CN1970574A - Double function infusion protein for thrombolysis and anticoagulation , its preparation method and uses - Google Patents

Abstract

The invention discloses a fusing protein with plasminokin and anticoagulant function and DNA sequence to code the fusing protein, carrier with the DNA sequence and making method of fusing protein, which provides the application of fusing protein to prepare functional drug with peptide segment of continuous amino acid sequence as connecting structure, wherein the fusing protein connects 10-12 amino acids in the 55-66th amino acids sequence at IIIC end of hirudin with r-PA as t-PA bobbing mutant.

Description

Thrombolysis and anti-freezing double effects fusion rotein, preparation method and application thereof

Technical field

The present invention relates to a kind of fusion rotein that obtains with the DNA recombination form with thrombolysis and anti-freezing double effects, the encode dna sequence dna of this fusion rotein, the carrier that contains this dna sequence dna, the preparation method of this fusion rotein, this fusion rotein has application aspect thrombolysis and the anti-freezing effect medicine in preparation, and the peptide section of being made up of continuous glycine sequence is as the application of syndeton in preparation thrombolysis and anti-freezing double effects fusion rotein.

Background technology

Thrombolytic drug and anticoagulant are the medicines of present two classes treatment thrombotic diseases.

As the first-generation thrombolytic drug staphylokinase (SAK), streptokinase (SK), urokinase (UK) etc. are arranged.Containing 527 amino acid whose people's tissue fibers dissolved preferment activators (t-PA) is s-generation thrombolytic drug, have the high characteristics of thrombus specificity, its nucleotide sequence is referring to the NM_033011 among the GENEBANK, have thrombus specificity height, administration has advantages such as tangible effect to the perfusion again that recovers occluding vascular in the short period of time of paresthesia epilepsy.But shortcoming is that the transformation period is shorter, and a large amount of administrations of short period of time domestic demand have potentially to cause the danger of intracranialing hemorrhage, and cost an arm and a leg.For overcoming these shortcomings, the reteplase (r-PA) of having researched and developed at present the truncated mutant that belongs to t-PA is a third generation thrombolytics, contain 355 in 527 amino acid of t-PA, strand, non-glycosylated, have better efficacy and side effect less than preceding two generation medicine advantage, be comparatively ideal a kind of thrombolytic drug in the present clinical application.

Leech is the medicine that activates blood circulation and disperses blood clots in traditional Chinese materia medica.R-hirudin (hirudin) is its main effective constituent, and its aminoacid sequence can be the Chinese patent literature of CN 1319671A referring to NO.P09944 among the GENEBANK and publication number, is the single chain polypeptide of being made up of 65-66 amino acid.Research is at present confirmed, the segment of the maintenance anticoagulating active of r-hirudin minimum is 10-12 the amino acid whose peptide section of its acidic terminal (C end), be minimum peptide section wherein with maximum activity with 12 peptides, the activity of energy specificity, high-affinity ground Trombin inhibiting, be to act on the strongest specific coagulation enzyme inhibitors so far, have very strong anti-freezing, anti-thrombus activity, its antithrombotic property is better than heparin, and multiple thrombus disease is had prevention and result of treatment.Obtaining the progress that attracts people's attention aspect the employing gene recombination technology development r-hirudin at present.

Comprising as embolism again for solving thrombolytics at present commonly used, the deficiency of aspect such as hemorrhage side effect and anti reperfusion, further improve its target, improve it at the drug level at thrombus position and be reduced in the concentration or the activity at non-thrombus position, reported a kind of by can be in the documents such as CN 1480466A and WO 2004/022598 by thrombin FXa (or FII the aminoacid sequence IEGR or the GPR that a) discern, perhaps contain these amino acid whose peptide sections as connection peptides, with thrombolysis albumen (SAK, SK, UK or t-PA etc.) and anticoagulant protein (r-hirudin, Antithrombin III or snake venom etc.) fusion rotein that is formed by connecting, make it can have thrombolysis and anti-freezing dual-use function.But its mechanism of action and process are must rely on to enter in the body back and discerned by thrombin and it is hydrolyzed into two floating preteinses, and its bifunctional activity of competence exertion is at external then non-activity.Owing to have many interference components in the body, can such fusion rotein on earth by correct identification of thrombin and the degree that can be identified, therefore it is hydrolyzed in two protein process and has many uncertain factors, has caused the disadvantageous effect to its stable curative effect.

Summary of the invention

In view of the foregoing, the present invention's purpose at first is to propose a kind of fusion rotein with thrombolysis and anti-freezing double effects on this basis.Further aim of the present invention also comprises respectively: provide described this of coding to have the dna sequence dna of thrombolysis and anti-freezing double effects fusion rotein; The carrier that contains this dna sequence dna is provided; The preparation method of described this fusion rotein is provided; Provide described this fusion rotein to have application aspect thrombolysis and the anti-freezing effect medicine in preparation; And provide the peptide section of forming by continuous glycine sequence as the application of syndeton in preparation thrombolysis and anti-freezing double effects fusion rotein.

The present invention has the fusion rotein (HrP) of thrombolysis and anti-freezing double effects, have 10～12 amino acid peptide sections in the 55-66 amino acids sequence of sequence shown in SEQ IDNO.3 by r-hirudin III C end, with have shown in SEQ IDNO.6 aminoacid sequence, belong to the r-PA (reteplase) of t-PA truncated mutant, be formed by connecting through connection peptides.

In above-mentioned thrombolysis and anti-freezing double effects fusion rotein, one of said connection peptides can be a successive 3-5 glycine sequence, for example is 3 glycine tripeptide sequences of successive a connection peptides that adopts in can the embodiment of reference.

Because it is the minimum peptide section with maximum activity with 12 peptides in pulsating its acidic terminal (C end) 10-12 amino acid whose peptide section of the maintenance anticoagulating active of r-hirudin minimum that research has at present been confirmed.Therefore, in the structure of above-mentioned thrombolysis of the present invention and anti-freezing double effects fusion rotein, though said this r-hirudin III C end peptide section can be 10 peptides or 11 peptides in this 10-12 the amino acid peptide section, but 12 peptide sequences with the 55-66 position in sequence shown in the SEQ ID NO.3 are good, and said this fusion rotein of the present invention's this moment has the aminoacid sequence shown in SEQ ID NO.9.

Content of the present invention also comprises a kind of isolated DNA molecule, its aforesaid fusion rotein with thrombolysis and anti-freezing double effects of encoding.Nucleotide sequence with dna molecular of the above-mentioned fusion rotein with thrombolysis and anti-freezing double effects of code book invention can be a kind of incessantly, the dna molecular that for example has nucleotide sequence shown in SEQ ID NO.7, be exactly wherein can be for reference an example, by the fusion rotein aminoacid sequence of the present invention of its coding shown in SEQ IDNO.8.Except that the dna molecular of nucleotide sequence shown in the SEQ ID NO.7, for example, the Nucleotide of Serine correspondence wherein can also be tcc, tca, tcg except tct; The Nucleotide of tyrosine correspondence wherein can also be tat except tac, equally can the said fusion rotein with thrombolysis and anti-freezing double effects of code book invention.

On this basis, the present invention comprises that also other the corresponding nucleotides sequence that reaches that contains just like shown in the SEQ ID NO.7 is listed in carrier and the corresponding host cell that contains these carriers that interior energy code book is invented the dna molecular of the fusion rotein with thrombolysis and anti-freezing double effects, for example, when adopting the pET system, can be connected with carriers such as pET-21a, pET-28a with anti-freezing double effects fusion rotein (HrP) gene obtaining described thrombolysis, change in BL21 (DE3), the HMS174 intestinal bacteria such as (DE3) and express.

Above-mentioned preparation method with thrombolysis and anti-freezing double effects fusion rotein of the present invention can comprise following operation steps:

1 ': the primer of design 10～12 peptide sequences of amplification r-hirudin IIIC end on the r-PA basis;

2 ': by twice add-on PCR, amplify 10～12 peptide sequences of connection peptides sequence and r-hirudin IIIC end, obtain purpose HrP gene at the r-PA upstream region of gene;

3 ': make up the pET21a-HrP expression vector;

4 ': transformed into escherichia coli, set up engineering bacteria;

5 ': preparation HrP fusion rotein; And

Further also can determine the biological activity of this fusion rotein of gained.

The above-mentioned application with thrombolysis and anti-freezing double effects fusion rotein of the present invention comprises the relative medicine that acceptable ancillary component co-production in this fusion rotein and the medicine is become to have thrombolysis and anti-freezing double effects, is used for the treatment to thrombotic diseases.Because fusion rotein of the present invention is the structure of modification that is based upon on the third generation thrombolytics r-PA basis, thereby fusion rotein of the present invention can have with r-PA and than first and second thrombolytics medicine before t-PA, staphylokinase, the urokinase etc. arranged in generation the longer effect transformation period, make things convenient for the patient to use, and more highly selective act on same characteristics such as thrombus position and systemic bleeding side effect be little.Test shows that the effect of this fusion rotein of the present invention aspect thrombolysis and anti-freezing is more sure reliably, and its tool than small molecular weight, can help reducing antigenic side effect and influence, then one of its significant advantage especially.

Below in conjunction with embodiment, foregoing of the present invention is described in further detail again by the accompanying drawing illustrated embodiment.But this should be interpreted as that the scope of the above-mentioned theme of the present invention only limits to following example.Do not breaking away under the above-mentioned technological thought situation of the present invention, various replacements or change according to ordinary skill knowledge and customary means are made all should comprise within the scope of the invention.The experimental technique of unreceipted actual conditions in an embodiment wherein can be according to common condition, for example can be with reference to the corresponding conditions of people such as Sambrook in " molecular cloning guide (Science Press (2002) ", or the condition of advising according to manufacturer.

Description of drawings

Fig. 1 is the design of graphics of recombinant plasmid pET21a-HrP

Fig. 2 is the proteic electrophoresis evaluation of HrP/BL21 engineering bacterium expression figure.Indicate among the figure and be respectively: the 1:BL21 bacterial protein; 2:HrP/BL21 (DE3) does not induce; 3: lower molecular weight standard protein Marker (being followed successively by 14400,20100,31000,43000,66200,97400 from small to large): 4:HrP/BL21 (DE3) induces 4h; 5:pET21a/BL21 (DE3) induces 4h.

Fig. 3 is the electrophoresis evaluation figure of HrP/BL21 engineering bacteria protein expression form.Indicate among the figure and be respectively: 1: low molecular weight protein (LMWP) Marker (being followed successively by 14400,20100,31000,43000,66200,97400 from small to large): 2:HrP/BL21 (DE3) engineering bacteria abduction delivering bacterial protein; Supernatant liquor after the ultrasonication of 3:HrP/BL21 (DE3) engineering bacteria; Precipitation after the ultrasonication of 4:HrP/BL21 (DE3) engineering bacteria.

Fig. 4 is the lithograph of fusion protein sample thrombolysis circle test-results of the present invention.Sign 1,2,3,4,6 among the figure is respectively urokinase 5,40,10,20,80 IU/ml; Indicate 5,7 and be respectively the test solution of 4 times of fusion protein sample dilutions of the present invention and the test solution of sample original content.

Embodiment

Embodiment 1

One, obtains target gene sequences by PCR

As shown in Figure 1, according to known gene order, (the J1 plasmid among Fig. 1 contains just like the r-PA gene shown in the SEQ ID NO.4 at the r-PA gene to use the add-on PCR method, its amino acid sequence coded is respectively shown in SEQ ID NO.5 and SEQ ID NO.6) 5 ' end add 12 peptides (55～66) of reorganization r-hirudin HV3 and the gene of GlyGlyGly connection peptides, but owing to add terminal sequence two greater than 60bp, may cause the inaccurate of PCR result, thus PCR at twice, in the hope of improving the accuracy of PCR.

1. first round PCR

With the r-PA plasmid is template, is primer with primer 1,2, and TaqDNA polysaccharase catalysis amplification obtains first round PCR product P 1.

Primer 1 (SEQ ID NO.10):

GGAGACGCGTACGATGAA GGTGGTGGTTCTTACCAAGGAAACAGTGAC

Wherein line part is the connection peptides sequence of three glycine.

Primer 2 (SEQ ID NO.11):

GC AAGCTTTTACTACGGTCGCATGTTGTCACGAATCCAGTCTAGGTAG

Wherein line part is the restriction enzyme site of HindIII.

Second takes turns PCR

With P1 is template, is primer with primer 2,3, and TaqDNA polysaccharase catalysis amplification obtains second and takes turns PCR product P 2.

Primer 3 (SEQ ID NO.12):

G GACTTCGAACCGATCCCGGAAGACGCGTACGATGAAGG

Wherein dash area is the restriction enzyme site of NheI.The line part is nucleotide sequence (the corresponding nucleotide sequence in r-hirudin III1-198 position such as the SEQ ID NO.1 of r-hirudin III12 peptide, shown in SEQID NO.2 and SEQ ID NO.3, this 12 peptide of being sloughed off is a 55-66 amino acids wherein to the 1-66 amino acids sequence of coding respectively).

Primer 2 (SEQ ID NO.11):

GC

TTACTACGGTCGCATGTTGTCACGAATCCAGTCTAGGTAG

Wherein dash area is the restriction enzyme site of HindIII.

Above-mentioned two-wheeled pcr amplification condition is:

94℃?5min

94℃1min，63℃?1min，72℃?1min?30sec，28?Cycles

72℃?10min

4℃?∞，Hold。

Two, the structure of pET21a-HrP expression vector

Take turns PCR product P 2 with second and carry out HindIII and NheI double digestion, same pET21a carrier also carries out HindIII and NheI double digestion, both double digestion product is connected with the T4DNA ligase enzyme at 16 ℃ spend the night.To connect product transformed competence colibacillus DH5 α bacterium.Screening positive clone is served extra large English fine horse (invitrogen) Bioisystech Co., Ltd and is checked order after nucleic acid electrophoresis and PCR checking correctly, comprise the nucleotide sequence shown in the SEQ NO.7 in the sequencing result.The result is correct, and expression plasmid transformed competence colibacillus BL21 (DE3) bacterium is extracted in the back.

Three, the abduction delivering in the intestinal bacteria

Inoculation pET21a-HrP/BL21 bacterium is in LB, and 37 ℃ of joltings are spent the night, and the inoculum size with 1% is inoculated in shakes in the bottle, and 37 ℃ of jolting 3h add IPTG (final concentration is 1mM) and continue to induce 4h, receive bacterium.8000r/min, 3min, 4 ℃ of frozen centrifugations, the precipitation thalline is washed with cold PBS, and thalline is resuspended in the 50mM Tris-HCl pH8.0 damping fluid, and ice-bath ultrasonic is broken bacterium, obtains precipitating inclusion body.Bacterial protein and inclusion body are identified by the 12%SDS-PAGE electrophoresis.As seen near the bacterial protein 40KDa place target protein band is arranged, as shown in Figure 2.Through after the carrying out ultrasonic bacteria breaking, target protein exists with the inclusion body form entirely, there is no the purpose band in the supernatant liquor, as shown in Figure 3.

Four, the biological activity assay of fusion rotein

1. the mensuration of anticoagulating active:

In the enzyme plate aperture, add 200 μ l, 0.5% ox blood Fibrinogen (0.05mol/LTris-HCl damping fluid (pH7.4) preparation), add the protein solution of 10～100 μ l again, fully mixing through preliminary renaturation.Draw the thrombin solution (100NIH unit) of standard with microsyringe, the timed interval is 1min, if solidify in that the 1min inner fibrin is former, i.e. and the bright titration end point that reached of institute.A zymoplasm unit of every consumption (NIH) is equivalent to an anti-freezing unit (ATU).

2. fibrinolytic is measured: adopt scleroproein-agarose plate assay method.

Preparation is dull and stereotyped to be PBS (pH7.4) with solution.In the adherent adding of the thrombin solution of 1BP unit/ml 10ml fibrinogen (5mg/ml) solution, quick mixing, impouring is to melting fully and having reduced in 45 ℃ the 10ml agarose solution (1.0%) mixing, pour in the plate of diameter 90mm, solidify the back punching and use.Draw the urokinase standard substance of different specific activities respectively, drip in the hole, in 37 ℃ of incubation 12h.Thrombolysis circle treadmill test result as shown in Figure 4.

Through detecting separately, the thrombolysis of the above-mentioned fusion rotein of the present invention reaches 8400.5 IU/mg than living, and anti-freezing reaches 930.2 ATU/mg than living, and shows that this fusion rotein of the present invention has the double activity of thrombolysis and anti-freezing.

The preparation and the biological activity assay of the fusion rotein of embodiment 2 r-hirudins, 11 peptides and r-PA

Primary process such as above-mentioned embodiment 1, except that wherein second take turns PCR and embodiment 1 different, all the other operations and condition are all with embodiment 1.

With P1 is template, is primer with primer 4,5, and TaqDNA polysaccharase catalysis amplification obtains second and takes turns PCR product P 2.

Primer 4:(SEQ ID NO.13)

GGCTAGC TTCGAACCGATCCCGGAAGACGCGTACGATGAAGG

Wherein black matrix is the restriction enzyme site of NheI.The line part is the nucleotide sequence of r-hirudin III12 peptide.

Primer 5:(SEQ ID NO.14)

GC

TTACTACGGTCGCATGTTGTCACGAATCCAGTCT

Wherein dash area is the restriction enzyme site of HindIII.

The preparation and the biological activity assay of the fusion rotein of embodiment 3 r-hirudins, 10 peptides and r-PA

Primary process such as above-mentioned embodiment 1, except that wherein second take turns PCR and embodiment 1 different, all the other operations and condition are all with embodiment 1.

With P1 is template, is primer with primer 6,5, and TaqDNA polysaccharase catalysis amplification obtains second and takes turns PCR product P 2.

Primer 6:(SEQ ID NO.15)

GGCTAGC GAACCGATCCCGGAAGACGCGTACGATGAAGG

Wherein black matrix is the restriction enzyme site of NheI.The line part is the nucleotide sequence of r-hirudin III12 peptide.

Primer 5:(SEQ ID NO.14)

GC

TTACTACGGTCGCATGTTGTCACGAATCCAGTCT

Wherein dash area is the restriction enzyme site of HindIII.

The explanation of sequence table numbering:

SEQ ID NO.1-3 r-hirudin III coding nucleotide sequence and corresponding proteins matter aminoacid sequence

SEQ ID NO.4-6 r-PA coding nucleotide sequence and corresponding proteins matter aminoacid sequence

SEQ ID NO.7-9 HrP fusion rotein coding nucleotide sequence and corresponding proteins matter aminoacid sequence

The nucleotide sequence of SEQ ID NO.10-15 primer 1～primer 6

Sequence table

＜110〉China Medicine University

＜120〉thrombolysis and anti-freezing double effects fusion rotein, preparation method and application thereof

<130>001

<160>15

<170>PatentIn?version?3.1

<210>1

<211>198

<212>DNA

<213>Hirudo?medicinalis

<400>1

atcacctaca?ctgactgcac?cgaatctggt?cagaacctgt?gcctgtgcga?aggttctaac 60

gtttgcggta?agggaaacaa?atgcatcctg?ggttctcaag?gtaaggacaa?ccagtgcgtt 120

actggtgaag?gtactccgaa?accgcagtct?cacaaccagg?gtgacttcga?accgatcccg 180

gaagacgcgt?acgatgaa 198

<210>2

<211>198

<212>DNA

<213>Hirudo?medicinalis

<220>

<221>CDS

<222>(1)..(198)

<223>

<400>2

atc?acc?tac?act?gac?tgc?acc?gaa?tct?ggt?cag?aac?ctg?tgc?ctg?tgc 48

Ile?Thr?Tyr?Thr?Asp?Cys?Thr?Glu?Ser?Gly?Gln?Asn?Leu?Cys?Leu?Cys

1 5 10 15

gaa?ggt?tct?aac?gtt?tgc?ggt?aag?gga?aac?aaa?tgc?atc?ctg?ggt?tct 96

Glu?Gly?Ser?Asn?Val?Cys?Gly?Lys?Gly?Asn?Lys?Cys?Ile?Leu?Gly?Ser

20 25 30

caa?ggt?aag?gac?aac?cag?tgc?gtt?act?ggt?gaa?ggt?act?ccg?aaa?ccg 144

Gln?Gly?Lys?Asp?Asn?Gln?Cys?Val?Thr?Gly?Glu?Gly?Thr?Pro?Lys?Pro

35 40 45

cag?tct?cac?aac?cag?ggt?gac?ttc?gaa?ccg?atc?ccg?gaa?gac?gcg?tac 192

Gln?Ser?His?Asn?Gln?Gly?Asp?Phe?Glu?Pro?Ile?Pro?Glu?Asp?Ala?Tyr

50 55 60

gat?gaa 198

Asp?Glu

65

<210>3

<211>66

<212>PRT

<213>Hirudo?medicinalis

<400>3

Ile?Thr?Tyr?Thr?Asp?Cys?Thr?Glu?Ser?Gly?Gln?Asn?Leu?Cys?Leu?Cys

1 5 10 15

Glu?Gly?Ser?Asn?Val?Cys?Gly?Lys?Gly?Asn?Lys?Cys?Ile?Leu?Gly?Ser

20 25 30

Gln?Gly?Lys?Asp?Asn?Gln?Cys?Val?Thr?Gly?Glu?Gly?Thr?Pro?Lys?Pro

35 40 45

Gln?Ser?His?Asn?Gln?Gly?Asp?Phe?Glu?Pro?Ile?Pro?Glu?Asp?Ala?Tyr

50 55 60

Asp?Glu

65

<210>4

<211>1065

<212>DNA

<213>Homo?sapiens

<400>4

tcttaccaag?gaaacagtga?ctgctacttt?gggaatgggt?cagcctaccg?tggcacgcac 60

agcctcaccg?agtcgggtgc?ctcctgcctc?ccgtggaatt?ccatgatcct?gataggcaag 120

gtttacacag?cacagaaccc?cagtgcccag?gcactgggcc?tgggcaaaca?taattactgc 180

cggaatcctg?atggggatgc?caagccctgg?tgccacgtgc?tgaagaaccg?caggctgacg 240

tgggagtact?gtgatgtgcc?ctcctgctcc?acctgcggcc?tgagacagta?cagccagcct 300

cagtttcgca?tcaaaggagg?gctcttcgcc?gacatcgcct?cccacccctg?gcaggctgcc 360

atctttgcca?agcacaggag?gtcgcccgga?gagcggttcc?tgtgcggggg?catactcatc 420

agctcctgct?ggattctctc?tgccgcccac?tgcttccagg?agaggtttcc?gccccaccac 480

ctgacggtga?tcttgggcag?aacataccgg?gtggtccctg?gcgaggagga?gcagaaattt 540

gaagtcgaaa?aatacattgt?ccataaggaa?ttcgatgatg?acacttacga?caatgacatt 600

gcgctgctgc?agctgaaatc?ggattcgtcc?cgctgtgccc?aggagagcag?cgtggtccgc 660

actgtgtgcc?ttcccccggc?ggacctgcag?ctgccggact?ggacggagtg?tgagctctcc 720

ggctacggca?agcatgaggc?cttgtctcct?ttctattcgg?agcggctgaa?ggaggctcat 780

gtcagactgt?acccatccag?ccgctgcaca?tcacaacatt?tacttaacag?aacagtcacc 840

gacaacatgc?tgtgtgctgg?agacactcgg?agcggcgggc?cccaggcaaa?cttgcacgac 900

gcctgccagg?gcgattcggg?aggccccctg?gtgtgtctga?acgatggccg?catgactttg 960

gtgggcatca?tcagctgggg?cctgggctgt?ggacagaagg?atgtcccggg?tgtgtacacc 1020

aaggttacca?actacctaga?ctggattcgt?gacaacatgc?gaccg 1065

<210>5

<211>1065

<212>DNA

<213>Homo?sapiens

<220>

<221>CDS

<222>(1)..(1065)

<223>

<400>5

tct?tac?caa?gga?aac?agt?gac?tgc?tac?ttt?ggg?aat?ggg?tca?gcc?tac 48

Ser?Tyr?Gln?Gly?Asn?Ser?Asp?Cys?Tyr?Phe?Gly?Asn?Gly?Ser?Ala?Tyr

1 5 10 15

cgt?ggc?acg?cac?agc?ctc?acc?gag?tcg?ggt?gcc?tcc?tgc?ctc?ccg?tgg 96

Arg?Gly?Thr?His?Ser?Leu?Thr?Glu?Ser?Gly?Ala?Ser?Cys?Leu?Pro?Trp

20 25 30

aat?tcc?atg?atc?ctg?ata?ggc?aag?gtt?tac?aca?gca?cag?aac?ccc?agt 144

Asn?Ser?Met?Ile?Leu?Ile?Gly?Lys?Val?Tyr?Thr?Ala?Gln?Asn?Pro?Ser

35 40 45

gcc?cag?gca?ctg?ggc?ctg?ggc?aaa?cat?aat?tac?tgc?cgg?aat?cct?gat 192

Ala?Gln?Ala?Leu?Gly?Leu?Gly?Lys?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asp

50 55 60

ggg?gat?gcc?aag?ccc?tgg?tgc?cac?gtg?ctg?aag?aac?cgc?agg?ctg?acg 240

Gly?Asp?Ala?Lys?Pro?Trp?Cys?His?Val?Leu?Lys?Asn?Arg?Arg?Leu?Thr

65 70 75 80

tgg?gag?tac?tgt?gat?gtg?ccc?tcc?tgc?tcc?acc?tgc?ggc?ctg?aga?cag 288

Trp?Glu?Tyr?Cys?Asp?Val?Pro?Ser?Cys?Ser?Thr?Cys?Gly?Leu?Arg?Gln

85 90 95

tac?agc?cag?cct?cag?ttt?cgc?atc?aaa?gga?ggg?ctc?ttc?gcc?gac?atc 336

Tyr?Ser?Gln?Pro?Gln?Phe?Arg?Ile?Lys?Gly?Gly?Leu?Phe?Ala?Asp?Ile

100 105 110

gcc?tcc?cac?ccc?tgg?cag?gct?gcc?atc?ttt?gcc?aag?cac?agg?agg?tcg 384

Ala?Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Lys?His?Arg?Arg?Ser

115 120 125

ccc?gga?gag?cgg?ttc?ctg?tgc?ggg?ggc?ata?ctc?atc?agc?tcc?tgc?tgg 432

Pro?Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu?Ile?Ser?Ser?Cys?Trp

130 135 140

att?ctc?tct?gcc?gcc?cac?tgc?ttc?cag?gag?agg?ttt?ccg?ccc?cac?cac 480

Ile?Leu?Ser?Ala?Ala?His?Cys?Phe?Gln?Glu?Arg?Phe?Pro?Pro?His?His

145 150 155 160

ctg?acg?gtg?atc?ttg?ggc?aga?aca?tac?cgg?gtg?gtc?cct?ggc?gag?gag 528

Leu?Thr?Val?Ile?Leu?Gly?Arg?Thr?Tyr?Arg?Val?Val?Pro?Gly?Glu?Glu

165 170 175

gag?cag?aaa?ttt?gaa?gtc?gaa?aaa?tac?att?gtc?cat?aag?gaa?ttc?gat 576

Glu?Gln?Lys?Phe?Glu?Val?Glu?Lys?Tyr?Ile?Val?His?Lys?Glu?Phe?Asp

180 185 190

gat?gac?act?tac?gac?aat?gac?att?gcg?ctg?ctg?cag?ctg?aaa?tcg?gat 624

Asp?Asp?Thr?Tyr?Asp?Asn?Asp?Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser?Asp

195 200 205

tcg?tcc?cgc?tgt?gcc?cag?gag?agc?agc?gtg?gtc?cgc?act?gtg?tgc?ctt 672

Ser?Ser?Arg?Cys?Ala?Gln?Glu?Ser?Ser?Val?Val?Arg?Thr?Val?Cys?Leu

210 215 220

ccc?ccg?gcg?gac?ctg?cag?ctg?ccg?gac?tgg?acg?gag?tgt?gag?ctc?tcc 720

Pro?Pro?Ala?Asp?Leu?Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu?Ser

225 230 235 240

ggc?tac?ggc?aag?cat?gag?gcc?ttg?tct?cct?ttc?tat?tcg?gag?cgg?ctg 768

Gly?Tyr?Gly?Lys?His?Glu?Ala?Leu?Ser?Pro?Phe?Tyr?Ser?Glu?Arg?Leu

245 250 255

aag?gag?gct?cat?gtc?aga?ctg?tac?cca?tcc?agc?cgc?tgc?aca?tca?caa 816

Lys?Glu?Ala?His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Thr?Ser?Gln

260 265 270

cat?tta?ctt?aac?aga?aca?gtc?acc?gac?aac?atg?ctg?tgt?gct?gga?gac 864

His?Leu?Leu?Asn?Arg?Thr?Val?Thr?Asp?Asn?Met?Leu?Cys?Ala?Gly?Asp

275 280 285

act?cgg?agc?ggc?ggg?ccc?cag?gca?aac?ttg?cac?gac?gcc?tgc?cag?ggc 912

Thr?Arg?Ser?Gly?Gly?Pro?Gln?Ala?Asn?Leu?His?Asp?Ala?Cys?Gln?Gly

290 295 300

gat?tcg?gga?ggc?ccc?ctg?gtg?tgt?ctg?aac?gat?ggc?cgc?atg?act?ttg 960

Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Leu?Asn?Asp?Gly?Arg?Met?Thr?Leu

305 310 315 320

gtg?ggc?atc?atc?agc?tgg?ggc?ctg?ggc?tgt?gga?cag?aag?gat?gtc?ccg 1008

Val?Gly?Ile?Ile?Ser?Trp?Gly?Leu?Gly?Cys?Gly?Gln?Lys?Asp?Val?Pro

325 330 335

ggt?gtg?tac?acc?aag?gtt?acc?aac?tac?cta?gac?tgg?att?cgt?gac?aac 1056

Gly?Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Asp?Trp?Ile?Arg?Asp?Asn

340 345 350

atg?cga?ccg 1065

Met?Arg?Pro

355

<210>6

<211>355

<212>PRT

<213>Homo?sapiens

<400>6

Ser?Tyr?Gln?Gly?Asn?Ser?Asp?Cys?Tyr?Phe?Gly?Asn?Gly?Ser?Ala?Tyr

1 5 10 15

Arg?Gly?Thr?His?Ser?Leu?Thr?Glu?Ser?Gly?Ala?Ser?Cys?Leu?Pro?Trp

20 25 30

Asn?Ser?Met?Ile?Leu?Ile?Gly?Lys?Val?Tyr?Thr?Ala?Gln?Asn?Pro?Ser

35 40 45

Ala?Gln?Ala?Leu?Gly?Leu?Gly?Lys?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asp

50 55 60

Gly?Asp?Ala?Lys?Pro?Trp?Cys?His?Val?Leu?Lys?Asn?Arg?Arg?Leu?Thr

65 70 75 80

Trp?Glu?Tyr?Cys?Asp?Val?Pro?Ser?Cys?Ser?Thr?Cys?Gly?Leu?Arg?Gln

85 90 95

Tyr?Ser?Gln?Pro?Gln?Phe?Arg?Ile?Lys?Gly?Gly?Leu?Phe?Ala?Asp?Ile

100 105 110

Ala?Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Lys?His?Arg?Arg?Ser

115 120 125

Pro?Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu?Ile?Ser?Ser?Cys?Trp

130 135 140

Ile?Leu?Ser?Ala?Ala?His?Cys?Phe?Gln?Glu?Arg?Phe?Pro?Pro?His?His

145 150 155 160

Leu?Thr?Val?Ile?Leu?Gly?Arg?Thr?Tyr?Arg?Val?Val?Pro?Gly?Glu?Glu

165 170 175

Glu?Gln?Lys?Phe?Glu?Val?Glu?Lys?Tyr?Ile?Val?His?Lys?Glu?Phe?Asp

180 185 190

Asp?Asp?Thr?Tyr?Asp?Asn?Asp?Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser?Asp

195 200 205

Ser?Ser?Arg?Cys?Ala?Gln?Glu?Ser?Ser?Val?Val?Arg?Thr?Val?Cys?Leu

210 215 220

Pro?Pro?Ala?Asp?Leu?Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu?Ser

225 230 235 240

Gly?Tyr?Gly?Lys?His?Glu?Ala?Leu?Ser?Pro?Phe?Tyr?Ser?Glu?Arg?Leu

245 250 255

Lys?Glu?Ala?His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Thr?Ser?Gln

260 265 270

His?Leu?Leu?Asn?Arg?Thr?Val?Thr?Asp?Asn?Met?Leu?Cys?Ala?Gly?Asp

275 280 285

Thr?Arg?Ser?Gly?Gly?Pro?Gln?Ala?Asn?Leu?His?Asp?Ala?Cys?Gln?Gly

290 295 300

Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Leu?Asn?Asp?Gly?Arg?Met?Thr?Leu

305 310 315 320

Val?Gly?Ile?Ile?Ser?Trp?Gly?Leu?Gly?Cys?Gly?Gln?Lys?Asp?Val?Pro

325 330 335

Gly?Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Asp?Trp?Ile?Arg?Asp?Asn

340 345 350

Met?Arg?Pro

355

<210>7

<211>1125

<212>DNA

＜213〉artificial sequence (Artificial)

<400>7

atggctagcg?acttcgaacc?gatcccggaa?gacgcgtacg?atgaaggtgg?tggttcttac 60

caaggaaaca?gtgactgcta?ctttgggaat?gggtcagcct?accgtggcac?gcacagcctc 120

accgagtcgg?gtgcctcctg?cctcccgtgg?aattccatga?tcctgatagg?caaggtttac 180

acagcacaga?accccagtgc?ccaggcactg?ggcctgggca?aacataatta?ctgccggaat 240

cctgatgggg?atgccaagcc?ctggtgccac?gtgctgaaga?accgcaggct?gacgtgggag 300

tactgtgatg?tgccctcctg?ctccacctgc?ggcctgagac?agtacagcca?gcctcagttt 360

cgcatcaaag?gagggctctt?cgccgacatc?gcctcccacc?cctggcaggc?tgccatcttt 420

gccaagcaca?ggaggtcgcc?cggagagcgg?ttcctgtgcg?ggggcatact?catcagctcc 480

tgctggattc?tctctgccgc?ccactgcttc?caggagaggt?ttccgcccca?ccacctgacg 540

gtgatcttgg?gcagaacata?ccgggtggtc?cctggcgagg?aggagcagaa?atttgaagtc 600

gaaaaataca?ttgtccataa?ggaattcgat?gatgacactt?acgacaatga?cattgcgctg 660

ctgcagctga?aatcggattc?gtcccgctgt?gcccaggaga?gcagcgtggt?ccgcactgtg 720

tgccttcccc?cggcggacct?gcagctgccg?gactggacgg?agtgtgagct?ctccggctac 780

ggcaagcatg?aggccttgtc?tcctttctat?tcggagcggc?tgaaggaggc?tcatgtcaga 840

ctgtacccat?ccagccgctg?cacatcacaa?catttactta?acagaacagt?caccgacaac 900

atgctgtgtg?ctggagacac?tcggagcggc?gggccccagg?caaacttgca?cgacgcctgc 960

cagggcgatt?cgggaggccc?cctggtgtgt?ctgaacgatg?gccgcatgac?tttggtgggc 1020

atcatcagct?ggggcctggg?ctgtggacag?aaggatgtcc?cgggtgtgta?caccaaggtt 1080

accaactacc?tagactggat?tcgtgacaac?atgcgaccgt?agtaa 1125

<210>8

<211>1125

<212>DNA

＜213〉artificial sequence (Artificial)

<220>

<221>CDS

<222>10)..(1119)

<223>

<400>8

atggctagc?gac?ttc?gaa?ccg?atc?ccg?gaa?gac?gcg?tac?gat?gaa?ggt?ggt 51

Asp?Phe?Glu?Pro?Ile?Pro?Glu?Asp?Ala?Tyr?Asp?Glu?Gly?Gly

1 5 10

ggt?tct?tac?caa?gga?aac?agt?gac?tgc?tac?ttt?ggg?aat?ggg?tca?gcc 99

Gly?Ser?Tyr?Gln?Gly?Asn?Ser?Asp?Cys?Tyr?Phe?Gly?Asn?Gly?Ser?Ala

15 20 25 30

tac?cgt?ggc?acg?cac?agc?ctc?acc?gag?tcg?ggt?gcc?tcc?tgc?ctc?ccg 147

Tyr?Arg?Gly?Thr?His?Ser?Leu?Thr?Glu?Ser?Gly?Ala?Ser?Cys?Leu?Pro

35 40 45

tgg?aat?tcc?atg?atc?ctg?ata?ggc?aag?gtt?tac?aca?gca?cag?aac?ccc 195

Trp?Asn?Ser?Met?Ile?Leu?Ile?Gly?Lys?Val?Tyr?Thr?Ala?Gln?Asn?Pro

50 55 60

agt?gcc?cag?gca?ctg?ggc?ctg?ggc?aaa?cat?aat?tac?tgc?cgg?aat?cct 243

Ser?Ala?Gln?Ala?Leu?Gly?Leu?Gly?Lys?His?Asn?Tyr?Cys?Arg?Asn?Pro

65 70 75

gat?ggg?gat?gcc?aag?ccc?tgg?tgc?cac?gtg?ctg?aag?aac?cgc?agg?ctg 291

Asp?Gly?Asp?Ala?Lys?Pro?Trp?Cys?His?Val?Leu?Lys?Asn?Arg?Arg?Leu

80 85 90

acg?tgg?gag?tac?tgt?gat?gtg?ccc?tcc?tgc?tcc?acc?tgc?ggc?ctg?aga 339

Thr?Trp?Glu?Tyr?Cys?Asp?Val?Pro?Ser?Cys?Ser?Thr?Cys?Gly?Leu?Arg

95 100 105 110

cag?tac?agc?cag?cct?cag?ttt?cgc?atc?aaa?gga?ggg?ctc?ttc?gcc?gac 387

Gln?Tyr?Ser?Gln?Pro?Gln?Phe?Arg?Ile?Lys?Gly?Gly?Leu?Phe?Ala?Asp

115 120 125

atc?gcc?tcc?cac?ccc?tgg?cag?gct?gcc?atc?ttt?gcc?aag?cac?agg?agg 435

Ile?Ala?Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Lys?His?Arg?Arg

130 135 140

tcg?ccc?gga?gag?cgg?ttc?ctg?tgc?ggg?ggc?ata?ctc?atc?agc?tcc?tgc 483

Ser?Pro?Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu?Ile?Ser?Ser?Cys

145 150 155

tgg?att?ctc?tct?gcc?gcc?cac?tgc?ttc?cag?gag?agg?ttt?ccg?ccc?cac 531

Trp?Ile?Leu?Ser?Ala?Ala?His?Cys?Phe?Gln?Glu?Arg?Phe?Pro?Pro?His

160 165 170

cac?ctg?acg?gtg?atc?ttg?ggc?aga?aca?tac?cgg?gtg?gtc?cct?ggc?gag 579

His?Leu?Thr?Val?Ile?Leu?Gly?Arg?Thr?Tyr?Arg?Val?Val?Pro?Gly?Glu

175 180 185 190

gag?gag?cag?aaa?ttt?gaa?gtc?gaa?aaa?tac?att?gtc?cat?aag?gaa?ttc 627

Glu?Glu?Gln?Lys?Phe?Glu?Val?Glu?Lys?Tyr?Ile?Val?His?Lys?Glu?Phe

195 200 205

gat?gat?gac?act?tac?gac?aat?gac?att?gcg?ctg?ctg?cag?ctg?aaa?tcg 675

Asp?Asp?Asp?Thr?Tyr?Asp?Asn?Asp?Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser

210 215 220

gat?tcg?tcc?cgc?tgt?gcc?cag?gag?agc?agc?gtg?gtc?cgc?act?gtg?tgc 723

Asp?Ser?Ser?Arg?Cys?Ala?Gln?Glu?Ser?Ser?Val?Val?Arg?Thr?Val?Cys

225 230 235

ctt?ccc?ccg?gcg?gac?ctg?cag?ctg?ccg?gac?tgg?acg?gag?tgt?gag?ctc 771

Leu?Pro?Pro?Ala?Asp?Leu?Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu

240 245 250

tcc?ggc?tac?ggc?aag?cat?gag?gcc?ttg?tct?cct?ttc?tat?tcg?gag?cgg 819

Ser?Gly?Tyr?Gly?Lys?His?Glu?Ala?Leu?Ser?Pro?Phe?Tyr?Ser?Glu?Arg

255 260 265 270

ctg?aag?gag?gct?cat?gtc?aga?ctg?tac?cca?tcc?agc?cgc?tgc?aca?tca 867

Leu?Lys?Glu?Ala?His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Thr?Ser

275 280 285

caa?cat?tta?ctt?aac?aga?aca?gtc?acc?gac?aac?atg?ctg?tgt?gct?gga 915

Gln?His?Leu?Leu?Asn?Arg?Thr?Val?Thr?Asp?Asn?Met?Leu?Cys?Ala?Gly

290 295 300

gac?act?cgg?agc?ggc?ggg?ccc?cag?gca?aac?ttg?cac?gac?gcc?tgc?cag 963

Asp?Thr?Arg?Ser?Gly?Gly?Pro?Gln?Ala?Asn?Leu?His?Asp?Ala?Cys?Gln

305 310 315

ggc?gat?tcg?gga?ggc?ccc?ctg?gtg?tgt?ctg?aac?gat?ggc?cgc?atg?act 1011

Gly?Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Leu?Asn?Asp?Gly?Arg?Met?Thr

320 325 330

ttg?gtg?ggc?atc?atc?agc?tgg?ggc?ctg?ggc?tgt?gga?cag?aag?gat?gtc 1059

Leu?Val?Gly?Ile?Ile?Ser?Trp?Gly?Leu?Gly?Cys?Gly?Gln?Lys?Asp?Val

335 340 345 350

ccg?ggt?gtg?tac?acc?aag?gtt?acc?aac?tac?cta?gac?tgg?att?cgt?gac 1107

Pro?Gly?Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Asp?Trp?Ile?Arg?Asp

355 360 365

aac?atg?cga?ccg?tagtaa 1125

Asn?Met?Arg?Pro

370

<210>9

<211>370

<212>PRT

＜213〉artificial sequence (Artificial)

<400>9

Asp?Phe?Glu?Pro?Ile?Pro?Glu?Asp?Ala?Tyr?Asp?Glu?Gly?Gly?Gly?Ser

1 5 10 15

Tyr?Gln?Gly?Asn?Ser?Asp?Cys?Tyr?Phe?Gly?Asn?Gly?Ser?Ala?Tyr?Arg

20 25 30

Gly?Thr?His?Ser?Leu?Thr?Glu?Ser?Gly?Ala?Ser?Cys?Leu?Pro?Trp?Asn

35 40 45

Ser?Met?Ile?Leu?Ile?Gly?Lys?Val?Tyr?Thr?Ala?Gln?Asn?Pro?Ser?Ala

50 55 60

Gln?Ala?Leu?Gly?Leu?Gly?Lys?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asp?Gly

65 70 75 80

Asp?Ala?Lys?Pro?Trp?Cys?His?Val?Leu?Lys?Asn?Arg?Arg?Leu?Thr?Trp

85 90 95

Glu?Tyr?Cys?Asp?Val?Pro?Ser?Cys?Ser?Thr?Cys?Gly?Leu?Arg?Gln?Tyr

100 105 110

Ser?Gln?Pro?Gln?Phe?Arg?Ile?Lys?Gly?Gly?Leu?Phe?Ala?Asp?Ile?Ala

115 120 125

Ser?His?Pro?Trp?Gln?Ala?Ala?Ile?Phe?Ala?Lys?His?Arg?Arg?Ser?Pro

130 135 140

Gly?Glu?Arg?Phe?Leu?Cys?Gly?Gly?Ile?Leu?Ile?Ser?Ser?Cys?Trp?Ile

145 150 155 160

Leu?Ser?Ala?Ala?His?Cys?Phe?Gln?Glu?Arg?Phe?Pro?Pro?His?His?Leu

165 170 175

Thr?Val?Ile?Leu?Gly?Arg?Thr?Tyr?Arg?Val?Val?Pro?Gly?Glu?Glu?Glu

180 185 190

Gln?Lys?Phe?Glu?Val?Glu?Lys?Tyr?Ile?Val?His?Lys?Glu?Phe?Asp?Asp

195 200 205

Asp?Thr?Tyr?Asp?Asn?Asp?Ile?Ala?Leu?Leu?Gln?Leu?Lys?Ser?Asp?Ser

210 215 220

Ser?Arg?Cys?Ala?Gln?Glu?Ser?Ser?Val?Val?Arg?Thr?Val?Cys?Leu?Pro

225 230 235 240

Pro?Ala?Asp?Leu?Gln?Leu?Pro?Asp?Trp?Thr?Glu?Cys?Glu?Leu?Ser?Gly

245 250 255

Tyr?Gly?Lys?His?Glu?Ala?Leu?Ser?Pro?Phe?Tyr?Ser?Glu?Arg?Leu?Lys

260 265 270

Glu?Ala?His?Val?Arg?Leu?Tyr?Pro?Ser?Ser?Arg?Cys?Thr?Ser?Gln?His

275 280 285

Leu?Leu?Asn?Arg?Thr?Val?Thr?Asp?Asn?Met?Leu?Cys?Ala?Gly?Asp?Thr

290 295 300

Arg?Ser?Gly?Gly?Pro?Gln?Ala?Asn?Leu?His?Asp?Ala?Cys?Gln?Gly?Asp

305 310 315 320

Ser?Gly?Gly?Pro?Leu?Val?Cys?Leu?Asn?Asp?Gly?Arg?Met?Thr?Leu?Val

325 330 335

Gly?Ile?Ile?Ser?Trp?Gly?Leu?Gly?Cys?Gly?Gln?Lys?Asp?Val?Pro?Gly

340 345 350

Val?Tyr?Thr?Lys?Val?Thr?Asn?Tyr?Leu?Asp?Trp?Ile?Arg?Asp?Asn?Met

355 360 365

Arg?Pro

370

<210>10

<211>48

<212>DNA

＜213〉artificial sequence (Artificial)

<400>10

ggagacgcgt?acgatgaagg?tggtggttct?taccaaggaa?acagtgac 48

<210>11

<211>48

<212>DNA

＜213〉artificial sequence (Artificial)

<400>11

gcaagctttt?actacggtcg?catgttgtca?cgaatccagt?ctaggtag 48

<210>12

<211>45

<212>DNA

＜213〉artificial sequence (Artificial)

<400>12

ggctagcgac?ttcgaaccga?tcccggaaga?cgcgtacgat?gaagg 45

<210>13

<211>42

<212>DNA

＜213〉artificial sequence (Artificial)

<400>13

ggctagcttc?gaaccgatcc?cggaagacgc?gtacgatgaa?gg 42

<210>14

<211>42

<212>DNA

＜213〉artificial sequence (Artificial)

<400>14

gcaagctttt?actacggtcg?catgttgtca?cgaatccagt?ct 42

<210>15

<211>39

<212>DNA

＜213〉artificial sequence (Artficial)

<400>15

ggctagcgaa?ccgatcccgg?aagacgcgta?cgatgaagg 39

Claims (10)

1. thrombolysis and anti-freezing double effects fusion rotein, have 10～12 amino acid peptide sections in the 55-66 amino acids sequence of sequence shown in SEQ ID NO.3 by r-hirudin IIIC end, the reteplase (r-PA) with aminoacid sequence shown in SEQ ID NO.6 with tissue plasminogen activator's truncated mutant is formed by connecting through connection peptides.

2. thrombolysis as claimed in claim 1 and anti-freezing double effects fusion rotein is characterized in that said connection peptides is a successive 3-5 glycine sequence.

3. thrombolysis as claimed in claim 2 and anti-freezing double effects fusion rotein is characterized in that said connection peptides is three glycine tripeptide sequences of successive.

4. as described thrombolysis of one of claim 1 to 3 and anti-freezing double effects fusion rotein, the C end that it is characterized in that said r-hirudin III in the fusion rotein has 12 amino acid peptide sections of 55-66 position among the SEQ NO.3, and this fusion rotein has the aminoacid sequence shown in SEQ ID NO.9.

5. isolated DNA molecule, thrombolysis as claimed in claim 1 and anti-freezing double effects fusion rotein is characterized in that encoding.

6. dna molecular as claimed in claim 5 is characterized in that having the nucleotide sequence shown in the SEQ ID NO.7.

7. a carrier is characterized in that containing dna molecular as claimed in claim 4.

8. method for preparing described thrombolysis of claim 1 and anti-freezing double effects fusion rotein is characterized in that operation steps is:

1 ': the primer of design 10～12 peptide sequences of amplification r-hirudin IIIC end on the r-PA basis;

2 ': by twice add-on PCR, amplify 10～12 peptide sequences of connection peptides sequence and r-hirudin IIIC end, obtain object thrombolysis and anti-freezing double effects fusion rotein (HrP) gene at the r-PA upstream region of gene:

3 ': make up the pET2la-HrP expression vector;

4 ': transformed into escherichia coli, set up engineering bacteria;

5 ': preparation object thrombolysis and anti-freezing double effects fusion rotein (HrP).

9. the medicine that has thrombolysis and anti-freezing double effects is characterized in that being made up of jointly acceptable ancillary component in the thrombolysis of claim 1 and anti-freezing double effects fusion rotein and the medicine.

10. the peptide section of being made up of the successive glycine sequence is as the application of syndeton in preparation thrombolysis and anti-freezing double effects fusion rotein.

Images