CN1974592A - Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization - Google Patents
Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization Download PDFInfo
- Publication number
- CN1974592A CN1974592A CNA2006100224991A CN200610022499A CN1974592A CN 1974592 A CN1974592 A CN 1974592A CN A2006100224991 A CNA2006100224991 A CN A2006100224991A CN 200610022499 A CN200610022499 A CN 200610022499A CN 1974592 A CN1974592 A CN 1974592A
- Authority
- CN
- China
- Prior art keywords
- primer
- amylase
- alpha
- supressor
- specific
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses four specific primers based on the specific sites in 19bp, 47bp, 125bp and 276bp of wheat alpha-amylase and with one of the specific sites specifically amplified. The four specific primers have simple clear structure and convenient use, and may be used in fast and efficiently establishing molecular marker by means of PCR technology for fast precise detection of different kinds of alpha-amylase inhibiting factor in wheat. The present invention has quick and obvious effect and excellent application foreground.
Description
Technical field
The invention belongs to technical field of biological genetic engineering, particularly a kind of nucleotide sequence of wheat alpha-amylase supressor encoding gene, and based on the application of this sequence by biotechnological means improvement wheat insect-resistance.
Background technology
Owing to be subjected to the attack of various insects, annual grain in the world can the underproduction 37%.The further investigation of chemical insecticide and widespread use have obtained significant vermins-proof effect on producing, but simultaneously the cost height of chemical insecticide pest control, big for environment pollution, easily insect is developed immunity to drugs to cause disturbed ecological balance.Therefore, research emphasis in recent years concentrates on the insect-resistance that how to improve plant self, and having carried out with the importing of allos (plant, animal, microorganism) anti insect gene is the breeding of purpose, so that plant obtains anti insect gene.At present, from different plant species separating clone polytype anti insect gene, and import in the plant materials and obtain transgenic anti-insect plants.Therefore the plant seed rich in proteins of starch based, sugar, lipid are subjected to insect (particularly weevil) " attack " easily.Usually plant itself has the mechanism of some opposing insect predations, can lower the harm of insect on some degree, and these mechanism form in plant long-term evolution process.The defense system of involved in plant self has microbiotic, alkaloid, terpenes, prussiate and some protein, and enzyme inhibition factor is exactly important a kind of in protein-based.The α-Dian Fenmei supressor is to belong to sugar (glycosides) lytic enzyme supressor, is a huge protein families, has purposes widely at present on medicine and agricultural.
Be rich in the α-Dian Fenmei supressor of various ways in the wheat crops seed, can suppress multiple outer rim or inner edge α-Dian Fenmei from insect and dried meat breast animal.Part α-Dian Fenmei supressor is only single-minded at the insect diastatic action, because they have strong restraining effect to the enzyme that derives from insect, but but very little or do not have to the salivin that derives from dried meat breast animal and pancreatic amylase effect.Wherein molecular weight is that two supressor families research of 12kDa (0.28family) and 24kDa (0.19family) is comparatively thorough.24kDa wheat dimerization α-Dian Fenmei supressor (WDAI) is the natural pest-resistant albumen of a class wherein, α-Dian Fenmei to some insect is inhibited, supressor in this protein family is the small protein matter of 124 amino-acid residues, wherein two factors of WDAI-0.19 and WDAI-0.53 only have 7 seats to replace on aminoacid sequence, 94% homology is arranged, but 0.19 factor sphere of action is then single-minded effect of 0.53 factor and insect α-Dian Fenmei very extensively, and also there is 100 times difference in same diastatic inhibition vigor.Oda etc. study in great detail the crystalline structure of 0.19 factor, and it is the protein factor (PDB ID-code:1HSS) of a unique known 3D structure in the cereal α-Dian Fenmei supressor at present.The mechanism of action of itself and dried meat breast animal, insect α-Dian Fenmei has also had further investigation.
Quantity, particularly control that α-Dian Fenmei supressor in plant seed and other organs can effectively be controlled food leaf class insect highly rely on the insect of starch as its energy donor.Bt gene pest-resistant spectrum is very limited, can't tackle crop pests such as western corn rootworm, because Cry albumen can't be attached on the goldbeater's skin of this insect, does not bring into play effect.And the α-Dian Fenmei supressor is to all toxic effect of several purpose insects, and pest-resistant spectrum is wider, can remedy this shortcoming of Bt toxalbumin.Though most of insects can utilize the α-amylases of multiple different qualities to digest plant amylum self-energy is provided, making does not have specific α-Dian Fenmei supressor.But people still can utilize α-amylase inhibitors Pest Control by the plant genetic engineering means.Nineteen ninety Teresa successfully changes the gene of α AI21 in the Kidney bean over to two kinds of leguminous crop peas and cowpea, utilizes the promotor of PHA to obtain proteic the efficiently expressing of α AI21, and transgenic plant have tangible insect-resistance.The pest-resistant rate of transgenosis pea nearly 100% in soybean in 2000 experiment.Contain 3% α AI in the transgenosis pea, and in general Kidney bean, only contain 1%～2%.α AI can suppress the early development of pea weevil cape larva, can reduce a large amount of losses like this.In transgenic pest-resistant, security is good with wheat 24kDa dimerization α-Dian Fenmei supressor, is easier to people and accepts.
But at present also do not study difference between different supressors, can't select more suitably that the supressor gene carries out transgenosis work, the amylase of different sources is played restraining effect from gene level.We have developed the specific mark primer according to single nucleotide polymorphism (SNP) site that exists in the α-Dian Fenmei supressor nucleotide sequence, amplification source Israel different areas wild emmer alpha-amylase inhibiting factor encoding gene.From the research angle of plant and environmental interaction, inquired into the evolution and the genetic variation and genetic differentiation of α-Dian Fenmei supressor.For exploitation is laid a good foundation at special, the colleges and universities of insect, the insect-killing protein product of environmental protection.
Summary of the invention
The molecule marking method that the purpose of this invention is to provide wheat alpha-amylase supressor encoding gene, the insect-resistance of prediction wheat seed, the seed selection progress of quickening pest-resistant wheat.To the long-term detailed research and analysis of wheat alpha-amylase supressor encoding gene, develop the specific mark primer of dissimilar different areas, the source wild emmer alpha-amylase inhibiting factor encoding gene of specific amplified by the inventor.Can use the regular-PCR technology and accurately detect in the wheat whether contain specific α-Dian Fenmei supressor fast.
In order to reach purpose of the present invention, the technical solution used in the present invention is as follows:
A, from ncbi database, obtain α-Dian Fenmei supressor encoding gene correlated series.Utilizing BLAST-n program frisking correlated series resource, is that the sequence resource is identified to obtaining, and the sequence that screening is fit to is analysed in depth.
B, utilize DNAMAN5.0 software and Primer2.0 software design universal primer that wild emmer is increased, obtain gene order.After the sequence that will have a complete encoding gene is processed, by sequence alignment software DNAMAN5.0 comparison, observation sequence structure and according to conservative primer of homologous fragment exploitation and locus specificity primer between sequence.
Distinctive supressor coding gene sequence in c, the analysis different areas wild emmer, the exploitation specific molecular marker.
The mark amplification common wheat that d, utilization are developed is cloned into carrier with target fragment and opens transformed into escherichia coli, and the target fragment that obtains is checked order again, guarantees that its positive fragment is a part α-Dian Fenmei supressor coding gene sequence.
E, in wheat lines the specificity and the stability of the different primers of checking, and determine PCR program and reaction system at different primers.
By above-mentioned steps, obtain the specific mark primer of wild emmer alpha-amylase inhibiting factor encoding gene:
1, specific amplified Israel Mt.Hermon area wild emmer alpha-amylase inhibiting factor encoding gene:
R holds primer: ACTCATTT/CGCTTGACTAGGC
F holds primer:
F19：ATGCTCGTGGCGACACTCG
Specific amplified Israel Mt.Hermon area wild emmer alpha-amylase inhibiting factor encoding gene.Amplification 426bp fragment infers then that as positive fragment 19 are " G " in the gene.
Amplification program is as follows:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 64 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 32 circulations; 72 ℃ are extended 5min.
2, specific amplified Israel Tabiha, Rosh-Pinna and Bat-Shelomo area wild emmer alpha-amylase inhibiting factor encoding gene:
R holds primer: ACTCATTT/CGCTTGACTAGGC
F holds primer:
F47：AGTACARCGCATGGAGTGG
Specific amplified Israel Tabiha, Rosh-Pinna and Bat-Shelomo area wild emmer alpha-amylase inhibiting factor encoding gene.Amplification 398bp fragment infers then that as positive fragment the 46-47 position is " GG " in the gene.
Amplification program is as follows:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 57 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
3, specific amplified Israel Qzzrin, Yehudiyya and Rosh-Pinna area wild emmer alpha-amylase inhibiting factor encoding gene:
R holds primer: ACTCATTT/CGCTTGACTAGGC
F holds primer:
F125：CTGTCGTCCATTGCTTAG
Specific amplified Israel Qzzrin, Yehudiyya and Rosh-Pinna area wild emmer alpha-amylase inhibiting factor encoding gene.Amplification 319bp fragment infers then that as positive fragment 125 are " G " in the gene.
Amplification program is as follows:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 62.5 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
4, specific amplified Israel Yehudiyya, Gamla and Amirim area wild emmer alpha-amylase inhibiting factor encoding gene:
R holds primer: ACTCATTT/CGCTTGACTAGGC
F holds primer:
F276：GCGTGTCGGAGGGACAGTCA
Specific amplified Israel Yehudiyya, Gamla and Amirim area wild emmer alpha-amylase inhibiting factor encoding gene.Amplification 170bp fragment infers then that as positive fragment 276 are " A " in the gene.
Amplification program is as follows:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 60 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
α-Dian Fenmei supressor mark by method exploitation of the present invention can be used by the following method:
1, serve as a mark method that screening knows altogether by this area staff such as particle gun, agriculture bacillus mediated, pollen tube channels imports the α-Dian Fenmei supressor encoding gene of wheat, cultivates the good wheat breed of insect-resistance.
2, carry out the oriented molecule breeding and select, strong new variety of wheat and the germplasm of initiative insect-resistance.
3, screening obtains expression efficiency and suppresses all good α-Dian Fenmei supressor of effect according to the Yeast expression carrier that contains α-Dian Fenmei supressor encoding gene of gene order foundation, adds in the common sterilant as plant edge sterilant.
Enthusiasm effect of the present invention is as follows:
1, the PCR system of the present invention's use does not need special P CR instrument and special reaction reagent, and the product that common commercial company produces all can reach requirement.
What 2, in the PCR condition of the present invention expanding effect is had the greatest impact is annealing temperature, and the specific mark primer that is used to increase differs greatly in position and based composition, can not occur obscuring mutually or disturbing.And the annealing temperature higher (57-64 ℃) of our use, can guarantee that the result is accurate.In addition, reverse primer used in the present invention comprises the termination codon of α-Dian Fenmei supressor encoding gene just.
3, utilize base specific to design 4 primers, structure is simple and clear, and is easy to use, and utilizes round pcr to detect rapidly and efficiently, can accurately detect α-Dian Fenmei supressor encoding genes dissimilar in the wheat at short notice.Effect is fast obvious, and good promotion prospect is arranged.
Embodiment
The present invention is described in further detail below in conjunction with embodiment, but be not limitation of the present invention, all any this areas of doing according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.
Embodiment 1:
1. extracting genome DNA:
Adopt the CTAB method to extract genomic dna.Get the fresh young leaflet tablet of 2g, liquid nitrogen grinding adds the 2 * CTAB extracting solution (2%CTAB that is preheated to 65 ℃ after becoming fine powder; 1.4M NaCl, 0.1MTris-HCl, PH8.0,0.1MEDTA, PH8.0 faces with before adding 2% beta-mercaptoethanol) and 15ml, mixing.
65 ℃ of water-bath 30-45min, jog mixing therebetween.
Add isopyknic chloroform after being cooled to room temperature: primary isoamyl alcohol (24: 1), mixing to supernatant liquor is the milk shape gently, the centrifugal 10min of 4000rpm.
Get supernatant liquor, add the equal-volume Virahol, place ice bath deposit D NA.
Tick DNA, wash 2 times with 70% alcohol, dehydrated alcohol is washed once gas and is done DNA, is dissolved in the TE solution of an amount of pH8.0.Add the RNA enzyme to final concentration 100 μ g/ μ l.
Agarose gel electrophoresis detects DNA concentration and quality.
2. design of primers:
According to DNAMAN software sequences comparison result, at coding region 19bp place according to locus specificity, the special primer in this site of specific amplified.This primer specific nature is as follows:
F19:R holds primer: 5 ' ACTCATTT/CGCTTGACTAGGC 3 '
F holds primer: 5 ' ATGCTCGTGGCGACACTCG 3 '
F19: length 19bp, GC content 63.2%, molecular weight 5.84kDa, Tm 62.0 degree
3. gene amplification:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ sex change 45s, 57-65 ℃ annealing 45s, 72 ℃ of extension 1min, 32-35 circulation altogether; 72 ℃ are extended 5min.
4. the checking of specific fragment:
4.1 product reclaims, purifying
(1) under ultraviolet lamp, carefully cuts off the agar sugar that contains DNA, put into the centrifuge tube of 1.5ml.
(2) ratio in every 100mg agarose/300 μ l sol solutionses adds colloidal sol buffer, and 50 ℃ of water-bath 10min make the agarose off-bottom, and every 2min puts upside down once.
(3) the agar liquid glucose after will dissolving moves into adsorption column, and the centrifugal 30s of 10000rpm outwells the liquid in the collection tube, adsorption column is put into same collection tube again.
(4) in adsorption column, add 500 μ l washingss, leave standstill the centrifugal 15s of 10000rpm behind the 1min, outwell the liquid in the collection tube, adsorption column is put into same collection tube.
(5) repeat the 4th operation that goes on foot.
(6) the centrifugal 1min of 10000rpm.
(7) adsorption column is put into the centrifuge tube of a clean 1.5ml, central authorities add 30 μ l elutriants at adsorption film, leave standstill 1min after, the centrifugal 1min of 10000rpm.
(8) will reclaim in product is stored in-20 ℃ after agarose gel electrophoresis detects the refrigerator stand-by.
4.2 transform:
It is as follows to be connected to T carrier reaction system behind amplified production recovery and the purifying:
T carrier 1 μ l (about 50ng)
10 * ligase enzyme damping fluid, 2 μ l
T4DNA ligase enzyme 350U
Reclaim the PCR product and add to end reaction volume 20 μ l
16 ℃ of connections are spent the night
Transformed into escherichia coli DH10B
The preparation of competent cell
(1) be taken at well-grown single DH10B bacterium colony on the antibiotic-free flat board, be inoculated in the 2 μ l LB liquid nutrient mediums, 37 ℃ of shaken overnight are cultivated.
(2) get bacterium liquid that 500 μ l activation spends the night in 50ml LB liquid nutrient medium, 37 ℃ of shaking culture are to OD600=0.3
(3) bacterium liquid is poured in the 50ml centrifuge tube, ice bath is placed 10min.
(4) in being chilled to 4 ℃ whizzer in advance, remove supernatant liquor behind the centrifugal 10min of 4000rpm, collect thalline.
(5) add the ice-cold 0.1M CaCl2 of 20ml in centrifuge tube, behind the thalline that evenly suspends, 30min in the ice bath.
Under (6) 4 ℃, remove supernatant liquor behind the centrifugal 10min of 4000rpm, collect thalline, add the ice-cold 0.1M CaCl2 solution of 2ml and evenly suspend behind the thalline, it is stand-by to put into ice.
Thermal shock transforms and the screening of blue hickie
(1) will connect product and add in the 200 μ l competent cells, fully mixing places 30min on ice.
(2) 42 ℃ of thermal shock 2min 30s, adding is preheated to 37 ℃ LB liquid nutrient medium 400 μ l behind the ice bath 1min.
(3) 37 ℃ of low speed (100rpm) shaking culture 40min.
(4) add 200 μ l bacterium liquid on each contains the LB solid medium flat board of penbritin (50 μ g/ml), the X-gal 40 μ l of 0.1M IPTG 4 μ l and 20mg/ml evenly are applied on the flat board.
Incubated overnight in (5) 37 ℃ of incubators.
4.3 positive colony screening:
Well-grown white, blue look list bacterium colony are rule on the LB solid medium flat board that contains penbritin (50 μ g/ml) on the culture plate of picking overnight incubation, enlarged culturing (37 ℃ of overnight incubation).
Picking a small amount of day shift of bacterium colony carries out pcr amplification, the same 2.2.2 of amplification the primer, and PCR reaction cumulative volume is 25 μ l, wherein contain 10 * ExTaq PCR buffer, 2.5 μ l, 1.5mmol/L MgCl2,4 kinds of each 200 μ mol/L of dNTP, each 150ng of primer, 1U ExTaq enzyme, a little hickie thalline.
4.4 sequential analysis:
Utilize analysis softwares such as blast in the NCBI network address and DNAman4.0 to carry out dna sequence dna splicing, Nucleotide and amino acid sequence analysis.In conjunction with former supressor gene order, the accuracy of checking Auele Specific Primer.
Embodiment 2,
1, with the 1st step of embodiment 1.
2, design of primers:
According to DNAMAN software sequences comparison result, at coding region 47bp place according to locus specificity, the special primer in this site of specific amplified.This primer is specific as follows:
F47:R holds primer: 5 ' ACTCATTT/CGCTTGACTAGGC 3 '
F holds primer: 5 ' AGTACARCGCATGGAGTGG 3 '
F47: length 19bp, GC content 52.6%, molecular weight 5.94kDa, Tm 56.7 degree
3. gene amplification:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 57 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
4, with the 4th step of embodiment 1.
Embodiment 3,
1, with the 1st step of embodiment 1.
2, design of primers:
According to DNAMAN software sequences comparison result, at coding region 125bp place according to locus specificity, the special primer in this site of specific amplified.This primer is specific as follows:
F125:R holds primer: 5 ' ACTCATTT/CGCTTGACTAGGC 3 '
F holds primer: 5 ' CTGTCGTCCATTGCTTAG 3 '
F125: length 18bp, GC content 50.0%, molecular weight 5.50kDa, Tm 51.9 degree
3. gene amplification:
The PCR reaction system is that to add to total amount be 5O μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmo/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 62.5 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
4, with the 4th step of embodiment 1.
Embodiment 4,
1, with the 1st step of embodiment 1.
2, design of primers:
According to DNAMAN software sequences comparison result, at coding region 276bp place according to locus specificity, the special primer in this site of specific amplified.This primer is specific as follows:
F276:R holds primer: 5 ' ACTCATTT/CGCTTGACTAGGC 3 '
F holds primer: 5 ' GCGTGTCGGAGGGACAGTCA 3 '
F276: length 20bp, GC content 65.0%, molecular weight 6.26kDa, Tm 63.5 degree
3. gene amplification:
The PCR reaction system is that to add to total amount be 50 μ l for 5 μ L10 * PCR buffer, 1.5U Ex TaqTM archaeal dna polymerase, 2mmol/LMgCl2,0.2mmol/L dNTP, each 150ng of primer, 100ng template DNA, distilled water.The PCR response procedures is 94 ℃ of pre-sex change 4min; 94 ℃ of sex change 45s, 60 ℃ of annealing 45s, 72 ℃ of extensions 1min, totally 35 circulations; 72 ℃ are extended 5min.
4, with the 4th step of embodiment 1.
Claims (2)
1, a kind of artificial design synthetic nucleic acid molecule is characterized in that, wheat alpha-amylase supressor encoding gene 19bp, 47bp, 125bp, 276bp place be respectively according to locus specificity, 4 special primers in one of them site of specific amplified.This primer has the oligomer of the particular sequence of following based composition:
(1) R end primer: 5 ' ACTCATTT/CGCTTGACTAGGC3 '
F holds primer: 5 ' ATGCTCGTGGCGACACTCG3 '
Or (2) R end primer: 5 ' ACTCATTT/CGCTTGACTAGGC3 '
F holds primer: 5 ' AGTACARCGCATGGAGTGG3 '
Or (3) R end primer: 5 ' ACTCATTT/CGCTTGACTAGGC3 '
F holds primer: 5 ' CTGTCGTCCATTGCTTAG3 '
Or (4) R end primer: 5 ' ACTCATTT/CGCTTGACTAGGC3 '
F holds primer: 5 ' GCGTGTCGGAGGGACAGTCA 3 '
2, a kind of molecule marking method of wheat alpha-amylase supressor encoding gene, comprise the checking of extracting genome DNA, design of primers, gene amplification, specific fragment, it is characterized in that, be primer with the described nucleic acid molecule of claim 1, the exploitation specific molecular marker.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100224991A CN1974592A (en) | 2006-12-14 | 2006-12-14 | Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNA2006100224991A CN1974592A (en) | 2006-12-14 | 2006-12-14 | Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1974592A true CN1974592A (en) | 2007-06-06 |
Family
ID=38124978
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNA2006100224991A Pending CN1974592A (en) | 2006-12-14 | 2006-12-14 | Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1974592A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565751B (en) * | 2009-06-01 | 2012-02-08 | 四川农业大学 | Development of wide stress protein family gene specific molecular marker and application thereof |
-
2006
- 2006-12-14 CN CNA2006100224991A patent/CN1974592A/en active Pending
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101565751B (en) * | 2009-06-01 | 2012-02-08 | 四川农业大学 | Development of wide stress protein family gene specific molecular marker and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109182586B (en) | KASP primer group for wheat scab resistance detection and application thereof | |
| CN102234651A (en) | Nucleotide sequence of gene for resistance to Cereal cyst nematode, Heterodera avenae and application thereof | |
| Mirghasempour et al. | Identification and characterization of Fusarium nirenbergiae associated with saffron corm rot disease | |
| CN104046636A (en) | Codon vegetalization-transformed PMI gene and applications thereof | |
| CN1291021C (en) | Use of boea crassifolia BcBCP1 gene for breeding drought-salt-tolerant plants | |
| CN1223606C (en) | Rice DREB transcription factor and its encoding gene and use | |
| CN1699573A (en) | V. alginolyticus outer-membrane protein W gene, process for preparing the same and uses thereof | |
| CN1775797A (en) | Boea clarkeane drought-resistant and salt-tolerance related gene and its coding protein and use | |
| CN1313614C (en) | Glyphosate acetyl transferase gene and its application | |
| CN1974592A (en) | Specific molecular marker of wild emmer alpha-amylase inhabiting factor and its utilization | |
| CN1216906C (en) | Transcription factor capable of regulating and controlling soybean adverse resistance, its coding gene and application | |
| CN1810976A (en) | Pesticidal gene and its use | |
| CN1908011A (en) | Plant inverse-resistant zinc finger protein, coding gene and application thereof | |
| CN1831008A (en) | Rice blast fungus non-toxin gene Avr-pii and its application | |
| CN1974772A (en) | Sea island cotton receptor analogous protein kinase gene and its application | |
| CN1294258C (en) | Method for separating antibiotic peptide and separated antibiotic peptide | |
| CN104694566B (en) | RNAi carrier and its application of HaAK genes dsRNA are expressed in transfer-gen plant | |
| CN1454989A (en) | Yeast genetically engineered strain expressing hrp gene and constructing method thereof | |
| CN102373223A (en) | Nucleotide sequence of LEA3 (Late Embryogenesis Abundant 3) protein coding gene from drought-resistant H.vulgare ssp.vulgare and application thereof | |
| CN1262657C (en) | Method for producing human leukemia inhibitory factor using transgenic plant | |
| CN1772904A (en) | Galactinol synthetase gene of Boga crassifolia Hemsl and its coded protein and application | |
| CN1166775C (en) | Application of transgene paddy rice endosperm in genetics demonstration experiment | |
| CN110922463B (en) | Rice disease-resistant gene RGA5-HMA5 and application thereof in rice breeding | |
| CN1059236C (en) | High-efficiency conversion system of kluyveromyces fragilis yeast | |
| CN1769443A (en) | Method for cloning close plant favorable gene utilizing whole genome knock-in mutant library |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |