CN1982456B - China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use - Google Patents

China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use Download PDF

Info

Publication number
CN1982456B
CN1982456B CN2006100353102A CN200610035310A CN1982456B CN 1982456 B CN1982456 B CN 1982456B CN 2006100353102 A CN2006100353102 A CN 2006100353102A CN 200610035310 A CN200610035310 A CN 200610035310A CN 1982456 B CN1982456 B CN 1982456B
Authority
CN
China
Prior art keywords
pgrp
gly
ser
protein
lancelet
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN2006100353102A
Other languages
Chinese (zh)
Other versions
CN1982456A (en
Inventor
徐安龙
颜庆瑜
于萃玲
周琴
董美玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sun Yat Sen University
Original Assignee
Sun Yat Sen University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sun Yat Sen University filed Critical Sun Yat Sen University
Priority to CN2006100353102A priority Critical patent/CN1982456B/en
Publication of CN1982456A publication Critical patent/CN1982456A/en
Application granted granted Critical
Publication of CN1982456B publication Critical patent/CN1982456B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Landscapes

  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Chinese amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use are disclosed. The process is carried out by constructing cDNA library, large-scaled sequencing, and separating out B.b.PGRP gene from digestive tube of Chinese amphioxus. The crude protein of first check can combine biological macromolecular peptidoglycan specifically and has lysis function for expression strain. It can be used as natural bacterium-inhibiting active substance and to prepare medicine for treating infectious diseases.

Description

China lancelet peptidoglycan recognition protein B.b.PGRP and its production and application
Technical field
The present invention relates to Chinese lancelet peptidoglycan recognition protein (B.b.pgrp) gene and encoded protein B.b.PGRP thereof,, and the application of this albumen in preparation treatment infectious disease medicament.。
Background technology
China lancelet (Branchiostoma belcheri tsingtauense) is the good material that the research vertebrates grows as the primitive chordate-cephalochordate that is in the turnover status on the spore status all the time.In recent years, the research of the immunity of lancelet caused widely paid attention to, found many significant immunogenes therein.
Peptidoglycan (peptidoglycan PGN) is one of the main component of the cell walls of nearly all bacterium, especially be rich in gram-positive microorganism, peptidoglycan recognition protein (peptidoglycan recognition protein PGRP) thus be exactly to be responsible for that exclusive molecule plays immunization on this microorganism wall of identification.First is found and is the albumen of the about 19Kda in silkworm that finds of people such as Yoshida in 1996 by the peptidoglycan recognition protein named.This PGRP is found to be exclusive pro-phenoloxidase cascade reaction in the activation insect.Then insects such as moth, fruit bat, mosquitos, and also be found in succession in the animals such as the mouse in the Mammals, rat, people, ox, pig, camel and name.This proteinoid all has the structural domain of identical peptidoglycan identification, by phylogenetic homology relatively, illustrates that this proteinoid guards on evolving.
People such as Choe KM find, fruit bat extracellular protein PGRP-SA participates in the identification gram-positive microorganism, and the proteolytic enzyme in the activation Toll path, this enzyme liberating Toll acceptor spaetzle, thus cascade reaction caused, start transcription factor Dorsal and Dif, (this is with coming from mammiferous NF-κ B), transcribe out a series of antibacterial peptides,, thereby play germicidal action as Drosomysin etc.Transmembrane protein PGRP-LC of fruit bat and PGRP-LE have but participated in an other path, " Imd " path, the bacillus in their identification Gram-negative bacterias and the gram-positive microorganism.TNF path in the similar mammal of this path causes the member Relish in the Rel family, transcribes out antibacterial peptides such as Dipterincin.In addition, this molecule is also inferred the effect that Gram-negative bacteria is engulfed in participation.PGRP except these identification receptor effects, another kind of PGRP is found to have the Ntn hydrolase effect by people such as Steiner H, the PGRP-SC1B of fruit bat, have from the enzymatic activity that cuts between L-acetylmurami and the L-L-Ala, be proved and reduced the immune prototype effect of PGN, thereby played street cleaner's effect in the extracellular.
In Mammals, except S and L, also have two kinds of PGRP, be exactly PGRP-I α and PGRP-I β.Mouse PGRP-S suppresses the growth of gram-positive microorganism under the cell cultures state.High expression level amount is at marrow, and plays germicidal action in the particle in many types of white corpuscle and neutrophilic granulocyte.Mammiferous PGRP-L is considered to the same with the enzyme PGRP of fruit bat mainly at liver expression, has enzymic activity.PGRP-I α and PGRP-I β mainly express in oesophagus, be proved to be positioned at TLR2, TLR4, and the upstream of paths such as NOD1 (nucleotide-binding oligomerization domain) and NOD2.
By the sequence homology analysis, find that the character that this proteinoid has a similar N,O-Diacetylmuramidase promptly has the enzyme active sites of degraded peptidoglycan, prompting plays an important role in the external cause of disease of antagonism, become the antibacterial natural radioactivity albumen of potential, and have the exploitation value of the antibacterials that become efficient natural.Has the wide development prospect in every profession and trades such as kind of an aquaculture, medical and health.
Summary of the invention
The object of the present invention is to provide a kind of new natural antibacterial protein B .b.PGRP and this proteic gene B.b.pgrp of coding.
Another object of the present invention is to provide this proteic production method.
The 3rd purpose of the present invention is to provide the application of this albumen in preparation treatment infectious disease medicament.
The present invention therefrom separates the Chinese lancelet peptidoglycan identification protein gene B.b.pgrp that obtains among the total RNA of state lancelet by the structure in cDNA library and the method for large scale sequencing, its dna sequence dna as in the sequence table＜400〉1 sequences shown in.
The protein B .b.PGRP of genes encoding of the present invention, its aminoacid sequence as in the sequence table＜400〉2 sequences shown in; This albumen iso-electric point is 7.60, and molecular weight is 27,102 dalton.
This albumen can by expression vector pGEX-B.b.pgrp intestinal bacteria with born of the same parents in soluble form express.
Described expression vector pGEX-B.b.pgrp sets up Thiadiazolidine isomerase for merging the companion body, the middle efficient expression vector that inserts the zymoplasm recognition site, this system make B.b.PGRP in intestinal bacteria with soluble formal representation in the born of the same parents.
The selected Qingdao branchiostoma of the present invention (Branchiostoma belcheri tsingtauense) is collected in sand saliva territory, Shandong Province.
The present invention has therefrom obtained the clone of 1 new coding lancelet B.b.PGRP by to the extensive sequencing of library recombinant clone, called after B.b.pgrp (its dna sequence dna as in the sequence table＜400〉1 sequences shown in).New 255 amino acid of genes encoding (its aminoacid sequence as in the sequence table＜400〉2 sequences shown in), iso-electric point is 7.60, molecular weight is 27,102 dalton, has the lactamase activity site of conservative PGRP.
The present invention is by having designed a pair of primer, and the new gene B.b.pgrp that will encode is cloned on the prokaryotic fusion expression vector pGEX-4T (Amersham company), construction expression plasmid and with its transformed into escherichia coli BL21 (DE3).This expression vector (pGEX-B.b.pgrp) is that molecule merges the companion body with Thiadiazolidine isomerase GST, helps recombinant protein correctly folding, and with soluble formal representation, the C of GST end has gentle chain plot structure, is convenient to utilize the body affinity chromatography to carry out purifying.The C end of GST contains the zymoplasm restriction enzyme site, is beneficial to the monomeric acquisition of foreign protein.467 amino acid of this fusion rotein coding, iso-electric point is 7.2, molecular weight is 51,804 dalton.By to incubation time, induction time, the groping and optimize of conditions such as temperature, B.b.PGRP Expression of Fusion Protein amount is higher, and major part is in solvable state.
The present invention also gropes and has optimized the proteic purification condition of reorganization B.b.PGRP, and the ultrasonic degradation liquid of expression product obtains purer fusion rotein through GST Sepharose 4B affinity chromatography.
Expression plasmid clone method of the present invention:, use CaCl with reference to Sambrook (Sambrook, et al.1989, Molecularcloing.Cold Spring Harbor Labroratory Press.USA) method 2Method with plasmid Transformed E .coli.DH5 α or BL21 (DE3) bacterial strain, transform bacterial strain with the LB culture medium culturing that contains penbritin (100 μ g/mL), extract plasmid with Omega company test kit.
The present invention has proved that tentatively this has the activity of bacteriolyze.Fusion rotein carries out affine hatching by the peptidoglycan with the streptococcus aureus extraction, carry out the Western-blocking detection with the GST protein monoclonal antibody again and be combined in the sedimentary protein-bonded method of insoluble peptidoglycan, proved the biomacromolecule peptidoglycan of this fusion rotein energy specific combination bacterium surface.
Method by the chloroform bacteriolyze has proved that tentatively this fusion rotein has the bacteriolyze activity, and method is according to the bacteriolyze experiment of tradition checking phage lysozyme success at escherichia coli expression.
Description of drawings
Fig. 1 is Chinese lancelet albumen of the present invention and the proteic comparative result of other species PGRP, wherein " * " table
Show identical; ": " expression difference is less; ". " expression obvious difference; Complete difference is represented in the space.
Fig. 2 is the total RNA of lancelet digestive tube.1:DNA marker DL2000 (Takara); 2: total RNA
The double-stranded cDNA electrophoresis result of Fig. 3.1: double-stranded cDNA PCR electrophoresis; 2:DNA marker widerange (Takara).
Fig. 4 is the recombinant expression plasmid pGEX-B.b.pgrp design of graphics of gene B.bpgrp.
Fig. 5 is the protein induced expression of reorganization B.b.PGRP, affinity chromatography electrophorogram.1: lower molecular weight standard protein marker; 2: without inductive pGEX-B.b.pgrp bacterial protein; 3: through IPTG inductive pGEX-B.b.pgrp bacterial protein; 4: induce the ultrasonic supernatant total protein of bacterium; 5: the percolation peak; 6:10mM reduced glutathion elution peak; 7: remove gsh after crossing the G-25 molecular sieve.
Fig. 6 be the peptidoglycan of B.b.PGRP1 in conjunction with activity: 1: albumen Marker; 2:B.b.PGRP1-GST sample contrast on the ultrasonic supernatant of fusion rotein, the GST monoclonal antibody detects; 3: from the B.b.PGRP1-GST fusion rotein that peptidoglycan elutes, the GST monoclonal antibody detects; 4:B.b.PGRP1-GST merge the wash-out supernatant, the GST monoclonal antibody detects: 5: sample contrast on the ultrasonic supernatant of empty carrier GST albumen, the GST monoclonal antibody detects; 6: from the empty carrier GST albumen that peptidoglycan elutes, the GST monoclonal antibody detects; 7: empty carrier GST albumen wash-out supernatant, the GST monoclonal antibody detects.
Fig. 7 is the active GST of the bacteriolyze of B.b.PGRP1: unloaded albumen; GST-PGRP: fusion rotein; BEFORE: before adding 1% (v/v) chloroform; AFTER: add 1% (v/v) chloroform after ten minutes.
Embodiment
Below implement to help those of ordinary skill in the art further to understand the present invention, but do not limit the present invention in any form.
Embodiment 1: the extraction of the total RNA of Chinese lancelet digestive tube and cDNA's is synthetic
The extraction of total RNA and cDNA are synthetic: collect Chinese lancelet digestive tube, adopt Trizol reagent method (Invitrogen company) to extract the total RNA of digestive tube, protein is removed in phenol/chloroform extracting, obtains the total RNA of Chinese lancelet digestive tube, its A 260/ A 280=1.96, detect as seen 18s and 28s two bands clearly through 1% denaturing formaldehyde gel electrophoresis, ratio＞1 (see figure 2) shows that total RNA integrity is better, purity is also higher.Get the total RNA of 1ug, with SMARTIII olignuclotide (5 '-AAGCAGTGGTATCAACGCAGAGTGGCCATTATGGCCGGG-3 ') and CDSIII/3 ' PCR primer (5 '-ATTCTAGAGGCCGAGGCGGCCGACATG-d (T) 30N -1N-3 ') carries out synthetic first chain of reverse transcription, obtain 10 μ l, one chain cDNA product.
Getting 2ulcDNA one chain product, is that primer carries out the synthetic two chain cDNA of LD-PCR with 5 ' PCR Primer (5 '-TTCCACCCAAGCAGTGGTATCAACGCAGAGTGG-3 ') and 3 ' PCR Primer (5 '-GTATCGATGCCCACCCTCTAGAGGCCGAGGCGGCCGACA-3 ').
Embodiment 2: the mensuration and the analysis of Chinese lancelet digestive tube B.b.pgrp gene order
Two chain cDNA are connected to pcDNA3.0 carrier (available from Invitrogen company), transform DH5 α intestinal bacteria (available from Invitrogen company), select the recombinant clone order-checking.Blast homology analysis revealed has obtained the est sequence of coding total length B.b.pgrp gene, and mrna length all is 765bp, and 255 the amino acid whose B.b.PGRP albumen of encoding are 1 new PGRP albumen.
Use the ClustalW analysis software, to the PGRP protein sequence of the different plant species reported relatively, the result as shown in Figure 1.
As can be seen from Figure 1, PGRP is comparatively conservative in different species.
Embodiment 3: the structure of reorganization pGEX-B.b.pgrp expression plasmid
According to the synthetic a pair of primer of two terminal sequences of B.b.pgrp gene, upstream primer contains the BamHI cleavage site, and downstream primer contains Not I cleavage site.
Upstream primer (P1):
5’CGC GGATCC?CAGCGGTGGCGCAGTGACG?3’
BamHI
Downstream primer (P2):
5′CGT? GCGGCCGC?GCCAACGTATCGTCCCCAGGA3′
Not?I
With the pcDNA3.0 plasmid (available from Invitrogen company) that contains the B.b.pgrp gene is template, and P1, P2 are the primer PCR amplification, obtains the single band of specific amplified, and the product size is about 750bp.Pcr amplification product is cloned on the prokaryotic fusion expression vector pGEX (available from Aersham company), obtains recombinant expression vector pGEX-B.b.pgrp (its building process as shown in Figure 4).Foreign gene among the expression vector pGEX-B.b.pgrp is identified correct through order-checking.
Embodiment 4: Chinese lancelet B.b.PGRP Expression of Fusion Protein
With pGEX-B.b.pgrp transformed into escherichia coli BL21 (DE3) (available from Invitrogen company).Genetic engineering bacterium ultrasonic degradation supernatant liquor shows that through the SDS-PAGE electrophoretic analysis bacterial strain has tangible specifically expressing product band after inducing, molecular weight conform to theoretical value 52kD with software DNATOOLS6.0 prediction (Fig. 5).
To incubation time, induced concentration, the groping of conditions such as temperature draws.The culture condition of genetic engineering bacterium is: the order bacterium colony is in 50ml ammonia benzyl resistance LB liquid nutrient medium, 37 ℃, the 250rpm overnight incubation, get in the ammonia benzyl resistance LB substratum that overnight culture 10ml is inoculated in 1L, 37 ℃, 250rpm is cultured to OD600=0.6 (the about 4h of enlarged culturing), adds 100mM IPTG and is respectively 0.2mM to final concentration, 18 ℃, centrifugal collection thalline behind the 250rpm inducing culture 16h.Show that through the SDS-PAGE electrophoretic analysis B.b.PGRP Expression of Fusion Protein amount accounts for more than 40% of bacterial protein with this understanding, be in solvable state (Fig. 5).
Embodiment 5: the purifying of China restructuring lancelet B.b.PGRP fusion rotein
With total thalline 50mM Tris.Cl, 100mMNaCl (pH8.0) washing, use an amount of 50mMTris.Cl again, 100mMNaCl (pH8.0) suspends, after the supersound process, cracking supernatant liquor GST Sepharose 4B affinity chromatography purifying, the expression of SDS-PAGE analysis fusioning protein and the result of chromatography.Can draw from SDS-PAGE result: GST-B.b.PGRP can be adsorbed by affinity column, when washing post with the reduced glutathion of 10mM, can wash target protein GST-B.b.PGRP.Collection obtains the elution peak of recombinant protein.
Elutriant is crossed the G25 gel column except that the reduced glutathion in the Deproteinization, obtains the more single albumen of composition (Fig. 5).
The binding peptide glycan activity of embodiment 6:B.b.PGRP recombinant protein
With the ultrasonic supernatant of the expression bacterium that obtains and the insoluble peptidoglycan that from streptococcus aureus, extracts at 50mMTris.Cl, 4 ℃ of gentle rotations 1 hour among the 100mM NaCl (PH8.0), centrifugal 5 minutes of back 8000g, remove supernatant, use 50mM Tris.Cl again, 100mM NaCl (PH8.0) washing four times, remove the albumen of non-specific combination as far as possible, precipitation and supernatant add loading buffer respectively, carry out SDS-polyacrylamide electrophoresis together with sample on the ultrasonic upward white protein, change film, carrying out Western-block with the GST monoclonal antibody analyzes, compared with the control, on peptidoglycan, eluted purpose B.b.PGRP1-GST fusion rotein band, illustrated that this fusion rotein has the activity of binding peptide glycan.
The activation analysis of embodiment 7:B.b.PGRP recombinant protein
Method by the chloroform bacteriolyze has proved that tentatively this fusion rotein just has the bacteriolyze activity at expression strain, and method is according to the bacteriolyze experiment of tradition checking phage lysozyme success at escherichia coli expression.In the fresh bacterium liquid of abduction delivering, add 1% chloroform, make the cell walls cracking of bacterium, the fusion rotein peptidoglycan that discharges and degrade, thus make bacterium liquid become clarification, dilution is surveyed OD for 10 times after ten minutes 600Value.Naked eyes are the difference fairly obvious (Fig. 6) of experimental group and control group (the unloaded albumen of GST) as can be seen.
Sequence table
＜110〉Zhongshan University
＜120〉Chinese lancelet peptidoglycan recognition protein B.b.PGRP and its production and application
<140>200610035310.2
<141>2006-04-29
<160>2
<210>1
<211>768
<212>DNA
＜213〉lancelet (Branchiostoma belcheri tsingtauense)
<220>
<221>peptide
<222>(1)...(765)
<400>1
atg?gag?acg?aaa?gga?cta?gtc?atc?ctt?ttg?tgc?ctg?ctg?cca?tac?gcg 48
Met?Glu?Thr?Lys?Gly?Leu?Val?Ile?Leu?Leu?Cys?Leu?Leu?Pro?Tyr?Ala
1 5 10 15
gct?gcc?cag?cgg?tgg?cgc?agt?gac?ggc?cgc?tgc?ggc?ccg?aac?tac?ccc 96
Ala?Ala?Gln?Arg?Trp?Arg?Ser?Asp?Gly?Arg?Cys?Gly?Pro?Asn?Tyr?Pro
20 25 30
tcc?cct?gac?gcc?aac?ccg?ggc?gag?tgt?aac?ccg?cac?gcc?gtg?gac?cac 144
Ser?Pro?Asp?Ala?Asn?Pro?Gly?Glu?Cys?Asn?Pro?His?Ala?Val?Asp?His
35 40 45
tgc?tgc?tcg?gag?tgg?ggc?tgg?tgt?ggc?cgg?gag?acc?aca?cac?tgt?acc 192
Cys?Cys?Ser?Glu?Trp?Gly?Trp?Cys?Gly?Arg?Glu?Thr?Thr?His?Cys?Thr
50 55 60
tgc?tct?cgc?tgc?gtg?gac?tat?tcc?gcg?ggt?ggt?ggc?tct?tcg?gga?ggc 240
Cys?Ser?Arg?Cys?Val?Asp?Tyr?Ser?Ala?Gly?Gly?Gly?Ser?Ser?Gly?Gly
65 70 75 80
[0085]tcg?aca?gtc?gtc?gtc?agc?agc?tcg?gga?act?tgt?ccc?agg?atc?gtg?tcc 288
Ser?Thr?Val?Val?Val?Ser?Ser?Ser?Gly?Thr?Cys?Pro?Arg?Ile?Val?Ser
[0087] 85 90 95
aag?tcg?gaa?tgg?ggt?tcc?cgg?gcc?acc?aac?tat?aac?gtg?ttt?ctc?agc 336
Lys?Ser?Glu?Trp?Gly?Ser?Arg?Ala?Thr?Asn?Tyr?Asn?Val?Phe?Leu?Ser
100 105 110
ctg?ccg?gtc?cca?aag?gtt?gtg?atc?cac?cac?tcg?gcg?ggc?gcc?acg?tgc 384
Leu?Pro?Val?Pro?Lys?Val?Val?Ile?His?His?Ser?Ala?Gly?Ala?Thr?Cys
[0093] 115 120 125
agt?acc?cag?tcg?tcc?tgt?tct?cta?cag?gtc?agg?aac?atc?cag?aac?tac 432
Ser?Thr?Gln?Ser?Ser?Cys?Ser?Leu?Gln?Val?Arg?Asn?Ile?Gln?Asn?Tyr
130 135 140
cac?atg?gac?ggc?aga?ggc?tac?agc?gac?atc?ggc?tac?aac?ttc?ctg?gtc 480
His?Met?Asp?Gly?Arg?Gly?Tyr?Ser?Asp?Ile?Gly?Tyr?Asn?Phe?Leu?Val
145 150 155 160
ggt?aac?gat?ggc?aac?gtg?tac?gaa?ggg?cgc?ggc?tgg?gac?agg?aga?ggt 528
Gly?Asn?Asp?Gly?Asn?Val?Tyr?Glu?Gly?Arg?Gly?Trp?Asp?Arg?Arg?Gly
165 170 175
gcg?cat?gcg?ctt?aac?gtc?aac?acc?gag?tcc?atc?ggg?atc?tgc?ttc?atg 576
Ala?His?Ala?Leu?Asn?Val?Asn?Thr?Glu?Ser?Ile?Gly?Ile?Cys?Phe?Met
180 185 190
gga?gac?ttc?acc?agt?cag?aag?ccg?acc?gcc?tcc?gcc?atc?gcc?gcc?gcc 624
[0107]Gly?Asp?Phe?Thr?Ser?Gln?Lys?Pro?Thr?Ala?Ser?Ala?Ile?Ala?Ala?Ala
195 200 205
aag?agc?ctc?atc?tca?tgc?ggg?gtg?tcc?ctg?ggc?aag?atc?agg?tcg?ggc 672
Lys?Ser?Leu?Ile?Ser?Cys?Gly?Val?Ser?Leu?Gly?Lys?Ile?Arg?Ser?Gly
210 215 220
tac?tcc?ctg?tac?gga?cat?cgt?gac?gtc?ggc?tcc?aca?gcc?tgc?cct?ggg 720
tyr?Ser?Leu?Tyr?Gly?His?Arg?Asp?Val?Gly?Ser?Thr?Ala?Cys?Pro?Gly
225 230 235 240
aac?ctg?ctc?tat?gat?gac?atc?aag?tcc?tgg?gga?cga?tac?gtt?ggc?tga 768
Asn?Leu?Leu?Tyr?Asp?Asp?Ile?Lys?Ser?Trp?Gly?Arg?Tyr?Val?Gly *
245 250 255
<210>2
<211>255
<212>PRT
＜213〉lancelet (Branchiostoma belcheri tsingtauense)
<220>
<221>peptide
<222>(1)...(255)
<400>2
Met?Glu?Thr?Lys?Gly?Leu?Val?Ile?Leu?Leu?Cys?Leu?Leu?Pro?Tyr?Ala
1 5 10 15
Ala?Ala?Gln?Arg?Trp?Arg?Ser?Asp?Gly?Arg?Cys?Gly?Pro?Asn?Tyr?Pro
20 25 30
Ser?Pro?Asp?Ala?Asn?Pro?Gly?Glu?Cys?Asn?Pro?His?Ala?Val?Asp?His
35 40 45
Cys?Cys?Ser?Glu?Trp?Gly?Trp?Cys?Gly?Arg?Glu?Thr?Thr?His?Cys?Thr
50 55 60
Cys?Ser?Arg?Cys?Val?Asp?Tyr?Ser?Ala?Gly?Gly?Gly?Ser?Ser?Gly?Gly
65 70 75 80
Ser?Thr?Val?Val?Val?Ser?Ser?Ser?Gly?Thr?Cys?Pro?Arg?Ile?Val?Ser
85 90 95
Lys?Ser?Glu?Trp?Gly?Ser?Arg?Ala?Thr?Asn?Tyr?Asn?Val?Phe?Leu?Ser
100 105 110
Leu?Pro?Val?Pro?Lys?Val?Val?Ile?His?His?Ser?Ala?Gly?Ala?Thr?Cys
115 120 125
Ser?Thr?Gln?Ser?Ser?Cys?Ser?Leu?Gln?Val?Arg?Asn?Ile?Gln?Asn?Tyr
130 135 140
His?Met?Asp?Gly?Arg?Gly?Tyr?Ser?Asp?Ile?Gly?Tyr?Asn?Phe?Leu?Val
145 150 155 160
Gly?Asn?Asp?Gly?Asn?Val?Tyr?Glu?Gly?Arg?Gly?Trp?Asp?Arg?Arg?Gly
165 170 175
Ala?His?Ala?Leu?Asn?Val?Asn?Thr?Glu?Ser?Ile?Gly?Ile?Cys?Phe?Met
180 185 190
Gly?Asp?Phe?Thr?Ser?Gln?Lys?Pro?Thr?Ala?Ser?Ala?Ile?Ala?Ala?Ala
195 200 205
Lys?Ser?Leu?Ile?Ser?Cys?Gly?Val?Ser?Leu?Gly?Lys?Ile?Arg?Ser?Gly
210 215 220
tyr?Ser?Leu?Tyr?Gly?His?Arg?Asp?Val?Gly?Ser?Thr?Ala?Cys?Pro?Gly
225 230 235 240
Asn?Leu?Leu?Tyr?Asp?Asp?Ile?Lys?Ser?Trp?Gly?Arg?Tyr?Val?Gly
245 250 255

Claims (3)

1. therefrom separate the Chinese lancelet peptidoglycan identification protein gene B.b.pgrp that obtains among the total RNA of the digestive tube of state lancelet, its dna sequence dna is shown in sequence in the sequence table 1.
2. Chinese lancelet peptidoglycan recognition protein B.b.PGRP, its aminoacid sequence is shown in sequence in the sequence table 2.
3. the production method of protein B .b.PGRP, carry out according to the following steps:
(1) the described gene B.b.pgrp of claim 1 is cloned on the coli expression carrier pGEX-4T, obtains recombinant expression vector pGEX-B.b.pgrp;
(2) with pGEX-B.b.pgrp transformed into escherichia coli bacterial strain BL21 (DE3);
(3) e. coli bl21 (DE3) liquid medium within that transforms is added rich LB and cultivate, cultivate that to add concentration after three hours be that the IPTG of 0.2mM induces in 18 ℃ and spends the night for 37 ℃;
(4) purifying of the Chinese lancelet B.b.PGRP fusion rotein of reorganization specifically is with the centrifugal collection thalline of bacterium liquid, carries out ultrasonication, the centrifuging and taking supernatant liquor, and last GST Sepharose 4B affinity column can obtain purer albumen.
CN2006100353102A 2006-04-29 2006-04-29 China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use Expired - Fee Related CN1982456B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN2006100353102A CN1982456B (en) 2006-04-29 2006-04-29 China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN2006100353102A CN1982456B (en) 2006-04-29 2006-04-29 China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use

Publications (2)

Publication Number Publication Date
CN1982456A CN1982456A (en) 2007-06-20
CN1982456B true CN1982456B (en) 2010-07-21

Family

ID=38165300

Family Applications (1)

Application Number Title Priority Date Filing Date
CN2006100353102A Expired - Fee Related CN1982456B (en) 2006-04-29 2006-04-29 China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use

Country Status (1)

Country Link
CN (1) CN1982456B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103484468A (en) * 2013-09-11 2014-01-01 华南农业大学 Diamondback moth peptidoglycan recognition protein, preparation method and application thereof

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8680235B2 (en) * 2006-09-22 2014-03-25 Stowers Institute For Medical Research Branchiostoma derived fluorescent proteins
CN103131686A (en) * 2011-11-29 2013-06-05 中国科学院海洋研究所 Type two peptidoglycan recognition protein and preparation method and application thereof
CN102925447B (en) * 2012-11-06 2014-04-02 中山大学 peptidoglycan binding protein BjApextrin1 and BjApextrin2, and genes, production method and application thereof
CN105132431B (en) * 2015-09-15 2019-03-29 盐城工学院 A kind of Cynoglossus semilaevis peptidoglycan recognition protein Cs-PGRP gene coded protein and its application
CN113583102B (en) * 2021-08-28 2023-09-19 青岛农业大学 Recombinant protein of paralichthys olivaceus peptidoglycan recognition protein, and preparation method and application thereof
CN116178521B (en) * 2023-03-21 2024-04-09 中国海洋大学 Fish-source peptidoglycan recognition protein mutant, preparation method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1644697A (en) * 2004-12-24 2005-07-27 中山大学 Thioredoxin peroxidase gene of China Qingdao branchiostoma and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1644697A (en) * 2004-12-24 2005-07-27 中山大学 Thioredoxin peroxidase gene of China Qingdao branchiostoma and use thereof

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103484468A (en) * 2013-09-11 2014-01-01 华南农业大学 Diamondback moth peptidoglycan recognition protein, preparation method and application thereof

Also Published As

Publication number Publication date
CN1982456A (en) 2007-06-20

Similar Documents

Publication Publication Date Title
CN1982456B (en) China amphioxus peptidoglycan recognition protein B.b.PGRP, its production and use
CN101918431B (en) Cell-permeabilising peptides and polypeptides for microbial cells
CN100584860C (en) A plurality of reconstructing antibiotic peptide and preparation method and application thereof
CN101967485A (en) Human FGF21 mutant gene and method for preparing recombinant human FGF21 protein
CN101092618B (en) Method for preparing enzyme of dissolving staphylococcal bacteria, its derivative, and method for preparing the derivative
CN105859863A (en) Litopenaeus vannamei antimicrobial peptide-CrustinB gene and preparation and application of recombinant protein of gene
CN100535115C (en) Amphioxus galactose lectin AmphiGAL13-gene and its use
CN1606565B (en) Nucleic acids encoding recominant 56 and 82 kda antigens from gametocytes of eimeria maxima and their uses
CN112480227B (en) Protein for improving pathogenic bacterium resistance of sturgeon and preparation method and application thereof
CN104195157A (en) High-efficiency recombination expression and purification method of biological active peptide in prokaryotic cells
CN110117587A (en) A kind of staphylolytic enzyme and its store method and application
CN106084024A (en) Litopenaeus vannamei antibacterial peptide CrustinA gene and the preparation and application of recombiant protein thereof
CN100516218C (en) Toxic sequential, its preparation and use
CN105132431B (en) A kind of Cynoglossus semilaevis peptidoglycan recognition protein Cs-PGRP gene coded protein and its application
CN101948890A (en) Production method of chicken interferon alpha and constructed engineering bacteria
CN101914546B (en) Amphioxus saccharide pattern-recognition molecule Bjfcn1 gene and application thereof
CN111690636B (en) Trypsin-like serine protease gene, encoded protein and application
CN101003568A (en) Recombined diphtheria toxin, preparation method, and application
CN102604906A (en) Bombyx mori glutathione-S-transferase BmGSTD4 and genes thereof
CN101775400B (en) Rana chensinensis functional gene Rd-RNase2 sequence, construction method and amino acid sequence and application thereof
CN102127168A (en) Recombinant fusion protein of triggering receptor-1 expressed on myeloid cells (TREM-1) and application thereof
CN102021161A (en) Preparation method for bacteriophage lyase of streptococcus pneumonia
CN100352841C (en) Antibiotic peptide and its coding sequence and uses
CN103484442B (en) Nod factor lytic enzyme, its encoding gene and application
CN103937828A (en) Preparation method of fusion protein of porcine interferon-alpha 1 and thymosin-alpha 1

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20100721

Termination date: 20160429