CN1980663A - Prodrugs of mitotic kinesin inhibitors - Google Patents

Prodrugs of mitotic kinesin inhibitors Download PDF

Info

Publication number
CN1980663A
CN1980663A CN 200580022248 CN200580022248A CN1980663A CN 1980663 A CN1980663 A CN 1980663A CN 200580022248 CN200580022248 CN 200580022248 CN 200580022248 A CN200580022248 A CN 200580022248A CN 1980663 A CN1980663 A CN 1980663A
Authority
CN
China
Prior art keywords
alkyl
aryl
cycloalkyl
heterocyclic radical
alkynyl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200580022248
Other languages
Chinese (zh)
Inventor
P·J·科尔曼
C·D·科克斯
G·D·哈特曼
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Merck and Co Inc
Original Assignee
Merck and Co Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Merck and Co Inc filed Critical Merck and Co Inc
Publication of CN1980663A publication Critical patent/CN1980663A/en
Pending legal-status Critical Current

Links

Landscapes

  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The present invention relates to prodrugs of dihydropyrazole compounds that are useful for treating cellular proliferative diseases, for treating disorders associated with KSP kinesin activity, and for inhibiting KSP kinesin. The invention also related to compositions which comprise these compounds, and methods of using them to treat cancer in mammals.

Description

The prodrug of mitotic kinesins inhibitor
Background of invention
The present invention relates to be mitotic kinesins, the prodrug derivatives of the pyrazoline chemical compound of the inhibitor of mitotic kinesins KSP particularly, it can be used for treating cell proliferation disorders, and described cell proliferation disorders is cancer, hyperplasia, restenosis, cardiac hypertrophy, immune disorders and inflammation for example.
Taxanes and vinca alkaloids are arranged in being used for the treatment of the treatment for cancer agent.Taxanes and vinca alkaloids work to the microtubule that is present in the various cellularity.Microtubule is the primary structure element of mitosis spindle.Mitosis spindle is responsible for genomic duplicate copy is distributed in two daughter cells that produce because of cell division each.Mitosis spindle is broken cause splitted inhibition of cancerous cell and inducing cancer cell death according to inferring these medicines.Yet microtubule forms the cellularity of other type, comprises the track that transports in the born of the same parents in the nervous process.Because these activating agents can't selectively targeted mitosis spindle, so there is the side effect that limits its serviceability in their.
The specific improvement of activating agent that is used for the treatment of cancer is quite noticeable because of the treatment helpfulness, if the side effect relevant with giving these activating agents can obtain reducing, so just can realize that these treat helpfulness.In general, the significance in the treatment cancer improves and identifies that the therapeutic agent that works by new mechanism is relevant.The example not only comprises taxanes, and comprises camptothecin topoisomerase I inhibitor.From these two kinds of viewpoints, mitotic kinesins is the attractive target of new anti-cancer drug.
Mitotic kinesins is the necessary enzyme of mitosis spindle form, fit, and function, but generally is not the ingredient such as other micro-tubular structure in the nervous process.It is essential that mitotic kinesins plays a part in all phase process of mitosis.These enzymes drive " the molecule dynamin " of cell goods along the mechanical force of microtubule directed movement for the energy that the ATP hydrolysis is discharged changes into.The catalyst structure domain that is enough to carry out this process is about 340 amino acid whose tight structures.In the mitosis process, kinesin makes microtubule be organized as the dipolar configuration of mitosis spindle.Kinesin mediation chromosome moves and the structural change of the mitosis spindle relevant with the mitosis moment along SMT.The experimental interference of mitotic kinesins function causes mitosis spindle deformity or malfunction, causes cell cycle arrest and cell death usually.
In the mitotic kinesins of having identified, KSP is arranged.KSP belongs to the kinesin subtribe of the evolution conservative of the directed microtubule motor protein of positive pole, and the microtubule motor protein of described anode orientation is assembled into the bipolar homotype tetramer of being made up of antiparallel homodimer.In the mitosis process, KSP combines with the microtubule of mitosis spindle.To go into human body cell at the antibody microinjection of KSP and can prevent that the spindle pole in the prometaphase process from separating, thereby produce monopolar spindle and cause mitosis to stagnate and induce programmed cell death.KSP and the associated drives albumen in other inhuman organism are tied up antiparallel microtubule and they can be slided over each other, and impel two spindle poles separately thus.Prolongation of B spindle and the microtubule on the spindle pole that KSP can also mediate in the later stage are concentrated.
Human KSP (being also referred to as HsEg5) [Blangy etc., Cell, 83:1159-69 (1995) have been described; Whitehead etc., Arthritis Rheum., 39:1635-42 (1996); Galgio et al., J.Cell Biol., 135:339-414 (1996); Blangy etc., J Biol.Chem., 272:19418-24 (1997); Blangy etc., Cell Motil Cytoskeleton, 40:174-82 (1998); Whitehead and Rattner, J.Cell Sci., 111:2551-61 (1998); Kaiser etc., JBC 274:18925-31 (1999); GenBank accessionnumbers:X85137, NM004523 and U37426], and fragment (TRIP5) [Lee etc., Mol Endocrinol., the 9:243-54 (1995) of KSP gene have been described; GenBankaccession number L40372].Xenopus KSP congener (Eg5) and Drosophila K-LP61 F/KRP 130 have been reported.
Recently it with some quinazolone class description KSP inhibitor (PCT Publ.WO 01/30768, May 3 calendar year 2001).
Mitotic kinesins is the attractive target that is used to find and develop new mitosis chemotherapeutics.Therefore, the object of the present invention is to provide chemical compound, the method and composition that is used to suppress mitotic kinesins KSP.
Summary of the invention
The present invention relates to be used for the treatment of cell proliferation disorders, be used for the treatment of and be used to suppress the prodrug of the pyrazoline derivant of KSP kinesin with the active relevant disease of KSP kinesin.Chemical compound of the present invention can be represented by general formula I:
Figure A20058002224800211
Detailed Description Of The Invention
Chemical compound of the present invention is used to suppress mitotic kinesins and is represented by the chemical compound of general formula I or its pharmaceutically acceptable salt or stereoisomer:
Wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-8;
P is 1-6;
U is 1,2,3,4 or 5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7)(C＝O)NR 9R 10；
8) (C=O) OC 1-C 10Alkyl;
9)SO 2 NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
13) C 1-C 10Alkyl;
14) aryl;
15) heteroaryl;
16) (CH 2) u(C=O) C 1-C 10Alkyl;
17)(CH 2) u(C＝O)NR 9R 10；
18) 3-pyrrolidone-base, 3-piperidone base, 2-Ketocyclopentane base, 2-hexamethylene ketone group;
19) (C=O) (C=O) C 1-C 10Alkyl;
20)(C＝O)(C＝O)NR 9R 10；
21) (C=O) (C=O) OC 1-C 10Alkyl;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, heteroaryl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 2Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) C 1-C 6Perfluoroalkyl;
6) C 1-C 6Aralkyl;
7) C 1-C 6Heteroarylalkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl, heteroarylalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 3, R 4And R 5Be independently selected from:
1)H；
2) C 1-C 10Alkyl;
3) aryl;
4) C 2-C 10Alkenyl;
5) C 2-C 10Alkynyl;
6) C 1-C 6Perfluoroalkyl;
7) C 1-C 6Aralkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
The R that is connected with same carbon atom 3And R 4Be merged into-(CH 2) u-, wherein one of carbon atom randomly is selected from O, S (O) m,-N (R 9) C (O)-and-N (COR 10)-part replace;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) (C 0-C 6) alkylidene-S (O) mR a
4) oxo;
5)OH；
6) halogen;
7)CN；
8) (C=O) aO b(C 2-C 10) alkenyl;
9) (C=O) aO b(C 2-C 10) alkynyl;
10) (C=O) aO b(C 3-C 6) cycloalkyl;
11) (C=O) aO b(C 0-C 6) alkylidene-aryl;
12) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
13) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
14)C(O)R a；
15) (C 0-C 6) alkylidene-CO 2R a
16)C(O)H；
17) (C 0-C 6) alkylidene-CO 2H;
18)C(O)N(R b) 2；
19)S(O) mR a；
20) S (O) 2NR 9R 10With
21)C(NH)NH 2；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl are randomly by one or more R that are selected from 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 3-7 member and denitrogenate, randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle are randomly by one or more R that are selected from 8Substituent group replace;
R aBe (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl, benzyl or heterocyclic radical;
R bBe H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aWith
R cBe independently selected from: (C 1-C 6) alkoxyl, new pentane acyloxy methoxyl group and NR b 2Or
Two R cS can be combined with one another to the monocyclic heterocycles of 5-7 unit with the phosphorus that they are connected, described monocyclic heterocycles randomly by one, two or three are selected from R bSubstituent group replace;
R dBe independently selected from H, (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl, benzyl or heterocyclic radical;
Rp is selected from :-PO (OH) 2,-PO (Rc) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2, C (O) CH 2CH 2CH 2OPO (R c) 2,-CH 2OPO (OH) 2,-CH 2OPO (R c) 2,-C (O) (CHR d) pNR a 2,-C (O) (CHR d) pNR a 3 +,-CH 2OC (O) (CHR d) pNR a 2,-CH 2OC (O) (CHR a) pNR a 3 +With
Another embodiment of the invention is represented by the chemical compound of general formula I I or its pharmaceutically acceptable salt or stereoisomer:
Wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7) (C=O) OC 1-C 10Alkyl;
8)(C＝O)NR 9R 10；
9)SO 2NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 2Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) C 1-C 6Perfluoroalkyl;
6) C 1-C 6Aralkyl;
7) C 3-C 8Cycloalkyl; With
8) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 3, R 4And R 5Be independently selected from:
1)H；
2) C 1-C 10Alkyl;
3) aryl;
4) C 2-C 10Alkenyl;
5) C 2-C 10Alkynyl;
6) C 1-C 6Perfluoroalkyl;
7) C 1-C 6Aralkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) ObC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen;
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R aBe (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl or heterocyclic radical;
R bBe H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aAnd
R cBe independently selected from: (C 1-C 6) alkoxyl, new pentane acyloxy methoxyl group and NR b 2Or
Two R cS can be combined with one another to the monocyclic heterocycles of 5-7 unit with the phosphorus that they are connected, described monocyclic heterocycles randomly by one, two or three are selected from R bSubstituent group replace;
R PBe selected from :-PO (OH) 2,-PO (R c) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2, C (O) CH 2CH 2CH 2OPO (R c) 2,-C (O) CH 2NR a 2,-C (O) CH 2NR a 3 +,-CH 2OC (O) CH 2NR a 2,-CH 2OC (O) CH 2NR a 3 +With
Figure A20058002224800301
Another embodiment is chemical compound or its pharmaceutically acceptable salt or the stereoisomer of aforesaid general formula I I, wherein:
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 3-C 8Cycloalkyl;
4) (C=O) heterocyclic radical;
5) (C=O) OC 1-C 10Alkyl;
6) SO 2NR 9R 10With
7) SO 2C 1-C 10Alkyl;
Described alkyl, aryl, cycloalkyl and heterocyclic radical randomly by one, two or three are selected from R 7Substituent group replace;
R 2Be selected from:
1) C 1-C 10Alkyl;
2) aryl; With
3) heteroaryl;
Described alkyl, aryl and heteroaryl are randomly by one or more R that are selected from 7Substituent group replace;
R 3And R 4Be independently selected from:
1) H; With
2) C 1-C 10Alkyl;
Described alkyl is randomly by one or more R that are selected from 7Substituent group replace; And
R 5Be selected from:
1)H；
2) C 1-C 10Alkyl;
3) aryl; With
4) heterocyclic radical;
Described alkyl, aryl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
Rp is selected from :-PO (OH) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2,-CH 2OPO (OH) 2,-C (O) CH 2NR a 2,-C (O) CH 2NR a 3 +,-CH 2OC (O) CH 2NR a 2,-CH 2OC (O) CH 2NR a 3 +With
R 7, R 8, R 9, R 10, R aAnd R bAs mentioned above.
Another embodiment of the invention is represented by the chemical compound of general formula III or its pharmaceutically acceptable salt or stereoisomer:
Wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7) (C=O) OC 1-C 10Alkyl;
8)(C＝O)NR 9R 10；
9)SO 2NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 7aAnd R 7cBe independently selected from:
1)H；
2) O bC 1-C 10Alkyl;
3) halogen;
4) CN; With
5)OH；
Described alkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 7bBe halogen;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen;
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R aBe independently selected from: (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl and heterocyclic radical;
R bBe independently selected from: H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aWith
Rp is selected from :-PO (OH) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2,-CH 2OPO (OH) 2,-C (O) CH 2NR a 2,-C (O) CH 2NR a 3 +,-CH 2OC (O) CH 2NR a 2,-CH 2OC (O) CH 2NR a 3 +With
Figure A20058002224800351
Another embodiment of the invention is represented by the chemical compound of general formula I V or its pharmaceutically acceptable salt or stereoisomer:
Figure A20058002224800352
Wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-5;
R 7aAnd R 7cBe independently selected from:
1) O bC 1-C 10Alkyl;
2) halogen;
3) CN; With
4)OH；
Described alkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 7bBe halogen;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen,
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl with alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R 11Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 3-C 8Cycloalkyl;
4) heterocyclic radical;
Described alkyl, aryl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 10Substituent group replace; Or
R aBe independently selected from: (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl and heterocyclic radical; And
R bBe independently selected from: H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R a
The instantiation of The compounds of this invention comprises:
3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol;
3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethanol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethyl dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] fourth-1-alcohol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] butyl dihydrogen phosphoric acid ester;
3-[(5S)-and 1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol; With
3-[(5S)-and 1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
Or its pharmaceutically acceptable salt or stereoisomer.
Chemical compound of the present invention can have asymmetric center, chiral axis and chirality plane (as: E.L.Eliel and S.H.Wilen, Stereochemistry of Carbon Compounds, JohnWiley ﹠amp; Sons, New York, 1994, described in the 1119-1190 page or leaf) and as racemate, racemic mixture and the appearance of each diastereomer, all possible isomer and composition thereof comprises optical isomer, and all these class stereoisomers all comprise in the present invention.In addition, the chemical compound that this paper discloses can be used as the tautomeride existence and two kinds of tautomeric forms include within the scope of the present invention, even only describe a kind of tautomerism body structure.
As (the R for example of variable arbitrarily 7, R 8, R bDeng) on any composition, occur when once above, the definition when its definition when at every turn occurring and another time occur is independently of one another.In addition, the combination of substituent group and variable allows, and condition is the stable chemical compound of this class combination results.Key shown in the line of drawing in ring system on substituent group is downwards represented can be connected with the commutable annular atoms any one.If ring system is multi-ring, so its implication be key only with adjacent ring on suitable carbon atom in any one be connected.
Be appreciated that substituent group and substitute mode on the The compounds of this invention can be selected by those skilled in the art, so that provide chemically stable and be easy to by techniques well known in the art and following method by the synthetic chemical compound of the raw material that is easy to obtain.If substituent group self is replaced by an above group, should understand these a plurality of groups so and can be positioned on same carbon or the different carbon, as long as produce stable structure.Term " is randomly replaced by one or more substituent groups " " randomly to be replaced by at least one substituent group " with term and is equal to, and in this class situation, embodiment preferred is for having 0-3 substituent group.
" alkyl " used herein is in order to comprise side chain and the straight chain radical of saturated aliphatic alkyl that has to the carbon atom of determined number.For example, with " C 1-C 10Alkyl " in C 1-C 10Be defined as and be included in the group that has 1,2,3,4,5,6,7,8,9 or 10 carbon that straight or branched is arranged.For example, " C 1-C 10Alkyl " particularly including methyl, ethyl, just-propyl group, different-propyl group, just-butyl, tert-butyl, different-butyl, amyl group, hexyl, heptyl, octyl group, nonyl, decyl etc.Term " cycloalkyl " refers to the monocycle radical of saturated aliphatic alkyl that has given number of carbon atoms.For example, " cycloalkyl " comprises cyclopropyl, methyl-cyclopropyl, 2,2-dimethyl-cyclobutyl, 2-ethyl-cyclopenta, cyclohexyl etc.In one embodiment of the invention, term " cycloalkyl " comprises above-mentioned group and further comprises monocycle unsaturated aliphatic alkyl.For example, Ding Yi " cycloalkyl " comprises cyclopropyl, methyl-cyclopropyl in this embodiment, 2, and 2-dimethyl-cyclobutyl, 2-ethyl-cyclopenta, cyclohexyl, cyclopentenyl, cyclobutane base etc.
Term " alkylidene " refers to the two free alkyl that has the specified quantity carbon atom.For example, " alkylidene " comprises-CH 2-,-CH 2CH 2-etc.
When at term " C 1-C 6Aralkyl " and " C 1-C 6Heteroarylalkyl " in when using, term " C 1-C 6" refer to the moieties in this part and do not describe the aryl of this part and the atomic quantity in the heteroaryl moieties.
The ring that indicates carbon number or non--cycloalkyl that " alkoxyl " expression connects by oxo bridge." alkoxyl " comprises the definition of abovementioned alkyl and cycloalkyl thus.
If do not specify carbon number, term " alkenyl " refer to the straight chain that contains 2-10 carbon atom and at least one carbon-carbon double bond, side chain or cyclic non--aromatic hydrocarbyl.Preferably there is a carbon-carbon double bond and can has four non--aromatics carbon-carbon double bonds at the most.Therefore, " C 2-C 6Alkenyl " refer to the alkenyl that has 2-6 carbon atom.Alkenyl comprises vinyl, acrylic, cyclobutenyl, 2-methyl butene base and cyclohexenyl group.The straight chain of alkenyl, side chain or annulus can contain two keys, and if specify the alkenyl that replaces, can be substituted so.
Term " alkynyl " refers to and contains 2-10 carbon atom and the triple-linked straight chain of at least one carbon carbon, side chain or cyclic hydrocarbon group.Can there be three carbon-to-carbon triple bonds at the most.Therefore, " C 2-C 6Alkynyl " refer to the alkynyl that has 2-6 carbon atom.Alkynyl comprises acetenyl, propinyl, butynyl, 3-methyl butynyl etc.The straight chain of alkynyl, side chain or annulus can contain triple bond, and if specify the alkynyl that replaces, can be substituted so.
In some cases, use to comprise 0 carbon range definition substituent group, such as (C 0-C 6) alkylidene-aryl.If aryl is decided to be phenyl, so this definition comprise phenyl self and-CH 2Ph ,-CH 2CH 2Ph, CH (CH 3) CH 2CH (CH 3) Ph etc.
" aryl " used herein encircles any stable monocycle or the bicyclic carbocyclic of 7 atoms at the most in order to refer to each, and wherein at least one ring is aromatic ring.The example of this class aryl key element comprises phenyl, naphthyl, tetralyl, indanyl and xenyl.At aryl substituent is that dicyclo and a ring are in the situation of non--aromatic ring, should understand by aromatic ring to connect.
Term heteroaryl used herein represents respectively to encircle the stable monocycle or the dicyclo of 7 atoms at the most, and wherein at least one ring is aromatic ring and contains 1-4 hetero atom that is selected from the group of O, N and S composition.Heteroaryl in this range of definition includes, but are not limited to: acridinyl, carbazyl, cinnolines base, quinoxalinyl, pyrazolyl, indyl, benzotriazole base, furyl, thienyl, benzothienyl, benzofuranyl, quinolyl, isoquinolyl,  azoles base, different  azoles base, indyl, pyrazinyl, pyridazinyl, pyridine radicals, pyrimidine radicals, pyrrole radicals, tetrahydroquinoline.Be similar to heterocyclic definition hereinafter, " heteroaryl " can also be interpreted as the N-oxide derivative that comprises nitrogenous arbitrarily heteroaryl.In the heteroaryl substituent group is that dicyclo and a ring are non--aromatic ring or do not contain in the heteroatomic situation, should understand respectively to connect by aromatic ring or by containing heteroatomic ring.
Term used herein " heterocycle " or " heterocyclic radical " are in order to refer to contain 1-4 heteroatomic 3-to 10-unit's aromatics that is selected from the group that O, N and S form or non-aromatic heterocyclic and to comprise bicyclic radicals." heterocyclic radical " comprises above-mentioned heteroaryl and dihydro and tetrahydrochysene analog thus.The extra example of " heterocyclic radical " comprises; but be not limited to following group: azetidinyl; benzimidazolyl; benzofuranyl; benzo furazan base; the benzopyrazoles base; the benzotriazole base; the benzo thiophenyl; the benzoxazol base; carbazyl; carbolinyl; the cinnolines base; furyl; imidazole radicals; indolinyl; indyl; indolazinyl; indazolyl; isobenzofuran-base; isoindolyl; isoquinolyl; isothiazolyl; different  azoles base; naphthyridinyl; the  di azoly;  azoles base;  azoles quinoline; different  azoles quinoline; oxetanyl; pyranose; pyrazinyl; pyrazolyl; pyridazinyl; the pyridopyridine base; pyridazinyl; pyridine radicals; pyrimidine radicals; pyrrole radicals; quinazolyl; quinolyl; quinoxalinyl; THP trtrahydropyranyl; tetrahydrochysene sulfo-pyranose; tetrahydro isoquinolyl; tetrazole radical; the tetrazolo pyridine radicals; thiadiazolyl group; thiazolyl; thienyl; thiazolyl; 1,4-two  alkyl; the hexahydroazepine base; piperazinyl; piperidyl; the pyridin-2-ones base; pyrrolidinyl; morpholinyl; thio-morpholinyl; the dihydrobenzo imidazole radicals; dihydro benzo furyl; the dihydrobenzo thiophenyl; dihydrobenzo  azoles base; the dihydrofuran base; the glyoxalidine base; indolinyl; the different  azoles of dihydro base; the dihydro isothiazolyl; dihydro  di azoly; dihydro  azoles base; the dihydro pyrazinyl; the pyrazoline base; the dihydropyridine base; the dihydro-pyrimidin base; the pyrrolin base; the dihydroquinoline base; the dihydro tetrazole radical; the thiodiazoline base; dihydro-thiazolyl; the dihydro-thiophene base; the dihydro triazolyl; the dihydro azetidinyl; the methylenedioxyphenyl formoxyl; tetrahydrofuran base and tetrahydro-thienyl and N-oxide thereof.Can connect the heterocyclic radical substituent group by carbon atom or by hetero atom.
In one embodiment, term used herein " heterocycle " or " heterocyclic radical " contain 1-4 heteroatomic 5-to 10-unit's aromatics or non-aromatic heterocyclic that is selected from the group of O, N and S composition in order to finger, and comprise bicyclic group." heterocyclic radical " in this embodiment comprises above-mentioned heteroaryl and dihydro and tetrahydrochysene analog thus.The extra example of " heterocyclic radical " comprises; but be not limited to following group: benzimidazolyl; benzofuranyl; benzo furazan base; the benzopyrazoles base; the benzotriazole base; the benzo thiophenyl; the benzoxazol base; carbazyl; carbolinyl; the cinnolines base; furyl; imidazole radicals; indolinyl; indyl; indolazinyl; indazolyl; isobenzofuran-base; isoindolyl; isoquinolyl; isothiazolyl; different  azoles base; naphthyridinyl; the  di azoly;  azoles base;  azoles quinoline; different  azoles quinoline; oxetanyl; pyranose; pyrazinyl; pyrazolyl; pyridazinyl; the pyridopyridine base; pyridazinyl; pyridine radicals; pyrimidine radicals; pyrrole radicals; quinazolyl; quinolyl; quinoxalinyl; THP trtrahydropyranyl; tetrahydrochysene sulfo-pyranose; tetrahydro isoquinolyl; tetrazole radical; the tetrazolo pyridine radicals; thiadiazolyl group; thiazolyl; thienyl; thiazolyl; azetidinyl; 1,4-two  alkyl; the hexahydroazepine base; piperazinyl; piperidyl; the pyridin-2-ones base; pyrrolidinyl; morpholinyl; thio-morpholinyl; the dihydrobenzo imidazole radicals; dihydro benzo furyl; the dihydrobenzo thiophenyl; dihydrobenzo  azoles base; the dihydrofuran base; the glyoxalidine base; indolinyl; the different  azoles of dihydro base; the dihydro isothiazolyl; dihydro  di azoly; dihydro  azoles base; the dihydro pyrazinyl; the pyrazoline base; the dihydropyridine base; the dihydro-pyrimidin base; the pyrrolin base; the dihydroquinoline base; the dihydro tetrazole radical; the thiodiazoline base; dihydro-thiazolyl; the dihydro-thiophene base; the dihydro triazolyl; the dihydro azetidinyl; the methylene-dioxy benzoyl; tetrahydrofuran base and tetrahydro-thienyl and N-oxide thereof.Can connect the heterocyclic radical substituent group by carbon atom or by hetero atom.
In another embodiment, heterocycle is selected from 2-azepines ketone, benzimidazolyl, 2-two azepines ketone, imidazole radicals, 2-imidazolidinone, indyl, isoquinolyl, morpholinyl, piperidyl, piperazinyl, pyridine radicals, pyrrolidinyl, 2-piperidones, 2-pyrimidone, 2-Pyrrolidone, quinolyl, tetrahydrofuran base, tetrahydro isoquinolyl and thienyl.
Just as will be understood by the skilled person in the art, " halogen (halo) " used herein or " halogen (halogen) " are in order to comprise chlorine, fluorine, bromine and iodine.
Except as otherwise noted, described alkyl, alkenyl, alkynyl, cycloalkyl, aryl, heteroaryl and heterocyclic radical substituent group can be substituted or not be substituted.For example, (C 1-C 6) alkyl can be by one, two or three substituent groups replacements, described substituent group is selected from OH, oxo, halogen, alkoxyl, dialkyl amido or heterocyclic radical, such as morpholinyl, piperidyl etc.In this case, if a substituent group is an oxo, and another is OH, comprises following group so in the definition:
-C=O) CH 2CH (OH) CH 3The OH of ,-(C=O) ,-CH 2(OH) CH 2CH (O) etc.
R on same carbon atom 3And R 4Be merged in the definition-(CH 2) uThe part that-time forms is expressed as follows:
In addition, this class annulus can randomly comprise hetero atom.The example that this class contains heteroatomic annulus includes, but are not limited to:
Figure A20058002224800432
In some cases, defined R 9And R 10Make they can be combined with one another to the nitrogen that they are connected on each ring, have 5-7 member and denitrogenate outside, can also randomly contain one or two extra heteroatomic monocycle or bicyclic heterocycle of being selected from N, O and S, described heterocycle is randomly by one or more R that are selected from 11Substituent group replace.The heterocyclic example that can form thus includes, but are not limited to following group, remembers that sincerely heterocycle randomly is selected from R by one or more (and preferred one, two or three) 11Substituent group replace:
Figure A20058002224800433
In some cases, two R have been defined cS makes them can be combined with one another to the heterocycle that has 5-7 member on ring with the phosphorus that they are connected, and described heterocycle is randomly by one or more R that are selected from bSubstituent group replace.The heterocyclic example that can form thus includes, but are not limited to following group, remembers that sincerely heterocycle randomly is selected from R by one or more (and preferably one or two) bSubstituent group replace:
Figure A20058002224800441
In one embodiment, n is 1,2 or 3.
In one embodiment, R 1Be selected from (C=O) C 1-C 10Alkyl, (C=O) aryl, (C=O) C 3-C 8Cycloalkyl and-(C=O) heteroaryl, they randomly are selected from R by 1-3 7Substituent group replace.In aspect another of this embodiment, R 1Be (C=O) C 1-C 10Alkyl.
In one embodiment, R 2Be selected from aryl, it randomly is selected from R by 1-3 7Substituent group replace.In aspect another of this embodiment, R 2Be phenyl, it randomly is selected from halogen and C by 1-3 1-C 6The substituent group of alkyl replaces.
In one embodiment, R 3And R 4Be H.
In one embodiment, R 5Be selected from aryl, it randomly is selected from R by 1-3 10Substituent group replace.In aspect another of this embodiment, R 5Be phenyl, it randomly by 1-3 be selected from halogen and-substituent group of OH replaces.In aspect another of this embodiment, R 5Be phenyl, it is randomly replaced by 1-3 substituent group that is selected from halogen.
In one embodiment, Rp be-P (O) (OH) 2
In an embodiment of general formula I V chemical compound, R 11Be C 1-C 6Alkyl.In another embodiment of general formula I V chemical compound, R 11Be methyl.
In an embodiment of general formula I V chemical compound, R 7aAnd R 7cBe independently selected from C 1-C 6Alkyl, halogen and OH.
In an embodiment of general formula I V chemical compound, R 7bBe F.
In an embodiment of general formula I V chemical compound, n is 1,2 or 3.
The present invention includes free form and the pharmaceutically acceptable salt and the stereoisomer of compound of Formula I.In the particular compound that exemplifies herein some is the protonated salt of amines.Term " free form " refers to the amines of non--salt form.The pharmaceutically acceptable salt that comprises not only comprises the salt that exemplifies of particular compound described herein, and comprises acceptable salt on all typical medicaments of free form of compound of Formula I.Can use the free form of technical point well known in the art from described concrete salt compound.For example, can handle with the regeneration free form such as rare NaOH aqueous solution, potassium carbonate, ammonia and sodium bicarbonate by with suitable dilute alkaline aqueous solution.Free form is to a certain extent being different from its corresponding salt form aspect some physical characteristic, and such as the dissolubility in polar solvent, but with regard to purpose of the present invention, acid and basic salt are in its corresponding free form equivalence of others.
Can pass through the conventional chemical method, by the pharmaceutically acceptable salt of the synthetic The compounds of this invention of the The compounds of this invention that contains alkalescence or acidic moiety.In general, by ion exchange chromatography or by making the reaction in suitable solvent or different solvent combination of free alkali and stoichiometric amount or excessive desirable salify mineral acid or organic acid synthesize the salt of alkali compounds.Similarly, by forming the salt of acid compound with suitable inorganic base or organic base reaction.
Therefore, the pharmaceutically acceptable salt of The compounds of this invention comprises the non-toxic salts commonly used by the The compounds of this invention that makes the formation of alkali compounds of the present invention and mineral acid or organic acid reaction.For example, non-toxic salts commonly used comprises that those derive from the salt of mineral acid, the all example hydrochloric acids of described mineral acid, hydrobromic acid, sulphuric acid, sulfamic acid, phosphoric acid, nitric acid etc., and by the salt of organic acid preparation, described organic acid is such as acetic acid, propanoic acid, succinic acid, glycolic, stearic acid, lactic acid, malic acid, tartaric acid, citric acid, ascorbic acid, pounce on acid, maleic acid, hydroxymaleic acid, phenylacetic acid, glutamic acid, benzoic acid, salicylic acid, p-anilinesulfonic acid., 2-acetoxyl group-benzoic acid, fumaric acid, toluenesulfonic acid, methanesulfonic acid, ethionic acid, oxalic acid, isethionic acid, trifluoroacetic acid etc.
When chemical compound of the present invention was acidity, suitable " pharmaceutically acceptable salt " referred to by pharmaceutically acceptable avirulent alkali, comprised the salt of inorganic base and organic base preparation.The present invention is particularly including one of The compounds of this invention phosphonate moiety-and dibasic salt.The salt that derives from inorganic base comprises aluminum, ammonium, calcium, copper, ferrum, ferrous, lithium, magnesium, manganese salt, inferior manganese, potassium, sodium, zinc etc.Preferred especially aluminum, calcium, magnesium, potassium and sodium salt.The salt that derives from pharmaceutically acceptable organic avirulence alkali comprises the salt of following chemical compound: the primary, the second month in a season and tertiary amines, the amine that replaces comprises the amine of naturally occurring replacement, cyclic amine and deacidite, such as arginine, betanin, caffeine, choline, N, N 1-dibenzyl-ethylenediamin, diethylamine, 2-diethylaminoethanol, 2-dimethylaminoethanol, ethanolamine, ethylenediamine, N-ethylmorpholine, N-ethylpiperidine, glycosamine (glucamine), glycosamine (glucosamine), histidine, Hai Baming (hydrabamine), 2-aminopropane., lysine, methylglucosamine, morpholine, piperazine, piperidines, polyamino resin, procaine, purine class, theobromine, triethylamine, trimethylamine, tripropyl amine (TPA), trometamol etc.When chemical compound of the present invention was acidity, term " free form " referred to the chemical compound of non--salt form, makes acid functional groups still protonated.
Berg etc. are at " pharmaceutical salts "-J.Pharm.Sci., have more completely described the preparation of acceptable salt on the acceptable salt and other typical medicaments on the said medicine among the 1977:66:1-19.
Be also noted that chemical compound of the present invention may be inner salt or amphion, because under physiological condition, deprotonation acidic moiety in the chemical compound, can be anion such as carboxyl, and this electric charge subsequently can be at inner and protonated or alkylation basic moiety, balances such as the cationic charge of quaternary nitrogen atom.Have the internal balance electric charge and also can not be regarded as " free form " of chemical compound thus with the bonded isolated compound of intermolecular counter ion counterionsl gegenions.
Can prepare chemical compound of the present invention by using the standard operation that exemplifies in the known or experimental implementation step in reaction as shown in hereinafter scheme and other document.Therefore, explanatory scheme hereinafter is not limited to listed chemical compound or any specific substituent group that is used for task of explanation.Substituent group as shown in scheme numbering is not necessarily relevant with the numbering used in the claim, and usually for the sake of clarity, when above the definition of general formula I allows a plurality of substituent group, shows that single substituent group is connected with chemical compound.
Scheme
Shown in option A, suitably the benzohydroxamic acid ester A-1 that replaces generates benzoyl alkynes intermediate A-3 with the acetylene A-2 reaction that suitably replaces.Suitably the coupling of the copper of the phenyl that replaces mediation generates intermediate A-4.There is being intermediate A in the presence of the acid chloride-4 can generate N-acyldihydropyrazol A-5 then with hydrazine reaction.Make the terminal hydroxyl deprotection and obtain compd A of the present invention-6.
The similar series reaction that option b is represented to use optional hydroxyl protecting group to prepare The compounds of this invention B-5.This scheme has also been explained the formation of phosphate ester prodrug B-6.
Scheme C-G has explained the introducing of other prodrug part of The compounds of this invention.
Option A
Option b
Figure A20058002224800481
Scheme C
Figure A20058002224800491
Scheme E
Scheme F
Scheme G
Use
Chemical compound of the present invention can be applicable to various uses.Just as will be understood by the skilled person in the art, can change mitosis according to variety of way; Promptly can influence mitosis by the activity that increases or reduce the composition in the mitosis approach.In other words, can be by disequilibrating, promptly by suppressing or activating some composition influence (for example destroying) mitosis.Similarly means can be used to change meiosis.
In one embodiment, chemical compound of the present invention is used to regulate mitosis spindle and forms, and causes the cell cycle arrest in the mitosis to prolong thus.So-called herein " adjusting " refers to and changes mitosis spindle formation, comprises that increasing and reduce spindle forms.So-called herein " mitosis spindle formation " refers to mitotic kinesins makes microtubule be organized as dipolar configuration.So-called herein " mitosis spindle malfunction " refers to the mitosis stagnation and monopolar spindle forms.
Chemical compound of the present invention is used for combination and/or regulates the mitotic kinesins activity.In one embodiment, mitotic kinesins is the member's (as U.S. Pat 6,284, described in 480 the 5th hurdles) in the mitotic kinesins bimC subfamily.In another embodiment, mitotic kinesins behaviour KSP but, can also regulate mitotic kinesins activity from other organism with chemical compound of the present invention.In this context, regulating to refer to increases or reduces the spindle pole separation, thereby causes the deformity of the mitosis spindle utmost point, promptly launches, and perhaps causes the disorder of mitosis spindle form.The variant (avariants) and/or the fragment that in the KSP definition that is used for these purposes, also comprise KSP.In addition, can suppress other mitotic kinesins with chemical compound of the present invention.
Chemical compound of the present invention is used for the treatment of cell proliferation disorders.Can include, but are not limited to the morbid state of method and composition treatment provided herein: cancer (as described below); Autoimmune disease; Arthritis; Transplant rejection; Inflammatory bowel; Medical care precess includes, but are not limited to back inductive propagation such as operation, angioplasty.Be appreciated that in some cases cell can not be in hyper-proliferative or hypoproliferation state (abnormality), but still need treatment.For example, in wound healing process, cell can be bred in " normally ", but the propagation promotion can be for ideal.Similarly, as mentioned above, in agriculture field, cell can be in " normally " state, but needs propagation to regulate so that by direct promotion plant growth or by suppressing that the growth of making dysgenic plant of deposits yields or organism is improved crop yield.Therefore, in one embodiment, present invention resides in suffer from or may finally suffer from these diseases or the state any one cell or the application in the individuality.
Think that especially chemical compound provided herein, compositions and method can be used for treating cancer, comprise solid tumor, for example skin, mammary gland, brain, cervical cancer, carcinoma of testis etc.Especially, can include, but are not limited to the cancer of The compounds of this invention, compositions and method treatment: Heart: sarcoma (angiosarcoma, fibrosarcoma, rhabdomyosarcoma, liposarcoma), myxoma, rhabdomyoma, fibroma, lipoma and teratoma; Lung: bronchogenic carcinoma (squamous cell, undifferentiated minicell, undifferentiated maxicell, adenocarcinoma), alveolar (bronchioles) cancer, bronchial adenoma, sarcoma, lymphoma, cartilage hamartoma, mesothelioma; Gastrointestinal: esophagus (squamous cell cancer, adenocarcinoma, leiomyosarcoma, lymphoma), stomach (cancer, lymphoma, leiomyosarcoma), pancreas (duct adenocarcinoma, insulinoma, glucagonoma of pancreas, gastrinoma, carcinoid tumor, VIPoma), small intestinal (adenocarcinoma, lymphoma, carcinoid tumor, Kaposi sarcoma, leiomyoma, hemangioma, lipoma, neurofibroma, fibroma), large intestine (adenocarcinoma, canalicular adenoma, villous adenoma, hamartoma, leiomyoma); Genitourinary tract: kidney (adenocarcinoma, nephroblastoma [nephroblastoma], lymphoma, leukemia), bladder and urethra (squamous cell cancer, transitional cell carcinoma, adenocarcinoma), prostate (adenocarcinoma, sarcoma), testis (spermocytoma, teratoma, embryonal carcinoma, teratocarcinoma, choriocarcinoma, sarcoma, Interstitial cell cancer, fibroma, fibroadenoma, adenomatoid tumor, lipoma); Liver: hepatocarcinoma (hepatocarcinoma), cancer of biliary duct, hepatoblastoma, angiosarcoma, adenoma, hemangioma; Bone: osteogenic sarcoma (osteosarcoma), fibrosarcoma, malignant fibrohistiocytoma, chondrosarcoma, Ewing sarcoma, malignant lymphoma (reticulosarcoma), multiple myeloma, pernicious giant cell tumor, chordoma, osteochondroma (osteochronfroma) (osteocartilaginous exostosis), optimum chondroma, chondroblastoma, chondromyxoid fibroma, osteoid osteoma and giant cell tumor; Nervous system: skull (osteoma, hemangioma, granuloma, xanthoma, osteitis deformans), meninges (meningioma, meningosarcoma, neurogliosis), brain (astrocytoma, medulloblastoma, glioma, ependymoma, germinoma [pinealoma], multiform glioblastoma (gioblastomas), oligodendroglioma, schwannoma, retinal neuroblastoma, congenital tumor), the spinal nerves fibroma, meningioma, glioma, sarcoma); Gynecological: uterus (carcinoma of endometrium), cervix uteri (cervical cancer, tumor cervical atypical hyperplasia in early stage), ovary (ovarian cancer [serous cystadenocarcinoma, mucous cystoadenocarcinoma, non-classified cancer], granulosa-sheath cell tumor, Sai Ertuoli-leydig cell tumor, dysgerminoma, malignant teratoma), cysthus (squamous cell cancer, intraepithelial carcinoma, adenocarcinoma, fibrosarcoma, melanoma), vagina (clear cell carcinoma, squamous cell cancer, sarcoma botryoides (embryonal rhabdomyosarcoma), fallopian tube (cancer); Blood: blood (myelocytic leukemia [acute and chronic], acute lymphoblastic leukemia, chronic lymphocytic leukemia, myeloproliferative disease, multiple myeloma, myelodysplastic syndrome), Hodgkin, non Hodgkin lymphoma [malignant lymphoma]; Skin: malignant melanoma, basal cell carcinoma, squamous cell cancer, Kaposi sarcoma, dysplastic nevus, lipoma, hemangioma, dermatofibroma, keloid, psoriasis; With The adrenal gland: neuroblastoma.Therefore, term provided herein " cancerous cells " comprises the cell of suffering from the above listed disease any one.
As U.S. Pat 6,284, described in 480, chemical compound of the present invention can also be used as antifungal agent by the activity of regulating the fungus member in the bimC kinesin subgroup.
Can be with chemical compound of the present invention separately or according to standard drug practice and pharmaceutically acceptable carrier, excipient or diluent combination with the form of pharmaceutical composition to mammal, preferably to people's administration.Can pass through oral or non-intestinal, comprise that intravenous, intramuscular, intraperitoneal, subcutaneous, rectum and local route of administration give described chemical compound.
The pharmaceutical composition that contains active component can be for being suitable for the form of oral application, for example, but as tablet, tablet, lozenge, water or oil suspension dispersed powders or granule, Emulsion, hard or soft capsule or syrup or elixir.The compositions that can be used for oral application according to known any means preparation in the pharmaceutical compositions field, and this based composition can contain one or more reagent that is selected from the group of sweetener, correctives, coloring agent and antiseptic composition, so that make pharmaceutically graceful and agreeable to the taste pharmaceutical preparation.Tablet contains active component and is suitable for preparing the mixture of the pharmaceutically acceptable excipient of avirulence of tablet.These excipient can for: for example, inert diluent, for example calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; Granulating agent and disintegrating agent, for example, microcrystalline Cellulose, cross-linking sodium carboxymethyl cellulose, corn starch or alginic acid; Binding agent, for example starch, gelatin, polyvinylpyrrolidone or arabic gum; And lubricant, for example, magnesium stearate, stearic acid or Pulvis Talci.Maybe can give their coatings can be for tablet coating, so that the taste of masking agents discomfort or delay disintegrate and absorption in gastrointestinal tract provides continuous action thus in time limit long period by known technology.For example, can use the material of water solublity taste masking, such as hydroxypropyl emthylcellulose or hydroxypropyl cellulose, or the time-delay material, such as ethyl cellulose, cellulose acetate-butyrate.
The preparation that orally uses can also be made hard gelatin capsule, wherein active component is mixed with inert solid diluent, for example, calcium carbonate, calcium phosphate or Kaolin, or make Perle, wherein active component is mixed with water-solubility carrier, such as Polyethylene Glycol or oily medium, for example Oleum Arachidis hypogaeae semen, liquid paraffin or olive oil.
Aqueous suspension contains active substance and is suitable for preparing the mixture of the excipient of aqueous suspension.This class excipient is a suspending agent, for example sodium carboxymethyl cellulose, methylcellulose, hydroxypropyl methyl-cellulose, sodium alginate, polyvinylpyrrolidone, tragakanta and Radix Acaciae senegalis; Dispersant or wetting agent can be naturally occurring phospholipid, for example lecithin; Or the condensation product of alkylene oxide and fatty acid, for example Myrj 45; Or the condensation product of oxirane and long chain aliphatic alcohols, for example heptadecaethylene oxycetanol; Or oxirane and derive from fatty acid and the condensation product of the partial ester class of hexitol, polyoxyethylene sorbitol monoleate for example, or oxirane and derive from fatty acid and the condensation product of the partial ester of hexitan, for example polyethylene dehydrating sorbitol monooleate.Aqueous suspension can also contain: one or more antiseptic, for example ethylparaben or P-hydroxybenzoic acid n-propyl; One or more coloring agent; Or one or more correctivess; With one or more sweeteners, such as sucrose, glucide or aspartame.
Can be by active component be suspended in the vegetable oil, for example Oleum Arachidis hypogaeae semen, olive oil, Oleum sesami or Oleum Cocois or mineral oil are such as the liquid paraffin suspension that makes up oil.Oil suspension can contain thickening agent, for example Cera Flava, hard paraffin or spermol.Can add such as aforesaid sweetener and correctives so that make agreeable to the taste oral formulations.Can give these compositionss anticorrosion such as butylated hydroxyanisole or alpha tocopherol by adding antioxidant.
Be adapted to pass through add water prepare moisture (aqueous) but the dispersed powders of suspension and the mixture that granule provides active component and dispersant or wetting agent, suspending agent and one or more antiseptic.Suitable dispersant or wetting agent and suspending agent are the typical case with above-mentioned those.Can also there be extra excipient, for example sweetener, correctives and coloring agent.Can give these compositionss anticorrosion such as ascorbic acid by adding antioxidant.
Pharmaceutical composition of the present invention can also be the oil-in-water emulsion form.Oil phase can be vegetable oil, for example olive oil or Oleum Arachidis hypogaeae semen or mineral oil, for example mixture of liquid paraffin or these materials.Suitable emulsifying agent can be naturally occurring phospholipid, soybean lecithin and derive from the esters or the partial ester class of fatty acid and hexitan class for example, the for example condensation product of dehydrating sorbitol monooleate and described partial ester class and oxirane, for example polyoxyethylene sorbitan monoleate.Emulsion can also contain sweetener, correctives, antiseptic and antioxidant.
Can use sweetener, for example glycerol, propylene glycol, sorbitol or agent of sucrose syrup blend and elixir.This class preparation can also contain wetting agent, antiseptic, correctives and coloring agent and antioxidant.
Pharmaceutical composition can be sterile injectable aqueous solution form.In operable acceptable vehicle and solvent, water, Ringer's solution, Polyethylene Glycol/aqueous solution and isotonic sodium chlorrde solution are arranged.
Sterile injectable preparation can also be the water oil-packaging type micro-emulsion of sterile injectable, and wherein active component is dissolved in oil phase.For example, at first active component is dissolved in the mixture of soybean oil and lecithin.Then this oil solution is imported water and glycerol mixture and be processed into microemulsion.
Can Injectable solution or microemulsion be imported patient's blood flow by local bolus injection.Perhaps, maybe advantageously give described solution or microemulsion in the mode of the constant circulation concentration of keeping The compounds of this invention.In order to keep the constant concentration of this class, can use continuous intravenous delivery apparatus.The example of this class device is Deltec CADD-PLUS TMType 5400 intravenous injection pumps.
Pharmaceutical composition can be sterile injectable water or the oil suspension form that is used for intramuscular and subcutaneous administration.Can use above-mentioned those suitable dispersants or wetting agent and suspending agent preparation suspension according to known technology.Sterile injectable preparation can also be for accepting sterile injectable solution or the suspension in diluent or the solvent, for example as the solution in 1,3 butylene glycol outside avirulent intestinal.In addition, aseptic expressed oi is usually as solvent or suspension media.For this purpose, can use the expressed oi of any gentleness, comprise synthetic monoglyceride class or diacylglycerol esters.In addition, fatty acid can be applicable to prepare injection such as oleic acid.
Can also give the chemical compound of general formula I with the suppository form that is used for rectally.Can by with medicine be solid at normal temperatures, and under rectal temperature for liquid and thus in rectum fusing prepare these compositionss with the nothing-zest mixed with excipients of release medicine.This class material comprises the mixture of the fatty acid ester of cocoa butter, glycerin cement, hydrogenated vegetable oil, different molecular weight polyethylene glycol and Polyethylene Glycol.
With regard to topical application, use (for this application aims, topical application should comprise mouth wass and collutory) such as cream, ointment, gel, solution or suspensions of containing compound of Formula I.
Intranasal carrier and the delivery apparatus suitable by topical application give chemical compound of the present invention with the intranasal form or by the transdermal route of using the well-known transdermal patch dosage form of those skilled in the art.Certainly, for form administration with transdermal delivery system, in whole dosage, the giving of dosage to successive, but not be interrupted.Can also be with chemical compound of the present invention as using substrate, send such as the suppository of the mixture of the fatty acid ester of cocoa butter, glycerin cement, hydrogenated vegetable oil, different molecular weight polyethylene glycol and Polyethylene Glycol.
When compound administration of the present invention was gone into people experimenter, every day, dosage generally determined that by the clinicist who opens according to prescription wherein this dosage generally changes according to age, body weight, sex and the reaction of individual patient and the different of the order of severity of patient's symptom.
In a kind of typical application, give an amount of chemical compound to the mammal that carries out treatment of cancer.Dosage is about 0.1mg/kg body weight-Yue 60mg/kg body weight/day, preferred 0.5mg/kg body weight-Yue 40mg/kg body weight/day.
Also with chemical compound of the present invention and known therapeutic agent and anticarcinogen coupling.For example, with chemical compound of the present invention and known anticarcinogen coupling.The chemical compound that discloses and the drug combination of other anticarcinogen or chemotherapeutics belong to scope of the present invention at present.The example of this class activating agent can be in Cancer Principles and Practice of Oncology by V.T.Devita and S.Hellman (editors), 6 ThEdition (February 15,2001), Lippincott Williams﹠amp; Find among the Wilkins Publishers.Those skilled in the art can determine that the combination of which activating agent will be useful based on the special characteristic of medicine that relates to and cancer.This kind anti-cancer drugs includes, but are not limited to following medicine: the activating agent at estrogenic agents, androgen receptor modifier, retinoid receptor regulator, cytotoxicity/cytostatics, antiproliferative agents, prenyl-protein transferase inhibitor, HMG-CoA reductase inhibitor and other angiogenesis inhibitor, cell proliferation and survival signal conduction depressant drug, apoptosis inducers and the interference cell cycle outpost of the tax office.When using jointly with radiotherapy, The compounds of this invention is useful especially.
In one embodiment, also with chemical compound of the present invention and the known anticarcinogen coupling that comprises following medicine: estrogenic agents, androgen receptor modifier, retinoid receptor regulator, cytotoxic agent, antiproliferative agents, prenyl-protein transferase inhibitor, HMG-CoA reductase inhibitor, hiv protease inhibitor, reverse transcriptase inhibitors and other angiogenesis inhibitor.
" estrogenic agents " refers to the chemical compound that disturbs or suppress estrogen and receptors bind, and irrelevant with mechanism.The example of estrogenic agents comprises, but be not limited to tamoxifen, raloxifene, idoxifene, LY353381, LY117081, toremifene, fulvestrant, 4-[7-(2,2-dimethyl-1-oxopropoxy-4-methyl-2-[4-[2-(piperidino) ethyoxyl] phenyl]-2H-1-.alpha.-5:6-benzopyran-3-yl)-phenyl-2,2-dimethyl propylene hydrochlorate, 4,4 '-dihydroxy benzophenone-2,4-dinitrophenyl-hydrazone and SH646.
" androgen receptor modifier " refers to the chemical compound of interference or inhibition androgen and receptors bind and has nothing to do with mechanism.The example of androgen receptor modifier comprises finasteride and other 5 inhibitor, nilutamide, flutamide, bicalutamide, liarozole and acetic acid abiraterone.
" retinoid receptor regulator " refers to the chemical compound of interference or inhibition retinoid and receptors bind and has nothing to do with mechanism.The example of this class retinoid receptor regulator comprises bexarotene, tretinoin, 13-cis-retinoic acid, 9-cis-retinoic acid, alpha-difluoromethyl ornithine, ILX23-7553, trans-N-(4 '-hydroxy phenyl) dimension amine (retinamide) and N-4-carboxyl phenyl dimension amine (retinamide).
The function that " cytotoxicity/cytostatics " refers to mainly by direct interference cell causes cell death or suppresses cell proliferation or inhibition or the mitotic chemical compound of interference cell, comprising: but alkylating agent, tumor necrosis factor, intercalator, hypoxia activating compounds, microtubule inhibitor/microtubule-stabilizing agent, mitotic kinesins inhibitor, relate to kinase whose inhibitor, the antimetabolite of mitosis process; Biological response modifier; Therapeutic agent, topoisomerase enzyme inhibitor, proteasome inhibitor and the ubiquitin protein ligase inhibitor of hormone/anti--hormone therapy agent, hemopoietic growth factor, monoclonal antibody targeting.
The example of cytotoxic agent comprises; but be not limited to sertenef; cachectin; ifosfamide; tasonermin; lonidamine; carboplatin; altretamine; prednimustine; mitolactol; Ranimustine; fotemustine; nedaplatin; oxaliplatin; the temozolomide; heptaplatin; estramustine; a toluenesulfonic acid improsulfan; trofosfamide; nimustine; dibrospidium chloride; pumitepa; lobaplatin; husky platinum; methylmitomycin; cisplatin; irofulven; dexifosfamide; cis-amine dichloro (2-methyl-pyridine radicals) platinum; the benzyl guanine; glufosfamide; GPX100 is (trans; trans; trans)-(oneself is-1 years old for two-mu-; the 6-diamidogen)-and mu-[diamidogen-platinum (II)] two [diamidogen (chlorine) platinum (II)] tetrachloride; two '-aziridino spermine; arsenic trioxide; 1-(11-dodecane amino-10-hydroxyl hendecyl)-3, the 7-dimethyl xanthine; zorubicin; idarubicin; daunorubicin; bisantrene; mitoxantrone; pirarubicin; pinafide; valrubicin; amrubicin; antineoplaston; 3 '-deaminizating-3 '-morpholino-13-deoxidation-10-hydroxyl Carubicin; annamycin; galarubicin; elinafide; MEN10755 and 4-demethoxylation-3-deaminizating-3-'-aziridino-4-methyl sulphonyl-daunorubicin (referring to WO 00/50032).
But the example of hypoxia activating compounds is a tirapazamine.
The example of proteasome inhibitor includes, but are not limited to lactacystin and bortezomib.
The example of microtubule inhibitor/microtubule-stabilizing agent comprises paclitaxel; vindesine sulfate; 3 '; 4 '-two dehydrogenations-4 '-deoxidation-8 '-norvincaleukoblastine; docetaxel; rhizomycin; dolastatin; the hydroxyethylsulfonic acid. mivobulin; auristatin; Cemadotin; RPR109881; BMS184476; vinflunine; cryptophycin; 2; 3; 4; 5; 6-five fluoro-N-(3-fluoro-4-methoxyphenyl) benzsulfamide; F 81097 (anhydrovinblastine); N; N-dimethyl-L-is valyl-and L-is valyl-and N-methyl-L-is valyl-L-prolyl-L-proline-uncle-butyramide; TDX258; Epothilones (for example; referring to U.S. Pat 6; 284; 781 and 6; 288,237) and BMS188797.
Some example of topoisomerase enzyme inhibitor is a hycamtin; hycaptamine; irinotecan; rubitecan; 6-ethoxy-c acyl group-3 '; outside 4 '-O--benzal-chartreusin; 9-methoxyl group-N; N-dimethyl-5-nitropyrazole also [3; 4; 5-kl] acridine-2-(6H) propylamine; 1-amino-9-ethyl-5-fluoro-2; 3-dihydro-9-hydroxy-4-methyl-1H; 12H-benzo [de] pyrans also [3 '; 4 ': b; 7]-indolizine also [1; 2b] quinoline-10; 13 (9H; 15H) diketone; lurtotecan; 7-[2-(N-isopropylamino) ethyl]-(20S) camptothecine; BNP1350; BNPI1100; BN80915; BN80942; the phosphoric acid etoposide; teniposide; sobuzoxane; 2 '-dimethylamino-2 '-deoxidation-etoposide; GL331; N-[2-(dimethylamino) ethyl]-9-hydroxyl-5; 6-dimethyl-6H-pyrido [4; 3-b] carbazole-1-Methanamide; asulacrine; (5a; 5aB; 8aa; 9b)-9-[2-[N-[2-(dimethylamino) ethyl]-the N-methylamino] ethyl]-5-[4-hydroxyl-3; the 5-Dimethoxyphenyl]-5; 5a; 6; 8; 8a; 9-hexahydro furyl also (3 '; 4 ': 6; 7) naphtho-(2; 3-d)-1; 3-dioxole-6-ketone; 2; 3-(methylene-dioxy)-5-methyl-7-hydroxyl-8-methoxyl group benzo [c]-phenanthridines ; 6; two [(2-amino-ethyl) amino] benzo [g] isoguinoline-5 of 9-; the 10-diketone; 5-(3-amino propyl amino)-7; 10-dihydroxy-2-(2-hydroxyethylamino methyl)-6H-pyrazolo [4; 5; 1-de] acridine-6-ketone; N-[1-[2 (lignocaine) ethylamino]-7-methoxyl group-9-oxo-9H-thioxanthene-4-ylmethyl] Methanamide; N-(2-(dimethylamino) ethyl) acridine-4-Methanamide; 6-[[2-(dimethylamino) ethyl] amino]-3-hydroxyl-7H-indeno [2,1-c] quinoline-7-ketone and dimesna.
Mitotic kinesins and the particularly example of the inhibitor of people's mitotic kinesins KSP, be described in PCT publication number WO 01/30768, WO 01/98278, WO03/050,064, WO 03/050,122, WO 03/049,527, WO 03/049,679, WO03/049,678 and WO 03/39460 and pending trial PCT application number US03/06403 (submission on March 4th, 2003), US03/15861 (submission on May 19th, 2003), US03/15810 (submission on May 19th, 19,2003), among US03/18482 (submission on June 12nd, 2003) and the US03/18694 (submission on June 12nd, 2003).In one embodiment, the inhibitor of mitotic kinesins comprises, but is not limited to KSP inhibitor, MKLP1 inhibitor, CENP-E inhibitor, MCAK inhibitor, Kif14 inhibitor, Mphosph1 inhibitor and Rab6-KIFL inhibitor.
" the kinase whose inhibitor that relates to the mitosis process " includes, but are not limited to aurora inhibitors of kinases, Polo-class kinases (PLK) inhibitor (particularly PLK-1 inhibitor), bub-1 inhibitor and bub-R1 inhibitor.
" antiproliferative " comprising: antisense RNA and DNA oligonucleotide, such as G3139, ODN698, RVASKRAS, GEM231 and INX3001; And antimetabolite; such as enocitabine; carmofur; ftorafur; pentostatin; doxifluridine; trimetrexate; fludarabine; capecitabine; galocitabine; cytarabine ocfosfate; fosteabine sodiumhydrate; Raltitrexed; paltitrexid; emitefur; tiazofurine; decitabine; 2-Amino-6-methyl-5-(pyridin-4-ylsulfanyl)-3H-quinazolin-4-one; pemetrexed; nelzarabine; 2 '-deoxidation-2 '-methylene cytidine; 2 '-fluorine methylene-2 '-deoxycytidine; N-[5-(2; 3-dihydro-benzofuranyl) sulfonyl]-N '-(3; the 4-Dichlorobenzene base) urea; N6-[4-deoxidation-4-[N2-[2 (E); 4 (E)-tetradecene acyl groups] glycyl amino]-L-glyceryl-B-L-manna-heptan pyrans glycosyl] adenine; aplidine; Ecteinascidin 858; troxacitabine; 4-[2-amino-4-oxo-4; 6; 7; 8-tetrahydrochysene-3H-pyrimido [5; 4-b] [1; 4] thiazine-6-base-(S)-ethyl]-2; 5-thiophene acyl group-L-glutamic acid; aminopterin; 5-fluorouracil; alanosine; 11-acetyl group-8-(carbamoyl oxygen ylmethyl)-4-formoxyl 6-methoxyl group-14-oxa--1; 11-diaza Fourth Ring (7.4.1.0.0)-14-2; 4,6-triolefin-9-yl acetate; sphaerophysine; lometrexol; dexrazoxane; methioninase; 2 '-cyano group-2 '-'-deoxy-n 4-palmityl-1-B-D-arabinofuranosyl base cytosine and 3-aminopyridine base-2-formaldehyde thiosemicarbazones.
The example of the therapeutic agent of monoclonal antibody targeting comprises that those have and cancerous cell specificity or bonded cytotoxic agent of target cell monoclonal antibody specific or radioisotopic therapeutic agent.Example comprises Bexxar.
" HMG-CoA reductase inhibitor " refers to the inhibitor of 3-hydroxy-3-methyl glutaryl-CoA reductase.The example of operable HMG-CoA reductase inhibitor includes, but are not limited to lovastatin (MEVACOR Referring to U.S. Pat 4,231,938, US4,294,926 and US4,319,039), simvastatin (ZOCOR Referring to U.S. Pat 4,444,784, US4,820,850 and US4,916,239), pravastatin (PRAVACHOL Referring to U.S. Pat 4,346,227, US4,537,859, US4,410,629, US5,030,447 and US5,180,589), fluvastatin (LESCOL Referring to U.S. Pat 5,354,772, US4,911,165, US4,929,437, US5,189,164, US5,118,853, US5,290,946 and US5,356,896) and atorvastatin (LIPITOR Referring to U.S. Pat 5,273,995, US4,681,893, US5,489,691 and US5,342,952).The general structure that can be used for these and other HMG-CoA reductase inhibitor of the inventive method is described in " pravastatin "-Chemistry﹠amp of M.Yalpani; Industry, 87 pages (on February 5th, 1996) and U.S. Pat 4,782,084 and the US4 of pp.85-89 are in 885,314.Term HMG-CoA reductase inhibitor used herein comprises all pharmaceutically acceptable lactones of the chemical compound with HMG-CoA reductase active and the sour form of open loop (promptly wherein lactonic ring open loop and form free acid) and salt and ester-formin, and the acid of this class salt, esters, open loop thus and the application of lactone form are included in the scope of the present invention.
" prenyl-protein transferase inhibitor " refers in inhibition of isoprenyl base-protein transferase the chemical compound of any one or combination in any, described prenyl-protein transferase comprises farnesyl-protein transferase (FPTase), the busy cattle base of busy cattle base-protein transferase I type (GGPTase-I) and the busy cattle base-protein transferase of busy cattle base-II type (GGPTase-II is also referred to as Rab GGPTase).
Can in following open source literature and patent, find the example of prenyl-protein transferase inhibitor: WO96/30343; WO97/18813; WO97/21701; WO97/23478; WO97/38665; WO98/28980; WO98/29119; WO95/32987; U.S. Pat 5,420,245; U.S. Pat 5,523,430; U.S. Pat 5,532,359; U.S. Pat 5,510,510; U.S. Pat 5,589,485; U.S. Pat 5,602,098; European Patent Publication No EP0618221; European Patent Publication No EP0675112; European Patent Publication No EP0604181; European Patent Publication No EP0696593; WO94/19357; WO95/08542; WO95/11917; WO95/12612; WO95/12572; WO95/10514; U.S. Pat 5,661,152; WO95/10515; WO95/10516; WO95/24612; WO95/34535; WO95/25086; WO 96/05529; WO96/06138; WO96/06193; WO96/16443; WO96/21701; WO96/21456; WO96/22278; WO96/24611; WO96/24612; WO96/05168; WO96/05169; WO96/00736; U.S. Pat 5,571,792; WO96/17861; WO96/33159; WO96/34850; WO96/34851; WO96/30017; WO96/30018; WO96/30362; WO96/30363; WO96/31111; WO96/31477; WO96/31478; WO96/31501; WO97/00252; WO97/03047; WO97/03050; WO97/04785; WO97/02920; WO97/17070; WO97/23478; WO97/26246; WO97/30053; WO97/44350; WO98/02436; With U.S. Pat 5,532,359.With regard to the example of the effect that blood vessel is taken place with regard to prenyl-protein transferase inhibitor, referring to European J.of Cancer, Vol.35, No.9, pp.1394-1401 (1999).
" angiogenesis inhibitor " refers to the chemical compound that suppresses neovascularization and has nothing to do with mechanism.The example of angiogenesis inhibitor includes, but are not limited to: tyrosine kinase inhibitor, such as the inhibitor of tyrosine kinase receptor Flt-1 (VEGFR1) and Flk-1/KDR (VEGFR2); The inhibitor of the somatomedin of epidermis-deutero-, fibroblast-deutero-or platelet-derived; MMP (matrix metalloproteinase) inhibitor; The integrin blocker; Interferon-' alpha '; Interleukin 12; Many sulphuric acid pentosan; Cyclooxygenase-2 inhibitor comprises nonsteroid anti-inflammatory drugs (NSAIDs), as aspirin and ibuprofen, and selective cyclooxygenase-2 inhibitor, as celecoxib and rofecoxib (PNAS, Vol.89, p.7384 (1992); JNCI, Vol.69, p.475 (1982); Arch.Opthalmol., Vol.108, p.573 (1990); Anat.Rec., Vol.238, p.68 (1994); FEBS Letters, Vol.372, p.83 (1995); Clin, Orthop.Vol.313, p.76 (1995); J.Mol.Endocrinol., Vol.16, p.107 (1996); Jpn.J.Pharmacol., Vol.75, p.105 (1997); Cancer Res., Vol.57, p.1625 (1997); Cell, Vol.93, p.705 (1998); Intl.J.Mol.Med., Vol.2, p.715 (1998); J.Biol.Chem., Vol.274, p.9116 (1999)); Steroidal antiinflammatory drug (such as corticosteroid, mineralocorticoid, dexamethasone, prednisone, prednisolone, methylprednisolone, betamethasone), carboxyl acylamino-triazole, combretastatin A-4, Squalamine, 6-O-chloracetyl-carbonyl)-aspergillus fumigatus cedrol, Thalidomide, angiostatin, troponin-1, Angiotensin II antagonist (referring to Fernandez etc., J.Lab.Clin.Med.105:141-145 (1985)); With at the antibody of VEGF (referring to Nature Biotechnology, Vol.17, pp.963-968 (October 1999); Kim etc., Nature, 362,841-844 (1993); WO00/44777; And WO00/61186).
The activating agent (referring to the summary of Clin.Chem.La.Med.38:679-692 (2000)) of adjusting or anticoagulant and fibrinolytic system takes place and can be used for comprising with other therapeutic agent of The compounds of this invention coupling in adjusting or inhibition blood vessel.The example of this class activating agent of adjusting or anticoagulant and fibrinolysis approach includes, but are not limited to the inhibitor (referring to Thrombosis Res.101:329-354 (2001)) of heparin (referring to Thromb.Haemost.80:10-23 (1998)), low molecular weight heparin and carboxypeptidase U inhibitor (being also referred to as the activable fibrinolysis inhibitor of active enzyme thrombin [TAFIa]).PCT publication number WO03/013,526 and United States Patent (USP) serial number US60/349, in 925 (submissions on January 18th, 2002) the TAFIa inhibitor has been described.
" activating agent at the interference cell cycle outpost of the tax office " refers to the protein kinase that suppresses transducer cell cycle pass card signal, makes the chemical compound of cancerous cell to DNA infringement agent sensitivity thus.This class activating agent comprises ATR, ATM,, Chk1 and the kinase whose inhibitor of Chk2 and cdk and cdc inhibitors of kinases and be the typical case with 7-hydroxyl D-82041 DEISENHOFEN, flavopiridol, CYC202 (Cyclacel) and BMS-387032 especially.
" inhibitor of cell proliferation and survival signal transduction path " refers to the pharmaceutically active agents of the signal transduction cascade that suppresses cell surface receptor and those surface receptor downstreams.This class activating agent comprises the inhibitor (for example gefitinib and erlotinib) of EGFR, the inhibitor of ERB-2 (for example trastuzumab), the inhibitor of IGFR, the inhibitor of cytokine receptor, the inhibitor of MET, the inhibitor of PI3K (for example LY294002), the inhibitor of serine-threonine kinase (includes, but are not limited to such as WO02/083064, WO02/083139, the inhibitor of Akt described in WO02/083140 and the WO02/083138), the kinase whose inhibitor of Raf (for example BAY-43-9006), the inhibitor (for example Wyeth CCI-779) of the inhibitor of MEK (for example CI-1040 and PD-098059) and mTOR.This class activating agent comprises all micromolecular inhibitor chemical compounds and antibody antagonist.
" apoptosis inducers " comprises TNF receptor family member's activator (comprising the TRAIL receptor).
The present invention also comprises and the combination medicine that is the NSAID ' s of selective COX-2-inhibitor 2.With regard to the purpose of this description, to be defined as those for the NSAID ' s of selective COX-2-inhibitor 2 and have the inhibition of COX-2 is surpassed activity specific agent at least 100 times of the inhibition of COX-1, as IC according to the COX-2 by cell or microsome test assessment 50IC with COX-1 50Ratio determined.Those chemical compounds that this compounds includes, but are not limited to disclose in the following document: U.S. Pat 5,474,995; U.S. Pat 5,861,419; U.S. Pat 6,001,843; U.S. Pat 6,020,343; U.S. Pat 5,409,944; U.S. Pat 5,436,265; U.S. Pat 5,536,752; U.S. Pat 5,550,142; U.S. Pat 5,604,260; U.S. Pat 5,698,584; U.S. Pat 5,710,140; WO94/15932; U.S. Pat 5,344,991; U.S. Pat 5,134,142; U.S. Pat 5,380,738; U.S. Pat 5,393,790; U.S. Pat 5,466,823; U.S. Pat 5,633,272; With U.S. Pat 5,932,598, all these documents are incorporated herein by reference.
The cox 2 inhibitor that is used in particular for Therapeutic Method of the present invention is: 3-phenyl-4-(4-(methyl sulphonyl) phenyl)-2-(5H)-furanone; With 5-chloro-3-(4-methyl sulphonyl) phenyl-2-(2-methyl-5-pyridine radicals) pyridine; Or its pharmaceutically acceptable salt.
Be described as cox 2 inhibitor and be used for chemical compound of the present invention thus including, but are not limited to: parecoxib, CELEBREX And BEXTRA Or its pharmaceutically acceptable salt.
Other example of angiogenesis inhibitor comprises; but be not limited to endostatin; ukrain; ranpirnase; IM862; 5-methoxyl group-4-[2-methyl-3-(3-methyl-2-butene base) epoxy ethyl]-1-oxaspiro [2; 5] suffering-6-base (chloracetyl) carbamate; acetyldinanaline; 5-amino-1-[[3; 5-two chloro-4-(4-chlorobenzene formacyl) phenyl] methyl]-1H-1; 2; 3-triazole-4-Methanamide; CM101; Squalamine; combretastatin; RPI4610; NX31838; sulphation manna pentose phosphate ester; 7; 7-(carbonyl-two [imino group-N-methyl-4; 2-pyrrolylcarbonyl imino group [N-methyl-4; 2-pyrroles]-the carbonyl imino group]-two-(1; the 3-napadisilate) and 3-[(2, methylene 4-dimethyl pyrrole-5-yl)]-2-dihydroindolone (SU5416).
Aforesaid " integrin blocker " refers to: selectivity antagonism, inhibition or obstruction physiology part and the bonded chemical compound of α v β 3 integrins; Selectivity antagonism, inhibition or obstruction physiology part and the bonded chemical compound of α v β 5 integrins; Selectivity antagonism, inhibition or obstruction physiology part and α v β 3 integrins and the bonded chemical compound of α v β 5 integrins; With antagonism, inhibition or hinder the chemical compound of the specific integrin activity of on capillary endothelial cells, expressing.This term also refers to the antagonist of α v β 6, α v β 8, α 1 β 1, α 2 β 1, α 5 β 1, α 6 β 1 and alpha 6 beta 4 integrin.This term also refers to the antagonist of the combination in any of α v β 3, α v β 5, α v β 6, α v β 8, α 1 β 1, α 2 β 1, α 5 β 1, α 6 β 1 and alpha 6 beta 4 integrin.
Some instantiation of tyrosine kinase inhibitor comprises the different  azoles of N-(trifluoromethyl)-5-methyl-4-Methanamide, 3-[(2,4-dimethyl pyrrole-5-yl) methylene] Indolin-2-one, 17-(allyl amino)-17-demethoxylation geldanamycin, 4-(3-chloro-4-fluorophenyl amino)-7-methoxyl group-6-[3-(4-morpholinyl) propoxyl group] quinazoline, N-(3-ethynyl phenyl)-6, two (2-the methoxy ethoxy)-4-quinazoline amine of 7-, BIBX1382,2,3,9,10,11,12-six hydrogen-10-(methylol)-10-hydroxyl-9-methyl-9,12-epoxy-1H-two indole also [1,2,3-fg:3 ', 2 ', 1 '-kl] pyrrolo-[3,4-i] [1,6] benzodiazepine Fang Xin-1-ketone, SH268, genistein, STI571, CEP2563,4-(3-chlorphenyl amino)-5,6-dimethyl-7H-pyrrolo-[2,3-d] the pyrimidine methanesulfonates, 4-(3-bromo-4-hydroxy phenyl) amino-6, the 7-dimethoxyquinazoline, 4-(4 '-hydroxy phenyl) amino-6, the 7-dimethoxyquinazoline, SU6668, STI571A, N-4-chlorphenyl-4-(4-pyridylmethyl)-1-phthalazines amine and EMD121974.
Be also included within the method for the present invention with the drug combination of the chemical compound of non-anticancer compound.For example, the claimed chemical compound of claim of the present invention and the combination medicine of PPAR-γ (being PPAR-gamma) agonist and PPAR-δ (being PPAR-delta) agonist are used for the treatment of some malignant tumor (malingnancies).PPAR-γ and PPAR-δ are nuclear peroxisome proliferator-activated receptor y and δ.Reported in the literature PPAR-γ on endotheliocyte expression and relate to blood vessel and take place (referring to J.Cardiovasc.Pharmacol.1998; 31:909-913; J.Biol.Chem.1999; 274:9116-9121; Invest.OphthalmolVis.Sci.2000; 41:2309-2317).More recent, confirmed that the PPAR-gamma agonist is in the generation vascular reaction of vitro inhibition to VEGF; Troglitazone and maleic acid rosiglitazone suppress the development (Arch.Ophthamol.2001 of the retinal neovascularization formation of mice; 119:709-717).The example of PPAR-gamma agonist and PPAR-γ/alfa agonists comprises, but be not limited to thiazolidinediones (such as DRF2725, CS-011, troglitazone, rosiglitazone and pioglitazone), fenofibrate, gemfibrozil, clofibrate, GW2570, SB219994, AR-H039242, JTT-501, MCC-555, GW2331, GW409544, NN2344, KRP297, NP0110, DRF4158, NN622, GI262570, PNU182716, DRF552926,2-[(5,7-dipropyl-3-Trifluoromethyl-1,2-benzisoxa  azoles-6-yl) oxygen base]-2 Methylpropionic acid (USSN09/782, disclose in 856) and 2 (R)-7-(3-(2-chloro-4-(4-fluorophenoxy) phenoxy group) propoxyl group)-2-ethyl chromane-2-carboxylic acid (USSN60/235, disclose in 708 and 60/244,697).
Another embodiment of the invention is the application for the treatment of in the cancer that is combined in of present chemical compound that discloses and gene therapy.With regard to the group strategy summary of treatment cancer, referring to Hall etc. (Am J Hum Genet 61:785-789,1997) and Kufe etc. (pp 876-889, BC Decker, Hamilton 2000 for Cancer Medicine, 5thEd).Gene therapy can be used to send any tumor suppressor gene.The example of this genoid includes, but are not limited to: the p53 that can send by the gene transfer of recombinant virus-mediation (referring to, for example U.S. Pat 6,069, and 134); UPA/uPAR antagonist (" sending of the adenovirus-mediation of uPA/uPAR antagonist suppressed growth of blood vessel generation-dependent tumors and propagation in the mice "-Gene Therapy, August1998; 5 (8): 1105-13); And interferon gamma (J Immunol 2000; 164:217-222).
Chemical compound of the present invention can also be united with diphosphate (should understand and comprise diphosphate, diphosphonate, di 2 ethylhexyl phosphonic acid and two phosphonic acids) and is used for the treatment of or prophylaxis of cancer, comprises osteocarcinoma.The example of diphosphate comprises, but be not limited to: etidronate (Didronel), pamldronate (Aredia), fosamax (Fosamax), Risedronate (Actonel), zoledronate (Zometa), ibandronate (Boniva), incadronate or cimadronate, clodronate, EB-1053, minodronate, neridronate, piridronate and Tiludronate comprise its any and all pharmaceutically acceptable salt, derivant, hydrate and mixture.
Chemical compound of the present invention and inherent multiple medicines thing toleration (MDR) particularly can also be expressed the inhibitor administering drug combinations of relevant MDR with high-level transport protein.This class MDR inhibitor comprises the inhibitor of p-glycoprotein (P-gp), such as LY335979, XR9576, OC144-093, R101922, VX853 and PSC833 (valspodar).
Can be with chemical compound of the present invention and Bendectin coupling so that the treatment n or V, comprise acute, delay, late period and may because of separately or with the anticipation of radiotherapy coupling chemical compound generation of the present invention in vomiting.In order to prevent or treat vomiting, can be with chemical compound of the present invention and other Bendectin coupling, especially antagonists of neurokinine-1 receptor; The 5HT3 receptor antagonist is such as ondansetron, granisetron, tropisetron and zatosetron; The GABAB receptor stimulating agent is such as baclofen; Corticosteroid is such as Decadron (dexamethasone), Kenalog, Aristocort, Nasalide, Preferid, Benecorten or other medicines, such as being disclosed in U.S. Pat 2,789,118, US2,990,401, US3,048,581, US3,126,375, US3,929,768, US3,996,359, US3,928, in 326 and US3,749,712; The dopamine antagonist medicine is such as phenothiazines (for example prochlorperazine, fluphenazine, thioridazine and mesoridazine), metoclopramide or dronabinol.In one embodiment, the Bendectin that is selected from antagonists of neurokinine-1 receptor, 5HT3 receptor antagonist and corticosteroid is given as adjuvant so that the vomiting for the treatment of or preventing when the The compounds of this invention administration, to produce.
Intactly be described in the following document with the antagonists of neurokinine-1 receptor of The compounds of this invention coupling: for example, in U.S. Pat 5,162,339, US5,232,929, US5,242,930, US5,373,003, US5,387,595, US5,459,270, US5,494,926, US5,496,833, US5,637,699, US5 is in 719,147; European Patent Publication No EP0360390, EP0394989, EP0428434, EP0429366, EP0430771, EP0436334, EP0443132, EP0482539, EP0498069, EP0499313, EP0512901, EP0512902, EP0514273, EP0514274, EP0514275, EP0514276, EP0515681, EP0517589, EP0520555, EP0522808, EP0528495, EP0532456, EP0533280, EP0536817, EP0545478, EP0558156, EP0577394, EP0585913, EP0590152, EP0599538, EP0610793, EP0634402, EP0686629, EP0693489, EP0694535, EP0699655, EP0699674, EP0707006, EP0708101, EP0709375, EP0709376, EP0714891, EP0723959, EP0733632 and EP0776893; Pct international patent publication number WO90/05525, WO90/05729, WO91/09844, WO91/18899, WO92/01688, WO92/06079, WO92/12151, WO92/15585, WO92/17449, WO92/20661, WO92/20676, WO92/21677, WO92/22569, WO93/00330, WO93/00331, WO93/01159, WO93/01165, WO93/01169, WO93/01170, WO93/06099, WO93/09116, WO93/10073, WO93/14084, WO93/14113, WO93/18023, WO93/19064, WO93/21155, WO93/21181, WO93/23380, WO93/24465, WO94/00440, WO94/01402, WO94/02461, WO94/02595, WO94/03429, WO94/03445, WO94/04494, WO94/04496, WO94/05625, WO94/07843, WO94/08997, WO94/10165, WO94/10167, WO94/10168, WO94/10170, WO94/11368, WO94/13639, WO94/13663, WO94/14767, WO94/15903, WO94/19320, WO94/19323, WO94/20500, WO94/26735, WO94/26740, WO94/29309, WO95/02595, WO95/04040, WO95/04042, WO95/06645, WO95/07886, WO95/07908, WO95/08549, WO95/11880, WO95/14017, WO95/15311, WO95/16679, WO95/17382, WO95/18124, WO95/18129, WO95/19344, WO95/20575, WO95/21819, WO95/22525, WO95/23798, WO95/26338, WO95/28418, WO95/30674, WO95/30687, WO95/33744, WO96/05181, WO96/05193, WO96/05203, WO96/06094, WO96/07649, WO96/10562, WO96/16939, WO96/18643, WO96/20197, WO96/21661, WO96/29304, WO96/29317, WO96/29326, WO96/29328, WO96/31214, WO96/32385, WO96/37489, WO97/01553, WO97/01554, WO97/03066, WO97/08144, WO97/14671, WO97/17362, WO97/18206, WO97/19084, WO97/19942 and WO97/21702; With in British patent publication number GB2266529, GB2268931, GB2269170, GB2269590, GB2271774, GB2292144, GB2293168, GB2293169 and GB2302689.The preparation of this compounds intactly is described in above-mentioned patent and the open source literature, and they are incorporated herein by reference.
In one embodiment, be selected from the antagonists of neurokinine-1 receptor of The compounds of this invention coupling: 2-(R)-(1-(R)-(3, two (trifluoromethyl) phenyl of 5-) ethyoxyl)-3-(S)-(4-fluorophenyl)-4-(3-(5-oxo-1H, 4H-1,2, the 4-triazol) methyl) morpholine or its pharmaceutically acceptable salt, it is described in U.S. Pat 5, in 719,147.
Can also be with chemical compound of the present invention with the activating agent administration that is used for the treatment of anemia.The therapeutic agent of this class anemia for example is successive erythropoiesis (eythropoiesis) receptor activation thing (such as Epoetin Alfa).
Can also be with chemical compound of the present invention with being used for the treatment of the activating agent administration that neutrophilic leukocyte reduces.The neutral leukopenia therapeutic agent of this class is for example for regulating the hemopoietic growth factor of neutrophilic leukocyte generation and function, such as Filgrastim (G-CSF).The example of G-CSF comprises filgrastim.
Can also be with chemical compound of the present invention with the administration of immunity-enhancing medicine, such as levamisole, inosine pranobex and Zadaxin.
Therefore; scope of the present invention comprises the chemical compound that the present invention is claimed and the use in conjunction of second kind of chemical compound, and described second kind of chemical compound is selected from: estrogenic agents; androgen receptor modifier; the retinoid receptor regulator; cytotoxicity/cytostatics; antiproliferative agents; prenyl-protein transferase inhibitor; the HMG-CoA reductase inhibitor; the hiv protease inhibitor; reverse transcriptase inhibitors; angiogenesis inhibitor; the PPAR-gamma agonist; the PPAR-delta agonists; diphosphate; the inhibitor of inherent multiple medicines thing toleration; Bendectin; the activating agent that is used for the treatment of anemia; be used for the treatment of the activating agent that neutrophilic leukocyte reduces; immunity-enhancing medicine; cell proliferation and survival signal conduction depressant drug; the activating agent and the apoptosis inducers at the interference cell cycle outpost of the tax office.
Term in relating to The compounds of this invention " administration " and version thereof (for example " giving " chemical compound) refer to the animal system that the prodrug of chemical compound or chemical compound is imported the needs treatment.When chemical compound of the present invention or its prodrug and one or more other activating agents (for example cytotoxic agent etc.) being united when providing, be interpreted as when comprising chemical compound or its prodrug and other activating agent separately " administration " and version thereof and importing successively.
Term used herein " compositions " is in order to the product that comprises the specified ingredients that contains specified amount and directly or indirectly because of any products of the combination results of the specified ingredients of specified amount.
Term used herein " treatment effective dose " refers to biology or the reactive compound of medical response or the amount of pharmaceutically active agents that causes that in tissue, system, animal or human's body research worker, veterinary, medical worker or other clinicists seek.
Term " treatment cancer (treating cancer) " or " treatment for cancer (treatment ofcancer) " refer to the mammal administration of suffering from Cancerous disease and refer to by killing and wounding cancerous cell alleviates the effect of Cancerous disease (cancerous condition), also refers to cause the cancer growth and/or shifts the effect that is suppressed.
In one embodiment, the angiogenesis inhibitor as second kind of chemical compound is selected from tyrosine kinase inhibitor; epidermis-deutero-growth factor receptor inhibitors; fibroblast-deutero-growth factor receptor inhibitors; the inhibitor of platelet-derived somatomedin; MMP (matrix metalloproteinase) inhibitor; the integrin blocker; interferon-' alpha '; interleukin 12; many sulphuric acid pentosan; cyclooxygenase-2 inhibitor; carboxyl acylamino-triazole; combretastatin A-4; Squalamine; 6-O-chloracetyl-carbonyl)-aspergillus fumigatus cedrol; Thalidomide; angiostatin; troponin-1 or at the antibody of VEGF.In one embodiment, estrogenic agents is tamoxifen or raloxifene.
Also comprise the treatment method for cancer in the scope of claim, comprise the chemical compound of the general formula I for the treatment of effective dose and radiotherapy combination and/or with the combination of compounds that is selected from following chemical compound: estrogenic agents, androgen receptor modifier, the retinoid receptor regulator, cytotoxicity/cytostatics, antiproliferative agents, prenyl-protein transferase inhibitor, the HMG-CoA reductase inhibitor, the hiv protease inhibitor, reverse transcriptase inhibitors, angiogenesis inhibitor, the PPAR-gamma agonist, the PPAR-delta agonists, diphosphate, the inhibitor of inherent multiple medicines thing toleration, Bendectin, the activating agent that is used for the treatment of anemia, be used for the treatment of the activating agent that neutrophilic leukocyte reduces, immunity-enhancing medicine, cell proliferation and survival signal conduction depressant drug, the activating agent and the apoptosis inducers at the interference cell cycle outpost of the tax office.
Another embodiment of the invention comprises the combination of chemical compound and the paclitaxel or the trastuzumab of the general formula I for the treatment of effective dose for the treatment method for cancer.
The present invention further comprises the method for treatment or prophylaxis of cancer, comprises the combination of the chemical compound and the cox 2 inhibitor of the general formula I for the treatment of effective dose.
The present invention also comprises and being used for the treatment of or the pharmaceutical composition of prophylaxis of cancer, comprises the chemical compound of the general formula I for the treatment of effective dose and is selected from following chemical compound: estrogenic agents, androgen receptor modifier, the retinoid receptor regulator, cytotoxicity/cytostatics, antiproliferative agents, prenyl-protein transferase inhibitor, the HMG-CoA reductase inhibitor, the hiv protease inhibitor, reverse transcriptase inhibitors, angiogenesis inhibitor, the PPAR-gamma agonist, the PPAR-delta agonists, cell proliferation and survival signal conduction depressant drug, the activating agent at the interference cell cycle outpost of the tax office, diphosphate and apoptosis inducers.
These and other aspect of the present invention is apparent from the instruction that wherein comprises.
Test
By the The compounds of this invention described in the following experimental test embodiment and find that they have kinesin and suppress active.Known in the literature other test and they are easy to implement (for example, referring to PCT publication number WO01/30768, May 3 calendar year 2001,18-22 page or leaf) by those skilled in the art.
I. Kinesin ATPase in vitro tests
The people is poly--clone and the expression of the KSP dynamin domain (KSP (367H)) of histidine mark
By PCR, use p Bluescript total length people's KSP construct (Blangy etc., Cell, vol.83, pp1159-1169,1995) to be used for the plasmid of expressing human KSP dynamin domain construct as the template clone.The terminal primer 5 ' of N--GCAACGATTAATATGGCGTCGCAGCCAAATTCGTCTGCGAAG (SEQ.ID.NO.:1) and C-end primer 5 '-GCAACGCTCGAGTCAGTGATGATGGTGGTGATGCTGATTCACTTCAGGCTTATTCA ATAT (SEQ.ID.NO.:2) be used to increase dynamin domain and neck bonding pad.With AseI and XhoI digestion PCR product, it is connected into the NdeI/XhoI digestion product of pRSETa (Invitrogen) and is transformed into e. coli bl21 (DE3).
Make cell under 37 ℃, grow to OD 600Be 0.5.After culture is cooled to room temperature, induces KSP to express and incubation is continued to spend the night with 100 μ M IPTG.By the centrifugal cell precipitation and once made from ice-cold PBS washing.To precipitate quick freezing and be stored under-80 ℃.
Protein purification
Cell precipitation is melted on ice and be suspended in lysis buffer (50mM K-HEPES, pH8.0,250mM KCl again, 0.1%Tween, 10mM imidazoles, 0.5mM Mg-ATP, 1mM PMSF, 2mM benzimidine, 1x adequate proteins enzyme inhibitor mixture (Roche)).Cell suspension was hatched on ice 10 minutes with 1mg/ml lysozyme and 5mM beta-mercaptoethanol, carry out supersound process (3x30 second) subsequently.Under 4 ℃, carry out all operating procedures subsequently.With lysate with 40, centrifugal 40 minutes of 000xg.Dilution supernatant and go up that (50mM K-HEPES, pH 6.8,1mM MgCl in buffer A 2, 1mM EGTA, 10 μ M Mg-ATP, 1mM DTT) in SP agarose column (Pharmacia, 5ml post) and with the 0-750mM KCl gradient elution in the buffer A.Collection contains the fraction of KSP and with Ni-NTA resin (Qiagen) incubation 1 hour., carry out three 15 minutes-incubations subsequently and wash resin washing three times with buffer B (removing the lysis buffer of PMSF and protease inhibitor cocktail) with buffer B.At last, incubation resin and with buffer C (identical, but pH is 6.0) washing three times 15 minutes and impouring post with buffer B.With elution buffer (identical, but do not comprise 150mM KCl and 250mM imidazoles) eluting KSP with buffer B.Collection contains the fraction of KSP, makes 10% and be stored under-80 ℃ in sucrose.
Prepare microtubule by the tubulin that separates from Medulla Bovis seu Bubali.Under 37 ℃ and at BRB80 buffer (80mM K-PIPES, 1mM EGTA, 1mM MgCl 2, pH 6.8 times) in 10 μ M paclitaxels, 1mM DTT, 1mM GTP have the tubulin (＞97% does not contain MAP) of the purification of polymerization 1mg/ml down.By super centrifugal and remove supernatant separating obtained microtubule from unpolymerized tubulin.The precipitation that will contain microtubule is suspended in 10 μ M paclitaxels, 1mM DTT, 50 μ g/ml ampicillins and the 5g/ml chloromycetin in BRB80 lentamente again.
With kinesin dynamin domain and microtubule, 1mM ATP (1: 1 MgCl 2: Na-ATP) descend and contain 80mM K-HEPES (pH 7.0), 1mMEGTA, 1mM DTT, 1mM MgCl at 23 ℃ with chemical compound 2With incubation together in the buffer of 50mM KCl.By with the final buffer composition dilution 2-10 of 80mM HEPES and 50mM EDTA (or alternatively adding in 1: 1 the reaction volume and stop buffer (1.8M KCl and 50mM EDTA)) cessation reaction doubly.By Eastman no. 1361/ammonium molybdate test, measure free phosphorus hydrochlorate from the ATP hydrolysis by the quencher thing C (for example in 40 μ l reaction volumes+40 μ l stop buffer mixture, adding 120 μ l quencher thing C) that adds 1.5 times of volumes.Quencher thing A contains 0.1mg/ml Eastman no. 1361 and 0.14% polyvinyl alcohol; Quencher thing B contains the 12.3mM Ammonium Molybdate Tetrahydrate in 1.15M sulphuric acid.Quencher thing C is the quencher thing A of 2: 1 ratios: quencher thing B.With this reaction system at 23 ℃ of following incubation 5-10 minutes and measure the trap of phosphoric acid-molybdate complex at the 540nm place.
Chemical compound 1-5,1-7,1-9,1-11 and 1-13 in above-mentioned test in the test implementation example and find the IC that they have 50≤ 50 μ M.
II. Cell proliferation test
Cell is coated in the 96-hole tissue culture ware, and its density allows cell to become logarithmic growth in the process and its adhesion is spent the night with 72 hours 24,48.At second day, add chemical compound to all flat boards with 10-point 1/2nd log titres (in a 10-point, one-half log titration).Each titre series is all according to carrying out in triplicate, and keeps 0.1% constant DMSO concentration in entire test.Also comprise independent 0.1%DMSO contrast.The dilution series of every kind of chemical compound of preparation in the culture medium that does not contain serum.Serum final concentration in this test is in 200 μ L culture volumes 5%.After adding medicine, add the blue staining reagent of 20 microlitre Alamar and make this system be back to 37 ℃ of following incubations in each sample on titer plate and the control wells 24,48 or 72 hours the time.After 6-12 hour, on the dull and stereotyped reader of CytoFluor II, use the excitation wavelength of 530-560 nanometer, the emission wavelength of 590 nanometers to analyze the blue fluorescence of Alamar.
By being drawn, the cell growth inhibited average percent of each the titration point on compound concentration on the x-axle and the y-axle obtains cytotoxicity EC 50With the rate of growth that is defined as in this test 100%, and will compare with cell growth and this value of compound treatment with the cell in the control wells of independent vehicle treated growth.The in house software (proprietaryin-house software) of sale monopoly is used to calculate the percentage ratio of cytotoxicity values and uses logarithm 4-parameter curve The Fitting Calculation flex point.Cytotoxicity percentage ratio is defined as:
% cytotoxicity: (fluorescence Contrast)-(fluorescence Sample) x100x (fluorescence Contrast) -1
Flex point is reported to cytotoxicity EC 50
III. Estimating mitosis by FACS stagnates and programmed cell death
Facs analysis is used for by the cell in the dna content assessing compound inhibition mitosis of measuring the cell mass of handling and the ability of inducing apoptosis.With 1.4x10 6Individual cell/6cm 2The density inoculating cell of tissue culture's ware and its adhesion is spent the night.Use carrier (0.1%DMSO) or titre series (titration series) then compound treatment 8-16 hour.After processing, carry out the trypsinization collecting cell by at the appointed time the time and by centrifugation.In PBS, wash cell precipitation and be fixed in 70% alcohol and be stored in and spend the night under 4 ℃ or the longer time.
In order to carry out facs analysis, precipitate at least 500,000 fixed cell and remove 70% alcohol by suction.Down (BectonDickinson FACSCaliber analysis was hatched 30 minutes and used to 50 Kunitz unit/ml) and propidium iodide (50 μ g/ml) with RNase A at 4 ℃ with cell then.Use Modfit cell cycle analysis simulation softward (Verity Inc.) analytical data (from 10,000 cells).
Cell percentage ratio (as by the propidium iodide fluorimetric) drawing interim by the G2/M of the cell cycle of each titre point on compound concentration on the x-axle and the y-axle obtains the EC that mitosis is stagnated 50Use the SigmaPlot program to carry out data analysis so that use logarithm 4-parameter curve The Fitting Calculation flex point.Flex point is reported to the EC that mitosis is stagnated 50Similarly method is used to measure the compd E C of programmed cell death 50To be plotted on the y-axle at the apoptotic cell percentage ratio that each titre point (as fluorimetric by propidium iodide) is located herein, and similarly analyze as mentioned above.
IV. Detect the immunofluorescence microscopy of monopolar spindle
The method that is used for DNA, tubulin and grain peripheral proteins are carried out immunofluorescence dyeing basically as (2000) such as Kapoor described in the J.Cell Biol.150:975-988.In order to carry out cell culture studies, be coated on cell on the glass chamber microscope slide that tissue culture handles and its adhesion is spent the night.Then cell was hatched 4-16 hour with the chemical compound of being paid close attention to.Hatch finish after, suction culture medium and medicine and remove chamber (chamber) and pad from microscope slide.Change cell thoroughly according to the scheme of reference then, fixing, washing and sealing are so that carry out the non-specific antibody combination.Carry out after this sealing with the tumor biopsy deparaffinization of paraffin-embedding and by ethanol series with dimethylbenzene in aquation.(mouse monoclonal resists-α-microtubule antibody, from the clone DM1A according to dilution in 1: 500 of Sigma at primary antibody under 4 ℃; The rabbit polyclonal according to dilution in 1: 2000 from Covance is anti--grain peripheral proteins antibody) in microscope slide is incubated overnight.After washing, at room temperature (donkey that the FITC-of tubulin puts together resists-mice IgG with the secondary antibody of puting together that is diluted to 15 μ g/ml with microscope slide; The donkey of the texas Red-put together of grain peripheral proteins is anti--tame rabbit igg) and incubation 1 hour together.Washed and use Hoechst 33342 counterstain are so that develop DNA then.Use Metamorph to deconvolute and the Nikon epifluorescence microscope of imaging software on make the sample imaging of immunostaining with the 100x oil immersion objective.
Embodiment
The embodiment that provides is in order to help further to understand the present invention.Concrete material, kind and the condition of using is used to explain the present invention, but and limits zone of reasonableness of the present invention with non-.
Scheme 1
Step 1: 1-1's is synthetic
To at 0 ℃ of following 24.9g (255mmol) N, the O-dimethyl hydroxylamine hydrochloride is at 1.5LCH 2Cl 2In suspension in add 71.1mL (510mmol) triethylamine, drip 100mLCH subsequently 2Cl 2In 25.0g (141.6mmol) 2, the 5-difluoro benzoyl chloride.After stirring 1 hour, wash this reaction system with water, with 1M HCl washing three times, use the salt water washing, use Na 2SO 4Dry and be concentrated into and obtain 1-1Be colorless oil. 1-1Data: 1HNMR (500MHz, CDCl 3) δ 7.2-7.0 (m, 3H), 3.6 (bs, 3H), 3.4 (s, 3H) ppm.
Step 2: 1-(2, the 5-difluorophenyl)-6-(tetrahydrochysene-2H-pyrans-2-base oxygen base) is own-2-alkynes-1-ketone Synthesizing (1-3)
To the 15.0g under-78 ℃ (89.2mmol) THP-alkynes 1-2Add the 2.5M nBuLi of 35.7mL (89.2mmol) in hexane in (as Tetrahedron, 2001,57, prepare described in the 2597-2608) solution in 750mL THF.After stirring 1 hour under this temperature, add 17.9g (89.2mmol) by syringe 1-1Solution in 35mL THF.This solution stirring is spent the night, progressively be warming up to room temperature simultaneously.Use saturated NH 4The Cl aqueous solution makes the reaction quencher and extracts with EtOAc.With salt water washing organic extract, use Na 2SO 4Drying concentrates by rotary evaporation, and obtains by the column chromatography purification that uses the EtOAc/ hexane 1-3, be colorless oil. 1-3Data: 1HNMR (500MHz, CDCl 3) δ 7.7 (m, 1H), 7.3 (m, 1H), 7.15 (m, 1H), 4.6 (m, 1H), 3.9 (m, 2H), 3.55 (m, 2H), 2.65 (m, 2H), 1.95 (m, 2H), 1.85 (m, 1H), 1.75 (m, 1H), 1.6-1.5 (m, 4H) ppm.
Step 3: 1-(2, the 5-difluorophenyl)-3-phenyl-6-(tetrahydrochysene-2H-pyrans-2-base oxygen base) is own-2-alkene Synthesizing of-1-ketone (1-4)
In the suspension of the 20.2g under-78 ℃ (98.1mmol) cuprous bromide (I) dimethyl sulfide complex in 75mL THF, add the 2MPhLi solution of 98.1mL (196mmol) in dibutyl ethers.After stirring 1.5 hours, be added in 25.2g (81.7mmol) alkynes among the 200mL THF by sleeve pipe 1-3, and this reaction system stirred 3 hours down at-78 ℃.Use saturated NH 4The Cl aqueous solution makes the reaction quencher and extracts twice with EtOAc.Merge organic extract, use the salt water washing, use Na 2SO 4Drying concentrates and obtains by the column chromatography purification that uses the EtOAc/ hexane by rotary evaporation 1-4Be yellow oil, be (E) and (Z) mixture of isomers. 1-4Data: C 23H 24F 2O 3HRMS (ES) value of calculation M+Na:409.1586. measured value: 409.1586.
Step 4: 3-[1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5- Base] third-1-alcohol (1-5) synthetic
To 16.0g (41.4mmol) 1-4Add 3.0mL (62.1mmol) hydrazine hydrate in the solution in the 150mL pyridine and the gained mixture is descended heating 45 minutes at 90 ℃.After being cooled to room temperature, this reaction system is put into ice bath and dripped 14.7mL (207mmol) chloroacetic chloride.Remove ice bath and this reaction system at room temperature stirred and spend the night, after this put into and contain EtOAc and brinish separatory funnel.Separate each layer and organic facies with 1M HCl washed twice, with the salt water washing once, use Na 2SO 4Dry and concentrate by rotary evaporation.Residue is suspended in again in the toluene twice and is concentrated into azeotropic go out any remaining pyridine.Residue is dissolved in 200mL MeOH and add 8.0g (42mmol) right-the toluenesulfonic acid monohydrate.After at room temperature stirring 2 hours, remove most of solvent and make residue be distributed in saturated NaHCO by rotary evaporation 3Between aqueous solution and the EtOAc.After separating each layer, wash organic layer once more with bicarbonate, be saline then, use Na 2SO 4Dry and concentrate by rotary evaporation.With residue and Et 2O grinds together and obtains racemate by the solid collected by filtration material 1-5, be white solid.Racemate 1-5Data: 1HNMR (500MHz, CDCl 3) δ 7.7 (m, 1H), 7.4-7.0 (m, 7H), 3.8-3.65 (m, 2H), 3.6 (m, 1H), 3.5 (m, 1H), 2.9 (m, 1H), 2.4 (s, 3H), 2.3 (m, 1H), 1.7-1.5 (m, 2H) ppm.C 20H 20F 2N 2O 3HRMS (ES) value of calculation M+H:359.1566. measured value: 359.1557
Step 5: 3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4, the 5-dihydro-1 h-pyrazole -5-yl] chiral separation of third-1-alcohol 1-5
Split enantiomer by preparation HPLC, wherein use the eluent of 10cm Chiralpak AD post and 92% hexane (containing 0.1% diethylamine), 4%MeOH and 4%EtOH, flow velocity is 150mL/ minute.First peak under the eluting is (R) isomer of non-activity, and second peak under the eluting is active (S) isomer.
Step 6: 3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4, the 5-dihydro-1 h-pyrazole -5-yl] propyl group dihydrogen phosphoric acid ester 1-6 synthetic
To 250mg (0.70 mmol) (S)-1-5At 10mL CH 2Cl 2In solution in add 292 μ L (2.10mmol) triethylamines, 151 μ L (1.40mmol) clodronic acid (clorophosponate) dimethyl ester and 24mg (0.07mmol) tert-butyl alcohol titaniums (IV).After at room temperature stirring is spent the night, make this reaction system be distributed in EtOAc and saturated NaHCO 3Between the aqueous solution.Separate each layer, water, salt water washing organic layer are used MgSO 4Dry and concentrate by rotary evaporation.Residue is dissolved in 0.5mL dimethyl sulfide and 1mL methanesulfonic acid and this mixture at room temperature stirred and spend the night.Use a small amount of CH then 3CN dilutes this reaction system and passes through at Delta Pak C 18Use CH on the post 3CN/H 2O (+0.1%TFA) preparation HPLC purification.Lyophilizing contains the fraction of product and obtains 1-6, be loose white solid. 1-6Data: 1HNMR (500MHz, d 6-DMSO) δ 7.65 (m, 1H), 7.4 (m, 4H), 7.2 (m, 3H), 3.9 (m, 2H), 3.7 (m, 1H), 3.4 (m, 1H), 2.6 (m, 1H), 2.3 (s, 3H), 2.3 (m, 1H), 1.7 (m, 1H), 1.4 (m, 1H) ppm; C 20H 21F 2N 2O 5The HRMS of P (APCI) value of calculation M+H:439.1229. measured value: 439.1231.
Prepare following compounds by simple modification to the aforesaid operations step.Chemical compound 1-13 and 1-14 are separated into racemic mixture.Except as otherwise noted, the chemical compound in the table is separated as free alkali.
Chemical compound RP R 7’ n Title HRMS m/z(M+H)
1-7 H CH 3 0 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethanol HRMS m/z (M+H) 341.1521 measured values, 341.1660 theoretical values.
1-8 P(O)(OH) 2 CH 3 0 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethyl dihydrogen phosphoric acid ester HRMS m/z (M+H) 421.1325 measured values, 421.1323 theoretical values
1-9 H CH 3 1 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol HRMS m/z (M+H) 355.1798 measured values, 355.1817 theoretical values
1-10 P(O)(OH) 2 CH 3 1 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester HRMS m/z (M+H) 435.1477 measured values, 435.1480 theoretical values
1-11 H CH 3 2 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] fourth-1-alcohol HRMS m/z (M+H) 369.1971 measured values, 369.1973 theoretical values
1-12 P(O)(OH) 2 CH 3 2 2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] butyl dihydrogen phosphoric acid ester HRMS m/z (M+H) 449.1630 measured values, 449.1636 theoretical values
1-13 H Br 1 3-[1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol HRMS m/z (M+H) 419.0769 measured values, 419.0765 theoretical values
1-14 P(O)(OH) 2 Br 1 3-[1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester HRMS m/z (M+H) 499.0423 measured values, 499.0428 theoretical values
Sequence table
<110>Merck&Co.，Inc.
Coleman，Paul J.
Cox，Christopher D.
Hartman，George D.
＜120〉prodrug of mitotic kinesins inhibitor
<130>21685Y
<150>60/584,517
<151>2004-07-01
<150>60/605,840
<151>2004-08-30
<160>2
<170>FastSEQ for Windows Version 4.0
<210>1
<211>42
<212>DNA
＜213〉artificial sequence
<220>
＜223〉complete synthesis nucleotide sequence
<400>1
gcaacgatta atatggcgtc gcagccaaat tcgtctgcga ag 42
<210>2
<211>60
<212>DNA
＜213〉artificial sequence
<220>
＜223〉complete synthesis nucleotide sequence
<400>2
gcaacgctcg agtcagtgat gatggtggtg atgctgattc acttcaggct tattcaatat 60

Claims (10)

1. the chemical compound of general formula I:
Or its pharmaceutically acceptable salt or stereoisomer, wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-8;
P is 1-6;
U is 1,2,3,4 or 5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7)(C＝O)NR 9R 10；
8) (C=O) OC 1-C 10Alkyl;
9)SO 2NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
13) C 1-C 10Alkyl;
14) aryl;
15) heteroaryl;
16) (CH 2) u(C=O) C 1-C 10Alkyl;
17)(CH 2) u(C＝O)NR 9R 10；
18) 3-pyrrolidone-base, 3-piperidone base, 2-Ketocyclopentane base, 2-hexamethylene ketone group;
19) (C=O) (C=O) C 1-C 10Alkyl;
20)(C＝O)(C＝O)NR 9R 10；
21) (C=O) (C=O) O C 1-C 10Alkyl;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, heteroaryl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 2Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) C 1-C 6Perfluoroalkyl;
6) C 1-C 6Aralkyl;
7) C 1-C 6Heteroarylalkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl, heteroarylalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 3, R 4And R 5Be independently selected from:
1)H；
2) C 1-C 10Alkyl;
3) aryl;
4) C 2-C 10Alkenyl;
5) C 2-C 10Alkynyl;
6) C 1-C 6Perfluoroalkyl;
7) C 1-C 6Aralkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
The R that is connected with same carbon atom 3And R 4Be merged into-(CH 2) u-, wherein one of carbon atom randomly is selected from O, S (O) m,-N (R 9) C (O)-and-N (COR 10)-part replace;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) (C 0-C 6) alkylidene-S (O) mR a
4) oxo;
5)OH；
6) halogen;
7)CN；
8) (C=O) aO b(C 2-C 10) alkenyl;
9) (C=O) aO b(C 2-C 10) alkynyl;
10) (C=O) aO b(C 3-C 6) cycloalkyl;
11) (C=O) aO b(C 0-C 6) alkylidene-aryl;
12) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
13) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
14)C(O)R a；
15) (C 0-C 6) alkylidene-CO 2R a,
16)C(O)H，
17) (C 0-C 6) alkylidene-CO 2H;
18)C(O)N(R b) 2；
19)S(O) mR a；
20) S (O) 2NR 9R 10With
21)C(NH)NH 2；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl are randomly by one or more R that are selected from 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 3-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle are randomly by one or more R that are selected from 8Substituent group replace;
R aBe (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl, benzyl or heterocyclic radical;
R bBe H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aAnd
R cBe independently selected from: (C 1-C 6) alkoxyl, new pentane acyloxy methoxyl group and NR b 2Or
Two R c sCan be combined with one another to the monocyclic heterocycles of 5-7 unit with the phosphorus that they are connected, described monocyclic heterocycles randomly by one, two or three are selected from R bSubstituent group replace;
R dBe independently selected from H, (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl, benzyl or heterocyclic radical;
Rp is selected from :-PO (OH) 2,-PO (R c) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2, C (O) CH 2CH 2CH 2OPO (R c) 2,-CH 2OPO (OH) 2,-CH 2OPO (R c) 2,-C (O) (CHR d) pNR a 2,-C (O) (CHR d) pNR a 3+ ,-CH 2OC (O) (CHR d) pNR a 2,-CH 2OC (O) (CHR a) pNR a 3+ and
Figure A2005800222480006C1
2. the chemical compound of the described general formula I I of claim 1:
Or its pharmaceutically acceptable salt or stereoisomer,
Wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7) (C=O) OC 1-C 10Alkyl;
8)(C＝O)NR 9R 10；
9)SO 2NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 2Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) C 1-C 6Perfluoroalkyl;
6) C 1-C 6Aralkyl;
7) C 3-C 8Cycloalkyl; With
8) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 3, R 4And R 5Be independently selected from:
1)H；
2) C 1-C 10Alkyl;
3) aryl;
4) C 2-C 10Alkenyl;
5) C 2-C 10Alkynyl;
6) C 1-C 6Perfluoroalkyl;
7) C 1-C 6Aralkyl;
8) C 3-C 8Cycloalkyl; With
9) heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl, aralkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen;
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Randomly by three substituent groups replacements at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R aBe (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl or heterocyclic radical;
R bBe H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aAnd
R cBe independently selected from: (C 1-C 6) alkoxyl, new pentane acyloxy methoxyl group and NR b 2Or
Two R c sCan be combined with one another to the monocyclic heterocycles of 5-7 unit with the phosphorus that they are connected, described monocyclic heterocycles randomly by one, two or three are selected from R bSubstituent group replace;
Rp is selected from :-PO (OH) 2,-PO (R c) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2, C (O) CH 2CH 2CH 2OPO (R c) 2,-C (O) CH 2NR a 2,-C (O) CH 2NR a 3+ ,-CH 2OC (O) CH 2NR a 2,-CH 2OC (O) CH 2NR a 3+ and
3. the chemical compound of the described general formula III of claim 2:
Figure A2005800222480011C1
Or its pharmaceutically acceptable salt or stereoisomer, wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1, or 2;
N is 0-5;
R 1Be selected from:
1) (C=O) C 1-C 10Alkyl;
2) (C=O) aryl;
3) (C=O) C 2-C 10Alkenyl;
4) (C=O) C 2-C 10Alkynyl;
5) (C=O) C 3-C 8Cycloalkyl;
6) (C=O) heterocyclic radical;
7) (C=O) OC 1-C 10Alkyl;
8)(C＝O)NR 9R 10；
9)SO 2NR 9R 10；
10) SO 2C 1-C 10Alkyl;
11) SO 2C 1-C 10Aryl;
12) SO 2C 1-C 10Heterocyclic radical;
Described alkyl, aryl, alkenyl, alkynyl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 7Substituent group replace; Or
R 7aAnd R 7cBe independently selected from:
1)H；
2) O bC 1-C 10Alkyl;
3) halogen;
4) CN; With
5)OH；
Described alkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 7bBe halogen;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen;
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Randomly by three substituent group substituent groups at the most, described substituent group is selected from R for described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R aBe independently selected from: (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl and heterocyclic radical;
R bBe independently selected from: H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R aWith
Rp is selected from :-PO (OH) 2,-C (O) CH 2CH 2CH 2OPO (OH) 2,-CH 2OPO (OH) 2,-C (O) CH 2NR a 2,-C (O) CH 2NR a 3+ ,-CH 2OC (O) CH 2NR a 2,-CH 2OC (O) CH 2NR a 3+ and
4. the chemical compound of the described general formula III of claim 3, wherein Rp is :-PO (OH) 2, and described in all remaining substituent groups such as the claim 3.
5. the chemical compound of general formula I V:
Figure A2005800222480014C2
Or its pharmaceutically acceptable salt or stereoisomer, wherein:
A independently is 0 or 1;
B independently is 0 or 1;
M independently is 0,1 or 2;
N is 0-5;
R 7aAnd R 7cBe independently selected from:
1)H；
2) O bC 1-C 10Alkyl;
3) halogen;
4) CN; With
5)OH；
Described alkyl randomly by one, two or three are selected from R 8Substituent group replace;
R 7bBe halogen;
R 7For:
1) (C=O) aO bC 1-C 10Alkyl;
2) (C=O) aO bAryl;
3) C 2-C 10Alkenyl;
4) C 2-C 10Alkynyl;
5) (C=O) aO bHeterocyclic radical;
6)CO 2H；
7) halogen;
8)CN；
9)OH；
10) O bC 1-C 6Perfluoroalkyl;
11)O a(C＝O) bNR 9R 10；
12)S(O) mR a；
13)S(O) 2NR 9R 10；
14) oxo;
15)CHO；
16) (N=O) R 9R 10Or
17) (C=O) aO bC 3-C 8Cycloalkyl;
Described alkyl, aryl, alkenyl, alkynyl, heterocyclic radical and cycloalkyl are randomly by one or more R that are selected from 8Substituent group replace;
R 8Be selected from:
1) (C=O) aO b(C 1-C 10) alkyl;
2) O b(C 1-C 3) perfluoroalkyl;
3) oxo;
4)OH；
5) halogen;
6)CN；
7) (C 2-C 10) alkenyl;
8) (C 2-C 10) alkynyl;
9) (C=O) aO b(C 3-C 6) cycloalkyl;
10) (C=O) aO b(C 0-C 6) alkylidene-aryl;
11) (C=O) aO b(C 0-C 6) the alkylidenyl-heterocyclic base;
12) (C=O) aO b(C 0-C 6) alkylidene-N (R b) 2
13)C(O)R a；
14) (C 0-C 6) alkylidene-CO 2R a
15)C(O)H；
16) (C 0-C 6) alkylidene-CO 2H; With
17)C(O)N(R b) 2；
18) S (O) mR aWith
19)S(O) 2NR 9R 10；
Described alkyl, alkenyl, alkynyl, cycloalkyl, aryl and heterocyclic radical are randomly replaced by three substituent groups at the most, and described substituent group is selected from R b, OH, (C 1-C 6) alkoxyl, halogen, CO 2H, CN, O (C=O) C 1-C 6Alkyl, oxo and N (R b) 2
R 9And R 10Be independently selected from:
1)H；
2) (C=O) O bC 1-C 10Alkyl;
3) (C=O) O bC 3-C 8Cycloalkyl;
4) (C=O) O bAryl;
5) (C=O) O bHeterocyclic radical;
6) C 1-C 10Alkyl;
7) aryl;
8) C 2-C 10Alkenyl;
9) C 2-C 10Alkynyl;
10) heterocyclic radical;
11) C 3-C 8Cycloalkyl;
12) SO 2R aWith
13)(C＝O)NR b 2；
Described alkyl, cycloalkyl, aryl, heterocyclic radical, alkenyl and alkynyl randomly by one, two or three are selected from R 8Substituent group replace; Or
R 9And R 10Can be combined with one another to monocycle or bicyclic heterocycle with the nitrogen that they are connected, outside on each ring, having 5-7 member and denitrogenate, also randomly contain one or two extra hetero atom that is selected from N, O and S, described monocycle or bicyclic heterocycle randomly by one, two or three are selected from R 8Substituent group replace;
R 11Be selected from:
1) C 1-C 10Alkyl;
2) aryl;
3) C 3-C 8Cycloalkyl;
4) heterocyclic radical;
Described alkyl, aryl, cycloalkyl and heterocyclic radical are randomly by one or more R that are selected from 10Substituent group replace; Or
R aBe independently selected from: (C 1-C 6) alkyl, (C 3-C 6) cycloalkyl, aryl and heterocyclic radical; And
R bBe independently selected from: H, (C 1-C 6) alkyl, aryl, heterocyclic radical, (C 3-C 6) cycloalkyl, (C=O) OC 1-C 6Alkyl, (C=O) C 1-C 6Alkyl or S (O) 2R a
6. chemical compound is selected from:
3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol;
3-[(5S)-and 1-acetyl group-3-(2, the 5-difluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethanol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] ethyl dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] fourth-1-alcohol;
2-[(5R)-and 1-acetyl group-3-(2-fluoro-5-aminomethyl phenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] butyl dihydrogen phosphoric acid ester;
3-[(5S)-and 1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] third-1-alcohol; With
3-[(5S)-and 1-acetyl group-3-(5-bromo-2-fluorophenyl)-5-phenyl-4,5-dihydro-1 h-pyrazole-5-yl] propyl group dihydrogen phosphoric acid ester;
Or its pharmaceutically acceptable salt or stereoisomer.
7. pharmaceutical composition comprises the chemical compound and the pharmaceutically acceptable carrier of claim 1.
8. the using method of the chemical compound of claim 1 is used to prepare the medicine that is used for the treatment of or need prevents the mammalian cancer of this class treatment.
9. the using method of the chemical compound of claim 1, be used to prepare the medicine that is used for the treatment of or need prevents the mammalian cancer of this class treatment, wherein said cancer is selected from histiocytic lymphoma, adenocarcinoma of lung, small cell lung cancer, cancer of pancreas, glioblastoma and breast carcinoma.
10. the using method of the chemical compound of claim 1 is used to prepare the medicine that is used to regulate the mammiferous mitosis spindle formation that needs this class treatment.
CN 200580022248 2004-07-01 2005-06-27 Prodrugs of mitotic kinesin inhibitors Pending CN1980663A (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US58451704P 2004-07-01 2004-07-01
US60/584,517 2004-07-01
US60/605,840 2004-08-30

Publications (1)

Publication Number Publication Date
CN1980663A true CN1980663A (en) 2007-06-13

Family

ID=38131506

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200580022248 Pending CN1980663A (en) 2004-07-01 2005-06-27 Prodrugs of mitotic kinesin inhibitors

Country Status (1)

Country Link
CN (1) CN1980663A (en)

Similar Documents

Publication Publication Date Title
CN100548296C (en) The mitotic kinesins inhibitor
JP4467979B2 (en) Mitotic kinesin inhibitor
JP4463679B2 (en) Mitotic kinesin inhibitor
JP4391825B2 (en) Mitotic kinesin inhibitor
CN101084194A (en) Mitotic kinesin inhibitors
CN101005837A (en) Mitotic kinesin inhibitors
CN101115745A (en) Mitotic kinesin inhibitors
CN101155583B (en) Mitotic kinesin inhibitors
JP2005511581A (en) Mitotic kinesin inhibitor
JP2007502775A (en) Mitotic kinesin inhibitor
JP2005515208A (en) Mitotic kinesin inhibitor
CN1980662A (en) Mitotic kinesin inhibitors
CN101193637A (en) Flruoro amino alkyl-4-oxo-3,4-dihydropyrido [3,4-d] pyrimidine compounds as mitotic kinesin inhibitors
CN101106998A (en) Mitotic kinesin inhibitors
CN101107253A (en) Mitotic kinesin inhibitors
CN1980911A (en) Mitotic kinesin inhibitors
CN1980938B (en) Mitotic kinesin inhibitors
CN101142183A (en) Mitotic kinesin inhibitors
CN100403900C (en) Mitotic kinesin inhibitors
JP2008510012A (en) Mitotic kinesin inhibitor
CN101137372A (en) Mitotic kinesin inhibitors
AU2004305069B2 (en) Mitotic kinesin inhibitors
CN1980663A (en) Prodrugs of mitotic kinesin inhibitors
JP2007514757A (en) Mitotic kinesin inhibitor
JP2007530545A (en) Mitotic kinesin inhibitor

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication