CN1954084A - Oligonucleotide composition for analyzing human leukocyte antigen (hla) genotype and detecting method thereof - Google Patents

Abstract

The present invention relates to oligonucleotide composition for analyzing HLA genotype and detecting method thereof.

Description

Be used to analyze genotypic oligonucleotide composition of human leucocyte antigen (HLA) and detection method thereof

Background of invention

Invention field

The present invention relates to be used to analyze genotypic oligonucleotide of HLA and detection method thereof.

The description of related technology

The present invention relates to oligonucleotide chip composition and manufacture method thereof, particularly relate to and be used to analyze the oligonucleotide chip composition of HLA genotype with the required histocompatibility of research transplanting, and manufacture method and detection method.

Major histocompatibility complex (MHC) is the antigen systems by the complexity of gene level control, and it is the relevant gene group of rejection (immunne response) during with organ transplantation.It is present in all animals.Human MHC is found therefore to be known as human leucocyte antigen (HLA) first in the identification leukocyte surface antigenic anti-white corpuscle factor, and it is positioned on No. 6 chromosomal galianconism.According to the type of amynologic characteristic, molecular structure, gene location and institute's distribution cell, this HLA locus is divided into 3 classes (HLA-I, II and III).Wherein, the HLA-A of HLA-I ,-B ,-locus of the HLA-DR of Cw and HLA-II be considered to and the relation of the rejection organized the closest.

The characteristic features of HLA is as follows.At first, because having, the HLA gene surpasses tens allelotrope, so the HLA gene shows the highest genetic polymorphism in many human inheritance's marks.The secondth, the heredity of haplotype level.Because the gene in the HLA gene classification closely is positioned on No. 6 karyomit(e), so their normally whole heredity is from parental generation.These allelic particular combinations are called as haplotype.The 3rd is the HLA genetic polymorphism that human race relies on.Compare with other gene, the allelic distribution of HLA shows very big-difference according to each race.This feature is more obvious in the HLA haplotype.Some ethnic HLA genes show the intensive linkage disequilibrium, so the HLA haplotype of specific population is exactly the feature of some human population.Because the genetic polymorphism of this HLA, the gene frequency of HLA gene and haplotype frequency are used as the significant notation of studying human population genetic background difference.The 4th, another vital role of HLA gene is relevant with immunne response.HLAI class and II quasi-molecule combine with antigen in the cell, and then it appears at cell surface, and the T cell antigen receptor is discerned this antigen that combines the HLA molecule then, and this causes immunne response.

As mentioned above, because the height genetic polymorphism of HLA gene and the characteristics relevant, so it is used to many fields such as organ transplantation, the dependency with disease, blood transfusion, forensic application for example paternity test and anthropological studies with immunne response.The HLA detection is necessary in kidney and bone marrow transplantation program now.Before transplanting, to donor and acceptor carry out abo blood group detection and HLA-A ,-B ,-Cw and-the DR type detects and carries out the cross match test.Under the situation that marrow, kidney etc. are transplanted,, then have rejection for transplant organ if the HLA type of donor and acceptor is different.Common bone marrow transplantation needs between donor and the acceptor hereditary in full accord, because it is the transplanting of immunocyte.Therefore, it is crucial selecting the donor consistent with acceptor HLA type.Specifically because as the situation of acute or chronic leukemia, immunological incompetence and aplastic anemia etc. under HLA type when carrying out bone marrow transplantation should be in full accord, so heredity the brothers or sisters of same HLA type be the most titular.But,, then in not having the people of genetic connection, seek titular donor if there are not relatives.Under these circumstances, must analyze to determine the HLA genotype many people.

Along with development of molecular biology, found the antigenic allelic base sequence of control HLA, therefore can analyze the HLA gene to find the multifarious mode of HLA by the difference of base sequence.Particularly the introducing of round pcr makes the dna typing fast development of HLA, and nearly all HLA polymorphism all obtains explanation on dna level.Use PCR to carry out the allelic classification of HLA following advantage is arranged: for example unnecessary the separation separating of T lymphocyte and bone-marrow-derived lymphocyte, because all karyocytes can be as sample, and no matter how many HLA molecules is in the expression quantity of cell surface, and might utilize and do not contain lymphocytic body fluid and tissue carries out gene type assay.DNA also is metastable, so it can be stored some months, almost preservation forever under freezing conditions under refrigerated condition.One of most important advantage of dna typing technology is that it can be classified to a large amount of HLA allelotrope.

At present, multiple normally used HLA dna typing method is arranged.At first, the PCR-SSP method is to synthesize the PCR of the Auele Specific Primer of each allelotrope base sequence.This needs a large amount of primers to distinguish tens allelotrope.It is analyzed fast and is simple method, but it needs careful wholwe-hearted, expertise and for a long time with synthetic primer, and can be restricted when analyzing a large amount of samples.It also has a shortcoming promptly to be difficult to a plurality of samples of primary treatment because the many more just a large amount of more PCR-SSP of needs of allelotrope.The second, distinguishing the genotypic method of HLA by PCR-RFLP is a kind of relatively simple method of allelotrope to the Restriction Enzyme reaction type that be used to analyze.This method is by being distinguished allelic type by the dna fragmentation of the certain-length of multiple restriction enzyme enzyme liberating.Though this method is determined result and easy easily, but its shortcoming is for example when the recognition site of restriction enzyme is restricted, it just can not be distinguished, and therefore it can not distinguish a large amount of samples or tens allelotrope simultaneously owing to need to use polyacrylamide gel.Therefore, its to have only several allelic genotypic situations for analysis be enough.The 3rd, the PCR-SSCP method is after adding denaturing agent such as methane amide sex change are single stranded DNA (ssDNA), the PCR product to be carried out electrophoresis on non-denaturing polyacrylamide gel.SsDNA has specific structure and therefore specific rate of migration is arranged according to base sequence in electrophoresis, therefore show the band of other type separately.Utilize the very complicated technology that also need be very high of the genotypic technology of these property analysis HLA.When being analyzed, the result needs a large amount of experience and knowledges.The 4th, be the method for research base sequence after the HLA gene is carried out pcr amplification respectively based on the somatotype (Sequence Based Typing) of sequence.An example that is used for the test kit of this method is the somatotype (SBT) of the HLA of ABI company (U.S.) based on sequence.Yet this test kit is very expensive and this method needs expensive equipment.And experimental arrangement is also very complicated.The 5th, the PCR-SSOP method is a kind of analytical procedure, its base sequence complementary probe synthetic and zone of representing genetic polymorphism, and the hybridization of analysis probe and pcr amplification product.Because take place to have the allelic hybridization of similar base sequence to other easily, this method needs a large amount of probes and experience, technology to set up suitable hybridization temperature and reaction conditions.Even this method can obtain accurate result according to a kind of probe, but owing to use filter paper, so limited to aspect fixing a large amount of probes, and because a filter paper can only be analyzed one type, so need plenty of time and labour to handle and analyze a lot of samples.The commodity of available this method of use are the INNO LiPA test kit of INNOGENETICS company (Belgium) and the Dynal RELI that uses the DYNAL Biotech company (U.S.) of Line Probe analytical procedure (this method is to carry out reverse hybridized with the SSOP that is respectively applied for HLA I class and II class) ^TMSSO HLA parting kit.

As mentioned above, though exist some to use several classifying methods to analyze the commodity of HLA gene, the common shortcoming of these methods is, carry out simultaneously HLA-A ,-B ,-need a lot of time and labors during the somatotype of Cw and DR.Particularly, analyze a large amount of samples difficulty more.

Nearest DNA chip technology (this technology can be fixed on a spot of DNA as also analyzing a large amount of samples simultaneously on the thin plates such as small slide, silicon with high-density) has been developed the novel analytical system that can be used in analyzing gene expression, gene diagnosis, searching transgenation, drug testing and medical diagnosis on disease etc.The present invention utilizes this DNA chip technology exactly, on slide simultaneously to HLA-A ,-B ,-Cw and-DR analyzes.That is, each probe is attached on 5 zones of aldehyde radical slide.Will be by the HLA gene and the probe hybridization that is combined on the slide of asymmetric PCR method amplification.By identifying the HLA genotype to the probe analysis that obtains to use HLA gene type program.

Summary of the invention

Therefore, in order to overcome the problems referred to above, the purpose of this invention is to provide a kind of oligonucleotide composition that is used to analyze the genotypic composition of HLA that comprises.

Another object of the present invention is that a kind of HLA methods of genotyping that uses the improvement of said composition is provided.

In order to achieve the above object, the invention provides a kind of a plurality of compositions that are used to analyze the genotypic oligonucleotide probe of HLA that have, wherein said composition comprises that at least one is selected from the probe groups of the group that is made of following probe groups: be used to analyze the probe groups that the genotypic probe of HLA-A is formed by at least two, its probe is selected from the group of being made up of SEQ ID NO:1-41; Be used to analyze the probe groups that the genotypic probe of HLA-B is formed by at least two, its probe is selected from the group of being made up of the represented base sequence of SEQ ID NO:42-89; Be used to analyze the probe groups that the genotypic probe of HLA-Cw is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ ID NO:90-112 is formed; Be used to analyze the probe groups that the genotypic probe of HLA-DR is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ ID NO:113-140 is formed.

The present invention also provides a kind of test upholder, it is fixed thereon to have a plurality of compositions that are used to analyze the genotypic oligonucleotide probe of HLA, wherein said composition comprises that at least one is selected from the probe groups of the group that is made of following probe groups: be used to analyze the probe groups that the genotypic probe of HLA-A is formed by at least two, its probe is selected from the group of being made up of SEQ ID NO:1-41; Be used to analyze the probe groups that the genotypic probe of HLA-B is formed by at least two, its probe is selected from the group of being made up of the represented base sequence of SEQ ID NO:42-89; Be used to analyze the probe groups that the genotypic probe of HLA-Cw is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ ID NO:90-112 is formed; Be used to analyze the probe groups that the genotypic probe of HLA-DR is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ ID NO:113-140 is formed.

Preferably, described upholder is the group that free filter membrane, band (strip), microballoon, chip, slide, porous plate, film and optical fiber are formed.

The present invention also comprises at least a primer of being analyzed the group that the genotypic base sequence of HLA formed by SEQ ID NO:141-157 being used to of representing that is selected from, and wherein this primer is used to detect the hybridization between described probe and the target gene.

In primer of the present invention, by the preferred example of antisense primers of SEQ ID NO:142,144,146,148,150,152 and 154 expressions be combine with vitamin H or with rhodamine (rhodamine) bonded.In described primer, in conjunction with antisense primer and streptavidin-cyanin interaction of vitamin H.

In addition, the preferred embodiments of the present invention provide the genotypic method of a kind of analysis HLA, and it may further comprise the steps: (a) from blood cell with the tissue separate hla dna; (b) use separated DNA to carry out asymmetric PCR; (c) probe with claim 1 or 2 combines with the asymmetric PCR product; (d) identify described combination.

In described authentication step of the present invention, use rhodamine or streptavidin-cyanin, wherein streptavidin-cyanin combines with vitamin H.Utilize microarray scanning that the result is identified with HLA gene type program the result is analyzed, so the HLA genotype can be easy to be identified.In a preferred embodiment of the invention, developed HLA oligonucleotide chip, its be used for use on the slide of the dna microarray technology of exploitation recently simultaneously to HLA-A ,-B ,-Cw and-DR analyzes.That is to say to have prepared and be used to analyze genotypic 38 oligonucleotides with 21 class HLA-A specific reactioies of HLA, 46 oligonucleotides with 36 class HLA-B specific reactioies, with 20 oligonucleotides of 14 class HLA-Cw specific reactioies, with 22 oligonucleotides of 16 class HLA-DRB1/3/4/5 specific reactioies and with the B1 of 8 class HLA- DRB1 ^*3, ^*8, ^*11, ^*12, ^*13, ^*14, ^*15 Hes ^*17 oligonucleotides of 16 specific reactioies.They are bonded on 5 zones of aldehyde radical slide.To hybridize with the oligonucleotide probe that is combined on the slide by the HLA gene of asymmetric PCR method amplification.Utilize the fluorescent reaction method that reacted probe is analyzed, identified 87 genotype of HLA.

Description of drawings

Fig. 1 is the figure of the whole slide of expression HLA oligonucleotide chip.Promptly have 5 grooves shown in reference numerals, with on slide simultaneously to HLA-A ,-B ,-Cw and-DR analyzes.It is as shown in the table, wherein in 155 probes altogether, following probe is provided with twice on slide, and it is in each group: distinguish the genotypic probes of HLA-A for 38,2 probe and 1 probe as its negative control as its positive control; Distinguish the genotypic probe of HLA-B for 46,1 probe and 1 probe as its negative control as its positive control; Distinguish the genotypic probe of HLA-Cw for 20,2 probe and 1 probe as its negative control as its positive control; Distinguish the genotypic probe of HLA-DRB1/3/4/5 for 22,1 probe and 1 probe as its negative control as its positive control; 17 probes of strengthen distinguishing HLA-DRB1 genotype abilities (it is unclear because distinguish analysis that the genotypic probe of HLA-DRB1/3/4/5 is subjected to genotypic influence of DRB3/4/5 and the HLA-DRB1 part that becomes that it is essential), 1 probe and 1 probe that is used for negative control that is used for positive control.By on the probe that COVERWELL PERFUSION CHAMBER (the SIGMA U.S.) is attached to dispersion state to make HLA oligonucleotide chip, be used for distinguishing the hybrid reaction of each genotypic probe.

Fig. 2 to 6 is that expression HLA oligonucleotide chip is for HLA-A ^*11/ ^*31, B ^*27, Cw ^*06 and DRB ^*01/ ^*The fluorescent reaction result of 11/DRB3 type.These figure carry out enlarged image with reacting in 5 grooves of slide shown in Figure 1.

Fig. 2 a is that expression HLA oligonucleotide chip is for containing HLA-A ^*11 and HLA-A ^*The result of the simultaneous fluorescent reaction of sample of 31 types.The figure shows in 41 probes and A ^*The probe 13,14,15,17,18,23,29,30 that 11 types are relevant and 33 and and A ^*31 relevant probes 11,13,15,18,21,25,26,29,32,39 and 40 (these are called as " active HLA type " in table 4) are gone up simultaneous positive reaction.Probe 01 and 41 is positive controls, and it appears at institute and responds, and probe 06 is a negative control, and it does not occur in any reaction, and this also can prove the tolerance range of test.Two identical points that same probe is set are used so that reaction is accurate more and the minimizing error.

Fig. 2 b represents to be fixed on the position of the probe on the slide.

Fig. 3 a is that expression HLA oligonucleotide chip is for containing HLA-B ^*The result of the fluorescent reaction of the sample of 27 types.The figure shows and take place in 48 probes and B ^*Positive reaction on 27 probes 09,12,21,30,31,32,36,37,42 and 47 (it is called as " active HLA type " in table 5) of being correlated with.Probe 01 is positive control, and it appears at institute and responds, and probe 06 is a negative control, and it does not occur in any reaction, and this also can prove the tolerance range of test.Two identical points that same probe is set are used so that reaction is accurate more and the minimizing error.

Fig. 3 b represents to be arranged on the position of the probe on the slide.

Fig. 4 a is that expression HLA oligonucleotide chip is for containing HLA-Cw ^*The result of the fluorescent reaction of the sample of 06 type.The figure shows and occur in 23 probes and Cw ^*Positive reaction (it is called " active HLA type " in table 6) on 06 probe 06,08,13 and 17 of being correlated with. Probe 01 and 23 is positive controls, and it appears at institute and responds, and probe 04 is a negative control, and it does not occur in any reaction, and this also can prove the tolerance range of test.Two identical points that same probe is set are used so that reaction is accurate more and the minimizing error.

Fig. 4 b represents to be arranged on the position of the probe on the slide.

Fig. 5 a is that expression HLA oligonucleotide chip is for containing HLA-DRB1 ^*01 and HLA-DRB1 ^*The result of the simultaneous fluorescent reaction of sample of 11 types.The figure shows and occur in simultaneously in 41 probes and DRB1 ^*01 relevant probe 07,10 and and DRB1 ^*11 relevant probe 04,10,13 and and DRB1 ^*Positive reaction (it is called as " active HLA type " in table 7) on the probe 16,24 that 11 hereditary together DRB3 are correlated with.Probe 01 is positive control, and it appears at institute and responds, and probe 05 is a negative control, and it does not occur in any reaction, and this also can prove the tolerance range of test.Two the identical point that same probe is set is used so that reaction is accurate more and the minimizing error.

Fig. 5 b represents to be arranged on the position of the probe on the slide.

Fig. 6 a is that expression HLA oligonucleotide chip is for containing HLA-DRB1 ^*01 and HLA-DRB1 ^*The result of the simultaneous fluorescent reaction of sample of 11 types.The figure shows occur in simultaneously in 19 probes with the resulting DRB of selective amplification ^*Positive reaction (it is called as " active HLA type " in table 8) on 11 probes 07,10,13 of being correlated with.Probe 01 is positive control, and it appears at institute and responds, and probe 04 is a negative control, and it does not occur in any reaction, and this also can prove the tolerance range of test.Two identical points that same probe is set are used so that reaction is accurate more and the minimizing error.

Fig. 6 b represents to be arranged on the position of the probe on the slide.

Fluorescent primer and probe are used in PCR and the hybridization.For analytical results, the fluorescence of performance probe type is analyzed with the HLA somatotype program of using GenePiX4000 Scanner (Axon instrument company, the U.S.).

The detailed description of embodiment

Describe the present invention according to exemplary embodiment with reference to the accompanying drawings, its only as an illustration method provide, therefore do not limit the present invention.

Embodiment 1: synthetic HLA primer and base sequence thereof

Expression is used for the HLA PCR primer of asymmetric PCR in the table 1, its analyze HLA-A ,-exon 2 of B and Cw and 3 and the common reaction site of the exon 2 of HLA-DRB1/3/4/5, and the site of analyzing the 8 kinds of specific gene types that only the increase B1 on the exon 2 of HLA-DBR1 for example ^*3, ^*8, ^*11, ^*12, ^*13, ^*14, ^*15 Hes ^*16.

Behind the hybridization, the 5 ' end that rhodamine is connected the antisense primer that uses in the asymmetric PCR is used for identifying fluorescent reaction, perhaps behind hybridization, connects vitamin H it is combined with streptavidin-cyanin.The requirement that this primer is answered the contriver by Metabion company (Germany) according to molecular cloning (Molecular cloning) third edition (Sambrook and Rusell, Cold Spring HarborLaboratory Pess, New York, the U.S., 2001) the method synthetic of the synthetic oligonucleotide of describing in 10.42.

Table 1 is used to analyze the genotypic primer base sequence of HLA

Primer		Base sequence	Reference
				HLA-A	Exon 2 justice (SEQ ID NO:141)	AAACC GCCTC TGYGG GGAGA AGCAA	PCR size 466bp
Exon 2 antisense (SEQ ID NO:142)	GATCT CGGAC CCGGA GACTG TGG
		Exon 3 justice (SEQ ID NO:143)	TCSGG GCCAG GTTCT CACACC		PCR size 374bp
Exon 3 antisense (SEQ ID NO:144)	GTGTT GGTCC CAATT GTCTC CCCTC
		HLA-B	Exon 2 justice (SEQ ID NO:145			GCTCC CACTC CATGAGGTAT	PCR size 420bp
Exon 2 antisense (SEQ ID NO:146)	TAAAC GCGCC TGGGS CTCTCG and TAGAC GCGCCTGGGG CTCTCG
			Exon 3 justice (SEQ ID NO:147)	TACCC GGTTT CATTTTCAGTTG	PCR size 509bp
Exon 3 antisense (SEQ ID NO:148)	ATTCT CCATT CAASG GAGGG CGAC
			HLA-Cw	Exon 2 justice (SEQ ID NO:149)		CTCCCACTCCATGARGTATTT	PCR size 419bp
Exon 2 antisense (SEQ ID NO:150)	TAAAGGYGACTGGGG CTCTCT
		Exon 3 justice (SEQ ID NO:151)		TTTAC CCGGT TTCAT TTTCA GTTT	PCR size 480bp
Exon 3 antisense (SEQ ID NO:152)	GCTGA TCCCA TTTTC CTCCC CTC
		HLA- DRB1/3/4/5		Exon 2 justice (SEQ ID NO:153)		TCCCCACAGCACGTTTCTTG	PCR size 276bp
Exon 2 antisense (sequence ID NO:154)	CCGCTGCACT GTGAAGCTCT
			HLA-DRB1	Exon 2 justice-1 (SEQ ID NO:155)	TCCTGTGGCAGCCTAAGAGG	PCR size 276bp
Exon 2 justice-2 (SEQ ID NO:156)	AGCAC GTTTC TTGGA GTACT CTACGTC
		Exon 2 justice-3 (SEQ ID NO:157)		GCACG TTTCT TGGAG TACTC TACGGG
Exon 2 antisense (SEQ ID NO:154)	CCGCTGCACTGTGAAGCTCT

The extraction of embodiment 2:HLA DNA and asymmetric PCR reaction

1) PUREGENE of use Gentra Systems company ^TMThe DNA separating kit separates HLA DNA.300 μ l blood are mixed with 900 μ l RBC cracked solution.Mixture is at room temperature reacted 1 minute, and follow 10 vibrations.Then, with 13000rpm with centrifugal 20 seconds of mixture.Get 20 μ l supernatant liquors.

2) with remaining supernatant liquor whirlpool (vortex) 10 seconds with behind the resuspension white corpuscle, add 300 μ l lysis solution.Then with transfer pipet with lysis.

3) in lysis solution, add 100 μ l protein precipitation solution, with mixed solution whirlpool 20 seconds.Then with 13000rpm with centrifugal 1 minute of mixed solution.

4) supernatant liquor that will contain DNA mixes with 100% Virahol.Shake test tube 50 times then mixing, with 13000rpm with centrifugal 1 minute of test tube liquid.

5) remove supernatant liquor also with 300 μ l, 70% ethanol washing and precipitating.With 13000rpm centrifugal 1 minute.

6) remove supernatant liquor, make precipitation dry.Solution with 100 μ l hydration DNA suspends to precipitation then.

7) use GeneAmp PCR system 9600 thermal cyclers (Perkin Elmer CetusCompany, the U.S.) to carry out asymmetric PCR reaction as shown in table 2.

8) 5 μ l asymmetric PCR products and 1 μ l gel sample-loading buffer (0.25% bromjophenol blue, 0.25% xylidene(s) FF and 15%Ficol 1400) are mixed.On 2% sepharose that contains 1 μ l/ml bromination second pyridine (EtBr), carry out electrophoresis then.(VilberLourmat Company France) identifies the PCR band to use the image analyzer that assembles ultraviolet transilluminator.

Table 2 HLA asymmetric PCR reaction conditions

Reaction composition condition			The temperature of reaction condition
					Sterile distilled water (DW)	10.0		95 ℃, 5.0 minutes	1 circulation
10 * damping fluid	2.0
				2mM dNTP	1.0	94 ℃, 45 seconds 62 ℃, 1.0 minutes 72 ℃, 20 seconds		35 circulations
The 1-3pmol sense primer	1.0
		The 7-15pmol antisense primer	1.0
1U Taq	0.5
		Separated DNA	4.5
Amount to	20μl					72 ℃, 5.0 minutes		1 circulation

Embodiment 3: synthetic probe and the base sequence thereof that is used to prepare HLA oligonucleotide chip

Each the 5 ' end that amino chain (Amino links) is connected all probes is used for covalent linkage on the aldehyde radical slide.10-20 oligomerization (dT) be connected to hybridization is carried out easily.Then, the base shown in the table 3 is linked amino chain-oligomerization (dT) _10-20On.In brief, has " amino acid chain-oligomerization (dT) _10-20-probe base sequence " primer of order has been synthetic by Metabion company according to contriver's requirement.By analyzing as table 3 described in 21 types HLA-A, 36 types HLA-B, 14 types HLA-Cw and 16 types HLA-D, definite genotypic base sequence of the HLA that identifies.

To the base sequence shown in 7, the base that the intermediary capitalization is represented is most important base sequence at table 4.With described base is the center, synthesized the probe of about 13-30bp, and it has determined reflection Tm and GC% 60～65 ℃.

HLA genotype and kind that table 3 is analyzed

The HLA genotype	The HLA type
		HLA-A	A *01，A *02，A *23，A *24，A *25，A *26，A *34，A *66，A *29，A *30，A *31，A *32， A *33，A *74，A *68，A *69，A *03，A *11，A *36，A *43，A *80
HLA-B	B *07，B *08，B *13，B *14，B *15，B *18，B *27，B *35，B *37，B *38，B *39，B *40， B *41，B *42，B *44，B *45，B *46，B *47，B *48，B *49，B *50，B *51，B *52，B *53， B *54，B *55，B *56，B *57，B *58，B *59，B *67，B *73，B *78，B *81，B *82，B *83
		HLA-Cw	C *01，C *02，C *03，C *04，C *05，C *06，C *07，C *08，C *12，C *14，C *15，C *16， C *17，C *18
HLA-DR	DRB1 *01，B1 *03，B1 *04，B1 *07，B1 *08，B1 *09，B1 *10，B1 *11，B1 *12，B1 *13， B1 *14，B1 *15，B1 *16，DRB3，DRB4，DRB5

Table 4 is used for determining the genotypic probe base sequence of HLA-A

The probe title	Base sequence	Active HLA type
			HLA-A01 (SEQ ID NO：1)	gtgggctacgtggacgaca	All react with all types (positive control exon 2)
HLA-A02 (SEQ ID NO：2)	gcgagccagaAgatggagcc	A				*01，A *36
			HLA-A03 (SEQ ID NO：3)	ctgaccgagCgAAcctg	A		*01，A *26，A *29，A *36，A *43
HLA-A04 (SEQ ID NO：4)	attgggacGGggagaca	A *02，A *23，A *24，A *80
			HLA-A05 (SEQ ID NO：5)	attgggacCgggagaca	A *0246，A *6813
HLA-A06 (SEQ ID NO：6)	tgcgctctGTgaccgc	Not with any kind reaction (negative control)
			HLA-A07 (SEQ ID NO：7)	attgggacgAggagaca	A *23，A *24，A *80
HLA-A08 (SEQ ID NO：8)	ggaTcGCgcTcCgctacta	A				*23，A *24，A *25，A *32
			HLA-A09 (SEQ ID NO：9)	gggaccGgAaCacacgg	A *25，A *26，A *34，A *66，A *33，A *68，A *69
HLA-A10 (SEQ ID NO：10)	ttgggaccTgCagacacgg	A *29，A *43

(continued on next page)

(brought forward)

HLA-A11 (SEQ ID NO：11)	gcaggagAggccTgagtat	A	*30，A *31
				HLA-A12 (SEQ ID NO：12)	ctgaccgagAgaGcctg	A *25，A *32
HLA-A13 (SEQ ID NO：13)	cagaTtgaccgagTgGacctg	A *03，A *11，A *30，A *31，A *33，A *34，A *66， A *68，A *69，A *74
			HLA-A14 (SEQ ID NO：14)	cagaCtgaccgagtggacctg	A *03，A *11，A *30，A *34，A *66，A *68，A *69 A *74
HLA-A15 (SEQ ID NO：15)	ctgaccgaGtgGacctg	A *02，A *30，A *31，A *33，A *34，A *66，A *74， A *68，A *69，A *03，A *11
			HLA-A16 (SEQ ID NO：16	acTcgcagttcgtgcAgtt	A *80
HLA-A17 (SEQ ID NO：17)	gagggcCGgtgcgt	A *01，A *25，A *26，A *66，A *11，A *43
			HLA-A18 (SEQ ID NO：18)	cgtggaGTggctccgc	A	*02，A *25，A *26，A *34，A *66，A *29，A *30， A *31，A *32，A *33，A *74，A *68，A *69，A *03， A *11，A *36，A *43
HLA-A19 (SEQ ID NO：19)	tacctggaTggcACgtgc	A *03
			HLA-A20 (SEQ ID NO：20)	ccagatGatgtTtggctgc	A *23，A *24
HLA-A21 (SEQ ID NO：21)	tggagggcACgtgcgt	A *02，A *03，A *23，A *24，A *34，A *29，A *30， A *31，A *32，A *33，A *74，A *68，A *69，A *36
			HLA-A22 (SEQ ID NO：22)	tggaTggcACgtgcgt	A *03
HLA-A23 (SEQ ID NO：23)	ggagcagcAgagagCcta	A *24，A *11
			HLA-A24 (SEQ ID NO：24)	caccatccgaGGatgtatggc	A	*02，A *25，A *26，A *66，A *43，A *29, some A *31，A *32，A *33，A *34，A *68，A *69，A *74
HLA-A25 (SEQ ID NO：25)	caccatccagaTgatgtatggc	A *29，A *31，A *32，A *33，A *68，A *74
			HLA-A26 (SEQ ID NO：26)	cagatcaccCagcgcaag	A *23，A *25，A *26，A *34，A *66，A *29，A *30， A *31，A *32，A *33，A *74，A *43
HLA-A27 (SEQ ID NO：27)	gagAcggCccatgAggc	A *25，A *26，A *34，A *66，A *43
			HLA-A28 (SEQ ID NO：28)	gagGcggcccatgaggc	A *03

(continued on next page)

(brought forward)

HLA-A29 (SEQ ID NO：29)	ttacatcgccTtgaacgagg	A *29，A *31，A *32，A *33，A *74，A *01，A *03， A *11，A *25，A *26，A *30，A *34，A *36，A *43， A *66，A *80
			HLA-A30 (SEQ ID NO：30)	ttacatcgccCtgaacgagg	A *01，A *03，A *11，A *25，A *26，A *30，A *34， A *36，A *43，A *66，A *80
HLA-A31 (SEQ ID NO：31)	gcgggtaTGAAcagCacgc	A *30
			HLA-A32 (SEQ ID NO：32)	ccatccagatGatgtatggc	A *29，A *31，A *32，A *33，A *74，A *68
HLA-A33 (SEQ ID NO：33)	ccatccagatAatgtatggc	A *01，A *03，A *11，A *30，A *80，A *34，A *36
			HLA-A34 (SEQ ID NO：34)	agcagTggagagCctacc	A *25，A *26，A *66，A *68，A *43
HLA-A35 (SEQ ID NO：35)	ctcagaCcaccaagcAcaagtg	A *02，A *68，A *69
			HLA-A36 (SEQ ID NO：36)	tcacaccGtccagaGGatgtatg	A *02，A *69
HLA-A37 (SEQ ID NO：37)	tcacaccCtccagaggatgtatg	Some A *02
			HLA-A38 (SEQ ID NO：38)	tcacaccAtccagaggatgtatg	A *25，A *26，A *66，A *43
HLA-A39 (SEQ ID NO：39	gggTcggacTggcgc	A *02，A *69，A *03，A *23，A *24，A *29，A *30， A *31，A *33，A *34，A *68，A *80
			HLA-A40 (SEQ ID NO：40)	gggtcggacGggcgc	A *03，A *23，A *24，A *29，A *30，A *31，A *33， A *34，A *68，A *80
HLA-A41 (SEQ ID NO：41)	ctgcgctcttggaccgcg	All react with all types (positive control, exon 3)

Table 5 is used to measure the genotypic probe base sequence of HLA-B

The probe title	Base sequence	Active HLA type
			HLA-B01 (SEQ ID NO：42)	gccctcccgttgattggag	All react with all types (positive control)
HLA-B02 (SEQ ID NO：43)	gcagcTgagaAcctacctg	B *1548，B *1569，B *3535，B *39，B *4429， B *5119，B *67
			HLA-B03 (SEQ ID NO：44)	tatttcGacaccGccAtgtc	B *0729，B *08
HLA-B04 (SEQ ID NO：45)	cacccagcTcaagtggg	B *13
			HLA-B05 (SEQ ID NO：46)	ggccggaAtattgggacc	B *14，B *3526, some B *38，B *670101
HLA-B06 (SEQ ID NO：47)	agacggcacgattgagaca	Not with any kind reaction (negative control)
			HLA-B07 (SEQ ID NO：48)	agGATggCgccCcg	B *13, some B *15，B *4021，B *4408，B *46， B *5202，B *57
HLA-B08 (SEQ ID NO：49	tagagcaAgaggggccg	B *18
			HLA-B09 (SEQ ID NO：50)	atctGcaaggccAaggc	B *27，B *7301
HLA-B10 (SEQ ID NO：51)	gactTaccgagagGAcctg	B *37，B *0727，B *543，B *47010101， B *47010102，B *5303
			HLA-B11 (SEQ ID NO：52)	gtatttcCacaccGccAtgt	Some B *40，B *41，B *45，B *49，B *50， B *4415，B *4418
HLA-B12 (SEQ ID NO：53)	ggtatttcCacacctccgtg	Some B *40，B *18，B *27，B *37，B *4202， B *5402，B *7301
			HLA-B13 (SEQ ID NO：54)	CgctgGagcgcgcG	B *41，B *42，B *08
HLA-B14 (SEQ ID NO：55)	caagGccCaGGcacag	Some B *07，B *42，B *54，B *55，B *56， B *670101，B *670102，B *81，B *82，B *83
			HLA-B15 (SEQ ID NO：56)	cgggTatgaccagGacg	B *0728，B *44，B *5704，B *8301
HLA-B16 (SEQ ID NO：57)	GtggagtCgctccgc	B *0720，B *1514，B *44，B *45，B *5002， B *5123，B *5707，B *82，B *83
			HLA-B17 (SEQ ID NO：58)	acagaAGtacaagCGccag	B *0713，B *46，B *6702
HLA-B18 (SEQ ID NO：59)	tccagagGatgtTTggctg	B *1506，B *1527，B *3523，B *4410，B *47， B *82
			HLA-B19 (SEQ ID NO：60)	tcTcccagcgcaagtTgg	Some B *40，B *4431，B *48，B *8101
HLA-B20 (SEQ ID NO：61)	acgacggcaaAgattacatcg	B *150102，B *1509，B *4026，B *4028，B *51， B *52，B *5605，B *5606，B *78
			HLA-B21 (SEQ ID NO：62)	cggGaGacacagatctCc	B *13, some B *15，B *1812，B *27, some B *35， B *37, some B *38，B *40，B *41，B *44，B *45， B *47，B *48，B *49，B *50，B *52，B *7805

(continued on next page)

(brought forward)

HLA-B22 (SEQ ID NO：63)	gacCtggggccCgac	B *0712，B *1520，B *1562，B *35，B *4024， B *4104, some B *44，B *45，B *4802，B *49, some B *50，B *53，B *5609，B *5705，B *58， B *82
			HLA-B23 (SEQ ID NO：64)	gttcgtgCggttcgaca	B *150104，B *54
HLA-B24 (SEQ ID NO：65)	cacaTcAtccagGTGatgtaTgg	B *4030，B *4034，B *57
			HLA-B25 (SEQ ID NO：66)	agcgaggAcgggtctc	B *73
HLA-B26 (SEQ ID NO：67)	ctacaccGcTAtgtcccG	B *82
			HLA-B27 (SEQ ID NO：68)	ggaaggacaAgctggagc	B *07
HLA-B28 (SEQ ID NO：69)	TggacgGcacccag	B *18
			HLA-B29 (SEQ ID NO：70	ctacaccGccgtgtcc	B *14，B *3805
HLA-B30 (SEQ ID NO：71)	gcttcatcAcCgtgggcta	B *13，B *1553，B *27 some B *40，B *41, some B *44，B *45, some B *49，B *50，B *73
			HLA-B31 (SEQ ID NO：71)	ggacctgAgctcctgg	B *13，B *14, some B *15，B *18, some B *27, some B *35，B *37，B *38，B *4026，B *4028， B *4035, some B *44，B *45，B *46，B *47， B *4802，B *49，B *50, some B *51，B *52， B *53，B *54, some B *55，B *56，B *57，B *58， B *59，B *67，B *78，B *82，B *83
HLA-B32 (SEQ ID NO：71)	cGCgcTcCgctactaca	Some B *13，B *1513，B *1516，B *15170101， B *15170102，B *1523，B *1524，B *1536， B *1567，B *1809，B *2701，B *2702，B *38， B *4013，B *4019, some B *44，B *49，B *51， B *52, some B *53，B *5607，B *57，B *58，B *59
			HLA-B33 (SEQ ID NO：74)	ggagggcACgtgcgt	B *0719，B *0731, some B *08，B *1306，B *14， B *1542，B *1544，B *1550，B *1569, some B *18，B *2715，B *3535, some B *37, some B *38，B *4039，B *41，B *42，B *4404，B *5121， B *54, some B *55，B *5610，B *5805，B *59， B *67

(continued on next page)

(brought forward)

HLA-E34 (SEQ ID NO：75)	cgagagaAcctgcggaTc	B *1513，B *1516，B *15170101，B *151702， B *1523，B *1524，B *1567，B *2702，B *3801， B *3805，B *3806，B *3807，B *3809，B *4013， B *4019，B *4406，B *4418，B *4425, some B *49，B *51，B *52, some B *53，B *57，B *58， B *59
			HLA-B35 (SEQ ID NO：76)	caccctccagTgGatgtatcc	Some, b *14, some B *58
HLA-B36 (SEQ ID NO：77	accctccagaATatgtaTggctg	Some B *27，B *3702，B *4704
			HLA-B37 (SEQ ID NO：78	agtccgagAGAggagccg	B *07，B *08，B *14, some B *15，B *27, some B *38，B *39，B *4012，B *42，B *48，B *55， B *56，B *59, some B *67，B *73，B *81，B *82， B *83
HLA-B38 (SEQ ID NO：79)	agaggatgtCTggctgcga	Some B *37，B *1532，B *1818，B *3909， B *5307
			HLA-B39 (SEQ ID NO：80)	tatttcTacaccTccGtgtccc	B *07，B *38, some B *42，B *48，B *5510，B *81
HLA-B40 (SEQ ID NO：81)	ggagcagGACagagccta	Some B *07，B *08，B *3538, some B *37，B *41， B *42, some B *44, some B *51，B *5709，B *82， B *83
			HLA-B41 (SEQ ID NO：82)	ggagcagCGGagagccta	B *07，B *0806，B *1403, some B *15，B *1813, some B *35, some B *40, some B *44, some B *51，B *5509, some B *57
HLA-B42 (SEQ ID NO：83)	cgTgtggcggagcagcTgaga	B *0726，B *13, some B *15，B *18，B *27， B *35，B *3702，B *38，B *39，B *40, some B *44，B *47，B *48, some B *51，B *5203， B *53，B *54, some B *55, some B *56, some B *57, some B *58，B *59，B *7804，B *81
			HLA-B43 (SEQ ID NO：84)	ggagcagTggagagccta	Some B *15，B *2725, some B *35，B *3918， B *5603
HLA-B44 (SEQ ID NO：85)	gacgccAcgagtccgagGAT	B *13, some B *15, some B *40，B *41, some B *44，B *45，B *47, some B *49，B *50
			HLA-B45 (SEQ ID NO：86)	tccgcagaCacctggag	B *14, some B *15, some B *18, some B *35， B *3704，B *4028, some B *51, some B *52, some B *53, some B *56，B *73, some B *78
HLA-B46 (SEQ ID NO：87)	cGgaAcATGaaggccTCC	Some B *15，B *57，B *58
			HLA-B47 (SEQ ID NO：88)	gggTaCCaccagGacgcc	Some B *15, some, B *27，B *3702，B *47
HLA-B48 (SEQ ID NO：89)	gagGACggagccCcgg	B *18，B *35，B *37, some B *39，B *51，B *52， B *53，B *58，B *78

Table 6 is used for determining the genotypic probe base sequence of HLA-Cw

The probe title	Base series	Active HLA type
			HLA-Cw01 (SEQ ID NO：90)	cggagtattgggaccgggagaca	All react with all types (positive control, exon 2)
HLA-Cw02 (SEQ ID NO：91)	catgaAgtatttctTcacATCcgtgtcc	Cw *01
			HLA-Cw03 (SEQ ID NO：92)	gaggtatttctCcacatccgtgt	Some Cw *04，Cw *14
HLA-Cw04 (SEQ ID NO：93)	agacggcacgattgagaca	Do not react with any kind (negative control)
			HLA-Cw05 (SEQ ID NO：94	tccgtgtccTggcccggc	Some Cw *04
HLA-Cw06 (SEQ ID NO：95)	cgcttcatcTcagtgggcta	Cw *01，Cw *0311，Cw *06，Cw *07，Cw *18
			HLA-Cw07 (SEQ ID NO：96)	agttcgtgcAgttcgacag	Cw *05，Cw *0605，Cw *08
HLA-Cw08 (SEQ ID NO：97)	tgaAcctgcggaaActgcg	Cw *02, some Cw *03，Cw *04，Cw *05， Cw *06, some Cw *07, some Cw *12，Cw *15， Cw *1602，Cw *17，Cw *18
			HLA-Cw09 (SEQ ID NO：98	gggccaggTtctcacaccA	Cw *17
HLA-Cw10 (SEQ ID NO：99)	cgcgggCatgaccag	Cw *15
			HLA-Cw11 (SEQ ID NO：100)	cgccctgaaTgaggacc	Cw *05，Cw *08
HLA-Cw12 (SEQ ID NO：101)	gcggacaAGgcggctcag	Cw *05, some Cw *08
			HLA-Cw13 (SEQ ID NO：102)	ggagcagTggagagcc	Some Cw *01, some Cw *02, some Cw *06， Cw *12，Cw *160401
HLA-Cw14	gagggcGAgtgcgtg	Cw *02，Cw *0608，Cw *0715，Cw *17

(continued on next page)

(brought forward)

(SEQ ID NO：103)
			HLA-Cw15 (SEQ ID NO：104)	gctccgcGgatacctg	Cw	*17
HLA-Cw16 (SEQ ID NO：105)	gatacctgAagaaTgggaagga	Cw					*03
			HLA-Cw17 (SEQ ID NO：106)	aggtatttcGAcacCGccgt	Cw	*06，Cw *07，Cw *18
HLA-Cw18 (SEQ ID NO：107)	cggcccgtACggcggagc	Some Cw *08
			HLA-Cw19 (SEQ ID NO：108)	agacacagaaCtacaagcgcc	Cw *0308, some Cw *07，Cw *1208，Cw *15
HLA-Cw20 (SEQ ID NO：109)	cagAggatgtTtggctgcg	Cw				*04，Cw *0708，Cw *1210，Cw *18
			HLA-Cw21 (SEQ ID NO：110)	gtctcacaTcctccagAggat	Some Cw *03, some Cw *07
HLA-Cw22 (SEQ ID NO：111)	tggaccgcGgcggacacg	Cw *120302，Cw *17
			HLA-Cw23 (SEQ ID NO：112)	caaggattacatcgccctgaa	All react with all types (positive control, exon 3)

Table 7 is used for determining the genotypic probe base sequence of HLA-DRB1/3/4/5

The probe title	Base sequence	Active HLA type
			HLA-DRN01 (SEQ ID NO：113)	gacagcgacgtggggggagt	All react with all types (positive control)
HLA-DRN02 (SEQ ID NO：114)	ctggagcagGcgcggg	B1				*15
			HLA-DRN03 (SEQ ID NO：115)	cggtatctgCacagaggca	B1		*09
HLA-DRN04 (SEQ ID NO：116)	ggcctgatgAGgagtactg	B1				*11
			HLA-DRN05 (SEQ ID NO：117)	acagcgacCAgggggag	Do not react with any kind (negative control)
HLA-DRN06 (SEQ ID NO：118)	caggataagtAtgagtgtcat	DRB5，B1 *15，B1 *16
			HLA-DRN07 (SEQ ID NO：119)	gttgctggaaagatGcatctataaccaag	B1	*01

(continued on next page)

(brought forward)

HLA-DRN08 (SEQ ID NO：120)	ggaaagacgcGtccataacca	B1 *10
			HLA-DRN09 (SEQ ID NO：121)	aggaggagCTcctgcgctt	B1 *12
HLA-DRN10 (SEQ ID NO：122)	TataaccaAgaggagtAcgtgcg	DRB4，B1 *01，B1 *04，B1 *08，B1 *09，B1 *10， B1 *11, some B1 *13
			HLA-DRN11 (SEQ ID NO：123)	ggagcgagtgTggaacctgat	DRB4，B1 *04，B1 *07，B1 *09，
HLA-DRN12 (SEQ ID NO：124)	tttcttcaaCgggacggag	DRB5，B1 *04，B1 *07，B1 *09，B1 *10
			HLA-DRN13 (SEQ ID NO：125)	tggagtactctacgKStgagtgt	B1 *03，B1 *08，B1 *11，B1 *12，B1 *13，B1 *14
HLA-DRN14 (SEQ ID NO：126)	ggaagacGAgcgggcc	Some B1 *13
			HLA-DRN15 (SEQ ID NO：127)	cctgCtgcGgagCactg	Some B1 *14
HLA-DRN16 (SEQ ID NO：128)	ggtggacaATtactgcagaca	DRB3，B1 *03，B1 *11，B1 *12，B1 *13，B1 *14
			HLA-DRN17 (SEQ ID NO：129)	tgGAgcagGttaaACAtgaGtgt	B1 *04
HLA-DRN18 (SEQ ID NO：130)	gGcCGggtggacaAc	B1 *03
			HLA-DRN19 (SEQ ID NO：131)	ccgAggtggacacctaTTg	DRB4，B1 *12, some B1 *14
HLA-DRN20 (SEQ ID NO：132)	aaccaGgaggagAAcgtgc	B1 *03, some B1 *14, some B1 *13
			HLA-DRN21 (SEQ ID NO：133)	gcagcctaagAgggagtgtca	B1 *15，B1 *16
HLA-DRN22 (SEQ ID NO：134)	tcctggaaagaCTcttctataacca	B1 *07
			HLA-DRN23 (SEQ ID NO：135)	cgggccCTggtggac	B1 *08
HLA-DRN24 (SEQ ID NO：136)	gacagatacttcCataaccaggagg	DRB3，B1 *03，B1 *12, some B1 *13，B1 *14， B1 *15，B1 *16

Table 8 is used for determining the genotypic probe base sequence of HLA-DRB1

The probe title	Base sequence	Active HLA type
			HLA-DRS01 (SEQ ID NO：113)	gacagcgacGTgggggagt	All react with all types (positive control)
HLA-DRS02 (SEQ ID NO：130)	gGcCGggtggacaAc	B1 *03
			HLA-DRS03 (SEQ ID NO：126)	ggaagacGAgcgggcc	Some B1 *13
HLA-DRS04 (SEQ ID NO：117)	acagcgacCAgggggag	Do not react with any kind (negative control)
			HLA-DRS05 (SEQ ID NO：133)	gcagcctaagAgggagtgtca	B1 *15，B1 *16
HLA-DRS 06 (SEQ ID NO：135)	cgggccCTggtggac	B1 *08
			HLA-DRS07 (SEQ ID NO：122)	TataaccaAgaggagtAcgtgcg	B1 *08，B1 *11, some B1 *13
HLA-DRS08 (SEQ ID NO：137)	CataaccaGgaggagtTcgtg	B1 *15，B1 *16, some B1 *14
			HLA-DRS09 (SEQ ID NO：114)	ctggagcagGcgcggg	B1 *15
HLA-DRS10 (SEQ ID NO：116)	ggcctgatgAGgagtactg	B1 *11
			HLA-DRS11 (SEQ ID NO：132)	aaccaGgaggagAAcgtgc	B1 *03, some B1 *14, some B1 *13
HLA-DRS12 (SEQ ID NO：138)	cagaaggacCtcctggagc	B1 *03, some B1 *14
			HLA-DRS13 (SEQ ID NO：139)	cctggaAGaCaggcgc	B1 *16，B1 *08，B1 *11，B1 *12, some B1 *13
HLA-DRS14 (SEQ ID NO：121)	aggaggagCTcctgcgctt	B1 *12
			HLA-DRS15 (SEQ ID NO：140)	cagaaggacAtcctggaagac	B1 *12, some B1 *13
HLA-DRS16 (SEQ ID NO：131)	ccgAggtggacacctaTTg	Some B1 *12, some B1 *14
			HLA-DRS17 (SEQ ID NO：125)	tggagtactctacgKStgagtgt	B1 *08，B1 *12

(continued on next page)

(brought forward)

HLA-DRS18 (SEQ ID NO：136)	gacagatacttcCataaccaggagg	B1	*03，B1 *12，B1 *15，B1 *16, some B1 *13， B1 *14
				HLA-DRS19 (SEQ ID NO：127)	cctgCtgcGgagCactg	Some B1 *14

Embodiment 4: preparation HLA oligonucleotide chip

1) in the preparation of oligonucleotide chip, uses the aldehyde radical slide of NuricellInc. (Korea S) or CellInc. (U.S.).The probe of the connection amino of 100pmole/ μ l is mixed with the 3X SSC of equivalent.Resulting probe stationary was also at room temperature reacted 16 hours on slide.Clean this slide 2 times with 0.2% SDS then, each 5 minutes, then clean 2 times each 5 minutes with distilled water.After cleaning 2 minutes with the distilled water that is heated to 95 ℃, cleaned 5 minutes with the distilled water of room temperature.

2) this slide and sodium borohydride (1.3g NaBH ₄, 375ml PBS and 125ml 100%EtOH) and reaction is after 5 minutes, and the SDS with 0.2% cleans three times, and each 1 minute, clean twice with distilled water, each 1 minute, at room temperature dry then.

3) be partitioned into reactive tank on the slide by Coverwell Perfusion Chamber (SIGMA, the U.S.) is connected, be used for 5 kinds of each autoreactions of reactant of HLA PCR.Before use the HLA oligonucleotide chip of making is stored in the dark place under room temperature.

Embodiment 5: with the hybridization of HLAPCR product

1) will combine the HLAPCR product of rhodamine or vitamin H and hybridization solution (3X SSC and 0.3%SDS) with 1: 9 mixed.When using vitamin H to cause fluorescent reaction, add 1 μ l/ml streptavidin-cyanin and react.

2) in the reaction chamber with cover of slide, drip 90 μ l hybridization buffers.This slide reacted 1 hour down at 62 ℃.

3) at room temperature cleaned this slide 5 minutes, cleaned 2 minutes with 0.1X SSC with 1X SSC, at room temperature dry then.

4) qualification result

Use Scanner (GenePiX4000, Axon instrument company, the U.S.) analysis of fluorescence probe so that the HLA genotype is identified.HLA gene type program with contriver's exploitation is analyzed it.

In the base sequence shown in table 4～7, the middle base of being represented by capitalization is most important base sequence.With described base is the center, has synthesized the probe of about 13～30bp, its definite 60-65 ℃ of reflecting Tm and GC%.

The result is as shown in Fig. 2 to 6.Among the figure, in PCR and hybridization, use fluorescent primer and probe.Use GenePiX4000 Scanner (Axon instrument company, the U.S.) analysis of fluorescence probe, so that the HLA genotype is identified.Use is analyzed it by the HLA gene type program of contriver's exploitation.

HLA gene type program is analyzed by the result to the probe of each chamber of being arranged in HLA oligonucleotide chip of the present invention, forms a suitable standardized method.This program forms region intermediate, and it has been introduced and can divide positive and negative this notion of threshold.We judge that based on described threshold probe is the positive or feminine gender.Synopsis by the positive that will work out in the positive or negative of probe and the program and negative type is relatively analyzed mutually deserved HLA genotype, and the HLA genotype is identified.

Industrial application

Among the present invention, developed a kind of oligonucleotide microarray, by analyze the HLA gene be used for diagnosing HLA-A ,-B, Cw and DR genotype. Use the HLA Genotyping of this chip, compare with normally used kit, can save plenty of time, material cost and cost of labor. Namely, HLA DNA chip of the present invention only by once the experiment just can show HLA-A ,-B, Cw and DR genotype, and because closely so stationary probe only needs 1 slide for a large amount of HLA allele, and common detection method and kit can not analyze simultaneously HLA-A ,-B, Cw and DR genotype, therefore experiment must be carried out respectively. In addition, method of the present invention has been used fluorescent material, the step that does not therefore need color to produce. Method of the present invention does not need the necessary many steps of usual method such as cleaning, color reaction etc. yet, and therefore method of the present invention can be saved the result that the plenty of time obtains expecting.

Sequence table

＜110〉Biocore Co., Ltd.

Ji Nuoqieke company limited

＜120〉be used to analyze genotypic oligonucleotide composition of human leucocyte antigen (HLA) and detection method thereof

<130>PCT04-032

<150>KR1020040020155

<151>2004-03-24

<160>157

<170>KopatentIn 1.71

<210>1

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 01)

<400>1

gtgggctacg tggacgaca 19

<210>2

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 02)

<400>2

gcgagccaga agatggagcc 20

<210>3

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 03)

<400>3

ctgaccgagc gaacctg 17

<210>4

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 04)

<400>4

attgggacgg ggagaca 17

<210>5

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 05)

<400>5

attgggaccg ggagaca 17

<210>6

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 06)

<400>6

tgcgctctgt gaccgc 16

<210>7

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 07)

<400>7

attgggacga ggagaca 17

<210>8

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 08)

<400>8

ggatcgcgct ccgctacta 19

<210>9

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 09)

<400>9

gggaccggaa cacacgg 17

<210>10

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 10)

<400>10

ttgggacctg cagacacgg 19

<210>11

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 11)

<400>11

gcaggagagg cctgagtat 19

<210>12

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 12)

<400>12

ctgaccgaga gagcctg 17

<210>13

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 13)

<400>13

cagattgacc gagtggacct g 21

<210>14

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 14)

<400>14

cagactgacc gagtggacct g 21

<210>15

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 15)

<400>15

ctgaccgagt ggacctg 17

<210>16

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 16)

<400>16

actcgcagtt cgtgcagtt 19

<210>17

<211>14

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 17)

<400>17

gagggccggt gcgt 14

<210>18

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 18)

<400>18

cgtggagtgg ctccgc 16

<210>19

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 19)

<400>19

tacctggatg gcacgtgc 18

<210>20

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 20)

<400>20

ccagatgatg tttggctgc 19

<210>21

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 21)

<400>21

tggagggcac gtgcgt 16

<210>22

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 22)

<400>22

tggatggcac gtgcgt 16

<210>23

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 23)

<400>23

ggagcagcag agagccta 18

<210>24

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 24)

<400>24

caccatccag aggatgtatg gc 22

<210>25

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 25)

<400>25

caccatccag atgatgtatg gc 22

<210>26

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 26)

<400>26

cagatcaccc agcgcaag 18

<210>27

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A27)

<400>27

gagacggccc atgaggc 17

<210>28

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 28)

<400>28

gaggcggccc atgaggc 17

<210>29

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A29)

ttacatcgcc ttgaacgagg 20

<210>30

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 30)

<400>30

ttacatcgcc ctgaacgagg 20

<210>31

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 31)

<400>31

gcgggtatga acagcacgc 19

<210>32

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 32)

<400>32

ccatccagat gatgtatggc 20

<210>33

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 33)

<400>33

ccatccagat aatgtatggc 20

<210>34

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 34)

<400>34

agcagtggag agcctacc 18

<210>35

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 35)

<400>35

ctcagaccac caagcacaag tg 22

<210>36

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 36)

<400>36

tcacaccgtc cagaggatgt atg 23

<210>37

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 37)

<400>37

tcacaccctc cagaggatgt atg 23

<210>38

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 38)

<400>38

tcacaccatc cagaggatgt atg 23

<210>39

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 39)

<400>39

gggtcggact ggcgc 15

<210>40

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 40)

<400>40

gggt cggacg ggcgc 15

<210>41

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-A genotype (HLA-A 41)

<400>41

ctgcgctctt ggaccgcg 18

<210>42

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 42)

<400>42

gccctcccgt tgattggag 19

<210>43

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 02)

<400>43

gcagctgaga acctacctg 19

<210>44

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 03)

<400>44

tatttcgaca ccgccatgtc 20

<210>45

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 04)

<400>45

cacccagctc aagtggg 17

<210>46

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 05)

<400>46

ggccggaata ttgggacc 18

<210>47

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 06)

<400>47

agacggcacg attgagaca 19

<210>48

<211>14

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 07)

<400>48

aggatggcgc cccg 14

<210>49

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 08)

<400>49

tagagcaaga ggggccg 17

<210>50

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 09)

<400>50

atctgcaagg ccaaggc 17

<210>51

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 10)

<400>51

gacttaccga gaggacctg 19

<210>52

<211>20

<212>DNA

＜213〉artificial sequence

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B11)

<400>52

gtatttccac accgccatgt 20

<210>53

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 12)

<400>53

ggtatttcca cacctccgtg 20

<210>54

<211>14

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 13)

<400>54

cgctggagcg cgcg 14

<210>55

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 14)

<400>55

caaggcccag gcacag 16

<210>56

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 15)

<400>56

cgggtatgac caggacg 17

<210>57

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 16)

<400>57

gtggagtcgc tccgc 15

<210>58

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 17)

<400>58

acagaagtac aagcgccag 19

<210>59

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 18)

<400>59

tccagaggat gtttggctg 19

<210>60

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 19)

<400>60

tctcccagcg caagttgg 18

<210>61

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 20)

<400>61

acgacggcaa agattacatc g 21

<210>62

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 21)

<400>62

cgggagacac agatctcc 18

<210>63

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 22)

<400>63

gacc tggggc ccgac 15

<210>64

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 23)

<400>64

gttcgtgcgg ttcgaca 17

<210>65

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 24)

<400>65

cacatcatcc aggtgatgta tgg 23

<210>66

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 25)

<400>66

agcgaggacg ggtctc 16

<210>67

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 26)

<400>67

ctacaccgct atgtcccg 18

<210>68

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 27)

<400>68

ggaaggacaa gctggagc 18

<210>69

<211>14

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 28)

<400>69

tggacggcac ccag 14

<210>70

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 29)

<400>70

ctacaccgcc gtgtcc 16

<210>71

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 30)

<400>71

gcttcatcac cgtgggcta 19

<210>72

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 31)

<400>72

ggacctggc tcctgg 16

<210>73

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 32)

<400>73

cgcgctccgc tactaca 17

<210>74

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 33)

<400>74

ggagggcacg tgcgt 15

<210>75

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 34)

<400>75

cgagagaacc tgcggatc 18

<210>76

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 35)

<400>76

caccctccag tggatgtatc c 21

<210>77

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 36)

<400>77

accctccaga atatgtatgg ctg 23

<210>78

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 37)

<400>78

agtccgagag aggagccg 18

<210>79

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 38)

<400>79

agaggatgtc tggctgcga 19

<210>80

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 39)

<400>80

tatttctaca cctccgtgtc cc 22

<210>81

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 40)

<400>81

ggagcaggac agagccta 18

<210>82

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 41)

<400>82

ggagcagcgg agagccta 18

<210>83

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 42)

<400>83

cgtgtggcgg agcagctgag a 21

<210>84

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 43)

<400>84

ggagcagtgg agagccta 18

<210>85

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 44)

<400>85

gacgccacga gtccgaggat 20

<210>86

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 45)

<400>86

tccgcagaca cctggag 17

<210>87

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 46)

<400>87

cggaacatga aggcctcc 18

<210>88

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 47)

<400>88

gggtaccacc aggacgcc 18

<210>89

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-B genotype (HLA-B 48)

<400>89

gaggacggag ccccgg 16

<210>90

<21t>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 01)

<400>90

cggagtattg ggaccgggag aca 23

<210> 91

<211>28

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 02)

<400>91

catgaagtat ttcttcacat ccgtgtcc 28

<210>92

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 03)

<400>92

gaggtatttc tccacatccg tgt 23

<210>93

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 04)

<400>93

agacggcacg attgagaca 19

<210>94

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 05)

<400>94

tccgtgtcct ggcccggc 18

<210>95

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 06)

<400>95

cgcttcatct cagtgggcta 20

<210>96

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 07)

<400>96

agttcgtgca gttcgacag 19

<210>97

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 08)

<400>97

tgaacctgcg gaaactgcg 19

<210>98

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 09)

<400>98

gggccaggtt ctcacacca 19

<210>99

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 10)

<400>99

cgcgggcatg accag 15

<210>100

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 11)

<400>100

cgccctgaat gaggacc 17

<210>101

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 12)

<400>101

gcggacaagg cggctcag 18

<210>102

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 13)

<400>102

ggagcagtgg agagcc 16

<210>103

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 14)

<400>103

gagggcgagt gcgtg 15

<210>104

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 15)

<400>104

gctccgcgga tacctg 16

<210>105

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw16)

<400>105

gatacctgaa gaatgggaag ga 22

<210>106

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 17)

<400>106

aggtatttcg acaccgccgt 20

<210>107

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 18)

<400>107

cggcccgtac ggcggagc 18

<210>108

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 19)

<400>108

agacacagaa ctacaagcgc c 21

<210>109

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 20)

<400>109

cagaggatgt ttggctgcg 19

<210>110

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 21)

<400>110

gtctcacatc ctccagagga t 21

<210>111

<211>18

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 22)

<400>111

tggaccgcgg cggacacg 18

<210>112

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-Cw genotype (HLA-Cw 23)

<400>112

caaggattac atcgccctga a 21

<210>113

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-DR genotype (HLA-DRN 01)

<400>113

gacagcgacg tgggggagt 19

<210>114

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉be used to analyze the probe of HLA-DR genotype (HLA-DRN 02)

<400>114

ctggagcagg cgcggg 16

<210>115

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 03 probe

<400>115

cggtatctgc acagaggca 19

<210>116

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 04 probe

<400>116

ggcctgatga ggagtactg 19

<210>117

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 05 probe

<400>117

acagcgacca gggggag 17

<210>118

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 06 probe

<400>118

caggataagt atgagtgtca t 21

<210>119

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 07 probe

<400>119

gttgctggaa agatgcatct ataaccaag 29

<210>120

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 08 probe

<400>120

ggaaagacgc gtccataacc a 21

<210>121

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 09 probe

<400>121

aggaggagct cctgcgctt 19

<210>122

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 10 probes

<400>122

tataaccaag aggagtacgt gcg 23

<210>123

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 11 probes

<400>123

ggagcgagtg tggaacctga t 21

<210>124

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 12 probes

<400>124

tttcttcaac gggacggag 19

<210>125

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 13 probes

<400>125

tggagtactc tacgkstgag tgt 23

<210>126

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 14 probes

<400>126

ggaagacgag cgggcc 16

<210>127

<211>17

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 15 probes

<400>127

cctgctgcgg agcactg 17

<210>128

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 16 probes

<400>128

ggtggacaat tactgcagac a 21

<210>129

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 17 probes

<400>129

tggagcaggt taaacatgag tgt 23

<210>130

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 18 probes

<400>130

ggccgggtgg acaac 15

<210>131

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 19 probes

<400>131

ccgaggtgga cacctattg 19

<210>132

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 20 probes

<400>132

aaccaggagg agaacgtgc 19

<210>133

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 21 probes

<400>133

gcagcctaag agggagtgtc a 21

<210>134

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 22 probes

<400>134

tcctggaaag actcttctat aacca 25

<210>135

<211>15

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 23 probes

<400>135

cgggccctgg tggac 15

<210>136

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRN 24 probes

<400>136

gacagatact tccataacca ggagg 25

<210>137

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRS 08 probe

<400>137

cataaccagg aggagttcgt g 21

<210>138

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRS 12 probes

<400>138

cagaaggacc tcctggagc 19

<210>139

<211>16

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRS 13 probes

<400>139

cctggaagac aggcgc 16

<210>140

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRS 15 probes

<400>140

cagaaggaca tcctggaaga c 21

<210>141

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-A exon 2 sense primer

<400>141

aaaccgcctc tgyggggaga agcaa 25

<210>142

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-A exon 2 antisense primer

<400>142

gatctcggac ccggagactg tgg 23

<210>143

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-A exon 3 sense primer

<400>143

tcsgggccag gttctcacac c 21

<210>144

<211>25

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-A exon 3 antisense primer

<400>144

gtgttggtcc caattgtctc ccctc 25

<210>145

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-B exon 2 sense primer

<400>145

gctcccactc catgaggtat 20

<210>146

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-B exon 2 antisense primer

<400>146

taracgcgcc tgggsctctc g 21

<210>147

<211>22

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-B exon 3 sense primer

<400>147

tacccggttt cattttcagt tg 22

<210>148

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-B exon 3 antisense primer

<400>148

attctccatt caasggaggg cgac 24

<210>149

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-Cw exon 2 sense primer

<400>149

ctcccactcc atgargtatt t 21

<210>150

<211>21

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-Cw exon 2 antisense primer

<400>150

taaaggygac tggggctctc t 21

<210>151

<211>24

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-Cw exon 3 sense primer

<400>151

tttacccggt ttcattttca gttt 24

<210>152

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-Cw exon 3 antisense primer

<400>152

gctgatccca ttttcctccc ctc 23

<210>153

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRB 1/3/4/5 exon 2 sense primer

<400>153

tccccacagc acgtttcttg 20

<210>154

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRB1/3/4/5 exon 2 antisense primer

<400>154

ccgctgcact gtgaagctct 20

<210>155

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRB1 exon 2 justice-1 primer

<400>155

tcctgtggca gcctaagagg 20

<210>156

<211>27

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRB1 exon 2 justice-2 primer

<400>156

agcacgtttc ttggagtact ctacgtc 27

<210>157

<211>26

<212>DNA

＜213〉artificial sequence

<220>

＜223〉HLA-DRB1 exon 2 justice-3 primer

<400>157

gcacgtttct tggagtactc tacggg 26

Claims (7)

1. one kind contains a plurality of compositions that are used to analyze the genotypic oligonucleotide probe of HLA, it is characterized by, described composition comprises that at least one is selected from the probe groups of the group that is made of following probe groups: be used to analyze the probe groups that the genotypic probe of HLA-A is formed by at least two, its probe is selected from the group of being made up of SEQID NO:1-41; Be used to analyze the probe groups that the genotypic probe of HLA-B is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ ID NO:42-89 is formed; Be used to analyze the probe groups that the genotypic probe of HLA-Cw is formed by at least two, its probe is selected from the group that the base sequence represented by SEQ IDNO:90-112 is formed; Be used to analyze the probe groups that the genotypic probe of HLA-DR is formed by at least two, its probe is selected from the group that base sequence that SEQ ID NO:113-140 represents is formed.

2. test upholder, it comprises probe compositions according to claim 1 and upholder, it is characterized by, described probe compositions is fixed on the described upholder.

3. upholder according to claim 2, wherein, described upholder is selected from the group of being made up of filter membrane, band, microballoon, chip, slide, porous plate, film, optical fiber.

4. at least one is selected from the primer of being analyzed the group that the genotypic base sequence of HLA forms by SEQ ID NO:141-157 being used to of representing, and wherein said primer is used to detect the hybridization between probe according to claim 1 and 2 and the target gene.

5. primer according to claim 4, wherein, the antisense primer that is selected from the group of being made up of the base sequence of SEQ ID NO:142,144,146,148,150,152 and 154 expressions combines with vitamin H or combines with rhodamine.

6. primer according to claim 5, wherein, in conjunction with antisense primer and streptavidin-cyanin interaction of vitamin H.

7. analyze the genotypic method of HLA for one kind, it may further comprise the steps:

(a) preparation HLA DNA from blood, cell and tissue;

(b) use the DNA of preparation to carry out asymmetric PCR;

(c) probe according to claim 1 and 2 is combined with the asymmetric PCR product;

(d) identify resulting combination;

(e) by using the certified combination of HLA somatotype programanalysis.

Images