, tripoli, talcum powder, stearic acid and magnesium salts thereof and silicon salt and/or polyoxyethylene glycol etc.Decomposition agent comprises, but is not limited to starch, methylcellulose gum, and agar, bentonite, yellow thick amylopectin, agar, alginic acid and sodium salt thereof, or effervescent mixture etc.Thinner comprises: lactose, glucose, sucrose, seminose, sorbose, Mierocrystalline cellulose and/or glycine.
Injectable composition is preferably the isoosmotic aqueous solution or suspension, and lipophilic emulsion or suspension help preparing suppository.Said composition should be aseptic.Comprise adjuvant, as protective material, stablizer, wetting agent or emulsifying agent, dissolution accelerator, the salt and/or the damping fluid of adjusting osmotic pressure.In addition, also should comprise other to treating useful material.According to routine preparation, granular or dressing etc. are multi-form, and the content of composition is 0.1-75%, preferably comprises the activeconstituents of 1-50%.
Composition of the present invention also can regularly discharge medicine and make slow releasing tablet, capsule, tablet, particle, elixir, tincture, suspension agent, syrup and emulsion with oral form administration.
Liquid, especially injectable composition can be by dissolving, and modes such as expansion are prepared.Solubilization of active ingredient in or mix with the purified organic solvent that will use, as water, physiological saline, glucose solution, glycerine, ethanol etc. form injectable solution or suspension thus.In addition, preparation is suitable for being dissolved in the solid form of liquid before injection.Injectable composition is preferably isotonic solution or suspension.Said composition should be aseptic, comprises adjuvant, stablizer, wetting agent or emulsifying agent, solvent promotor, the salt and/or the damping fluid of adjusting osmotic pressure.In addition, also should comprise other material useful to drug effect.
Composition of the present invention can pass through intravenously (transfusion of bolus box), intraperitoneal, and mode administration such as subcutaneous or intramuscular injection, every kind of mode described here all is the normal operations known of people in the industry.Injectable medicine should be mixed with liquor or suspension etc. and make things convenient for the available form.
The parenteral injection medication is generally used for subcutaneous, intramuscular or intravenous injection and transfusion.In addition, a method that also has administered parenterally guarantees to keep constant medicament level for injecting slow release or slow-released system, No. 3,710,795, the United States Patent (USP) in the document that sees reference, and it takes in this piece of writing in full.
In addition, composition of the present invention can use by inert matter in the suitable nose is local with form administration in the nose, or through transdermal route, the normal operations of using the insider to know.Because with the form administration that transdermal transports, dosage will continue, rather than intermittently.Other local application comprises emulsifiable paste, ointment, and lotion, aerosol spray and gel, here, the concentration range of active ingredient is 0.01%-15%, mass/mass ratio or mass/volume ratio.
At solids composition, vehicle comprises other N.F,USP MANNITOL of pharmaceutical grade, lactose, starch, Magnesium Stearate, asccharin sodium salt, talcum powder, Mierocrystalline cellulose, glucose, sucrose, magnesiumcarbonate etc.Active ingredient recited above can be mixed with suppository, with poly-alkyl ethylene glycol for example propyleneglycoles as carrier.In some pre-ferred embodiment, lipophilic emulsion or suspension are favourable to the preparation of suppository.
Composition of the present invention also can transport the form administration of system with liposome, for example, and little liposome, big liposome and liposome.Liposome can have multiple phosphatide to form, and comprises cholesterol, alkaline fat, phosphatidylcholine.In some specific exampless, one deck lipid composition film and pharmaceutical aqueous solution hydration form and are coated on the outer lipid layer of medicine, as United States Patent (USP) 5,262, described in No. 564.For example, suitable body-toxin described herein and/or nuclear reporter molecules can be built into complex body with the method that personnel in the industry know with lipophilic component or non-immunogenic high molecular weight component.United States Patent (USP) 6,011, the example that provides a nucleic acid related complexes No. 020.
Composition of the present invention can also match with the water-soluble polymers as the drug target carrier to combining.This polymkeric substance comprises polyvinylpyrrolidone, pyran co-polymer, and poly-alkyl propyl group-methylacrylic acid-phenol gathers alkyl ethyl asparagine phenol, or has the polyethylene oxidation polylysine of hexadecanoyl residue.In addition, composition of the present invention can also combine with biodegradable polymkeric substance pairing, so that drug release is controlled, for example, poly(lactic acid), poly-hexanoyl lactone, poly-alkyl butyric acid, poly-linear ester, poly-acetal, poly-dihydropyrane, poly-cyanoacrylate adhesive and crosslinked or intermediate both sexes interruption gel copolymer.
If desired, this medicinal compositions has also comprised a spot of atoxic auxiliary substance, as moistening or emulsifying agent, and PH buffer reagent and other material, as sodium-acetate, triethanolamine oleate etc.
The dosage of medication and mode are determined according to multiple factor, comprise type, race, age, body weight, sex and tried body medicine situation; Disease severity; Route of administration; Tried the hepatic and renal function situation of body, and tried body used other particular components or salt.Common physician and animal doctor can be easy to judge the effective dose that treatment is required.
Effective oral preparation scope of the present invention is 0.05-1000mg/ days.The content of said composition in tablet is 0.5,1.0,2.5,5.0,10.0,15.0,25.0,100.0,250.0,500.0 and 1000.0mg.Effective matrix horizontal extent of composition of the present invention is 0.002mg-50mg/ kg body weight/sky.Composition of the present invention can be by one day dosed administration, perhaps every day one day dosage is divided into two, three or four administrations.
Embodiment
Proteic purifying of embodiment 1 transforming grouth factor beta 2 and evaluation
The polynucleotide of the synthetic of coding total length human transforming growth factor β 2 maturation proteins is cloned into the pRSET coli expression carrier, changes in BL21 (plys) bacterial strain.Cell transformed is grown under the condition that makes transforming grouth factor beta 2 albumen high level expression, and forms inclusion body.Purifying also dissolves inclusion body.The transforming grouth factor beta 2 refolding, and, add that the transforming grouth factor beta 2 of His tail also can be by adding that at the N-of transforming grouth factor beta 2 end 30 extra amino acid obtain with exclusion chromatography (Fig. 4 A) purifying of S75 size.At 59 (S → T), 60 (R → K) and 94 (point mutation of K → N), corresponding and S58T/R60K/K94N mutant.The transforming grouth factor beta 2 of His tailing and sudden change all follows the same step of wild-type to express refolding and purifying.Fig. 4 B has showed the skeleton diagram of transforming grouth factor beta 2 at the exclusion chromatography wash-out of S75S size, comprises that the dimeric peak of transforming grouth factor beta 2 is consistent with the PAGE strip-type among Fig. 4 C.
Embodiment 2 transforming grouth factor beta 2 protein binding are to transforming growth factor β 2 specificitys are fit on the body
Be fit to the people of body and purifying or the protein bound dissociation constant of rodentine transforming grouth factor beta 2 has and 32The RNA of the RNA bonded nitrocellulose filter of P-mark decision in-vitro transcription handles (New England Biolabs) with calf intestinal alkaline phosphatase, with transferase 45 '-triguaiacyl phosphate, then with γ- 32P-ATP and T4 nucleic acid polymerase (New England Biolabs) thus cultivate together and carry out radio-labeling.Remove unconjugated mark by gel-filtration, use polyacrylamide gel electrophoresis (PAGE) to be further purified RNA again.Purifying in the water 32The refolding before using of the suitable body of P mark, 95 ℃ of heating 3 minutes, at room temperature (50mM heat shock protein, PH7.4,1mM MgCl in the binding buffer liquid then 2, 1mMCaCl 2, 3mM KCl, 140mMNaCl, 0.1mg/ml bovine serum albumin, 0.01mg/ml RNA) cultivated 10 minutes.Association reaction (100 μ l) is fit to body (≤0.1nM) beginning, at room temperature balance 10-30 minute then by adding in excessive transforming grouth factor beta 2 albumen.
Nitrocellulose filter divides adapted Minifold  I, 96 hole Dot blot menifold (Schileicher﹠amp; Schuell) finish.Protein bound suitable body and residue are fit to body freely respectively by moistening in advance Protran nitrocellulose (Schileicher﹠amp; Schuell) and Hybond-P polyvinyl dichloride (AmershamBiosciences) filter membrane catch by vacuumizing, and quantitative with phosphorescence imaging (Amersham Biosciences).Under each transforming grouth factor beta 2 concentration, the ratio of protein bound suitable body is according to counting/minute (the CPM NC) of Protran nitrocellulose filter and the demarcation recently of the CMP summation (CMP total) of Protran and Hybond-P filter membrane.The judgement of dissociation constant (KD) obtains and CPM NC/CPM total=C such as standard by transforming grouth factor beta 2 concentration (i.e. [TGF β 2]) temperature curve Max/ (2+KD/[TGF β 2] total), C here MaxEqual the maximum value that CPM NC/CPMtotal can reach when saturated [transforming grouth factor beta 2], can reflect that being suitable for discerning transforming grouth factor beta 2 suitably folds to such an extent that suitable body is made ratio.
Competitive analysisSome suitable body, she uses suitable bodies of high molecular weight PEGs component modified, with the nitrocellulose non-specific binding.Therefore the standard nitrocellulose filter is distributed and analyze not response.These suitable bodies are by analyzing with the competition of the suitable body (as ARC77) of other known features.
Be fit to the body competing reaction by in binding buffer liquid, 32(the pre-cultivation that≤unlabelled competition that 0.1nM) increases with concentration is fit to body (0.05-300nM) realizes the ARC77 of P mark.Association reaction begins by add suitable body sample in transforming grouth factor beta 2 albumen, and producing final concentration is the albumen of 2.5nM.When not having cold competition body to exist, under this transforming grouth factor beta 2 concentration, about 30% 32The ARC77 of P mark can observe and be attached on the Protran nitrocellulose membrane.With 32The ARC77 of P mark then competes increasing in conjunction with concentration of body in conjunction with minimizing, can describe in order to following pattern:
A * · P ↔ P K 1 ↔ K 2 A · P - - - ( 1 )
Here, A *For 32The ARC77 of P mark, P are that transforming grouth factor beta 2 is fit to body.A is that cold competition is fit to body, K 1Be albumen and the suitable interactional dissociation constant of body of the competition of heat, K 2Be albumen and the cold suitable interactional dissociation constant of body of competition.K 2Value is from CPM NC/ CPM TotalConcentration (i.e. [IA] with cold competition body Total) draw on the curve, meet equation 2.Need to satisfy [A *]＜＜[P] TotalCondition.
CPM NC CPM tota = C max 1 + ( 1 + [ A ] tota K 2 - [ P · A K 2 ) K 1 [ P ] tota - - - ( 2 )
Here [PA] has following secondary equation statement:
[ P · A ] = ( [ P ] total + [ A ] total + K 2 ) - {( [ P ] total + [ A ] total + K 2 ) 2 - 4 [ P ] total [ A ] total } 1 / 2 2
Each competition analysis all has a K 1Value, K 1Value is determined by above-mentioned standard binding analysis.
Fig. 5 A and 5B have showed that transforming grouth factor beta 2 is conjugated protein, have changed the concentration of the suitable body of transforming grouth factor beta 2 specificity.(A) 32The ARC77 of P mark (the transforming grouth factor beta 2 albumen of≤(0.2-100nM) human (●) or the mouse () that 0.1nM) increase with concentration is cultivated together, with the cellulose nitrate film analysis its in conjunction with situation.The Kd value of these suitable bodies is respectively ARC77:3.6 ± 0.6; ARC78:4.0 ± 0.5; ARC81:5.1 ± 0.4.The Kd value is obtained by equation 1.(B) dissociation constant that is fit to body is passed through 32The ARC77 of P mark to the competitiveness of people's transforming grouth factor beta 2 in conjunction with and obtain.Radiolabeled ARC77 () and the competitive bonded result of ARC81 (■) (shown in Fig. 5 B) are suitable for equation 2.
Embodiment 3 and transforming grouth factor beta 2 specificity bonded are fit to the kind of body
Three suitable volume recombination bodies of the present invention, ARC77, ARC78, ARC81 are and human and rodentine transforming grouth factor beta 2 specificity bonded kind, according to the affine combination of the method in the example 2.
As us seen in Fig. 6 A and the 6B, ARC81 be fit to body reversed the mediation of people's transforming grouth factor beta 2 to the outgrowth restraining effect of MLEC.Fig. 6 A has showed ARC77, and ARC78 and ARC81 are fit to the anti-proliferative activity that body has suppressed the 50pg/ml transforming grouth factor beta 2.The anti-transforming grouth factor beta 2 antibody (R﹠amp of thing in contrast; D AF-302-NA), has also reversed the hyperplasia effect of lower concentration aqueous humor.Shown in Fig. 6 B for ARC77 be fit to body to the resistant function of human transforming growth factor β 2 greater than to rodent.Both combine and see, these data declarations ARC77, ARC78 and ARC81 are fit to the biological activity that body can change transforming grouth factor beta 2.ARC77 is fit to the transforming grouth factor beta 2 that body can the specific antibody people.Fig. 6 C has illustrated that ARC77 is fit to body to human wild type (WT), mouse (NTK) and N end His tailing form human transforming growth factor β 2 have different binding affinities: wild-type (WT) 2.5 ± 0.3nM, mouse (NTK) 80 ± 5nM, His tailing 〉=500nM.
2000 cells in the every hole of MLEC were cultivated 4 hours down at 37 ℃.The suitable body and the transforming grouth factor beta 2 that add desired concn, 37 ℃, 16 hours.Measure cell proliferation with the Brdll hybrid system.The Brdll analytical method is done (Roche Diggno stics) by the step on the operational manual.
Embodiment 4 aqueous humor rechallenges
ARC81 reverse the aqueous humor mediation to the outgrowth restraining effect of MLEC.Fig. 7 A has shown that 1000nM ARC81 suppresses the anti-proliferative activity of rabbit aqueous humor (＜10%) of lower concentration.Anti-transforming grouth factor beta 2 antibody (R﹠amp; D, AF-302-NA), thing has in contrast also reversed the hyperplasia effect of lower concentration aqueous humor.As can be seen, ARC81 antibody and anti-transforming grouth factor beta 2 antibody have been removed the MLEC hyperplasia inhibition of rabbit aqueous humor mediation in dosage dependence mode among Fig. 7 B and the 7C.From this two width of cloth figure as can be seen, these data declarations ARC81 be fit to body and can reverse the biological function of transforming grouth factor beta 2 in aqueous humor.
The MLEC testThe test of mink pulmonary epithelial cells hyperplasia need be carried out more than two days.First day: 1) (MLEC) sucking-off culture from the mink pulmonary epithelial cells; 2) clean MLEC with 10ml 1 * PB S; 3) adding 3ml trypsinase, and tryptic digestion 3 minutes, 37 ℃; 4) with 10ml 0.5%FBS substratum stopped reaction; 5) 1000rpm changeed 3.3 minutes; 6) sucking-off supernatant liquor; 7) with the resuspended precipitation of 10ml 0.5%FBS substratum; 8) counting 10 μ l cell suspensions; 9) adjust cell density to 80,000 cell/ml; 10) add 50 μ l cells/well (4000 cells/well) in black matrix 96 orifice plates; Pressure-vaccum avoids cell precipitation and fabric swatch unbalanced several times in the fabric swatch process; 11) at 37 ℃, 5%CO 2The middle cultivation 4 hours makes cell attachment; 12) add 25 μ l and be fit to body (or substratum, or other experiment reagent, as, antibody), preferably outer hole is not used to handle cell; 13) add 25 μ l transforming grouth factor beta 2s (25pg/ml usually); 14) 37 ℃, 5%CO 2Middle culturing cell spends the night.
Second day: 1) 20 μ l BrdU and 2ml 0.5%FBS substratum are mixed; 2) every hole adds 10 μ l BrdU; 3) 37 ℃, 5%CO 2 Middle culturing cell 3 hours; 4) outwell substratum, dry the hybridization plate with paper; 5) every hole adds 200 μ l Fix Denat solution, at room temperature cultivates 30 minutes; 6) outwell FixDenat solution, dry the hybridization plate with paper; 7) every hole adds the anti-BrdUPOD solution of 200 μ l, cultivates 90 minutes under the room temperature; 8) outwell anti-BrdU POD, dry the hybridization plate with paper handkerchief; 9) every hole adds 200 μ l washing composition, at room temperature cultivates 5 minutes, washes the hybridization plate 3 times, dries the hybridization plate with paper handkerchief; 10) every hole adds 100 μ l substrate solutions, room temperature dark culturing 30 minutes; 11) read plate at Top Count, analytical results.
Add 2000 MLEC cells in every hole, cultivated 4 hours for 37 ℃.Be fit to body, antibody, aqueous humor and transforming grouth factor beta 2 and add, cultivated 16 hours for 37 ℃ by certain concentration.Mix measurement hyperplasia with BrdU.The operation of BrdU test is carried out (RocheDiagnostics) according to the requirement of operational manual.
Embodiment 5 selects to minimize and the transforming grouth factor beta 2 specificity is fit to body
Identify
The RNA that modifies among the present invention is fit to body, combines with natural human body transforming grouth factor beta 2 as ARC77 (sequence number 1), can interrupt the effect that the mink pulmonary epithelial cells suppresses the transforming grouth factor beta 2 in the experiment.Further carry out biochemical identification to being fit to body, intestinal bacteria produce the ripe transforming grouth factor beta 2 of two kinds of forms, the form of natural form and N-end His tailing.Behind refolding and the purifying, obtain meritorious transformation of energy grouth factor beta 2.These transforming grouth factor beta 2s are activated in cell experiment.The combination of N-end tail influence activity and suitable body, the avidity that is fit to body reduces significantly.Further produced, the transforming grouth factor beta 2 of two sudden changes (being labeled as K94N and S59T/R60K/K94N), they are the isomers of transforming grouth factor beta 2.The K94N mutant can combine with suitable body, and avidity is suitable with natural transforming grouth factor beta 2, and the avidity of S59T/R60K/K94N mutant and suitable body then greatly reduces.Equally, in the cell levels experiment, be fit to body natural and the bioactive destructiveness comparison of K94N transforming grouth factor beta 2 S59T/R60K/K94N are wanted high.Based on the crystalline structure of having announced, at 59 and 60, near transforming grouth factor beta 2 dimer combining site and the N-end two replacements are arranged, 94 near II receptor binding site also have a replacement.Learn that with the binding competition experiment of dissolved transforming growth factor-b acceptor the III receptor combines with suitable body competition, rather than the II receptor.By data as can be known, two suitable bodies combine with a dimer transforming grouth factor beta 2.Suitable body of the present invention combines with transforming grouth factor beta 2 at transforming growth factor-bIII receptor combination point place, destroys its biological function.
Test minimizes and dashes forward/modify.Fig. 8 A is the selection to the suitable body of sequence 1 (ARC77), the elaboration that minimizes and identify.The disappearance of residue and the influence of binding affinity are pointed out in Fig. 8 A and Fig. 8 B.The residue of playing frame among Fig. 8 A is represented the residue of high conservative.The binding affinity that suitable body is attached on the transforming grouth factor beta 2 is determined (Fig. 8 B) by the test of dot hybridization protein bound.Transforming grouth factor beta 2 is fit to body can reverse transforming grouth factor beta 2 restraining effect in the MLEC hyperplasia.Irregular suitable body (being denoted as " ARC77 transcribes " in Fig. 8 C) is used for negative regulation, and transforming grouth factor beta 2 neutral antibody is then as just regulating and control.
Fig. 9 represents to be fit to body/transforming grouth factor beta 2 dimer chemistry metering, is determined by the α screening.The suitable body and function fluorescein or the biotin labeling of different concns combine with anti--FITC acceptor globule or Streptavidin donor globule, with the titration of transforming grouth factor beta 2 homodimer.With mixing the flat-panel detector detection signal.
Figure 10 A for by various modifications and/or the suddenly change collection of illustrative plates of determined transforming grouth factor beta 2 binding site of wild-type transforming grouth factor beta 2.Three transforming grouth factor beta 2 varients have been tested: wild-type transforming grouth factor beta 2, the transforming grouth factor beta 2 of the transforming grouth factor beta 2 of long-tail form and short-tail form.In addition, also detected two mutant, K94N and S59T/R60K/K94N mutant are obtained by the mode of wild-type transforming grouth factor beta 2 by quick point mutation.These protein (that is: wild-type, S59T; R60K/K94N, K94N, N long-tail transforming grouth factor beta 2 and N short-tail transforming grouth factor beta 2) under the situation that the suitable body of transforming grouth factor beta 2 exists, cultivate, their EC100 value, binding affinity and IC50 value (nM) have been determined (Figure 10 B), are fit to body and those proteic binding affinities and determine by dot hybridization.The inhibition activity that is fit to body.The IC50 value is determined by the test of MLEC hyperplasia.
Figure 11 shows that the transforming grouth factor beta 2 that is combined in that transforming growth factor III receptor can interrupt being fit to body and transforming grouth factor beta 2 carries out with III type or the pre-cultivation of II receptor solution afterwards again.Dot hybridization is analyzed, and definite suitable body combines with transforming grouth factor beta 2.The Ki value is by the data computation of simple competitive mode.
Table 1-is fit to the body sequence
SEQ?ID?No.1?ARC77-TGFβ2
5′-GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC-3T-3′
SEQ?ID?No.2?ARC78-TGFβ3
5’NH2-GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC-3T-3’
SEQ?ID?No.3?ARC79-TGFβ2
5′-
mGmGmAmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfUfCfC-3T-3′
SEQ?ID?No.4?ARC81-TGFβ2
5′-NH2-
mGmGmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfCfC-3T-3′
SEQ?ID?No.5?ARC82-TGFβ2
5′-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.6?ARC111-TGFβ2
5′-[20KPEG]-NH2-
GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC-3T-3′
SEQ?ID?No.7?ARC112-TGFβ2
5′-[PEG30K]-NH2-
GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC-3T-3′
SEQ?ID?No.8?ARC113-TGFβ2
5′-[PEG40K]-NH2-
GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC-3T-3′
SEQ?ID?No.9?ARC117-TGFβ2
5′-[PEG20K]-NH2-
mGmGmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfCfC-3T-3′
SEQ?ID?No.10?ARC118-TGFβ2
5′-[PEG30K]-NH2-
mGmGmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfCfC-3T-3′
SEQ?ID?No.11?ARC119-TGFβ2
5′-[PEG30K]-NH2-
mGmGmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfCfC-3T-3′
SEQ?ID?No.12?ARC120-TGFβ2
5′-[PEG20K]-NH2-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.13?ARC121-TGFβ2
5′-[PEG30K]-NH2-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.14?ARC122-TGFβ2
5′-[PEG40K]-NH2-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.21?ARC152-TGFβ2
5′-[NH2]-
mGmGmAmGmGfUfUAfUfUmAtCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfUfCfC-3T-3′
SEO?ID?No.4?ARC154-TGFβ2
5′-[NH2]-
mGmGmAmGmGfUfUAfUfUmAfCmAmGmAmGfUfCfUGfUAfUAmGfCfUmGfUmAfCfUfCfC-3T-3′
SEQ?ID?No.23?ARC155-TGFβ2
5′C-[NH2]-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.24?ARC156-TGFβ2
5′-[tatp]-[NH2]-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T3′
SEO?ID?No.25?ARC157-TGFβ2
5′-[antp]-[NH2]-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.26?ARC158-TGFβ2
5′-[arg7]-[NH2]-
mGGmGmGfUfUmAfUfUAfCAmGmAmGfUfCfUmGfUmAfUmAmGfCfUmGfUAfCfCfC-3T-3′
SEQ?ID?No.27?ARC159-TGFβ2
5′-[NH2]-[NH2]-
mGmGmAmGmGmUmUmAmUmUmAmCmAmGmAmGmUmCmUmGmUmAmUmAmGmCmUmGmUmAmCmUmCmC-3T-3′
Embodiment 6PDGF is applied to the treatment of eye illness
The strong promoting mitosis of platelet derived growth factor (PDGF) plays crucial effect in various hyperplasia class diseases.Table 1 has been listed three kinds of dose concentrations to the useful suitable body sample of treatment eye illness in the mouse test.To the male mice intravenous injection dosage of 5-6 week size is that 1mg/kg or subcutaneous injection dosage are 1,5 and 20mg/kg.The time point of intravenous administration is 0,5,10,20,40 minutes, and 1,2,4,6,8 and 10 hours.Subcutaneous injection administration time point is 0,10,20,40 minutes, 1,2,4,6, and 8,10 and 12 hours.(PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T) is with PDGF AB and BB is affine combines Kd value 100pM for ARC125 (No. 16 sequences) and ARC127.(PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T) screen from the single stranded DNA storehouse, 2 '-O-methyl (underscore) and 2 '-fluorine (italic) are changed modification to ARC127 then, and add 40k PEG group.2 '-O-methyl, 2 '-fluoridize the trim to suit body to stablize.Degraded with the opposing endonuclease increases the intravital transformation period.3 '-3 '-dT cap sequence has increased the resistibility to exonuclease.40k PEG group has then increased the PK characteristic of ARC126.
Table 2-PDGF specificity is fit to body
Sample Mole (g mol -1) Ext?coeff (L?mol -1?cm -1) Dose concentration (mg ml -1) Dosage level (mg eye -1)
ARC126 10,129.47 265,400.00 20 0.02
ARC127 50,128.47 265,400.00 20 0.02
ARC128 50,128.47 264,800.00 20 0.02
As determined by anion exchange HPLC and/or CGE: determine by HPLC and/or GGE ion-exchange.
Calculated using aptamer weight only: only calculate with being fit to body weight
ARC123 (sequence number 15), ARC124 (sequence number 16) and ARC125 (sequence number 17) screen from the single stranded DNA storehouse, are used in conjunction with PDGF AB and BB acceptor, and the Kd value is 100pM.They are without any modification group, but 3 '-3 '-dT cap sequence is arranged.Be used to increase resistibility to exonuclease.
Table 3-PDGF is fit to body
ARC123(SEQ?ID?No.15)：
5′-
TdGdGdGdAdGdGdGdCdGdCdGTTdCTTdCdGTdGdGTTdAdCTTTTdAdGTdCdCdCdG-3T-3′
ARC124(SEQ?ID?No.16)：
5′-
dCdAdCdAdGdGdCTdAdCdGdGdCdAdCdGTdAdGdAdGdCdATdCdAdCdCdATdGdATdCdCTdGTdG-3T-3′
ARC125(SEQ?ID?No.17)：
5′-
TdAdCTdCdAdGdGdGdCdAdCTdGdCdAdAdGdCdAdATTdGTdGdGTdCdCdCdAdATdGdGdGdCTdGdAdGTdA-3T-3′
ARC126 (SEQ ID NO:18-PEG-SEQ ID NO:33-PEG-SEQ ID NO:34) (the functional body that accommodates):
5′-[NH2]-dCdAdGdGdCfUdAfCmG(SEQ?ID?NO：18)-PEG-dCdGTdAmGdAmGdCdAfUfCmA(SEQ?ID?NO：33)-PEG-TdGdATfCfCfUmG-3T-3′(SEQID?NO：34)
ARC127 (PEG-SEQ ID NO.19-PEG-SEQ ID NO:35-PEG-SEQ ID NO:36-3T) (the functional suitable body of PEGization):
5′-[PEG40K]-NH2-dCdAdGdGdCfUdAfCmG(SEQ?ID?NO：19)-PEG-dCdGTdAmGdAmGdCdAfUfCmA(SEQ?ID?NO：35)-PEG-TdGdATfCfCfUmG-3T-3′(SEQID?NO：36)
ARC128 (PEG-SEQ ID No.20-PEG-SEQ ID NO:37-PEG-SEQ ID NO:38-3T) (mixture control):
5′-[PEG40K]-NH2-dCdAdGfCmGfUdAfCmG(SEQ?ID?NO：20)-PEG-dCdGTdAdCdCmGdATfUfCmA(SEQ?ID?NO：37)-PEG-TdGdAdAdGfCfUmG-3T-3′(SEQID?NO：38)
Figure 13 A and 13B have shown ARC127 (binding curve and the kd value of PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T).BB and the AB isomers of ARC127 identification PDGF have been set forth.But nonrecognition AA isomers.Figure 14 A and 14B have showed ARC127 (PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T) the avidity combination to equate with people and mouse PDGF.The ability of the ability of ARC127 blocking-up PDGF inductive 3T3 hyperplasia and anti-PDGF antibody (upstream/cell signal solution) blocking-up PDGF inductive T3T hyperplasia is suitable.
(PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T) is interrupted the migration of retinal pigment epithelium (RPE) specifically to Figure 15 shows that ARC127, and ARC128 (PEG-20 sequence-PEG-37 sequence-PEG-38 sequence-3T), it is an irregular suitable body, do not have activity, especially Figure 15 A has shown the migration that does not have the RPE of PDGF cell.Figure 15 B has shown the RPE cell migration that contains 100ng/ml PDGF.What Figure 15 C showed is the migration that contains the RPE cell of PDGF and 100mM ARC127, has set forth the break-up effects of ARC127.Figure 15 D has shown the migration of the RPE cell that contains PDGF and 100mM ARC128, and having set forth does not have break-up effects when irregular suitable body reaches (ARC128) control.When the pictorialization PDGF concentration among Figure 15 E and the 15F increases to the influence of RPE cell migration.
Figure 16 has shown the ARC127 (stability in the protoplasma in the body 95% in the time of 37 ℃ of PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T).Transformation period (the t of the ARC127 that modifies 1/2) than the t of total DNA 1/2Long 14 times.
The pharmacokinetics of embodiment 7ARC127 and biological activity
By to mouse vein (IV), peritoneal cavity (IP), a pharmacokinetic (03002-002) has been carried out in subcutaneous (SC) medication, to determine the pharmacokinetics of ARC127.Table 4 has shown the result of research, and under the dosage of 10mg/kg, the biological effectiveness of abdominal cavity and subcutaneous administration compares vein, peritoneal cavity and subcutaneous injection height, Figure 17 show by vein, peritoneal cavity, the overdose administration in 50 hours of subcutaneous injection approach, ARC127 is fit to the nM concentration of body.ARC127 has been found that to have following properties: dissociation constant 100pM, cell IC 50Value: 2nM; There is not tangible cell toxicity effective to glomerulitis, cancer and pulmonary hypertension in zootype; C during 1mg/kg MaxBe 2 μ M; Solubleness 20mg/ml; The transformation period 6-12 of system hour (intravenous injection) and 3.87 days (abdominal injection) have been listed in embodiment 12.ARC127 can comprise vein, abdominal cavity, subcutaneous injection and intravitreal injection by the drug administration by injection of number of ways.The bioavailability of ARC127 is 62.5% by abdominal injection, is 24.0% by subcutaneous injection.
Show 4ARC127 through mouse vein (IV), peritoneal cavity (IP), the dosage that subcutaneous (SC) presses 10mg/kg injects the intravital pharmacokinetics overview of mouse.
Cmax (nM) ?tmax ?(hr) ?AUC ?(hrnM) ?MRT ?(hr) c1/2 (hr) Vz (L/kg) Bioavailability, F
?IV 29711.6 ?2 ?229686.8 ?6.57 8.60 0.053 1.000
?IP 12756.0 ?8 ?143605.5 ?11.23 7.86 0.078 0.625
?SC 3176.7 ?8 ?55030.9 ?16.63 9.18 0.238 0.240
Here C MaxRefer to maximum serum or substrate concn; AUC refers to the area that concentration-time curve is following, and AUC last refers to the region area before the last last point of following time of concentration-time curve; AUC inf refers to be extrapolated to below the concentration-time curve infinite region area; T 1/2Refer to the final transformation period; CL refers to clearance rate; MRT refers to retention time; MRT inf refers to infinite retention time; Vss refers to distribute surface volume.
In addition, ARC127 has been done research once more through the biological activity overview of intravenously administrable.The result of competitive binding analysis data is consistent with the medicine dynamics data, learns that therefrom ARC127 also had measurable activity (seeing Figure 18) in vivo in 48 hours later on.It is the suitable body of the anti-PDGF potentiality of tool that these data have been set forth ARC127, has in the body to render a service Kd 100pM cell IC 502nM.In addition, this effectiveness has been set forth in a large amount of body internal schemas.Pharmacokinetics/pharmacodynamic study shows: system's transformation period of ARC127 was C at 1mg/kg between 6-12 hour MaxBe 2 μ M.In addition, the transformation period of ARC127 in aqueous humor is 3.5 days, done elaboration in the experiment of describing in embodiment 4.
In sum, these data declarations ARC127 be that the anti-PDGF of a kind of potential is fit to body, it is a kind of new medicine that when being total to administration, has anti-angiogenic reproducing characteristic, be oncotherapy, a kind of new drug in the treatment of eye diseases such as proliferative diabetic retinopathy and age-related macular degeneration.
The treatment of embodiment 8 transforming grouth factor beta 2s is fit to body and is applied to vitreum
Interior injection
Have the suitable body with the transforming grouth factor beta 2 binding affinity, the intravitreal injection administration is arranged, the about 100 μ l/ eyes of volume injected, the dosage of various route of administration is respectively: intravitreal injection: 0.5-5mg/ eye, subcutaneous administration; 1-5mg (the not suitable body of conjugated); Intravenous administration: 1-20mg/kg.The concentration difference of various route of administration: intravitreal injection: 1-5mg/0.250ml=4-20mg/ml; Subcutaneous administration: 1-5mg/0.00ml=10-50mg/ml; Intravenous administration: 1-20mg/0.250-1.0ml=1-80mg/ml.Administration time is assigned as: vitreum and subcutaneous route administration: pre-administration, 5 minutes, 30 minutes, 0,6,12,24 and 72 hours; Intravenous route administration: pre-administration, 5,30 minutes, 1,6,12,24 and 48 hours.Figure 12 shows that ARC77 is fit to the distribution of body, has set forth the zone of adorned suitable body.
Table 4-transforming grouth factor beta 2 is fit to the body sequence
ARC77 SEQ ID No.1:(34nt; Cell IC50=10nM, K D=1nM) 17,2 ' OH purine; 17,2 ' F-pyrimidine, 5 '-G-G-A-G-G-fU-f U- A-f U-fU-A-fC-A-G-A- G-f U-fC-fU- G-fU- A-f U- A-G-fC-fU-G-fU-A-fC-fU-fC-fC-[3 ' T]; K D=1nM, 9 underscores are immutable zone.
ARC79 SEQ ID No.3:(34nt, cell IC 50=10nM, K D=1nM) by with RNA 2 '-oxygen methyl substituted nucleic acid residue 4 important Nucleotide of underscore (have except), improvement chemistry/endonuclease enzyme stability.
The gravity treatment SFLEX that embodiment 9 transforming grouth factor beta 2s are newly-increased TMBe fit to body
Newly-increased heavily screening SELEX TMProcess is carried out at transforming grouth factor beta 2 in the library; Primer is used for the lower situation of Doped re-SELEX:(and represents 30% newly-increased residue).These libraries are amplified, and transcribe respectively, and the first round mixes then.
SEQ?ID?No.28?TK.82.140.A(14i-1)
TCGGGCGAGTCGTCTGgaaggaattttactacaacgttacttccgcatcctccCCGCATCGTCCTCCCTATAGTGAGTCGTATTA
SEQ?ID?No.29?TK.82.140.B(21a-4)
TCGGGCGAGTCGTCTGgcggacttagtatatacatacgactaaacaacgccgcCCGCATCGTCCTCCCTATAGTGAGTCGTATTA
SEQ?ID?No.30?TK.82.140.C(21a-21)
TCGGGCGAGTCGTCTGggagtacagctatacagactctgtaataacctccCCGCATCGTCCTCCCTATAGTGAGTCGTATTA
SEQ ID No.31 5 '-Primer TK.82.140.D (positive-sense strand)
TAATACGACTCACTATAGGGAGGACGATGCGG
SEQ ID No.32 3 '-Primer TK.82.140.E (antisense strand)
TCGGGCGAGTCGTCTG
The new weightening finish screening SELE that transforming grouth factor beta 2 heavily screens TMProgram is as described below.With the newly-increased library of PAGE purifying.Increase the preparation template with PCR.The PCR product of purifying is transcribed with the Y639F RNA polymerase, adds 2 '-F pyrimidine nucleotide, 2 '-OH purine ribonucleotide.The RNA that obtains also is used for first round screening.
Preceding two-wheeled SELEX TMScreening is hybridized with nitrocellulose filter (NC).500pM human transforming growth factor β 2 (h transforming grouth factor beta 2) hybridizes on the pretreated NC film.At air drying.This film is at room temperature added 1mM MgCl 2, in the Dulbecco phosphate buffered saline buffer (DPBS) with 3 newly-increased RNA storehouse co-cultivation 1 hour.Wash film 3 times with DPBS, transforming grouth factor beta 2 bonded RNA 95 ℃ of elution buffers (7M urea, 100mM sodium-acetate (PH5.0), 3mM EDTA) wash-out of preheating.The RNA of wash-out phenol/chloroform extracting, ethanol sedimentation carries out reverse transcription, pcr amplification then.The template of transcribing of gained adds Y639F single mutation RNA polymerase, and 2 '-F pyrimidine nucleotide and 2 '-OH purine ribonucleotide are transcribed, and enter next circulation.
In the third round circulation, SELEX is by hydrophobic plate screening.100 μ l20nM h transforming grouth factor beta 2s and NUNC MaxiSorp plate (positive plate) in DPBS, (do not contain 0.1mg/ml tRNA) 37 ℃ cultivated 1 hour.Simultaneously, RNA storehouse (containing 0.1mg/ml tRNA) on negative pole 37 ℃ cultivated 1 hour.Be used for negative screening.The albumen plate washs with 6 * DPBS.The RNA storehouse of prescreen on positive pole 37 ℃ cultivated 1 hour, wash this plate with 6 * DPBS, remove unconjugated RNA, then, carry out reverse transcription onboard, the pcr amplification reverse transcription product.Transcribe template at 2 '-F pyrimidine nucleotide, under the situation that 2 '-OH purine ribonucleotide exists, transcribe, enter the next round circulation with the Y639F RNA polymerase.
Transforming grouth factor beta 2 carries out gradient dilution in the DPBS that contains 0.2mg/ml BSA and 0.2mg/mltRNA. 32The RNA of P mark (＜20pM) at room temperature cultivated 30 minutes with transforming grouth factor beta 2.Sample is transferred to 0.45 micron nitrocellulose filter of pre-wetted with the bull transfer pipet, Hybond membrane, and (order is from top to bottom) absorbs the back and washs with 3 * DPBS (comprising tRNA) on the 3MM filter paper.Three kinds of filtering membranes develop on the phosphorescence showing board all at air drying.Analyze with Imge Quant.Listed in the table 5 with the transforming grouth factor beta 2 bonded and be fit to the body full length sequence.
The up-to-date weightening finish screening of table 5-transforming grouth factor beta 2 is fit to the body full length sequence
S5CR12-27 GGGAGGACGAUGCGGAUCGAGUAUUAUAGAGUAUGUAUAGCUAUACGAUCAGACGACUCGCCCGA(SEQ?ID?NO：39)
AMX(71)_F7 * GGGAGGACGAUGCGGAUCGAGUAUUAUAGAGUAUGUAUAGCUAUACUAUCAGACGACUCGCCCGA(SEQ?ID?NO：40)
AMX(71)_A11 GGGAGGACGAUGCGGAUCGAGUAUUAUAGAGUAUGUAUAGCUAUACGGUCAGACGACUCGCCCGA(SEQ?ID?NO：41)
AMX(71)_B9 GGGAGGACGAUGCGGAUCGAGUAUUAUAGAGUCUGUAUAGCUAUACGAUCAGACGACUCGCCCGA(SEQ?ID?NO：42)
AMX(71)_B11 GGGAGGACGAUGCGGAUGGAGUAUUAUAGAGUAUGUAUAGCUAUACCAUCAGACGACUCGCCCGA(SEQ?ID?NO：43)
AMX(71)_C11 GGGAGGACGAUGCGGAUAGAGCAUUAUAGAGUAUGUAUAGCUAUACUAUCAGACGACUCGCCCGA(SEQ?ID?NO：44)
ARC232
S5CR8-15 GGGAGGACGAUGCGGAUAGAGUAUUAUAGAGUAUGUAUAGCUAUACUAUCAGACGACUCGCCCGA(SEQ?ID?NO：45)
AMX(71)_G9 GGGAGGACGAUGCGGACAGAGUAUUAUAGAGUAUGUGUAGCUAUACCGUCAGACGACUCGCCCGA(SEO?ID?NO：46)
S5R12-33 GGGAGGACGAUGCGGACAGAGUAUUAUAGAGUAUGUGUAGCUAUACCGUCAGACGACUCGCCCGA(SEQ?ID?NO：47)
S5R12-12 GGGAGGACGAUGCGGACAGAGUAUUAUAGAGUAUGUAUAGCUAUACCGUCAGACGAUCGCCCGA(SEQ?ID?NO：48)
AMX(71)_F11 GGGAGGACGAUGCGCGGACAGCAUUAUAGAGUGUGUAUAGCUGUACUGUCAGACGACUCGCCCGA(SEQ?ID?NO：49)
AMX(71)_F3 GGGAGGACGAUCGGCACAGAGUAUUAUAGAGUAUGUAUAGCUAUACUAUCAGACGACUCGCCCAA(SEQ?ID?NO：50)
ARC235
S5CR8-45 GGGAGGACGAUGCGGACAGAGUAUUAUAGAGUAUGUAUAGCUAUACUGUCCAGACGACUCGCCCGA(SEO?ID?NO：51)
ARC228
S5R8-10 GGGAGGACGAUGCGGACAGAGUAUUAUAGAUGUAUAGCUAUACUACUGUCAGACGACUCGCCCGA(SEQ?ID?NO：52)
AMX(71)_H7 GGGAGGACGAUGCGAAAGAGUAUUAUAGUCUGUAUAGCUAUACUACUGCUAGACGACUCGCCCGA(SEQ?ID?NO：53)
AMX(71)_D10 GGGAGGACGAUGCGAAAGAGUAUNAUAUUAUAGAGUAUAGCUAUACCAUCAGACGACUCGCCCGA(SEO?ID?NO：54)
S5CR12-12 GGGAGGACGAUGCGGAGGAGUAUUAUAGAGAUGUAUAAGCUAUACCAGACGACUCGCCCGA(SEQ?ID?N0：55)
S5CR12-15 GGGAGGACGAUGCGGAGGAGAUUAUAGAGUAUGUAUAGCUAUACCAGAGACGACGACUCGCCCGA?(SEQ?ID?NO：56)
AMX(71)_H10 GGGAGGACGAUGCGGAAGGAAUAUUAUAGAGUAUGUAUAGCUAUACCAUCAGACGACUCGCCCGA(SEO?ID?NO：57)
ARC233
S5CR8-18 GGGAGGACGAUGCGGAGGGAUUAUUAUAGAGUCUGUAUAGCUAUACCCUCAGACGACUCGCCCGA(SEO?ID?NO：58)
AMX(71)_A8 GGGAGGACGAUGCGGAGGGAAUAUUAUAGAGUAUGUAUAGCUAUACCAUCAGACGACUCGCCCGA(SEO?ID?NO：59)
AMX(71)_H9 GGGAGGACGAUGCGGAGAAGAGUAUUAUAGAGUCUGUAUAGCUAUACUUCAGACGACUCGCCCGA(SEQ?ID?NO：60)
AMX(74)_G6 GGGAGGACGAUGCGGAGAGAUUAUUAUAGAGUAUGUAUAGCUGUACUGCCAGACGACCCGCCCGA(SEQ?ID?NO：61)
ARC231
SSCR8-14 GGGAGGAGACGAUGCGGAACGAAUAUUACAGUAUGUAUAGCUGUACGGUCAGACGACUCGCCCGA(SEQ?ID?NO：62)
SSCR8-28 GGGAGGAGCGACGAUGCGAGUGAUAUUAUAGAGUAUGUAUAGCUAUACACUCAGAGACUCGCCCGA(SEQ?ID?NO：63)
AMX(71)_A10 GGGAGGACGAUGCGGCGUGUGAAUAUUAUAGAGUCUAUAGCUAUACCAUCAGACGACUCGCCCGA(SEO?ID?NO：64)
AMX(74)_F1 GGGAGGACGAUGCGGUGUGAAUAUUAUAGAGUCUGUAUAGCUAUACCACCAGACGACUCGCCCGA(SEQ?ID?NO：65)
ARC227
S5R8-1 GGGAGGACGAUGCGGUGUGAGUAUUAUAGAGUCUGUAUAGCUAUACCACCAGACGACUCGCCCGA(SEQ?ID?NO：66)
AMX(71)_B3 GGGAGGACGAUGGCGUCCGCAUUAUCUUCUACGUUACAUAUACUAUCUCUGUCAGACGACUCGCCCGA(SEQ?IDNO：67)
AMX(71)_D11 GGGAGGACGAUGCGGUCGGAGUAUUAUAGAGUAUGUAUAGCUAAACCGUCAGACGACUCGCCCGA(SEQ?ID?NO：68)
AMX(74)_A2 GGGAGGACGAUGCGGUAAGAGUAUUACAGAGUAUGUAUAGCUGUACUUGCCAGACGACUCGCCCGA(SEQ?ID?NO：69)
AMX(74)_E4 GGGAGGACGAUGCGGUGAAGAAUAUACAGAGUAUGUAUAGCUGUACUUGCCAGACGACUCGCCCGA(SEQ?ID?NO：70)
AMX(74)_F4 GGGAGGACGAUGCGGUGAGAAUAUUAUAGAGUAUGAUAGAAUCUACUCGCCAGACGACUCGCCCAA(SEQ?ID?NO：71)
AMX(74)_F3 GGGAGGACGANGCGGUGAGAGUAUUAUAGAGUCUGUAUAGCUAUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：72)
ARC229
S5R8-43 GGGAGGACGAUGCGGUGAGAGUAUUAUAGAGUCUGUAUAGCUAUACUCGCCAGACGACUCGCCCGA(SEQID?NO：73)
ARC234
S5CR8-32 GGGAGGAUGCGGUGAGAGUAUUAUAGAGUCUGUAUAGCUAUAFDACCACCAGACGACUCGCCCGA(SEQ?ID?NO：74)
AMX(71)_D9 GGGAGGACGAUGCGGUAGUAUAAFCGCCAGUAUGUAUAGCUAUACACUCAGACGACUCGCCCAA(SEQ?ID?NO：75)
AMX(71)_H12 GGGAGGACGAUGCGGUAGUAUUAUAGAUAGAGAGCUAUGUAUAGCCAUCAGACGACUCGCCCGA(SEQ?ID?NO：76)
AMX(71)_G7 GGGAGGACGAUGCGGUGGGAAUAUAUUAUAGACUGUAUAGCUAUACCCUCAGACGACUCGCCCGA(SEQ?ID?NO：77)
S5CR12-14 GGGAGGACGAUGCGGCGAUAUUAUAGAGUAUGGAUAGCUAUACCGUCAGACGACGACUCGCCCGA(SEQ?ID?NO：78)
ARC230
S5R8-45 GGGAGGACGAUGCGGGACAGAGUAUUAUAGAGUAUGUAUAGCUAUACUGUCAGACGACUCGCCCGA(SEQ?ID?NO：79)
AMX(71)_B7 GGGAGGACGAUGCGGGCAGAGUAUUAFFAGUACGUAUAGCUAUACUGUCAGGACGACUCGCCCGA(SEQ?ID?NO：80)
AMX(71)_9 GGGAGGACGAUGCGGGCAGAGUAUUAUAGAGUAUGUAUAGCUAUACUGUCAGACGACUCGCCCGA(SEQ?ID?NO：81)
AMX(71)_G8 GGGAGGACGAUGCGGGUGGAGUAUUAUAGAGUAUGUAUAGCUAUACUAUCAGACGACUCGCCCAA(SEQ?ID?NO：82)
AMX(74)_A3 GGGAGGACGAUGCGGUAGAUUAUUACAGAGUCUAGGUAUAGCGUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：83)
AMX(74)_E2 GGGAGGACGAUGCGGGUAGAAUAUUAUAGAGUCUGUAUAGCUAUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：84)
AMX(74)_H1 GGGAGGACGAUGCGGGUAGAAUAUUACAGAGUAAUAGCUGUACUGCCAGACGACGACUCGCCCGA(SEQ?ID?NO：85)
AMX(74)_C3 GGGAGGACGUGCGGGGAGAAUAUUACAGAGAUAUGUAUAGCUGUACUUGCCAGACGACUCGCCCGA(SEQ?ID?NO：86)
AMX(74)_A1 GGGAGGACGAUGCGGGGAGGAUAUUACAGAGUAUGUAUAGCUGUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：B7)
AMX(74)_B3 GGGAGGACGAUGCGGGGAGAUUAUUAUAGAGUAUGUAUAGCUAUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：88)
AMX(74)_G3 GGGAGGACGAUGCGGGGAGAGUAUUAUAGAGUAUGUAUAGCUAUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：89)
AMx(74)_D3 GGGAGGACGAUGCGGGAAGAGUAUUACAGAGUAUGUAUAGCUGUACUGCCAGACGACUCGCCCGA(SEQ?ID?NO：90)
AMX(74)_E6 GGGAGGAGGAUGAGGGCAAAGUAUGUAGAGCAUAGCAUAGCUAUAUUGCCAGACGACUCGCCCGA(SEQ?ID?NO：91)
21a-21 GGGAGGACGAUGCGGGGAGGUUAUUACAGAGUCUGUAUAGCUGUACUCCCAGACGACUCGCCCGA(SEQ?ID?NO：92)
14i-1 GGGAGGACGAUGCGGGGAGGAUGCGCGAAGUAACGUUGUAGUAAAUUCCUUCCAGACGACUCGCCCGA(SEQ?IDNO：93)
21a-4 GGGAGGACGAUGCGGGGCGGCUUGUUAGUAGUCGAGUAUAUACUAACUCCGCCAGACGACUCGCCCGA(SEQ?IDNO：94)
The binding data of above-mentioned suitable body full length sequence is listed in table 6.Figure 19 A and 19B have showed the binding curve figure of listed full length sequence in the table 5.
Table 6-MLEC suppresses the binding data of experiment
CW115-95，117，129
129：?S5R8-1： 7.4nM
S5R8-10： 14.5nM
S5R8-43： 6.5nM
S5R8-45： 12.1
S5CR8-15： 17.9nM
S5CR8-18： 5.3nM
S5CR8-32： 8.0nM
S5CR8-35： 8.4nM
S5CR8-45： 5.2nM
The minimized transforming grouth factor beta 2 of table 7-newly increases weight to screen and is fit to body
CW128.10.A(S5CR12-27)
AfUfCGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCGAfU[3T](SEQID?NO：95)
CW128.10.B(AMX(71)_F7)
AfUfCGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUAfU[3T](SEQ?ID?NO：96)
CW128.10.C(AMX(71)_A11)
AfUfCGAAfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCGGfU[3T](SEQ?ID?NO：97)
CW128.10.D(AMX(71)_B9)
AfUfCGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCGAfU[3T](SEQ?ID?NO：98)
ARC285
8.10.E(AMX(71)_B11)
AfUGGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：99)
CW128.10.F(AMX(71)_C11)
AfUAGAGfCAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUAfU[3T](SEQ?ID?NO：100)
CW128.10.G(S5CR8-15，full?length?ARC232)
AfUAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUAfU[3T](SEQ?ID?NO：101)
CW128.10.H(AMX(71)_G9)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUGfUAGfCfUAfUAfCfCGfU[3T](SEQ?ID?NO：102)
CW128.10.I(S5R12-33)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfC[3T](SEQ?ID?NO：103)
CW128.10.J(S5R12-12)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUG[3T](SEQ?ID?NO：104)
CW128.10.K(AMX(71)_F11)
AfCAGAGfCAfUfUAfUAGAGfUGfUGfUAfUAGfCfUGfUAfCfUGfU[3T](SEQ?ID?NO：105)
CW128.10.L(AMX(71)_F3)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUAfU[3T](SEQ?ID?NO：106)
ARC283，
CW128.10.M(s5CR8-45，full?length?ARC235)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfUfC[3T](SEQ?ID?NO：107)
ARC286，
CW128.10.N(S5R8-10，full?length?ARC228)
AfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfU[3T](SEQ?ID?NO：108)
CW128.10.O(AMX(71)_H7)
AAAGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfUfUfU[3T](SEQ?ID?NO：109)
CW128.10.P(AMX(71)_D10)
AANGAAfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：110)
CW128.10.Q(S5CR12-12)
AAGGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfC[3T](SEQ?ID?NO：111)
ARC281
CW128.10.R(S5CR12-15)
AAGGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：112)
ARC287
CW128.10.S(AMX(71)_H10)
AAGGAAfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：113)
CW128.10.T(S5CR8-18，full?length?ARC233)
AGGGAfUfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCfCfU[3T](SEQ?ID?NO：114)
ARC282
CW128.10.U(AMX(71)_A8)
AGGGAAfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：115)
CW128.10.V(AMX(71)_H9)
AGAAGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfUfU[3T](SEQ?ID?NO：116)
CW128.10.W(AMX(74)_G6)
AGAGAfUfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUGfUAfCfUGfC[3T](SEQ?ID?NO：117)
CW128.11.A(S5CR8-14，full?length?ARC231)
AAfCGAAfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCGGfU[3T](SEQ?ID?NO：118)
CW128.11.B(S5CR8-28)
AGfUGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCAfCAfU[3T](SEQ?ID?NO：119)
CW128.11.C(AMX(71)_A10)
fUGfUGAAfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：120)
CW128.11.D(AMX(74)_F1)
fUGfUGAAfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCAfC[3T](SEQ?ID?NO：121)
CW128.11.E(S5R8-1，full?length?ARC227)
fUGfUGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCAfC[3T](SEQ?ID?NO：122)
CW128.11.F(AMX(71)_B3)
fUfCfCGfCAfUfUAfUfCfUfUfCfUAfCGfUfUAfCAfUAfUAfCfUAfUfCfUfCfUGfU[3T](sEQIDNO：123)
CW128.11.G(AMX(71)_D11)
fUfCGGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAAAfCfCGfU[3T](SEQ?ID?NO：124)
CW128.11.H(AMX(74)_A2)
fUAAGAGfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUfUGfC[3T](SEQ?ID?NO：125)
CW128.11.I(AMX(74)_E4)
fUGAGAAfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUfUGfC[3T](SEQ?ID?NO：126)
CW128.11.J(AMX(74)_F4)
fUGAGAAfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUfCGfC[3T](SEQ?ID?NO：127)
CW128.11.K(AMX(74)_F3)
fUGAGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfUGfC[3T](SEQ?ID?NO：128)
CW128.11.L(S5R8-43，full?length?ARC229)
fUGAGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfUfCGfC[3T](SEQ?ID?NO：129)
CW128.11.M(S5CR8-32，full?length?ARC234)
fUGAGAGfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCAfC[3T](SEQ?ID?NO：130)
CW128.11.N(AMX(71)_D9)
fUAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCAfCfU[3T](SEQ?ID?NO：131)
CW128.11.O(AMX(71)_H12)
fUAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfCAfU[3T](SEQ?ID?NO：132)
CW128.11.P(AMX(71)_G7)
AAfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfCfCfU[3T](SEQ?ID?NO：133)
CW128.11.Q(S5CR12-14)
GfCGGAAfUAfUfUAfUAGAGfUAfUGGAfUAGfCfUAfUAfCfCGfU[3T](SEQ?ID?NO：134)
ARC284
CW128.11.R(S5R8-45，full?length?ARC230)
GAfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfU[3T](SEQ?ID?NO：135)
CW128.11.S(AMX(71)_B7)
GfCAGAGfUAfUfUAfUAGAGfUAfCGfUAfUAGfCfUAfUAfCfUGfU[3T](SEQ?ID?NO：136)
CW128.11.T(AMX(71)_A9)
GfCAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfU[3T](SEQ?ID?NO：137)
CW128.11.fU(AMX(71)_G8)
GfUGGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUAfU[3T](SEQ?ID?NO：138)
CW128.11.V(AMX(74)_A3)
GfUAGAfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUGfC[3T](SEQ?ID?NO：139)
CW128.11.W(AMX(74)_E2)
GfUAGAAfUAfUfUAfUAGAGfUfCfUGfUAfUAGfCfUAfUAfCfUGfC[3T](SEQ?ID?NO：140)
CW128.12.A(AMX(74)_H1)
GfUAGAAfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUGfC[3T](SEQ?ID?No：141)
CW128.12.B(AMX(74)_C3)
GGAGAAfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUfUGfC[3T](SEQC?ID?NO：142)
CW128.12.C(AMX(74)_A1)
GGAGAAfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUGfC[3T](SEQ?ID?NO：143)
CW128.12.D(AMX(74)_B3)
GGAGAfUfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfC[3T](SEQ?ID?No：144)
CW128.12.E(AMX(74)_G3)
GGAGAGfUAfUfUAfUAGAGfUAfUGfUAfUAGfCfUAfUAfCfUGfC[3T](SEQ?ID?NO：145)
CW128.12.F(AMX(74)_D3)
GAAGAGfUAfUfUAfCAGAGfUAfUGfUAfUAGfCfUGfUAfCfUGfC[3T](SEQ?ID?NO：146)
CW128.12.G(AMX(74)_E6)
GfCAAAAGfUAfUfUGfUAGAGfUAfUGfCAfUAGfCfUAfUAfUfUGfC[3T](SEQ?ID?NO：147)
CW128.12.H(21a-21，full?length?ARC236)
GGAGGfUfUAfUfUAfCAGAGfUfCfUGfUAfUAGfCfUGfUAfCfUfCfC[3T](SEQ?ID?NO：148)
CW128.12.I(14i-1，full?length?ARC237)
GGAGGAfUGfCGGAAGfUAAfCGfUfUGfUAGfUAAAAfUfUfCfCfUfUfC[3T](SEQ?ID?NO：149)
CW128.12.J(21a-4，full?length?ARC241)
GfCGGfCGfUfUGfUfUfUAGfUfCGfUAfUGfUAfUAfUAfCfUAAGfUfCfCGfC[3T](SEQ?IDNO：150)
The binding data of the suitable body of table 8-brachymemma
CW128_103
ARC235 ARC236 ARC281 ARC282 ARC283 ARC284 CW128.10.F
Kd(nM)0.53 0.75 1.42 0.62 1.27 0.11 3.66
Figure 20 A, 20B and 20C have showed that brachymemma listed in the table 7 is fit to the binding curve figure of body.
Embodiment 10 selects to minimize and vegf receptor 2 (VEGFR2) spy
The opposite sex is fit to the evaluation of body
At the suitable body of vegf receptor 2 (VEGF R2), also be the KDR molecule, use semi-automatic SELEX TMProgram is separated.The 15 takes turns screening will carry out more than three weeks.Be separated to 48 clones, be divided into 9 families.Analyze these sequences, identify functional die body.Kd scope at the suitable body of vegf receptor is 1-3nM.
Embodiment 11 pharmacokineticss and ARC81, ARC117 and ARC119
The biological activity overview
By the subcutaneous administration of mouse, to ARC81, the pharmacokinetics of ARC117 and ARC119 (transforming grouth factor beta 2 with 4,9, No. 11 sequences is fit to body) has been done research.These suitable bodies have been done to systematically discuss under the concentration of 10mg/ml.Sample is gathered in the time of 0,0.5,1,2,6,12,24,48 and 96 hours in excessive administration.Figure 21 A, 21B and 21C have shown the concentration (nM) through every kind of suitable body in aqueous humor after the subcutaneous 50 hours overdose administration and/or the blood plasma.Result of study when table 9 item has been listed 1mg/ eye (that is: 2.0mg/ animal) dosage.
Table 9, mouse subcutaneous administration, 1mg/ eye, ARC81, the pharmacokinetics overview of ARC117 and ARC119
Parameter NTTS ARC081 ARC117 ARC119
Blood plasma Aqueous humor PLASMA Aqueous humor PLASMA Aqueous humor
C max nM 6.44 5.19 144.8 22.9 721.1 28.4
t max h 1 6 6 1 12 0.5
TLAST h 12 12 48 24 48 48
AUC(0-t) nM.h 29.8 36.0 1,122.1 87.6 13,380.5 133.2
MRT h 3.13 6.03 * 9.22 3.62 17.28 12.80
t 1/2 h 2.42 - 7.40 4.33 6.94 17.52
V d mL 21079 - 1760 - 137 -
Can detect ARC81 in the subcutaneous administration rear vitreous body, ARC117 and ARC119.The suitable body of PEGization not, promptly ARC81 enters systemic circulation (as: being less than 0.5 hour) rapidly.The concentration of suitable body in vitreum of PEGization does not have the t of delay Max, it depends on the recirculation that is fit to body.The suitable body of PEGization, promptly ARC117 has slow identical blood plasma t with ARC119 1/2The reduction of the Vd of PEGization and t MaxDelay hinted near the intensive warehouse effect injection site.The suitable body of PEGization can detect in aqueous humor, also can find to retain in the operative site enrichment.
Embodiment 12ARC126, ARC127 and NX1838 pharmacokinetics
Comparison with the biological activity overview
(two PDGF of PEG-19 sequence-PEG-35 sequence-PEG-36 sequence-3T) are fit to the pharmacokinetics of this suitable body that is connected at the PEG of VEGF-165 of body and NX1838 and study in the rabbit body, and their pharmacokinetics is compared to ARC126 (No. 18 sequence-PEG-33 sequence-PEG-34 sequences) and ARC127.Research is pattern with Dutch rabbit, adopts hypodermic mode.Being fit to body dosage level is the 1.0mg/ eye, eyes intravitreal injection 100ml.Take a sample from aqueous humor, vitreum and blood plasma, be to be fit to before the body administration sample time, 0.25 hour, and 6 hours, 24 hours, 72 hours, 7 days, 14 days and 21 days.Figure 22 A, 22B and 22C have showed the concentration through every kind of suitable body in 25 days excessive administration rear vitreous bodies and/or the blood plasma.Table 10 has shown that ARC126 and ARC127 are fit to the result of study of body.
Table 10:ARC126 and ARC127 pharmacokinetics overview
Unit ARC126 ARC127
C max μM 117.91 109.18
t max h 0.25 0.25
AUC ？ μM？h 4,545.2 8,122.2
MRT d 2.39 4.85
t 1/2 d 2.25 3.87
Cl mL？d -1 0.52 0.29
V ss mL 1.25 1.42
Result shown in Figure 22 A analyzes by non-separation (NCA) and obtains.The volume of rabbit aqueous humor is 1.0-1.5ml.Be fit to body with ARC126 and ARC127 and compare, the transformation period of NX1838 is about 83 hours in the rabbit vitreum, and promptly 3.46 days, the transformation period of NX1838 was about 94 hours in the vitreum of primate, or 3.92 days.
From Figure 22 B and 22C, can see ARC127C Max(vitreum) is about 160 μ M.The C of the suitable body linker of non-PEGization and PEGization Max(vitreum) is about 100mm.The C of the suitable body of PEGization (vitreum) is about 250nM, t=30 days (40k PEG).The AUC ration of the suitable body of PEG and non-PEGization is 1.79.The transformation period that non-PEGization is fit to body is about 2.25 days, PEGization be 3.87 days.The tangible volume (Vss) that distributes is 1.25-1.42ml, this means that two kinds of linkers all are retained in the vitreum compartment.Clearance rate (c1) is that 0.29-0.52ml/ days (≤50nmol/ days) maximum haemoconcentrations are≤10nM.To be fit to the concentration of body linker be the nmole level to non-PEGization in the aqueous humor, t≤24 hour.

Claims (39)

1. pharmaceutical composition for the treatment of ocular disorders, comprising: the target molecule specificity bonded relevant with described illness is fit to body, wherein is fit to the effect that has reduced target molecule widely that combines of body and target molecule.
2. according to the composition of claim 1, wherein said illness is the hyperplasia illness.
3. according to the composition of claim 1, the intraocular pressure that is characterized as of wherein said illness raises.
4. according to the composition of claim 3, wherein said illness is a glaucoma.
5. according to the composition of claim 1, wherein said illness is an operation back scar.
6. according to the composition of claim 1, wherein said target molecule is a cytokine, somatomedin, or cell surface protein.
7. according to the composition of claim 6, wherein said target molecule is adhesion molecule-1, insulin-like growth factor α-1, vascular endothelial growth factor, tumor necrosis factor alpha or integrin alpha 5 β 3 in transforming growth factor-beta, platelet derived growth factor, the born of the same parents.
8. according to the composition of claim 6, wherein said target molecule is a transforminggrowthfactor-, 2 or 3.
9. composition according to Claim 8, wherein said transforming growth factor-beta is a transforming grouth factor beta 2.
10. according to the composition of claim 6, wherein said target molecule is a platelet derived growth factor.
11., further comprised non-suitable body pharmaceutical agent according to the composition of claim 1.
12. according to the composition of claim 11, wherein said non-suitable body pharmaceutical agent is narcotic, antiphlogistic, anti-angiogenic regenerator, anti-proliferative agent, antiseptic-germicide, antiviral agent or antifungal medicine.
13. according to the composition of claim 1, further comprise second and be fit to body, the target molecule specificity combination that it is relevant with described illness, the wherein effect that has reduced target molecule widely that combines of the second suitable body and target molecule.
14. according to the composition of claim 13, wherein said first and second are fit to the body homotype target molecule specificity combination relevant with described illness.
15. according to the composition of claim 13, wherein said first and second are fit to the body different shaped target molecule specificity combination relevant with described illness.
16. according to the composition of claim 1,, wherein said suitable body combines with the target molecule specificity relevant with described illness of more than one types.
17. composition according to Claim 8, comprising is the suitable body of 1-14,21-27,39-149 or No. 150 sequences.
18. composition according to Claim 8, comprising is the suitable body of ARC77, ARC78, ARC81 or ARC81.
19. according to the composition of claim 10, comprising is the suitable body of 15,16 or No. 17 sequences.
20. according to the composition of claim 10, comprising is the suitable body of ARC123, ARC124, ARC125, ARC126, ARC127 or ARC128.
21. suitable body therapeutical agent for the treatment of eye disease, described suitable body has and transforming grouth factor beta 2 (TGF β 2) binding specificity, the effect of transforming grouth factor beta 2 when wherein said suitable body has reduced hyperplasia in the eye illness widely with combining of transforming grouth factor beta 2.
22. suitable body therapeutical agent for the treatment of eye disease, described suitable body has and transforming grouth factor beta 2 (TGF β 2) binding specificity, and wherein said suitable body has reduced the effect of transforming grouth factor beta 2 in the scar after the operation widely with combining of transforming grouth factor beta 2.
23. suitable body therapeutical agent for the treatment of eye disease, described suitable body has and the platelet derived growth factor binding specificity, the effect of platelet derived growth factor when wherein said suitable body has reduced hyperplasia in the eye illness widely with combining of platelet derived growth factor.
24. suitable body therapeutical agent for the treatment of eye disease, described suitable body has and the platelet derived growth factor binding specificity, and wherein said suitable body has reduced the effect of platelet derived growth factor in the scar after the operation widely with combining of platelet derived growth factor.
25. method for the treatment of eye hyperplasia illness, comprise: taken the step that the suitable body therapeutical agent of significant quantity is gone up in treatment to trying body, described suitable body has the binding specificity of the target molecule relevant with described illness, and wherein said suitable body and combining of target molecule have been reduced the effect of hyperplasia class eye disease target molecule widely.
26. according to the method for claim 25, wherein said target molecule is a cytokine, somatomedin, or cell surface protein.
27. according to the method for claim 26, wherein said target molecule is adhesion molecule-1, insulin-like growth factor α-1, vascular endothelial growth factor, tumor necrosis factor alpha or integrin alpha 5 β 3 in transforming growth factor-beta, platelet derived growth factor, the born of the same parents.
28. according to the method for claim 25, wherein said suitable body treatment reagent adopts the eye socket administration.
29. according to the method for claim 25, wherein said suitable body treatment reagent adopts the intravitreal injection administration.
30. according to the method for claim 25, wherein said suitable body treatment reagent adopts the subcutaneous injection administration.
31. according to the method for claim 25, wherein said suitable body treatment reagent adopts topical.
32. according to the composition of claim 1, wherein said suitable body is modified, to increase its stability in aqueous humor.
33. according to the composition of claim 32, wherein said suitable body comprises the Nucleotide of modification.
34. according to the composition of claim 32, wherein said suitable body comprises polyalkylene glycols.
35. according to the composition of claim 34, polyalkylene glycols wherein is a polyoxyethylene glycol.
36. according to the composition of claim 34, wherein said suitable body further comprises the Nucleotide of modification.
37. composition according to claim 13, the first and second suitable bodies wherein link together by polyoxyethylene glycol, the primary structure that wherein is fit to the body composition comprises linear array, first is fit to first end that body is connected to the PEG connection portion, and second is fit to second end that body is connected to the PEG connection portion.
38. according to the composition of claim 37, suitable body wherein further is connected to the end of polyoxyethylene glycol, the primary structure that wherein is fit to the body composition comprises linear array, and promptly polyoxyethylene glycol-first is fit to body-polyoxyethylene glycol-second and is fit to body.
39. being fit to that the body composition comprises is the sequence of 1-27,33-150 or No. 151.
CN 200480004842 2003-01-21 2004-01-21 Adapter therapeutics useful in ocular pharmacotherapy Pending CN1984920A (en)

Applications Claiming Priority (11)

Application Number Priority Date Filing Date Title
US44134703P 2003-01-21 2003-01-21
US60/441,347 2003-01-21
US60/463,095 2003-04-15
US60/464,179 2003-04-21
US60/465,055 2003-04-23
US60/469,628 2003-05-08
US60/474,680 2003-05-29
US60/491,019 2003-07-29
US60/512,071 2003-10-17
US60/537,201 2004-01-16
US60/537,045 2004-01-16

Publications (1)

Publication Number Publication Date
CN1984920A true CN1984920A (en) 2007-06-20

Family

ID=38166707

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200480004842 Pending CN1984920A (en) 2003-01-21 2004-01-21 Adapter therapeutics useful in ocular pharmacotherapy

Country Status (1)

Country Link
CN (1) CN1984920A (en)

Similar Documents

Publication Publication Date Title
CN102380098B (en) Combination therapy for the treatment of ocular neovascular disorders
Ng et al. Pegaptanib, a targeted anti-VEGF aptamer for ocular vascular disease
TWI528963B (en) Methods for treating or preventing ophthalmological diseases
JP2006516288A (en) Aptamer therapeutics useful in ophthalmic drug therapy
CN109072241A (en) With the improved composition of vitreous half-life and application thereof
JPH09507381A (en) Inhibition of vascular smooth muscle cell proliferation
Kanwar et al. Aptamer-based therapeutics of the past, present and future: from the perspective of eye-related diseases
KR20020097241A (en) Splice-region antisense composition and method
US20130123330A1 (en) Dual Targeted siRNA Therapeutics for Treatment of Diabetic Retinopathy and Other Ocular Neovascularization Diseases
JP2013539456A (en) SiRNA Targeting VEGFA and Methods for In Vivo Treatment
WO2007087457A2 (en) Combination therapy for the treatment of neovascular disorders
US20040253243A1 (en) Aptamer therapeutics useful in ocular pharmacotherapy
CN107635550B (en) Improved disulfide-containing alkyne crosslinkers
WO2014003830A1 (en) Particle-nucleic acid conjugates and therapeutic uses related thereto
CN108251420A (en) Inhibit siRNA, the composition comprising it and its application of CTGF gene expressions in humans and animals
CN1984920A (en) Adapter therapeutics useful in ocular pharmacotherapy
KR20200093611A (en) MiR29 mimic for treatment of ocular fibrosis
US20230095004A1 (en) Aptamers and use thereof
WO2022092279A1 (en) siRNA AND PHARMACEUTICAL COMPOSITION, AND PROPHYLACTIC AND/OR THERAPEUTIC AGENT
US20240052353A1 (en) Bispecific Aptamer Compositions for the Treatment of Retinal Disorders
WO2020146731A1 (en) Compositions and methods for inhibiting vascular endothelial growth factor
CN116459270A (en) Pharmaceutical composition and application thereof in preparation of drugs for preventing and treating ocular neovascular diseases
CN101356284A (en) Aptamer medicinal chemistry
CN115484986A (en) Composition for preventing or treating macular degeneration containing cell-permeable nucleic acid complex as active ingredient
BANKS Mechanisms of antisense transport across the blood–brain barrier

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication