CN1978650B - New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield - Google Patents
New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield Download PDFInfo
- Publication number
- CN1978650B CN1978650B CN 200510126156 CN200510126156A CN1978650B CN 1978650 B CN1978650 B CN 1978650B CN 200510126156 CN200510126156 CN 200510126156 CN 200510126156 A CN200510126156 A CN 200510126156A CN 1978650 B CN1978650 B CN 1978650B
- Authority
- CN
- China
- Prior art keywords
- gly
- val
- leu
- lys
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
This invention involves the new acetyl-CoA ligase gene (pclB) from Penicillium chrysogenum, its amino acid sequence and expression vector. It also demonstrated that the expression of pclB can be induced by the phenyl acetic acid. Then expression vector containing the pclB gene and the genetic engineering strain producing penicillin are constructed, the yield of penicillin of the transgenic strain is markedly improved. The invention is of great importance to the production of penicillin.
Description
Technical field
The present invention relates to new isolating nucleotide sequence, relate in particular to new phenylaceta coenzyme A ligase gene (pclB) from Penicllium chrysogenum.
The invention still further relates to the aminoacid sequence of this genes encoding.
The invention still further relates to and contain this expression carrier.
The invention still further relates to a kind of method that improves the penicillin yield of Penicllium chrysogenum.
Background technology
With penicillin and cynnematin be the β-Nei Xiananleikangshengsu of representative as most important antibacterials, occupied 2/3 of anti-infectives market, the world, be that present known poisoning by antibiotic is minimum, kind is maximum, the class microbiotic that clinical application is the widest.
Penicillin is produced by filamentous fungus Penicllium chrysogenum (Penicillium chrysogenum), because the large market demand, people have dropped into huge energy to the improvement of penicillin production bacterium.Based on traditional mutagenesis screening technology, the production level of present industrial producing strain has reached quite high level.And the biosynthesizing mechanism that we disclose β-Nei Xiananleikangshengsu that develops into of Protocols in Molecular Biology provides help.
Studies show that; the biosynthesizing step of penicillin is by three precursor amino acid; α-An Jijiersuan, halfcystine, Xie Ansuan begin; become the LLD-ACV tripeptides through three peptide synthetases (ACVS) catalyzing and condensing; cyclisation forms isopenicillin N under the effect of isopenicillin N synthetic enzyme, and finally at acetyl-CoA: the side chain exchange obtains penicillin under 6-amino-penicillanic acid acyltransferase (AAT) catalysis.Wherein preceding 2 steps are reflected in the tenuigenin finishes, the exchange of final step side chain is finished in microbody, the AAT of this step reaction of catalysis has conservative microbody signal for locating sequence A RL (Muller et al.EMBO J 10:489-495,1991), essential by its function, the encoding gene of three key enzymes that biosynthesizing is relevant is all cloned (Ingolia﹠amp; Queener, Med.Res.Rev.9:245-264,1989; Aharonowitz, etal., Ann.Rev.Microbiol.46:461-495,1992).
In the industrial production of penicillin, (Phenylacetic acid PA) is used as the side chain precursor of penicillin G to toluylic acid.During the fermentation, toluylic acid at first is activated and is the coenzyme A thioester, again under the AAT effect through transacylation, substitute the L-alpha-amino group hexanedioyl side chain of isopenicillin N, form penicillin G.Because AAT has the substrate scope of broad, therefore add the biosynthesizing that toluylic acid can promote penicillin G during the fermentation.As the side chain precursor of penicillin G, its utilising efficiency depend on to a great extent it toxicity and Penicillium notatum to its oxidation capacity.Toluylic acid occupies suitable proportion in production cost, the utilising efficiency that improves toluylic acid is a most important content in the penicillin strain improved, process.
The activation of toluylic acid is finished by phenylaceta coenzyme A ligase.International monopoly WO97/02349 discloses the phenylacetyl ligase enzyme and the encoding sequence pclA thereof of a Penicllium chrysogenum.This enzyme is made up of 578 amino acid, the about 63kDa of molecular weight.Its last 3 amino acid are S-K-I, are the microbody signal for locating sequences of guarding, and to be positioned microbody essential by albumen.This illustrates that this ligase enzyme will be positioned at microbody and work.This is that the result of study finished in microbody is consistent with the exchange of the biosynthetic final step side chain of penicillin.
In addition, Minambres etc. have cloned a phenylaceta coenzyme A ligase gene pcl from pseudomonas (Pseudomonas putida U), the promotor of itself and tripeptides synthase gene pcbAB merged transform Penicllium chrysogenum Wis54-1255, make penicillin yield improve 1.8～2.2 times.
Summary of the invention
One object of the present invention is the penicillium chrysogenum phenylaceta coenzyme A ligase gene that provides new, names to be pclB.
Another object of the present invention is to provide the said gene amino acid sequence coded.
A further object of the present invention is to provide the expression vector that contains the said gene sequence.
Another purpose of the present invention is engineered bacteria producing penicillium chrysogenum strain that provides new and the method that improves penicillin yield.
According to an aspect of the present invention, new penicillium chrysogenum phenylaceta coenzyme A ligase gene pclB differentiates from Penicllium chrysogenum (Penicillium chrysogenum), clones, this expression of gene obviously is subjected to inducing of toluylic acid, its encoded protein matter is made up of 562 amino acid, the molecular weight of inferring is 62.6kDa, last 3 amino acid are microbody signal for locating sequence A-K-L, show that this enzyme is positioned in the microbody equally.The consistence of PclB and PclA aminoacid sequence is 35%.187～198 be the AMP that guards in conjunction with territory-LVYSSGTTGvPK-(PROSITE database entry PS00455[LIVMFY]-E}-{VES}-[STG]-[STAG]-G-[ST]-[STEI]-[SG]-x-[PASLIVM]-[KR]), its open reading frame (Open Reading Frame, ORF) be that length is 1686bp from the 59th to the 1744th bit base of 5 ' end.Specifically the invention provides the isolating polynucleotide that contain sequence shown in the SEQID NO.1.
The above-mentioned polynucleotide that relate to also comprise replacement, disappearance and insert variant and allelic variant, splice variant, fragment, derivative etc., wherein can be by replacing, lack, insert or one or more Nucleotide of deriving.Preferred these polynucleotide are polynucleotide that those codings have the phenylaceta coenzyme A ligase of biologic activity.
In a preferred embodiment of the invention, isolating polynucleotide comprise whole encoding sequences of phenylaceta coenzyme A ligase gene.In particularly preferred embodiments, polynucleotide comprise the sequence shown in the 59th～1744 Nucleotide of SEQ ID NO:1.This isolating polynucleotide comprise the open reading frame of the phenylaceta coenzyme A ligase of 1686 Nucleotide, and 562 the amino acid whose polypeptide of encoding, as mentioned above.
It will be understood by those skilled in the art that, above-mentioned isolating polynucleotide comprise that also the sequence shown in the 59th～1744 Nucleotide of sequence shown in those and the SEQID NO.1 or SEQ ID NO:1 has the sequence of higher homology, and for example homology is greater than 90% even 95% even 98% sequence; Also comprise those under rigorous condition can with the sequence of the sequence hybridization shown in the 59th～1744 Nucleotide of sequence shown in the SEQ ID NO.1 or SEQ ID NO:1.
According to a further aspect in the invention, new peptide sequence is provided, it contains the coded aminoacid sequence of above-mentioned nucleotide sequence, promptly contain the sequence shown in the SEQ ID NO.2, the supposition molecular weight of the phenylaceta coenzyme A ligase of expressing is 62.6kDa, last 3 amino acid are microbody signal for locating sequence A-K-L, show that this enzyme is positioned in the microbody equally.The consistence of PclB and PclA aminoacid sequence is 35%.Be the AMP that guards in the 187-198 position in conjunction with territory-LVYSSGTTGvPK-(PROSITE databaseentry PS00455[LIVMFY]-E}-{VES}-[STG]-[STAG]-G-[ST]-[STEI]-[SG]-x-[PASLIVM]-[KR]).
Similarly, it will be appreciated by persons skilled in the art that above-mentioned peptide sequence also comprises replacement, disappearance and inserts variant, with and equipotential mutant, splicing variant, fragment, derivative or homologue.Preferred polypeptide or polypeptide fragment comprise that those have bioactive polypeptide of phenylaceta coenzyme A ligase and fragment.Replacement, disappearance and insertion variant are meant with the aminoacid sequence shown in the SEQ ID NO:2 to be compared, and comprises replacement, disappearance and/or the interpolation of a place or many places aminoacid sequence in the described aminoacid sequence.
According to a further aspect in the invention, the present invention also provides the recombinant vectors that comprises one or more above-mentioned polynucleotide, and the genetically engineered host cell that comprises the carrier of above-mentioned polynucleotide.In preferred embodiments, this recombinant vectors comprises above-mentioned polynucleotide, and its coding contains the polypeptide of SEQ ID NO:2, and it contains the polynucleotide shown in the sequence of SEQ ID NO:1, or contains in the SEQ ID NO:1 sequence 59～1744 polynucleotide.In a specific embodiments of the present invention, made up the prokaryotic expression carrier that contains polynucleotide of the present invention.
The present invention also relates to comprise the host cell of any above-mentioned recombinant vectors.After carrier construction, can insert all or part of carrier to the host cell that is fit to, so that amplification and/or expression of polypeptides.Host cell can be prokaryotic organism host cell (for example E.coli) or eukaryote host cell (for example filamentous fungal cells, yeast cell, insect cell, or vertebrate cells).
According to another aspect of the invention, the new engineered bacteria producing penicillium chrysogenum bacterial strain that makes up with genetic engineering means is provided, the Penicllium chrysogenum conversion carrier that use contains polynucleotide of the present invention transforms Penicllium chrysogenum, obtain engineered bacteria producing penicillium chrysogenum bacterial strain of the present invention behind the screening positive strain, compare with original strain, the penicillin yield of transgenosis bacterial strain obviously improves, and the highest increase rate has surpassed 23%.
Therefore, the present invention also provides the method that improves the Penicllium chrysogenum penicillin yield, promptly makes up the engineered bacteria producing penicillium chrysogenum that contains polynucleotide of the present invention, and the engineering strain fermentation culture that makes up is obtained penicillin.
The present invention successfully separates the gene of the new penicillium chrysogenum phenylaceta coenzyme A ligase that obtained to encode from Penicllium chrysogenum, and proved that this expression of gene is subjected to inducing of toluylic acid, and then made up and contained new expression carrier of the present invention and engineered bacteria producing penicillium chrysogenum bacterial strain, the penicillin yield of this transgenosis bacterial strain obviously improves, and the present invention is significant for the production of penicillin.
Brief description of drawings
Fig. 1 is pclA gene and pclB gene order comparison diagram;
Fig. 2 is toluylic acid inductive pclA gene and pclB expression of gene contrast figure,
Wherein 54-PAA is not for adding toluylic acid Wis54-1255 bacterial strain RNA sample, and 54+PAA is for adding toluylic acid Wis54-1255 bacterial strain RNA sample;
Fig. 3 is the proteic SDS-PAGE electrophoretic analysis of reorganization pclB figure,
Wherein: swimming lane 1 is the molecular weight of albumen standard, and 2 for containing the contrast bacterium of empty carrier, and 3-10 is respectively the thalline of inducing 0 hour, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours.
The embodiment of invention
Below in conjunction with accompanying drawing,, describe the present invention in detail by description to preferred embodiment of the present invention.
The reagent material of Shi Yonging is commercially available purchase if no special instructions below.
[embodiment 1]
The pclB gene clone
Penicillium chrysogenum Wis54-1255 (ATCC28089) is cultivated 24h in YPD (1% yeast extract, 2% peptone, 2% glucose) substratum, filter and receive mycelia, get the wet mycelia liquid N of 0.1g
2Grind, (Invitrogen company, 15596-026) the total RNA of extracting Penicllium chrysogenum is dissolved in the total RNA of gained Penicllium chrysogenum in the DEPC water, preserves standby down for-70 ℃ to add 1ml Trizol reagent.
Pollute for removing possible DNA, get the total RNA 5 μ g of Penicllium chrysogenum, in 100 μ l reaction systems, add 5 μ l RQ1 RNase-Free DNase (Promega company, M6101), 10 μ l RQ1 RNase-FreeDNase reaction buffers (10 *), 37 ℃ are incubated 30 fens, use phenol: the chloroform extracting, ethanol sedimentation is dissolved in 10 μ l DEPC water.Get the RNA sample that 5 μ l remove DNA, with random primer (RandomHexamers, Promega company C1181) carry out reverse transcription, obtain cDNA, used ThermoScript II be SuperScriptTM II RNase H-(Invitrogen company, 18064-022).
With T220-1:5 '-TCCCTTTGAGCCTCTATTCACATTC-3 ' and T220-2:5 '-TATCAATATCAACATGGACAGGTC-3 ' is primer, is that template is carried out pcr amplification with cDNA, and the PCR condition is: 94 ℃, and 5 minutes; 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 2 minutes-40 the circulation; 72 ℃ 7 minutes; 4 ℃ of preservations.With RT-PCR product cloning and sequencing according to a conventional method, sequencing result shows that the RT-PCR product has the nucleotide sequence of SEQ ID NO.1 in the sequence table, and length is 1808bp.By sequential analysis and GenBank database retrieval, show this sequence open reading frame (OpenReading Frame, ORF) be from 5 ' end the 59th to the 1744th bit base, length is 1686bp.18bp place before ORF initiator codon ATG, same-phase has terminator codon TAG, illustrates that thus we have obtained the full length sequence of this gene, names to be pclB.
562 amino acid of the segmental reading frame coding of this gene ORF, the supposition molecular weight is 62.6kDa, shown in SEQ ID NO.2 in the sequence table.Last 3 amino acid are microbody signal for locating sequence A-K-L, show that this enzyme is positioned in the microbody equally.The consistence of PclB and PclA aminoacid sequence is 35%.Be the AMP that guards in the 187-198 position in conjunction with territory-LVYSSGTTGvPK-(PROSITE database entry PS00455[LIVMFY]-E}-{VES}-[STG]-[STAG]-G-[ST]-[STEI]-[SG]-x-[PASLIVM]-[KR])
The genomic dna of while with the Wis54-1255 bacterial strain of extraction is that masterplate carries out pcr amplification, primer and reaction conditions are the same, obtain the amplified production of 1954bp, and itself and RT-PCR product sequence are compared, confirm that the pclB gene has 2 introns, length is respectively 92bp, 54bp.Comparative result is seen Fig. 1.
[embodiment 2] pclB expression of gene is subjected to inducing of toluylic acid
Penicillium chrysogenum Wis54-1255 (ATCC28089) is pressed 2 * 10
6Conidium/ml is inoculated into seed culture medium, cultivates 24 hours down at 26 ℃, and the seed culture based formulas is (g/l): glucose, 30; Lactose, 10; Cottonseed meal, 10; Yeast powder, 10; Corn steep liquor, 10; (NH
4)
2SO
4, 2; KH
2PO
4, 1; CaCO
3, 5; PH5.8.Then inoculum is inoculated into fermention medium with 5% inoculum size, cultivates down for 26 ℃.Fermention medium is (g/l): lactose, 120; Cottonseed meal, 30; Corn steep liquor, 20; (NH
4)
2SO
4, 5; KH
2PO
4, 1; K
2SO
4, 5; CaCO
3, 10; PH6.5.
Experiment is divided into 2 groups, normally adds the toluylic acid precursor one group of every day, and another group does not add toluylic acid for contrast, collects thalline after 72 hours and extracts total RNA, and extraction and treatment process are seen embodiment 1.
Make real-time quantitative PCR detection pclB expression of gene with SYBR Green reagent, instrument is ABIPRISM 7000 quantitative PCR instrument.According to the cDNA sequence of pclB gene, utilize Primer Express software design quantification PCR primer, TS220:5 '-GATGCTATTGATGATGTTGCTGTC-3 ' TA220:5 '-TGCTTCAGAATCCGACGTAGG-3 '.With Penicllium chrysogenum γ-actin gene (AF056975) is interior mark, act1:5 '-CTCGCTGAGCGTGGTTACAC-3 ', act2:5 '-TTGATGTCACGGACGATTTCA-3 '.Do the quantitative PCR contrast of pclA simultaneously, AS013:CTGCCGATTTCCTCAAACTCTAC, AA013:CTCCGTGCCTCCTTCTCTTG.It is synthetic that primer is given birth to the worker by Shanghai.Quantitative PCR reagent is
Premix Ex Tag
TMTest kit (precious biotechnology (Dalian) company limited).Reaction conditions is: 95 ℃, and 1 minute; 95 ℃, 15 seconds, 60 ℃, 1 minute, 40 circulations.C as a result to quantitative PCR
TValue converts, and adopts
Method (Livak K.J.and T.D.Schmittgen Methods 25:402-408,2001).As a result, toluylic acid can significantly be induced the pclB expression of gene, is 1 with the expression amount that does not add toluylic acid, and the expression of pclB has improved 4 times when then adding toluylic acid.And nearly 8 times of amplitudes that pclA improves.The results are shown in Figure 2.
[embodiment 3] pclB Prokaryotic Expression
Prokaryotic expression carrier pET-39b (+) is available from Novagen company.
With Penicllium chrysogenum Wis54-1255cDNA is masterplate, primer T220a
5 '-
CATATGCCCGTATCCTCTA ACTACC-3 '/T220b5 '-
CTCGAGCAGCTTGGCTTTTGGTGCC-3 ' amplifies the encoding sequence of pclB, and restriction endonuclease sites Nde I is introduced at two ends, and Xho I is connected to the carrier pET-39b (+) that cuts with same enzyme, obtains plasmid pET39/pclB.
The plasmid pET39/pclB that builds is transformed expressive host bacterium BL21 (DE3)-RP (Stratgene company), and picking positive colony to LB substratum (yeast powder peptone NaCl) is cultured to OD for 37 ℃
6000.6, adding 0.5mmol/L IPTG induction exogenous gene and express, 37 ℃ of 200rpm continue to cultivate, and collect thalline, and SDS-PAGE analyzes.
It is resuspended with 16ml Buffer A (50mmol/L Tris-HCl pH7.5,0.5mmol/LEDTA, 50mmol/L NaCl, 5% glycerine) to take by weighing thalline 0.4g, ultrasonication, 10,4 ℃ of 10min of 000g are centrifugal, get cleer and peaceful precipitation respectively, the SDS-PAGE electrophoretic analysis the results are shown in Figure 3.The result shows that the most forms for inclusion body of recombinant expressed PclB exist.
[embodiment 4] improve the output of penicillin by the genetic expression that increases pclB in the Penicllium chrysogenum
According to document (Carr et al., 1986, Gene 48:257～266), design two couples of synthetic primer Pip1:5 ' TCGC
GGATCCTGTCCCTAGTGCTGGGCTTGA AGTATG3 '/Pip2:5 ' TGGAAG
CATATGTGTCTAGAAAAATAATGGTGAAAACT3 ', and Tip1:5 ' AT
GGTACCAAGGGCCCATGGATGGGACCGGGGAT3 '/Tip3:5 ' T
AAGCTTGAGAGCTCGTGCCGAATCTGCTTGGC3 '
With Penicllium chrysogenum Wis54-1255 (ATCC28089) strain gene group DNA is template, cloned the promoter sequence Pipns (two ends are introduced BamHI and NdeI restriction enzyme site respectively) of isopenicillin N synthase gene 1 .16kb respectively, and the terminator sequence Tipns (two ends are introduced Kpn I and Hind III restriction enzyme site respectively) of 640bp.
With T220-a:5 '-
CATATGCCCGTATCCTCTA ACTACC-3 '/T220-c:5 '-
GGTACCCAGCTTGGCTTTTGGTGCC-3 ' amplifies the encoding sequence of pclB again, and the two ends restriction enzyme site is Nde I/Kpn I.These three sections sequences are connected, obtain the pclB expression of gene box ibt that can in Penicllium chrysogenum, express.
The preparation employing application number of conversion carrier is 200410012139.4 the described method preparation of Chinese invention patent, key step is as follows: penicillium chrysogenum ATCC10003 (X-1612) is cultivated at YPD (1% yeast extract, 2% peptone, 2% glucose) cultivate 24h in the substratum, after mycelia is filtered, liquid feeding N
2Grind, (Invitrogen company, K1800-01) extraction obtains the Penicllium chrysogenum genomic dna with Easy-DNA kit.
According to document (Carr et al., 1986, Gene 48:257～266), with pip1:5 '-TCGCGGATCCTGTCCCTAGTGCTGGGCTTGAAGTATG-3 ' pip2:5 '-TGGAAGCCATGGTGTCTAGAAAAATAATGGTGAAAACT-3 ' is primer, with Penicllium chrysogenum ATCC10003 (x-1612) strain gene group DNA is template, carry out pcr amplification, the PCR condition is: 94 ℃, and 3 minutes; 94 ℃ 1 minute, 60 ℃ 1 minute, 72 ℃ 1.5 minutes-40 the circulation; 72 ℃ 7 minutes; 4 ℃ of preservations.The PCR product is adopted the ordinary method cloning and sequencing, and the result shows that clone's product length is 1168bp and bibliographical information basically identical, only becomes A at 589 by G, proves to have obtained the Pipns sequence.The Pipns sequence 5 ' and the 3 ' end that obtain 1.16kb the clone are introduced BamH I and NcoI restriction enzyme site respectively, are connected 12 hours with the pGEM-T carrier with dna ligase under 16 ℃ of temperature then, obtain plasmid pGEM-T/Pipns.
Yeast expression carrier pPICZA and prokaryotic gene cloning vector pCR4Blunt-TOPO are all available from Invitrogen company.
Utilize primer:
pk15’-TGAAGCTTGTCAGCTACTGGGCTATCAGGAC-3’
Pk25 '-ACA GATCTAAAGTGCCACCTGTATGCGGTGTG-3 ' is a template with the pCR4Blunt-TOPO plasmid, and pcr amplification obtains the resistant gene (kan of kantlex
r), and hold at its 5 ' end and 3 ' and to introduce Hind III, Bgl II restriction enzyme site respectively.
The pPICZA plasmid reclaims the 2.46kb fragment after using Hind III/BglII double digestion, with the kan that cuts through same enzyme
rFragment connects 12 hours under 16 ℃ of temperature, adopt CaCl then
2Conversion method transformed into escherichia coli DH5 α, the positive colony that screening has kantlex and phleomycin resistance simultaneously in the LB substratum therefrom extracts and obtains the pPICZA/kan plasmid.
The pPICZA/kan plasmid partly digests through BamH I/Nco I, reclaims the 3.1kb fragment.PGEM-T/Pipns cuts with BamH I/Nco I enzyme equally, reclaims the 1.16kb small segment.Two fragments are connected 12 hours under 16 ℃ of temperature, obtain the conversion carrier of Penicllium chrysogenum, name and be pPIPKA.
After Penicllium chrysogenum conversion carrier pPIPKA cut with Hind III and BamH I enzyme, reclaim big fragment, be connected with the ibt expression cassette and obtain carrier pPCLB.As stated above pPCLB is transformed bacterial strain Wis54-1255, screening positive clone is used for penicillin yield and detects.Detection is carried out according to standard method (Brownlee et al, J GenMicrobiol, 1949).Utilize shake flask fermentation to carry out retrial to the high unit bacterial strain that screens, method with reference to Lein (Overproduction of microbial metabolites, Z.Vanek and Z Hostalekeds, pp105-139).By the test-results of 89 strain bacterium, to compare with starting strain, the penicillin yield of transgenosis bacterial strain obviously improves, and the highest increase rate has surpassed 23%.
Above detailed description of the present invention does not limit the present invention, and those skilled in the art can make various changes and distortion according to the present invention, as long as do not break away from spirit of the present invention, all should belong to the defined scope of claim of the present invention.
SEQUENCE?LISTING
＜110〉North China Pharmacuetical Group New Drug Research ﹠ Development Co., Ltd
＜120〉new penicillium chrysogenum phenylaceta coenzyme A ligase gene and improve the method for penicillin yield
<130>05P101404
<160>2
<170>PatentIn?version?3.1
<210>1
<211>1808
<212>DNA
＜213〉Penicllium chrysogenum (Penicillium chrysogenum)
<220>
<221>CDS
<222>(59)..(1744)
＜223〉open reading frame
<400>1
tccctttgag?cctctattca?cattcgcatt?accggctcca?tagctttgtt?tcgccgca 58
atg?ccc?gta?tcc?tct?aac?tac?ccc?ctg?gtc?gac?atc?cca?gaa?gtg?gat 106
Met?Pro?Val?Ser?Ser?Asn?Tyr?Pro?Leu?Val?Asp?Ile?Pro?Glu?Val?Asp
1 5 10 15
ctt?tgg?acc?ttt?cta?ttt?gag?cgc?aag?gac?aga?gct?tac?cca?gat?gac 154
Leu?Trp?Thr?Phe?Leu?Phe?Glu?Arg?Lys?Asp?Arg?Ala?Tyr?Pro?Asp?Asp
20 25 30
aag?att?atc?tac?caa?gat?gcc?gat?acc?caa?cgt?cat?tac?aca?tac?aaa 202
Lys?Ile?Ile?Tyr?Gln?Asp?Ala?Asp?Thr?Gln?Arg?His?Tyr?Thr?Tyr?Lys
35 40 45
tcg?cta?cgt?gat?gcc?tcg?cta?gat?ttc?ggc?aag?ggc?ctc?aaa?gcc?ctg 250
Ser?Leu?Arg?Asp?Ala?Ser?Leu?Asp?Phe?Gly?Lys?Gly?Leu?Lys?Ala?Leu
50 55 60
tat?gag?tgg?cgc?aag?ggc?gat?gta?ctg?gcc?ctc?ttc?acg?cca?aac?agc 298
Tyr?Glu?Trp?Arg?Lys?Gly?Asp?Val?Leu?Ala?Leu?Phe?Thr?Pro?Asn?Ser
65 70 75 80
atc?gat?aca?ccc?gtg?gtg?atg?tgg?ggc?aca?ctt?tgg?gcc?ggc?gga?acc 346
Ile?Asp?Thr?Pro?Val?Val?Met?Trp?Gly?Thr?Leu?Trp?Ala?Gly?Gly?Thr
85 90 95
atc?tcg?cct?gca?aac?ccg?ggt?tac?acg?gtt?gac?gag?ctg?gcc?ttc?cag 394
Ile?Ser?Pro?Ala?Asn?Pro?Gly?Tyr?Thr?Val?Asp?Glu?Leu?Ala?Phe?Gln
100 105 110
ctc?aag?aac?tcc?cat?gcc?aag?ggc?ctt?gta?acg?caa?gcc?tcg?gtg?ctg 442
Leu?Lys?Asn?Ser?His?Ala?Lys?Gly?Leu?Val?Thr?Gln?Ala?Ser?Val?Leu
115 120 125
ccc?gtt?gcg?cgg?gaa?gcg?gcg?aag?aaa?gtt?ggc?atg?cct?gaa?gac?cgc 490
Pro?Val?Ala?Arg?Glu?Ala?Ala?Lys?Lys?Val?Gly?Met?Pro?Glu?Asp?Arg
130 135 140
att?atc?ctg?att?ggg?gac?cag?cgt?gat?ccc?gat?gcg?cgc?gtc?aag?cat 538
Ile?Ile?Leu?Ile?Gly?Asp?Gln?Arg?Asp?Pro?Asp?Ala?Arg?Val?Lys?His
145 150 155 160
ttc?acc?tct?gtg?cgc?aat?atc?tct?ggt?gct?acc?cgc?tac?cgc?aag?cag 586
Phe?Thr?Ser?Val?Arg?Asn?Ile?Ser?Gly?Ala?Thr?Arg?Tyr?Arg?Lys?Gln
165 170 175
aag?atc?act?cct?gcg?aag?gat?gtg?gct?ttt?ttg?gtt?tat?tct?tct?ggg 634
Lys?Ile?Thr?Pro?Ala?Lys?Asp?Val?Ala?Phe?Leu?Val?Tyr?Ser?Ser?Gly
180 185 190
acc?acg?ggt?gtg?cct?aag?ggt?gtc?atg?ata?tcg?cat?cgg?aac?atc?gtt 682
Thr?Thr?Gly?Val?Pro?Lys?Gly?Val?Met?Ile?Ser?His?Arg?Asn?Ile?Val
195 200 205
gcc?aat?atc?agg?cag?cag?ttc?att?gct?gag?ggt?gaa?atg?tta?agc?tgg 730
Ala?Asn?Ile?Arg?Gln?Gln?Phe?Ile?Ala?Glu?Gly?Glu?Met?Leu?Ser?Trp
210 215 220
aat?ggt?ggt?cct?gat?gga?aag?ggt?gat?cgg?gtc?ctg?gca?ttt?ttg?ccg 778
Asn?Gly?Gly?Pro?Asp?Gly?Lys?Gly?Asp?Arg?Val?Leu?Ala?Phe?Leu?Pro
225 230 235 240
ttc?tat?cat?atc?tat?gga?ttg?act?tgc?tta?att?acc?cag?gct?tta?tac 826
Phe?Tyr?His?Ile?Tyr?Gly?Leu?Thr?Cys?Leu?Ile?Thr?Gln?Ala?Leu?Tyr
245 250 255
aag?ggt?tat?cac?ttg?att?gtc?atg?tcc?aaa?ttc?gac?att?gaa?aag?tgg 874
Lys?Gly?Tyr?His?Leu?Ile?Val?Met?Ser?Lys?Phe?Asp?Ile?Glu?Lys?Trp
260 265 270
tgc?gcc?cac?gtg?cag?aac?tat?cgc?tgc?tcg?ttt?agt?tat?atc?gtc?cct 922
Cys?Ala?His?Val?Gln?Asn?Tyr?Arg?Cys?Ser?Phe?Ser?Tyr?Ile?Val?Pro
275 280 285
ccc?gtg?gtg?cta?ttg?tta?ggc?aag?cac?ccg?gtg?gtc?gac?aaa?tat?gac 970
Pro?Val?Val?Leu?Leu?Leu?Gly?Lys?His?Pro?Val?Val?Asp?Lys?Tyr?Asp
290 295 300
ctt?tca?agt?ctg?cgc?atg?atg?aac?tca?ggc?gct?gca?cca?ctc?act?caa 1018
Leu?Ser?Ser?Leu?Arg?Met?Met?Asn?Ser?Gly?Ala?Ala?Pro?Leu?Thr?Gln
305 310 315 320
gag?ctg?gta?gaa?gca?gtc?tac?tcc?cgc?atc?aag?gtt?ggc?att?aag?cag 1066
Glu?Leu?Val?Glu?Ala?Val?Tyr?Ser?Arg?Ile?Lys?Val?Gly?Ile?Lys?Gln
325 330 335
ggc?tac?gga?ctc?agc?gag?acc?agc?ccg?act?aca?cac?tcc?caa?cgg?tgg 1114
Gly?Tyr?Gly?Leu?Ser?Glu?Thr?Ser?Pro?Thr?Thr?His?Ser?Gln?Arg?Trp
340 345 350
gag?gac?tgg?cgc?gaa?gcc?atg?ggt?tcc?gtc?ggc?cgc?ttg?atg?cct?aat 1162
Glu?Asp?Trp?Arg?Glu?Ala?Met?Gly?Ser?Val?Gly?Arg?Leu?Met?Pro?Asn
355 360 365
atg?caa?gcc?aag?tac?atg?act?atg?cct?gag?gat?ggg?tcc?gag?cct?aag 1210
Met?Gln?Ala?Lys?Tyr?Met?Thr?Met?Pro?Glu?Asp?Gly?Ser?Glu?Pro?Lys
370 375 380
gag?gtt?ggc?gag?ggc?gag?gtt?ggc?gaa?ttg?tac?ctg?aaa?gga?cct?aac 1258
Glu?Val?Gly?Glu?Gly?Glu?Val?Gly?Glu?Leu?Tyr?Leu?Lys?Gly?Pro?Asn
385 390 395 400
gtt?ttc?ctg?ggc?tat?cac?gag?aac?cca?gag?gct?acc?aag?ggc?tgc?ctg 1306
Val?Phe?Leu?Gly?Tyr?His?Glu?Asn?Pro?Glu?Ala?Thr?Lys?Gly?Cys?Leu
405 410 415
tct?gag?gat?ggg?tgg?ttc?cag?act?ggt?gac?gtt?gga?tac?cag?gac?gcc 1354
Ser?Glu?Asp?Gly?Trp?Phe?Gln?Thr?Gly?Asp?Val?Gly?Tyr?Gln?Asp?Ala
420 425 430
aag?ggt?aat?ttc?tac?att?acc?gat?cgt?gtc?aag?gaa?ctt?atc?aag?tat 1402
Lys?Gly?Asn?Phe?Tyr?Ile?Thr?Asp?Arg?Val?Lys?Glu?Leu?Ile?Lys?Tyr
435 440 445
aag?ggc?ttc?cag?gtg?cct?cct?gct?gag?ttg?gaa?ggg?tat?ctg?gtt?gac 1450
Lys?Gly?Phe?Gln?Val?Pro?Pro?Ala?Glu?Leu?Glu?Gly?Tyr?Leu?Val?Asp
450 455 460
aac?gat?gct?att?gat?gat?gtt?gct?gtc?att?ggt?att?gag?agt?gag?aca 1498
Ash?Asp?Ala?Ile?Asp?Asp?Val?Ala?Val?Ile?Gly?Ile?Glu?Ser?Glu?Thr
465 470 475 480
cac?ggt?tcc?gag?gtt?cct?atg?gct?tgt?gtg?gtt?cgc?agc?gcg?aag?agc 1546
His?Gly?Ser?Glu?Val?Pro?Met?Ala?Cys?Val?Val?Arg?Ser?Ala?Lys?Ser
485 490 495
aag?tct?tcc?gga?aca?agc?gag?aag?gat?gaa?gca?gca?agg?att?atc?aaa 1594
Lys?Ser?Ser?Gly?Thr?Ser?Glu?Lys?Asp?Glu?Ala?Ala?Arg?Ile?Ile?Lys
500 505 510
tgg?ctg?gat?agc?aag?gtc?gca?agc?cac?aag?cgt?ctg?cgc?ggt?ggc?gtc 1642
Trp?Leu?Asp?Ser?Lys?Val?Ala?Ser?His?Lys?Arg?Leu?Arg?Gly?Gly?Val
515 520 525
cac?ttt?gtg?gat?gag?atc?ccc?aag?aat?ccc?agt?ggg?aag?atc?cta?cgt 1690
His?Phe?Val?Asp?Glu?Ile?Pro?Lys?Asn?Pro?Ser?Gly?Lys?Ile?Leu?Arg
530 535 540
cgg?att?ctg?aag?cag?aag?ttc?aag?ggg?gcg?gcc?gag?gca?cca?aaa?gcc 1738
Arg?Ile?Leu?Lys?Gln?Lys?Phe?Lys?Gly?Ala?Ala?Glu?Ala?Pro?Lys?Ala
545 550 555 560
aag?ctg?taaatgagaa?cttttagata?tgcacgctat?atacacttaa?gacctgtcca 1794
Lys?Leu
tgttgatatt?gata 1808
<210>2
<211>562
<212>PRT
＜213〉Penicllium chrysogenum (Penicillium chrysogenum)
<400>2
Met?Pro?Val?Ser?Ser?Asn?Tyr?Pro?Leu?Val?Asp?Ile?Pro?Glu?Val?Asp
1 5 10 15
Leu?Trp?Thr?Phe?Leu?Phe?Glu?Arg?Lys?Asp?Arg?Ala?Tyr?Pro?Asp?Asp
20 25 30
Lys?Ile?Ile?Tyr?Gln?Asp?Ala?Asp?Thr?Gln?Arg?His?Tyr?Thr?Tyr?Lys
35 40 45
Ser?Leu?Arg?Asp?Ala?Ser?Leu?Asp?Phe?Gly?Lys?Gly?Leu?Lys?Ala?Leu
50 55 60
Tyr?Glu?Trp?Arg?Lys?Gly?Asp?Val?Leu?Ala?Leu?Phe?Thr?Pro?Asn?Ser
65 70 75 80
Ile?Asp?Thr?Pro?Val?Val?Met?Trp?Gly?Thr?Leu?Trp?Ala?Gly?Gly?Thr
85 90 95
Ile?Ser?Pro?Ala?Asn?Pro?Gly?Tyr?Thr?Val?Asp?Glu?Leu?Ala?Phe?Gln
100 105 110
Leu?Lys?Asn?Ser?His?Ala?Lys?Gly?Leu?Val?Thr?Gln?Ala?Ser?Val?Leu
115 120 125
Pro?Val?Ala?Arg?Glu?Ala?Ala?Lys?Lys?Val?Gly?Met?Pro?Glu?Asp?Arg
130 135 140
Ile?Ile?Leu?Ile?Gly?Asp?Gln?Arg?Asp?Pro?Asp?Ala?Arg?Val?Lys?His
145 150 155 160
Phe?Thr?Ser?Val?Arg?Asn?Ile?Ser?Gly?Ala?Thr?Arg?Tyr?Arg?Lys?Gln
165 170 175
Lys?Ile?Thr?Pro?Ala?Lys?Asp?Val?Ala?Phe?Leu?Val?Tyr?Ser?Ser?Gly
180 185 190
Thr?Thr?Gly?Val?Pro?Lys?Gly?Val?Met?Ile?Ser?His?Arg?Asn?Ile?Val
195 200 205
Ala?Asn?Ile?Arg?Gln?Gln?Phe?Ile?Ala?Glu?Gly?Glu?Met?Leu?Ser?Trp
210 215 220
Asn?Gly?Gly?Pro?Asp?Gly?Lys?Gly?Asp?Arg?Val?Leu?Ala?Phe?Leu?Pro
225 230 235 240
Phe?Tyr?His?Ile?Tyr?Gly?Leu?Thr?Cys?Leu?Ile?Thr?Gln?Ala?Leu?Tyr
245 250 255
Lys?Gly?Tyr?His?Leu?Ile?Val?Met?Ser?Lys?Phe?Asp?Ile?Glu?Lys?Trp
260 265 270
Cys?Ala?His?Val?Gln?Asn?Tyr?Arg?Cys?Ser?Phe?Ser?Tyr?Ile?Val?Pro
275 280 285
Pro?Val?Val?Leu?Leu?Leu?Gly?Lys?His?Pro?Val?Val?Asp?Lys?Tyr?Asp
290 295 300
Leu?Ser?Ser?Leu?Arg?Met?Met?Asn?Ser?Gly?Ala?Ala?Pro?Leu?Thr?Gln
305 310 315 320
Glu?Leu?Val?Glu?Ala?Val?Tyr?Ser?Arg?Ile?Lys?Val?Gly?Ile?Lys?Gln
325 330 335
Gly?Tyr?Gly?Leu?Ser?Glu?Thr?Ser?Pro?Thr?Thr?His?Ser?Gln?Arg?Trp
340 345 350
Glu?Asp?Trp?Arg?Glu?Ala?Met?Gly?Ser?Val?Gly?Arg?Leu?Met?Pro?Asn
355 360 365
Met?Gln?Ala?Lys?Tyr?Met?Thr?Met?Pro?Glu?Asp?Gly?Ser?Glu?Pro?Lys
370 375 380
Glu?Val?Gly?Glu?Gly?Glu?Val?Gly?Glu?Leu?Tyr?Leu?Lys?Gly?Pro?Asn
385 390 395 400
Val?Phe?Leu?Gly?Tyr?His?Glu?Asn?Pro?Glu?Ala?Thr?Lys?Gly?Cys?Leu
405 410 415
Ser?Glu?Asp?Gly?Trp?Phe?Gln?Thr?Gly?Asp?Val?Gly?Tyr?Gln?Asp?Ala
420 425 430
Lys?Gly?Asn?Phe?Tyr?Ile?Thr?Asp?Arg?Val?Lys?Glu?Leu?Ile?Lys?Tyr
435 440 445
Lys?Gly?Phe?Gln?Val?Pro?Pro?Ala?Glu?Leu?Glu?Gly?Tyr?Leu?Val?Asp
450 455 460
Asn?Asp?Ala?Ile?Asp?Asp?Val?Ala?Val?Ile?Gly?Ile?Glu?Ser?Glu?Thr
465 470 475 480
His?Gly?Ser?Glu?Val?Pro?Met?Ala?Cys?Val?Val?Arg?Ser?Ala?Lys?Ser
485 490 495
Lys?Ser?Ser?Gly?Thr?Ser?Glu?Lys?Asp?Glu?Ala?Ala?Arg?Ile?Ile?Lys
500 505 510
Trp?Leu?Asp?Ser?Lys?Val?Ala?Ser?His?Lys?Arg?Leu?Arg?Gly?Gly?Val
515 520 525
His?Phe?Val?Asp?Glu?Ile?Pro?Lys?Asn?Pro?Ser?Gly?Lys?Ile?Leu?Arg
530 535 540
Arg?Ile?Leu?Lys?Gln?Lys?Phe?Lys?Gly?Ala?Ala?Glu?Ala?Pro?Lys?Ala
545 550 555 560
Lys?Leu
Claims (9)
1. isolating polynucleotide, it is the sequence shown in the 59th～1744 Nucleotide of nucleotide sequence shown in the SEQ ID NO.1 or SEQ IDNO:1.
2. isolating polynucleotide, it is the complete complementary nucleotide sequence of sequence shown in the 59th～1744 Nucleotide with nucleotide sequence shown in the SEQ ID NO.1 or SEQID NO:1.
3. by the polypeptide of the described polynucleotide encoding of claim 1.
4. the described polypeptide of claim 3, it has the sequence shown in the SEQ ID NO.2, and encoded protein has the phenylaceta coenzyme A ligase activity.
5. the expression vector that contains the described polynucleotide of claim 1.
6. the described expression vector of claim 5, wherein said expression vector is a prokaryotic expression carrier.
7. the host cell that contains the described expression vector of claim 5.
8. an engineered bacteria producing penicillium chrysogenum bacterial strain contains the described polynucleotide of claim 1.
9. a method that improves the Penicllium chrysogenum penicillin yield comprises the steps:
1) the described polynucleotide of claim 1 is operably connected to expression vector;
2) transform the engineering bacterial strain that penicillium chrysogenum obtains to contain the described polynucleotide of claim 1 with described expression vector;
3) the described engineering bacterial strain of fermentation culture, separation and purification obtains penicillin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510126156 CN1978650B (en) | 2005-11-30 | 2005-11-30 | New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510126156 CN1978650B (en) | 2005-11-30 | 2005-11-30 | New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1978650A CN1978650A (en) | 2007-06-13 |
| CN1978650B true CN1978650B (en) | 2010-11-17 |
Family
ID=38129957
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510126156 Expired - Fee Related CN1978650B (en) | 2005-11-30 | 2005-11-30 | New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1978650B (en) |
-
2005
- 2005-11-30 CN CN 200510126156 patent/CN1978650B/en not_active Expired - Fee Related
Non-Patent Citations (6)
| Title |
|---|
| Minambres B等.Molecular Cloning and Expression in Different Microbes of theDNA Encoding Pseudomonas putida U Phenylacetyl-CoALigase.J Biol Chem271 52.1996,271(52),第33531-33538页. |
| Minambres B等.Molecular Cloning and Expression in Different Microbes of theDNA Encoding Pseudomonas putida U Phenylacetyl-CoALigase.J Biol Chem271 52.1996,271(52),第33531-33538页. * |
| 任志红等.产黄青霉工业生产菌种基因报告系统的构建及启动子效率的评价.菌物学报24 3.2005,24(3),第376-384页. |
| 任志红等.产黄青霉工业生产菌种基因报告系统的构建及启动子效率的评价.菌物学报24 3.2005,24(3),第376-384页. * |
| 王富强等.产黄青霉转化载体pPIPKA的构建及青霉素工业生产菌株的转化研究.菌物学报23 1.2004,23(1),第66-72页. |
| 王富强等.产黄青霉转化载体pPIPKA的构建及青霉素工业生产菌株的转化研究.菌物学报23 1.2004,23(1),第66-72页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1978650A (en) | 2007-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP0758020B1 (en) | amdS gene from Aspergillus niger coding for an acetamidase | |
| CN101423850B (en) | Fermentative production of acetone from renewable resources by means of novel metabolic pathway | |
| CN1622998B (en) | Fungus-origin lysyl oxidases | |
| CN102016013A (en) | A butanol dehydrogenase enzyme from the bacterium achromobacter xylosoxidans | |
| CN102712912A (en) | Improved flux to acetolactate-derived products in lactic acid bacteria | |
| CN102186973A (en) | Identification and use of bacterial [2fe-2s] dihydroxy-acid dehydratases | |
| CN111560384B (en) | Application of gene FoRnt in regulation and control of pathogenicity of banana fusarium wilt | |
| CN1225125A (en) | Stable recombinant yeasts for fermenting xylose to ethanol | |
| CN111534527B (en) | Application of gene FoPao in regulation and control of pathogenicity of banana vascular wilt | |
| CN108034667B (en) | Monascus ruber alpha-amylase gene, and preparation method and application thereof | |
| CN105950640B (en) | The kappa-carrageenan enzyme gene and recombinase preparation method obtained using marine bacteria as source | |
| CN107574173B (en) | Recombinant plasmid and method for constructing monascus pigment high-yield strain by using same | |
| EP2840135A1 (en) | Cis-epoxysuccinate hydrolase-encoding gene, polypeptide encoded by the gene, and related application thereof | |
| CN1795270B (en) | DNA coding for protein having d-lactic acid dehydrogenase activity and use thereof | |
| CN102174557A (en) | Recombinant spores of surface displayed silkworm alcohol dehydrogenases and preparation method of same | |
| CN101463358A (en) | Nitrile hydratase gene cluster and use thereof | |
| CA2315534A1 (en) | Promoter from ashbya gossypii | |
| CN1978650B (en) | New penicillium chrysogenum phenylaceta coenzyme A ligase gene and method for increasing penicillin yield | |
| CN105316271A (en) | Method for constructing bacterium strain with high output of rhamnolipid | |
| Zhang et al. | Expression of the inulinase gene from Aspergillus niger in Pichia pastoris | |
| CN106635941A (en) | Thermophilic esterase derived from aquifex aeolicus strain and functional verification of thermophilic esterase | |
| CN1978651B (en) | Gene for coding penicillium chrysogenum phenylacetic acid hydroxylase and its use | |
| JP6392534B2 (en) | Protein having leucine acid production activity and use thereof | |
| CN100439504C (en) | Saponin-digesting enzymes, genes there of and soyasapogenol B mass procution system | |
| CN112010953A (en) | Wheat powdery mildew resistance related protein Pm24, and coding gene and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| ASS | Succession or assignment of patent right |
Owner name: HUABEI PHARMACEUTICAL CO., LTD. Free format text: FORMER OWNER: NCPC NEW DRUG RESEARCH AND DEVELOPMENT CO., LTD. Effective date: 20150714 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20150714 Address after: 050015 Heping East Road, Hebei, Shijiazhuang, No. 388 Patentee after: Huabei Pharmaceutical Co., Ltd. Address before: 050000 No. 388 Heping East Road, Hebei, Shijiazhuang Patentee before: Ncpc New Drug Research And Development Co., Ltd. |
|
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20101117 Termination date: 20191130 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |