CN1982334A

CN1982334A - Populus diversifolia PeCBL2 gene and its use

Info

Publication number: CN1982334A
Application number: CN 200510130451
Authority: CN
Inventors: 尹伟伦; 夏新莉; 陈金焕
Original assignee: Individual
Current assignee: Individual
Priority date: 2005-12-13
Filing date: 2005-12-13
Publication date: 2007-06-20

Abstract

Cold-resisting and drought-resisting transcriptional factor DREB of Populus euphratica Olive, its coded gene and use are disclosed. The DREB is named PeDREB2, which has amino-acid sequence or derived protein having same activity with amino-acid sequence substituted, lost or added by one or several amino-acid residue. Anti-reversible transcriptional factor PeDREB2 encoded gene has DNA sequence, 90% homology with DNA and important function in breeding drought-resisting and cold-resisting plant variety.

Description

Populus diversifolia PeCBL 2 gene and application

Technical field

The present invention designs diversiform-leaved poplar (Populus euphratica) DREB class transcription factor and encoding gene and application, particularly relates to diversiform-leaved poplar DREB class cold-resistant and drought-enduring transcription factor and encoding gene and application.

Technical background

Diversiform-leaved poplar (Populus euphratica) be unique can be saline and alkaline in arid and the arbor of the drought desert area growth of temperature difference acute variation build group seeds.As the extremely strong typical plant of natural resistance, diversiform-leaved poplar has caused the attention of international academic community.Research, development and utilization diversiform-leaved poplar resistance genetic resources have significant values for going deep into the degeneration-resistant forest new variety of forest resistance mechanism and directive breeding.The cell of organism the variation of envrionment conditions is to external world made corresponding reaction, in plant, DREB class transcription factor in the AP2/DREB family can be accepted the environment-stress signal, starts a series of stress response expression of gene, thereby strengthens the tolerance of plant to adverse circumstance.

Summary of the invention

The purpose of this invention is to provide relevant DREB class transcription factor and the encoding gene thereof of a kind of and resistance in the diversiform-leaved poplar, this transcription factor is cloned in diversiform-leaved poplar first, has regulating and controlling effect in cold-resistant and drought resisting reaction.DREB class transcription factor provided by the present invention derives from diversiform-leaved poplar, be in the DREB2 family, called after PeDREB2, be the protein that has with sequence table 2 amino acid residue sequences, or with sequence table 2 amino acid residue sequences through replacement, disappearance or the interpolation of one or several amino-acid residues and have identical active by sequence deutero-protein with the amino acid residue sequence of sequence

The protein that the sequence amino acid residue sequence is made up of 287 amino-acid residues in the sequence table, sequence table 2 underscores are this gene nuclear localization signal for the collinear sequence, its conservative AP2/DREB structural domain sequence be from the nitrogen end to carbon teminal 78-135 amino acids residue, i.e. underscore is the part of dotted line in the sequence table 2.

The encoding gene of anti-reverse transcription factor PeDREB2 is one of following nucleotide sequences:

1) dna sequence dna of sequence 1 in the sequence table

2) with sequence in the dna sequence dna that limits of sequence 1 have 90% above homology, and the identical function protein DNA sequence of encoding.

The dna sequence dna of sequence 1 is the opening code-reading frame sequence of this gene by 864 based compositions in the sequence table, contains conservative AP2/DREBP structural domain sequence, and its expression is subjected to inducing of low temperature, arid and high salt.

The gene of encoding transcription factor PeDREB2 provided by the present invention, use any expression vector that can guide foreign gene in plant, to express (comprising double base agrobacterium vector and the carrier that is used for the monocotyledons micropellet bombardment) transformed plant, can obtain low temperature and drought stress resistance enhanced transfer-gen plant.Gene of the present invention can add any strong promoter or inducible promoter in being building up to plant expression vector the time before its transcription initiation Nucleotide.Gene of the present invention can use enhanser in being building up to plant expression vector the time, but must be identical with the reading frame of encoding sequence, guarantee the translation of whole sequence.

For the ease of transgenic plant cells or plant being identified and screening, can when carrier construction, process carrier, for example add alternative mark, normally used alternative mark can be the gene of coding to microbiotic (comprising gentamicin, kantlex, Totomycin) resistance enzyme, also can be that GUS, GFP etc. can produce the enzyme of colour-change or the gene of luminophor etc.

Carry PeDREB2 expression carrier of the present invention and can transform plant host by several different methods, to cultivate the plant variety of cold-resistant or drought resisting, for example Ti-plasmids, Ri plasmid, electroporation, microinjection, plant viral vector, directly DNA transforms or plant viral vector etc., the plant transformed host of institute can be that monocotyledons also can be a dicotyledons.

The present invention will be further described below in conjunction with specific embodiment

Description of drawings

Fig. 1 is the full length gene electrophorogram that obtains by RT-PCR technology clone, and M is markerD2000 among the figure, and 1 is gene PeDREB2;

Fig. 2 is PeDREB2 gene RT-PCR detected result under cold condition;

Fig. 3 is PeDREB2 gene RT-PCR detected result under drought condition;

Fig. 4 is PeDREB2 gene RT-PCR detected result under high salt condition.

Embodiment

Embodiment 1, the extraction of the total DNA of diversiform-leaved poplar

Method with CTAB (Sa nurse Brooker, molecular cloning experiment guide, the third edition) is extracted total DNA from the diversiform-leaved poplar that arid is handled.

Embodiment 2, and PeDREB2 opens the clone of frame

Always the diversiform-leaved poplar DNA that extracts is carried out PCR with primer PDR1 (GGTCCTGAGATCGAGAATATG) and PDR2 (AGAAAACGCTACAAAGATGTC).The PCR program is: (1) 94 ℃, and sex change 5 minutes.(2) pcr amplification, 30 circulations: 94 ℃, sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃, extended 45 seconds; (3) 72 ℃, extended 10 minutes.The PCR product is carried out electrophoretic separation with 1% sepharose, reclaim the purpose segment with the agarose DNA separating kit that day is the epoch then and be connected with the pMD18 carrier of TaKaRa company, the reaction system that connects is: purpose segment 4 μ l, 1 μ l pMD18 vector, 5 μ lLigation Mix, (60ng/ μ l), in 16 ℃ of connections of spending the night, the intestinal bacteria TOP10 that will connect the product transformed competence colibacillus again, method with PCR detects positive strain, gets the successful bacterial strain of conversion at last and carries out determined dna sequence at AudioCodes.

Embodiment 3, the clone of the extraction of the total RNA of diversiform-leaved poplar and PeDREB2 cDNA sequence

With CTAB (Sa nurse Brooker, the molecular cloning experiment guide, the third edition) method is extracted total RNA from the diversiform-leaved poplar that arid is handled, total RNA uses primer PDR1 (GGTCCTGAGATCGAGAATATG) and PDR2 (AGAAAACGCTACAAAGATGTC) that this cDNA is carried out PCR with the synthetic cDNA of reversed transcriptive enzyme reverse transcription then.The PCR program is: (1) 94 ℃, and sex change 5 minutes.(2) pcr amplification, 30 circulations: 94 ℃, sex change 45 seconds; Annealed 45 seconds for 55 ℃; 72 ℃, extended 45 seconds; (3) 72 ℃, extended 10 minutes.The PCR product is carried out electrophoretic separation with agarose, reclaim the purpose segment with the agarose DNA separating kit that day is the epoch then and be connected with pGM-T Easy carrier, the reaction system that connects is: purpose segment 7 μ l, 1 μ l, 10 * ligase enzyme damping fluid, 1 μ l pGM-T Easy Vector (60ng/ μ l), the T4DNA ligase enzyme of 1 μ l spends the night in 16 ℃ of connections.To connect product again and transform into competent intestinal bacteria Top10, and get the successful bacterial strain of conversion at last and carry out sequencing in AudioCodes company, measurement result is compared with its dna sequence dna and is learnt that PeDREB2 does not contain intron.

Embodiment 4, the expression characterization of Populus diversifolia PeCBL 2 gene in adverse circumstance

For 2 years that obtain from Xinjiang living diversiform-leaved poplar plant, carry out subzero treatment (4 ℃) or arid processing, salt processing respectively, time according to experimental design is got blade, through liquid nitrogen flash freezer, to extract RNA and do the RT-PCR analysis, the RT-PCR reaction is contrast with the Actin2 of diversiform-leaved poplar, concentration unanimity with template cDNA in the control PCR reaction, result such as Fig. 2 are shown in 3,4.

Embodiment 5, the structure of Populus diversifolia PeCBL 2 gene expression vector

The primer that is added with Xbal restriction enzyme site joint with two is from the enterprising performing PCR of the cloning vector that contains its cDNA sequence, the product that obtains is connected on the cloning vector, bacterium colony shakes bacterium, upgrading grain with the positive colony that obtains after identifying, and cut 3 hours with the Xbal enzyme, extract the pBI121 plasmid simultaneously, also cut and the enzyme that obtains cut product with day being 16 ℃ of connections of spending the night of ligase enzyme in epoch in 3 hours with the Xbal enzyme, difference transformed into escherichia coli Top10, forward that obtains and reverse positive products further transform Agrobacterium LBA4404.

Sequence table

Sequence table 1 ATGGGTACTCTTATTCAAGGTTCTAACGCCACTTCCATGTCCATGGATTCTACCAA GAAG

Sequence table 2 M G T L I Q G S N A T S M S M D S T K K

61 AGGAAAAGGGCAAGTAATAAATCTGTAGCTGAGACCCTTCAAAAGTGGAAGGAATACAAT

21 R K R A S N K S V A E T L Q K W K E Y N

121 GAGTATCTTGATGCTCAAGGTGATGAAGGTAACAAACCAGTTCGTAAAGTTCCTGCCAAG

41 E Y L D A Q G D E G N K P V R K V P A K

181 GGCTCAAAGAAGGGGTGCATGAAAGGTAAAGGAGGCCCAGAGAATTCAGTCTGCAATTAC

61 G S K K G C M K G K G G P E N S V C N Y

241 AGAGGTGTGAGACAGAGGACATGGGGGAAGTGGGTTGCTGAGATTCGGGAGCCAGACAGA

81 R G V R Q R T W G K W V A E I R E P D R

301 GGGCCTAGGCTATGGCTTGGTACTTTTCCTACTGCCTATGAAGCTGCTCTTGCCTATGAT

101 G P R L W L G T F P T A Y E A A L A Y D

361 AATGCTGCACGAACTATGTATGGTCCTCGTGCTCGTTTAAACATTCCAGATGTGGTGAAT

121 N A A R T M Y G P R A R L N I P D V V N

421 TCAACAAGCTCATCGAAGGATAACTTCTCTGCTGTGACACCATCATACTATTATTCAGCT

141 S T S S S K D N F S A V T P S Y Y Y S A

481 GCAAGTTCTGCTGACTCCGTCACCACATCAACCCACTCTGAGGTTTGTGCGTACGAGGAT

161 A S S A D S V T T S T H S E V C A Y E D

541 CCTAACCAGAATGTATTAAGCCATGCTGAGGATTGGATGACAAATATATCAAGCCAAGCT

181 P N Q N V L S H A E D W M T N I S S Q A

601 GAGGTTTGCGAGCAGAATGCATCAAGCCAAACTGAGGTTTACGAGCAGAATGTATCAAGC

201 E V C E Q N A S S Q T E V Y E Q N V S S

661 CAGCATGTCGAGGATTGTTCTCGGGGAGTTGAAAAAAATAGCAAGCTGAGTCAAGATGAG

221 Q H V E D C S R G V E K N S K L S Q D E

721 CTGAAGATTCAACCAGAAAATCCTTCGTGGGCCAATGACTGTCACGACTACGGCTGGGAT

241 L K I Q P E N P S W A N D C H D Y G W D

781 GAGATCTTTAGCGTAGAAGAGCTGCTAGGGGATATCGATTCTGGGATGACAGGAGCAGAG

261 E I F S V E E L L G D I D S G M T G A E

841 GGGTACTTCAGCTTAGGATTTTGA

281 G Y F S L G F *

Claims

1. the DREB class transcription factor PeDREB2 of diversiform-leaved poplar, it have with sequence table in the amino acid residue sequence of sequence 2 obtain the amino acid residue sequence of sequence 2 through replacement, disappearance or the interpolation of one or several amino-acid residue and have with the amino acid residue sequence of sequence 2 identical active by sequence 2 deutero-protein.

2. transcription factor according to claim 1 is characterized in that: it has the amino acid residue sequence of sequence 2 in the sequence table.

3. the encoding gene of diversiform-leaved poplar DREB class transcription factor PeDREB2, it is one of following nucleotide sequences:

1) dna sequence dna of sequence 1 in the sequence table

2) with sequence table in the dna sequence dna that limits of sequence 1 have 90% above homology, and the identical function protein DNA sequence of encoding.

4. gene according to claim 3 is characterized in that: the encoding gene of described diversiform-leaved poplar DREB class transcription factor PeDREB2 is the dna sequence dna of sequence 1 in the sequence table.

5. the described gene of claim 4, its open reading frame are from 5 ' end the 1st to the 864th bit base.

6. contain the described expression carrier of claim 3.

7. the clone that contains the described gene of claim 3

8. the application of the described gene of claim 3 in cultivating cold-resistant and drought-resistant plant.