CN1952171A - Gene detection chip for determining pheochromocytoma-related gene and application thereof - Google Patents

Abstract

The invention provides gene chips for detecting affectability of chromaffin tumor, containing the gene chip kit and method for detecting different genotypes of four genes using the gene chip or kit and software for analyzing chip image. The products and methods of the invention can be used for detecting pheochromocytoma related gene mutation, providing necessary information for the treatment and prognosis of pheochromocytoma.

Description

A kind of gene detecting chip of measuring pheochromocytoma-related gene and uses thereof that is used to

Technical field

The invention belongs to the gene engineering field, relate to a kind of gene analysis test product, more specifically, the present invention relates to be applicable to and measure and the relevant genotypic gene detecting chip of gene (RET, SDHB, SDHD and VHL) of pheochromocytoma morbidity, the invention still further relates to the genotypic method of described gene (RET, SDHB, SDHD and VHL) of measuring.

Background technology

Pheochromocytoma is the tumour of adrenal medulla and the outer chromaffin tissue of suprarenal gland, originates from embryo's neural crest, is the autonomic nervous system tumour.This disease mostly is distributes, also can show as familial, the latter is relevant with heredity, there is corresponding embryonal system susceptibility gene mutation, except that simple familial pheochromocytoma, also comprise multiple endocrine adenomatosis 2 types (the multipleendocrine neoplasia type 2 that causes by RET (Rearranged during Transfection) sudden change, MEN-2), von Hippel-Lindau (VHL) disease that the vhl gene sudden change causes, I type neurofibroma (NF1), paraganglionic cell knurl and SDH (oxphos enzyme complex II, have another name called succinodehydrogenase,) tumour [the Koch CA of gene-correlation, Vortmeyer AO, Huang SC, Deng, Genetic aspects of pheochromocytoma.Endocr Regul.2001; 35 (1): 43-52.Review.Opocher G, Schiavi F, Conton P, etc., Clinical and genetic aspects ofphaeochromocytoma.Horm Res.2003; 59 Suppl 1:56-61.].Compare with the type of distributing, genotype patient's age of onset morning, poor prognosis, early diagnosis and control have crucial effects for improving survival rate.

1、RET

MEN-2 is a kind of monogenic disease of autosomal dominant inheritance.Can be divided into 3 kinds of hypotype: MEN-2A according to its clinical manifestation, and MEN-2B and familial medullary thyroid cancer (Familial medullary thyroidcarcinoma, FMTC).MEN-2A type (Sipple syndrome) is the most common, and clinical manifestation is medullary thyroid carcinoma (nearly 100%), pheochromocytoma (50%), and parathyroid adenoma or hyperplasia (20%); The MEN-2B type accounts for 5% of MEN-2, shows as medullary thyroid carcinoma, pheochromocytoma, and some special signs; FMTC patient only has medullary thyroid carcinoma [Takami H.Medullary thyroid carcinoma andmultiple endocrine neoplasia type 2.Endocr Pathol.2003; 14 (2): 123-31; Yip L, CoteGJ, Shapiro SE waits .Multiple endocrine neoplasia type 2:evaluation of thegenotype-phenotype relationship.Arch Surg.2003; 138 (4): 409-16.].

Patient's MEN-2 early stage clinical manifestation is a medullary thyroid carcinoma.Data shows that C hyperplasia is found in the baby at 20 monthly ages, and the pathological change of small medullary thyroid carcinoma is found in 3 years old children, and pathology shifts and can take place 6 years old children, and 90% above patient had the clinical manifestation of medullary thyroid carcinoma before 25 years old.This sick early diagnosis and control are the keys that improves survival rate.

Genetics research shows that the RET transgenation is the pathologic basis of MEN-2.This gene is positioned at 10q 11.2, the about 55kb of total length, contain 21 exons, the protein expression thing has 3 kinds of hypotypes, be tyrosine kinase receptor (RTK) superfamily member, [Kurokawa K, Kawai K play an important role in the normal development of kidney and peripheral nervous system, Hashimoto M etc., Cell signaling and gene expressionmediatedby RET tyrosine kinase.J Intern Med.2003; 253 (6): 627-33.].The mutation type of having found the RET gene so far has 169 kinds (almost all there is sudden change in each exon), these sudden changes are relevant with multiple disease, comprise: MEN-2, Hirschsprung disease, total colectomy aganglionosis, sporadic medullary thyroid cancer, congenital central hypoventilation syndromes (Congenital central hypoventilationsyndrome, CCHS) and pheochromocytoma etc.Mutational site difference in the different RET relative diseases, MEN-2A (25 kinds) wherein, MEN-2B (5 kinds), Hirschsprung disease (101 kinds), total colectomy aganglionosis (7 kinds), medullary thyroid carcinoma (31 kinds).External MEN-2 family has been reported 500 many cases, example surplus domestic patient only finds 10 at present, mutation rate [the Januszewicz A that 4.8-7.8% is arranged in sporadic pheochromocytoma case, Neumann HP, Lon I, Deng, Incidence and clinical relevance of RETproto-oncogene germline mutations in pheochromocytoma patients.J Hypertens.2000; 18 (8): 1019-23.Neumann HP, Bausch B, McWhinney SR, etc., Germ-linemutations in nonsyndromic pheochromocytoma.N Engl J Med.2002; 346 (19): 1459-66.].

The sudden change of MEN-2A 85% occur in the 10th and the halfcystine of o.11 exons coding be rich in the district, promptly the 609th, 611,61 8,620,630 and 634 bit codons are other amino acid by the cysteine mutation of high conservative.In addition, also there be the mutational site relevant the 13rd with No. 14 exon with MEN-2A.

The Kim of Korea S etc. has developed a kind of 9 sites of RET gene of can detecting, the chip of 57 kinds of point mutation modes [Kim IJ, Kang HC, Park JH etc., RET oligonucleotide microarray for thedetection of RET mutations in multiple endocrine neoplasia type 2 syndromes.ClinCancer Res.2002; 8 (2): 457-63.], but its information content is limited, and the transgenation of different ethnic groups and disease-related rule are different.

The special germ line mutation of 94% MEN-2B occurs in the Tyrosylprotein kinase district of No. 16 exons coding, and promptly the 918th bit codon sports Threonine (M918T) by methionine(Met).The mutant serine that also has sudden change to betide the 922nd bit codon is tyrosine [Kalinin VN, Amosenko FA, Shabanov MA etc., Three novel mutations in the RET proto-oncogene.J Mol Med.2001; 79 (10): 609-12.].

About 20% the type that distributes pheochromocytoma exists RET gene halfcystine to be rich in the sudden change in district or Tyrosylprotein kinase district, and halfcystine is rich in the district can the sudden change of non-cysteine residues and disappearance [the Beldjord C etc. of No. 10 exons, J Clin EndocrinolMetab, 1995,80:206322068.].

2、SDH

SDH is one of key enzyme in tricarboxylic acid cycle and the aerobic electrontransport resplratory chain, comprises A, B, C, a D4 subunit.Subunit A (SDHA, flavoprotein) and B (SDHB, iron-sulphur protein) form enzyme contact center, and C of subunit (SDHC) and D (SDHD) form compound enzyme II anchorage zone in the mitochondrial membrane, and 4 subunits are respectively by 4 genes encodings.

The SDHB assignment of genes gene mapping is in 1p36.1-p35, and genomic dna comprises nearly 40kb, 8 exons, and there are 252 amino acid in coding iron-sulphur protein subunit.

The SDHC assignment of genes gene mapping is in 1q21, and genomic dna comprises nearly 50kb, 6 exons, coding succsinic acid.Cytochrome b large subunit (cybL) in the CoQ oxide-reductase has 140 amino acid.

Sdhd gene is positioned 11q23, and genomic dna comprises 19kb, 4 exons and 3 introns, and 4 exon base pairs are respectively 52b, 117b, 145b, 163b, the coding succsinic acid.There are 103 amino acid in the little subunit of cytochrome b (cybS) in the CoQ oxide-reductase.

Many researchs have found that (hereditary paraganglioma, PGL) relevant with the pheochromocytoma generation, it is its possible mechanism that mitochondrial function causes carcinogenesis unusually for SDHD, SDHC, SDHB transgenation and familial chromaffinoma.It is optimum that the PGL that these transgenations cause mostly is the neural crest deutero-, poky neuroectodermal tumors, the height vascularization is its principal feature, may be because the SDH transgenation makes plastosome oxygen sensing pathway unusual, cause histanoxia, by the generation of increase reactive oxygen species (ROS) and then under the effect of hypoxia inducible factor-1 (HIF-1), activate erythropoietin (EPO), vascular endothelial growth factor (VEGF) and isogenic the transcribing of acceptor (VEGFR) thereof, the participation tumor vessel forms, [the Favier J of in the pathogenesis of pheochromocytoma, may playing a role, Briere JJ, Strompf L, Deng, Hereditary paraganglioma/pheochromocytoma and inherited succinatedehydrogenase deficiency.Horm Res.2005; 63 (4): 171-9.Review.Pawlu C, BauschB.Neumann HP.Mutations of the SDHB and SDHD genes.Fam Cancer.2005; 4 (1): 49-54.Review.Bertherat J, Gimenez-Roqueplo AP.New insights in thegenetics of adrenocortical tumors, pheochromocytomas and paragangliomas.HormMetab Res.2005; 37 (6): 384-90.Review.].

The SDHB transgenation of having found at present has 30 kinds, and at least 20 kinds relevant with pheochromocytoma; The sdhd gene sudden change has 37 kinds, and at least 10 kinds relevant with pheochromocytoma.[Gimenez-Roqueplo AP, Favier J, Rustin P, etc., Mutations in the SDHB gene are associated with extra-adrenaland/or malignant phaeochromocytomas.Cancer Res.2003; 63 (17): 5615-21; Astuti D, Latif F, Dallol A, Deng, Gene mutations in the succinate dehydrogenase subunitSDHB cause susceptibility to familial pheochromocytoma and to familialparaganglioma.Am J Hum Genet.2001; 69 (1): 49-54; Astuti D, Douglas F, LennardTW, etc., Germline SDHD mutation in familial phaeochromocytoma.Lancet.2001; 357 (9263): 1181-2.Astuti D, Douglas F, Lennard TW, etc.]

3、VHL

The VHL disease that the vhl gene sudden change causes is a kind of autosomal dominant inheritance neoplastic syndrome, mainly shows as retina and central nervous system bilateral multicenter hemangioblastoma (hemangioblastoma), pheochromocytoma, kidney and kidney, pancreas and cyst of epididymis etc.Be divided into 1 type (nonjoinder pheochromocytoma) and 2 types (merging pheochromocytoma) again according to whether merging pheochromocytoma, sickness rate is neonatal 1/36,000,18% pheochromocytoma to be arranged, and often is bilateral.Vhl gene belongs to cancer suppressor gene, is positioned 3p25-26, and 3 exons are arranged, and 2 kinds of albumen (pVHL): pVHL encodes ₁₉And pVHL ₃₀Contain 160 and 213 amino acid respectively.PVHL and transcriptional elongation factor B, C and CUL2 (VHL genes involved) form complex body together, participate in regulating the extension process of rna plymerase ii, and be relevant with mRNA stability; In addition, the inactivation of pVHL gene causes the forfeiture of ubiquinone process, raising the gene (as VEGF) of hypoxia inducible simultaneously expresses, promote vasculogenesis, the VHL inactivation causes the HIF functional disorder, may be to cause one of mechanism that pheochromocytoma takes place [Kim WY, Kaelin WG.Role of VHL gene mutation in human cancer.J Clin Oncol.2004; 22 (24): 4991-5004.Review.Gimm O.Pheochromocytoma-associatedsyndromes:genes, proteins and functions of RET, VHL and SDHx.Fam Cancer.2005; 4 (1): 17-23.Review.].

Found at present to surpass 300 kinds vhl gene sudden change, intersperse among in the whole gene, the sudden change relevant with pheochromocytoma is above 30, American-European research is thought in the hereditary paraganglioma, much more the vhl gene sudden change sees [Neumann HP, Cybulla M, Shibata H, New genetic causes ofpheochromocytoma:current concepts and the clinical relevance.Keio J Med.2005; 54 (1): 15-21.Review.].

Polymerase chain reaction-sub-thread chain conformation polymorphism (PCR-SSCP), craft or methods such as automatic sequencing, heteroduple analysis are adopted in present R﹠D institution's scientific research, all these need pass through the electrophoresis link, complex operation not only, sense cycle is long, and the factor of influence detection process is many, wayward, be difficult to satisfy the requirement of Clinical Laboratory, make the clinical detection that also can't carry out relevant pheochromocytoma susceptible check so far.

Gene chip is one of great science and technology progress of the tool characteristics of the times that occurred in high-tech area in recent years, a kind of while, one or more relevant all Disease-causing genes of monogenic disease of rapid detection, the method in all mutational sites are provided, it is many to be particularly useful for the mutational site, and is dispersed in the genopathy that distributes or may be caused by different Disease-causing genes.It is the gene probe (oligonucleotide probe, cDNA clone, PCR product etc.) with a large amount of gene informations in the energy reflected sample, being fixed on solid phase carrier (as the slide glass of aldehyde radical, amino, sulfydryl, carboxyl isoreactivity base group modification or silicon chip, nylon membrane, nitrocellulose filter) in order goes up and forms array, by carrying out hybridization with actual sample (or amplified production), only need once experiment, but obtain the information of all genes to be checked with regard to high-throughput.The characteristics of this parallel detection, high information flux make its application at aspects such as genetic expression, gene pleiomorphism detections be subjected to extensive attention.

Pheochromocytoma is the major reason that causes endocrine hypertension, can take place separately, also can be a kind of phenotype of other diseases (as MEN-2, VHL disease).Its clinical manifestation is intricate, and conventional antihypertensive therapy effect is not good enough, and can cause the serious heart, cerebrovascular complication.But, be recoverable if clarify a diagnosis in early days.

According to China grow up the sickness rate (about 1%) of crowd's hypertension morbidity and pheochromocytoma estimate [the history cyclophanes chief editor that is lost. the consonance E﹠M is learned. Science Press's 1999 first versions], the nearly 1,600,000 pheochromocytoma patients of China, with RET is example, has 7.7-12.5 ten thousand patients may carry the RET mutator gene approximately.This means that the part clinical diagnosis is that the patient of sporadic pheochromocytoma may pass to filial generation with the RET mutator gene, has 90% carrier will develop into medullary thyroid carcinoma.All need to carry out the detection of transgenation for carrier and relatives thereof, to determine the transmission situation of mutator gene, control early.Yet for a long time, owing to lack conveniently early diagnosis means and effective differential diagnosis method, the patient often misses best occasion for the treatment and correct treatment measure, and the crowd who carries Disease-causing gene in its family can not get correct control.

At present, for large sample, the pheochromocytoma pathogenic related gene of polygene, multi-mutant site detects, and directly adopts sequencing to detect that mutation time is long, cost is big, efficient is low, and is obviously not competent.Therefore, press in the prior art a kind of can be fast, convenient, high-throughput carries out the Method and kit for that the sudden change of pheochromocytoma pathogenic related gene detects.

Summary of the invention

The object of the present invention is to provide a kind of can be fast, convenient, high-throughput carries out the Method and kit for that the sudden change of pheochromocytoma pathogenic related gene detects.Particularly, the invention provides the cause a disease gene detecting chip of relevant RET, SDHB, SDHD and vhl gene type of rapid determination and pheochromocytoma.

In a first aspect of the present invention, a kind of gene chip that is used to measure the pheochromocytoma susceptibility is provided, it comprises solid phase carrier and is fixed in oligonucleotide probe on the described solid phase carrier in order that described oligonucleotide probe comprises:

(a) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of RET gene;

(b) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of SDHB gene;

(c) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of sdhd gene; With

(d) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of vhl gene.

In a preference of the present invention, the pathogenic relevant mutational site of the pheochromocytoma of described RET gene is selected from:

The 609th amino acids codon TGC → AGC in the RET gene extron 10;

The 609th amino acids codon TGC → TGG in the RET gene extron 10;

The 609th amino acids codon TGC → CGC in the RET gene extron 10;

The 609th amino acids codon TGC → GGC in the RET gene extron 10;

The 609th amino acids codon TGC → TCC in the RET gene extron 10;

The 609th amino acids codon TGC → TAC in the RET gene extron 10;

The 609th amino acids codon TGC → TTC in the RET gene extron 10;

The 611st amino acids codon TGC → CGC in the RET gene extron 10;

The 611st amino acids codon TGC → TTC in the RET gene extron 10;

The 611st amino acids codon TGC → AGC in the RET gene extron 10;

The 611st amino acids codon TGC → TGG in the RET gene extron 10;

The 611st amino acids codon TGC → TAC in the RET gene extron 10;

The 611st amino acids codon TGC → GGC in the RET gene extron 10;

The 611st amino acids codon TGC → TCC in the RET gene extron 10;

The 618th amino acids codon TGC → TTC in the RET gene extron 10;

The 618th amino acids codon TGC → TCC in the RET gene extron 10;

The 618th amino acids codon TGC → CGC in the RET gene extron 10;

The 618th amino acids codon TGC → GGC in the RET gene extron 10;

The 618th amino acids codon TGC → AGC in the RET gene extron 10;

The 618th amino acids codon TGC → TAC in the RET gene extron 10;

The 618th amino acids codon TGC → TGG in the RET gene extron 10;

The 620th amino acids codon TGC → GGC in the RET gene extron 10;

The 620th amino acids codon TGC → TGG in the RET gene extron 10;

The 620th amino acids codon TGC → TAC in the RET gene extron 10;

The 620th amino acids codon TGC → CGC in the RET gene extron 10;

The 620th amino acids codon TGC → TTC in the RET gene extron 10;

The 620th amino acids codon TGC → TCC in the RET gene extron 10;

The 620th amino acids codon TGC → AGC in the RET gene extron 10;

The 630th amino acids codon TGC → TTC in the RET gene extron 11;

The 630th amino acids codon TGC → TCC in the RET gene extron 11;

The 630th amino acids codon TGC → TAC in the RET gene extron 11;

The 630th amino acids codon TGC → CGC in the RET gene extron 11;

The 630th amino acids codon TGC → AGC in the RET gene extron 11;

The 630th amino acids codon TGC → GGC in the RET gene extron 11;

The 630th amino acids codon TGC → TGG in the RET gene extron 11;

The 632nd amino acids codon GAG → AAG in the RET gene extron 11;

Near codon ACGAGCTGTGCCGCACGGTGAT → ACGAGggCTGTGCCGCACGGTGAT the 633rd amino acids in the RET gene extron 11;

The 634th amino acids codon TGC → CGC in the RET gene extron 11;

The 634th amino acids codon TGC → GGC in the RET gene extron 11;

The 634th amino acids codon TGC → TTC in the RET gene extron 11;

The 634th amino acids codon TGC → AGC in the RET gene extron 11;

The 634th amino acids codon TGC → TGG in the RET gene extron 11;

The 634th amino acids codon TGC → TAC in the RET gene extron 11;

The 634th amino acids codon TGC → TCC in the RET gene extron 11;

The 640th amino acids codon GCC → GGC in the RET gene extron 11;

The 641st amino acids codon GCT → TCT in the RET gene extron 11;

The 648th amino acids codon GTC → ATC in the RET gene extron 11;

The 768th amino acids codon GAG → GAT in the RET gene extron 13;

The 768th amino acids codon GAG → GAC in the RET gene extron 13;

The 790th amino acids codon TTG → TTT in the RET gene extron 13;

The 791st amino acids codon TAT → TTT in the RET gene extron 13;

The 804th amino acids codon GTG → TTG in the RET gene extron 14;

The 804th amino acids codon GTG → ATG in the RET gene extron 14;

The 904th amino acids codon TCC → TGC in the RET gene extron 15;

The 918th amino acids codon ATG → ACG in the RET gene extron 16;

The 922nd amino acids codon TCC → TAC in the RET gene extron 16;

The pathogenic relevant mutational site of the pheochromocytoma of described SDHB gene is selected from:

The 43rd amino acids codon GCC → CCC in the SDHB gene extron 2;

The 46th amino acids codon CGA → GGA in the SDHB gene extron 2;

The 46th amino acids codon CGA → TGA in the SDHB gene extron 2;

The 46th amino acids codon CGA → CAA in the SDHB gene extron 2;

The 90th amino acids codon CGA → TGA in the SDHB gene extron 3;

The 591st disappearance of the codon of the 198th amino acids base C in the SDHB gene extron 6;

The codon the 620th of the 207th amino acids and 621 disappearance base TG in the SDHB gene extron 6;

Codon CGC → the TGC of the 230th amino acids in the SDHB gene extron 7;

Codon CGC → the CAC of the 230th amino acids in the SDHB gene extron 7;

The codon 713-716 position of 238-240 amino acids disappearance base TCTC in the SDHB gene extron 7;

The pathogenic relevant mutational site of the pheochromocytoma of described sdhd gene is selected from:

The 64th C → T of the codon of the 22nd amino acids in the sdhd gene exon 2;

The 94th TCA disappearance of the codon of the 32nd amino acids TC in the sdhd gene exon 2;

The 38th amino acids codon CGA → TGA in the sdhd gene exon 2;

Insert A between the codon 148-149 position of the 50th amino acids in the sdhd gene exon 2;

Insert A between the codon 202-203 position of the 68th amino acids in the sdhd gene exon 3;

The 92nd amino acids codon GAC → TAC in the sdhd gene exon 3;

Lack ACTG between the codon 334-337 position of the 112nd amino acids in the sdhd gene exon 4;

The 121st amino acids codon CAG → TAG in the sdhd gene exon 4;

The pathogenic relevant mutational site of the pheochromocytoma of described vhl gene is selected from:

The 93rd amino acids codon GGC → TGC in the vhl gene exons 1;

The 93rd amino acids codon GGC → GAC in the vhl gene exons 1;

The 98th amino acids codon TAC → CAC in the vhl gene exons 1;

The 98th amino acids codon TAC → TGC in the vhl gene exons 1;

The 112nd amino acids codon TAC → CAC in the vhl gene exons 1;

The 156th amino acids codon TAT → TGT in the vhl gene exon 3;

The 161st amino acids codon CGA → CAA in the vhl gene exon 3;

The 167th amino acids codon CGG → TGG in the vhl gene exon 3;

The 167th amino acids codon CGG → CAG in the vhl gene exon 3;

The 178th amino acids codon CTG → CCG in the vhl gene exon 3;

The 184th amino acids codon CTC → CAC in the vhl gene exon 3;

The 188th amino acids codon CTG → GTG in the vhl gene exon 3.

In a preference of the present invention, the kind of described oligonucleotide probe is the 20-250 kind, and each oligonucleotide probe contains 10-30 continuous nucleotide.More particularly, each oligonucleotide probe contains 18-28 continuous nucleotide.

In a preference of the present invention, 5 of each oligonucleotide probe ' end also comprises the poly-poly-deoxythymidylic acid (dT) of one section amido modified 4-25.

In a preference of the present invention, described pathogenic relevant mutational site is positioned at the middle part of place, mutational site oligonucleotide probe.

In a preference of the present invention, the sequence of the oligonucleotide probe of the pathogenic relevant mutational site of described pheochromocytoma is:

(a) be selected from SEQ ID NO:55-129 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of RET gene specifically;

(a) be selected from SEQ ID NO:1-17 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of SDHB gene specifically;

(a) be selected from SEQ ID NO:18-33 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of sdhd gene specifically; With

(a) be selected from SEQ ID NO:34-54 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of vhl gene specifically.

In a second aspect of the present invention, a kind of method of determining RET, SDHB, SDHD and vhl gene type in the sample simultaneously is provided, may further comprise the steps:

(1) extracting obtains DNA from sample;

(2) be template with the DNA that obtains in the step (1), amplification obtains to comprise the amplified production in mutational site in RET, VHL, SDHB, the sdhd gene;

(3) amplified production of gained in the markers step (2);

(4) with amplified production and the claim 1 described gene chip hybridization of gained in the step (3) through mark;

(5) detect the hybridization signal of gene chip, thereby determine RET, SDHB, SDHD and vhl gene type in the sample.

As a preference of the present invention, in the above-mentioned steps (2), respectively RET, VHL, SDHB, sdhd gene separately independently in the amplification system amplification comprise the amplified production of mutational site gene.

More preferably, in step (3), the marker that mark adopted is selected from: digoxin, vitamin H, fluorescein, Cy3, Cy5, alkaline phosphatase, horseradish peroxidase, or their derivative molecular.

In another preference, in step (5), the method that detects hybridization signal is selected from: the enzymatic tetrazole indigo plant of alkaline phosphatase (NBT) color reaction, 5-bromo-4-chloro-3-indolol-phosphoric acid-4-toluene amine salt (BCIP) color reaction of horseradish peroxidase enzyme catalytic, the color reaction of the tetramethyl benzidine of horseradish peroxidase enzyme catalytic (TMB), or fluoroscopic examination.

More preferably, described sample is blood, hair, oral mucosa cast.

In a third aspect of the present invention, a kind of test kit that is used to measure RET, SDHB, SDHD and vhl gene type is provided, this test kit comprises described gene chip.

More preferably, also comprise working instructions and/or chip image analysis software in the described test kit.

In a fourth aspect of the present invention, the described purposes that is used to measure the gene chip of pheochromocytoma susceptibility is provided, be used to prepare the test kit that detects the pheochromocytoma susceptibility.

Description of drawings

Fig. 1: the photo that detects RET 804 codon G/T genotype gained results with gene chip of the present invention.

Embodiment

The inventor selects relevant especially RET, SDHB, SDHD or vhl gene through extensive research from the pheochromocytoma pathogenic related gene, furtherd investigate and analyzed in the described gene each site mutation for the situation that influences of disease.The inventor has designed corresponding gene probe at the most relevant mutational site of causing a disease, and has prepared the detection gene chip that detects the pheochromocytoma susceptibility.This gene chip can detect the susceptibility that tested object is suffered from pheochromocytoma quickly and efficiently, thereby can detect the high-risk object that pheochromocytoma has heredity sudden change from the crowd, the reference data that provides usefulness for the early diagnosis and the auxiliary diagnosis of pheochromocytoma.

Gene chip of the present invention comprises solid phase carrier and is fixed on oligonucleotide probe on the described solid phase carrier in order, and described oligonucleotide probe is made up of 10-30 (being more particularly 18-28) continuous nucleotide.In a preference, the probe sequence of employing sees Table 3, and the sequence of the PCR product that is used to increase sees Table 2, and mutational site information sees Table 1.

In order to strengthen the intensity of detection signal, improve the accuracy rate of detected result, above-mentioned probe preferably is positioned at the middle part of place probe.Described probe can also comprise the poly-poly-deoxythymidylic acid of one section amido modified 0-25 (poly-dT) at its 5 ' end.

Described solid phase carrier can adopt the various common used materials in gene chip field, such as but not limited to nylon membrane, and the slide of slide of modifying through active group (as aldehyde radical, amino, the fine acidic group of different sulphur etc.) or silicon chip, unmodified, plastic sheet etc.

Gene chip preparation of the present invention can be adopted the conventional manufacture method of biochip.For example, if what solid phase carrier adopted is to modify slide or silicon chip, 5 of probe ' end contains amido modified poly-dT string, oligonucleotide probe can be mixed with solution, the back point sample instrument is being modified slide or silicon chip with its point then, be arranged in predetermined sequence or array, spending the night by placement then fixes, and just can obtain gene chip of the present invention.If it is amido modified that oligonucleotide probe does not contain, then its preparation method also can reference: Wang Shenwu chief editor's " gene diagnosis technology-on-radiation operational manual "; J.L.erisi, V.R.Iyer, P.O.BROWN.Exploring themetabolic and genetic control of gene expression on a genomic scale.Science, 1997; 278:680 and Ma Li people, the Jiang Zhonghua chief editor. biochip. Beijing: Chemical Industry Press, 2000,1-130.

The method of measuring RET, VHL, SDHB, sdhd gene type of the present invention can may further comprise the steps:

(1) preparation chromosomal DNA;

(2) with the gene fragment that comprises mutational site in the table 1 in the amplification of polymerase chain reaction (PCR) method RET, VHL, SDHB, the sdhd gene;

(3) the above gained amplified production of mark;

(4) with gained mark amplified production and gene chip hybridization;

(5) hybridization signal of detection gene chip, the recognition result.

The method for preparing the chromosomal DNA that is used for pcr amplification is a lot, can prepare from whole blood, also can prepare from root of hair, can also prepare from the cast of oral mucosa.Concrete grammar can consult document (Ding Zhennuo, Su Mingquan chief editor. " clinical PCR gene diagnosis technology ", the .1998 of world book publishing company first version).

With the specific segmental method of PCR method amplification chromogene has been techniques well known.Key wherein is design of primers, and method, the software of relevant design of primers all can obtain from commercial channels.The amplimer in the RET that the present invention relates to, VHL, SDHB, sdhd gene mutational site and system can according to above-mentioned the whole bag of tricks and relevant document (in Mu KB this, in F takes, chief editors " PCR polymerase chain reaction " such as R gibbs) method of record is independently finished by the user.

Amplified production is carried out the method that mark can increase by the primer that adopts 5 ' end tape label group, the method of mononucleotide that also can be by mixing the tape label group in amplification procedure is realized that described labelling groups includes but not limited to: digoxin molecule (DIG), biotin molecule (Bio), fluorescein and the biomolecules of deriving (FITC etc.) thereof, other fluorescence molecules (as Cy3, Cy5 etc.), alkaline phosphatase (AP), horseradish peroxidase (HRP) etc.These marks and marking method thereof all have been routine techniques well-known in the art, also can be with reference to Wang Shenwu chief editor's " gene diagnosis technology-on-radiation operational manual "; J. Sa nurse Brooker, D.W. Russell chief editor, " molecular cloning experiment guide ", Science Press, 2002; Horse stands the people, the Jiang Zhonghua chief editor. biochip. and Beijing: Chemical Industry Press, 2000,1-130.

Before the amplified production and gene chip hybridization of tape label, earlier with the amplified production sex change.At this moment, can adopt conventional denaturation method sex change pcr amplification product.These class methods for example are heated to amplified production 94～98 ℃, and are incubated 2～10min, put on ice rapidly then.Perhaps, also can adopt alkaline denaturation neutral method then.If the mutational site divides multitube to increase, can the amplified production of these pipes is mixed earlier, sex change together then, also sex change together earlier, mixed again.

When above-mentioned amplified production and gene chip are hybridized, can earlier gene chip and prehybridization damping fluid be carried out prehybridization.

Solid-phase hybridization between amplified production of the present invention and the gene chip carries out according to the classical way of this area, and the general personnel in this area determine relevant damping fluid, probe and the optimum condition of concentration of specimens, prehybridization temperature, hybridization temperature and time etc. easily according to experience.Perhaps also can be with reference to J. Sa nurse Brooker, D.W. Russell chief editor, " molecular cloning experiment guide ", Science Press, 2002.

Obtain according to information such as the position of marking signal on gene chip, intensity then and treat measurement information.The method of detection gene chip hybridization signal of the present invention is based on the color reaction that the tetrazole indigo plant (NBT) of the alkaline phosphatase that is combined with each other with anti-biotin antibodies or affinity element or streptavidin or anti digoxin antibody or anti-fluorescein antibody or horseradish peroxidase enzyme catalytic is closed 5-bromo-4-chloro-3-indolol-phosphoric acid-4-toluene amine salt (BCIP) or tetramethyl benzidine (TMB).Concrete grammar can be with reference to Wang Shenwu chief editor's " gene diagnosis technology-on-radiation operational manual ".If amplified production fluorophor mark, also can be directly obtain and treat measurement information with fluorescence detection device (as laser confocal scanning instrument Scanarray3000 etc.).

The present invention also provides a kind of test kit that is used to measure the RET relevant with pheochromocytoma, VHL, SDHB, sdhd gene type, and this test kit comprises the said gene chip of the present invention; More particularly, also comprise working instructions and/or chip image analysis software.Described chip image analysis software is such as the BaiO ArrayDoctor 2.0 of BaiO company, the Arraypro 4.0 of Media Cybernetics company.

The invention has the advantages that:

(a) the invention provides gene chip and test kit thereof, RET, the VHL, SDHB, the sdhd gene type that can be used for detecting pheochromocytoma patient and Susceptible population carry out the examination monitoring, this is the clinical high risk population that sifts out from the pheochromocytoma patient, predicts the danger that heredopathia takes place and provide targetedly that treatment provides a kind of simple and easy to do solution.

(b) gene chip of the present invention can convenient, high-throughput ground analysis list gene mutation site information, has impayable advantage aspect gene diagnosis.In the diagnosis and treatment of pheochromocytoma, early diagnosis is carried out in the not only measurable morbidity of the detection of transgenation, but also can carry out the examination monitoring to other members of family.

(c) to have a detecting operation simple for gene chip of the present invention.

(d) broad covered area of gene chip of the present invention reflects compatriots' pheochromocytoma-related gene mutational site all sidedly.

(e) the phase mutual interference between the oligonucleotide probe of gene chip of the present invention is little, and the result is accurate.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

The design of embodiment 1 probe

1. mutational site information

Present embodiment at the 86 kinds of mutation types in 58 sites (details see Table 1) of pheochromocytoma-related gene (RET, VHL, SDHD and SDHB), these sites comprise genotype and the newfound mutation type of having reported of the inventor both at home and abroad.

It is as shown in table 1 that present embodiment relates to the pathogenic relevant mutational site of RET, VHL, SDHB, SDHD.

Table 1 mutational site

Numbering	Gene	Exon	Codon	Nucleotide (wild-type-mutant)	Amino acid (wild-type-mutant)
						127-1	SDHB	2	43	GCC-CCC	Ala43Pro
136-1	SDHB	2	46	CGA-GGA	Arg46Gly
						136-2	SDHB	2	46	CGA-TGA	Arg46X
137-1	SDHB	2	46	CGA-CAA	Arg46Gln
						268-1	SDHB	3	90	CGA-TGA	Arg90X
591-1	SDHB	6	198	591 del C	Ser198fs
						620/621-1	SDHB	6	207	620-621 del TG	Leu207fs
688-1	SDHB	7	230	CGC-TGC	Arg230Cys
						689-1	SDHB	7	230	CGC-CAC	Arg230His
713/716-1	SDHB	7	238-240	713/716 del TCTC	Phe238fs
						64-1	SDHD	2	22	64 C/T	Arg22X
94-1	SDHD	2	32	94 TCA del TC	Ser32fs
						112-1	SDHD	2	38	CGA-TGA	Arg38X
148/149-1	SDHD	2	50	148-149 ins A	His50fs
						202/203-1	SDHD	3	68	202-203 ins A	Ser68fs
274-1	SDHD	3	92	GAC-TAC	Asp92Tyr
						334/337-1	SDHD	4	112	334-337 del ACTG	Thr112fs
361-1	SDHD	4	121	CAG-TAG	Gln121X
						277-1	VHL	1	93	GGC-TGC	Gly93Cys
278-1	VHL	1	93	GGC-GAC	Gly93Asp
						292-1	VHL	1	98	TAC-CAC	Tyr98His
293-1	VHL	1	98	TAC-TGC	Tyr98Cys

334-1	VHL	1	112	TAC-CAC	Tyr112His
						467-1	VHL	3	156	TAT-TGT	Tyr156Cys
482-1	VHL	3	161	CGA-CAA	Arg161Gln
						499-1	VHL	3	167	CGG-TGG	Arg167Trp
500-1	VHL	3	167	CGG-CAG	Arg167Gln
						533-1	VHL	3	178	CTG-CCG	Leu178Pro
551-1	VHL	3	184	CTC-CAC	Leu184His
						562-1	VHL	3	188	CTG-GTG	Leu188Val
609-1	RET	10	609	TGC-AGC	Cys-Ser
						609-2	RET	10	609	TGC-TGG	Cys-Trp
609-3	RET	10	609	TGC-CGC	Cys-Arg
						609-4	RET	10	609	TGC-GGC	Cys-Gly
609-5	RET	10	609	TGC-TCC	Cys-Ser
						609-6	RET	10	609	TGC-TAC	Cys-Tyr
609-7	RET	10	609	TGC-TTC	Cys-Phe
						611-1	RET	10	611	TGC-CGC	Cys-Arg
611-2	RET	10	611	TGC-TTC	Cys-Phe
						611-3	RET	10	611	TGC-AGC	Cys-Ser
611-4	RET	10	611	TGC-TGG	Cys-Trp
						611-5	RET	10	611	TGC-TAC	Cys-Tyr
611-6	RET	10	611	TGC-GGC	Cys-Gly
						611-7	RET	10	611	TGC-TCC	Cys-Ser
618-1	RET	10	618	TGC-TTC	Cys-Phe
						618-2	RET	10	618	TGC-TCC	Cys-Ser
618-3	RET	10	618	TGC-CGC	Cys-Arg
						618-4	RET	10	618	TGC-GGC	Cys-Gly
618-5	RET	10	618	TGC-AGC	Cys-Ser
						618-6	RET	10	618	TGC-TAC	Cys-Tyr
618-7	RET	10	618	TGC-TGG	Cys-Trp
						620-1	RET	10	620	TGC-GGC	Cys-Gly
620-2	RET	10	620	TGC-TGG	Cys-Trp

620-3	RET	10	620	TGC-TAC	Cys-Tyr
						620-4	RET	10	620	TGC-CGC	Cys-Arg
620-5	RET	10	620	TGC-TTC	Cys-Phe
						620-6	RET	10	620	TGC-TCC	Cys-Ser
620-7	RET	10	620	TGC-AGC	Cys-Ser
						630-1	RET	11	630	TGC-TTC	Cys-Phe
630-2	RET	11	630	TGC-TCC	Cys-Ser
						630-3	RET	11	630	TGC-TAC	Cys-Tyr
630-4	RET	11	630	TGC-CGC	Cys-Arg
						630-5	RET	11	630	TGC-AGC	Cys-Ser
630-6	RET	11	630	TGC-GGC	Cys-Gly
						630-7	RET	11	630	TGC-TGG	Cys-Trp
632-1	RET	11	632	GAG-AAG	Glu-Lys
						633-1	RET	11	633	ACGAG＾CTGTGccG CACGGTGAT	Insert gg
634-1	RET	11	634	TGC-CGC	Cys-Arg
						634-2	RET	11	634	TGC-GGC	Cys-Gly
634-3	RET	11	634	TGC-TTC	Cys-Phe
						634-4	RET	11	634	TGC-AGC	Cys-Ser
634-5	RET	11	634	TGC-TGG	Cys-Trp
						634-6	RET	11	634	TGC-TAC	Cys-Tyr
634-7	RET	11	634	TGC-TCC	Cys-Ser
						640-1	RET	11	640	GCC-GGC	Ala-Gly
641-1	RET	11	641	GCT-TCT	Ala-Ser
						648-1	RET	11	648	GTC-ATC	Val-lle
768-1	RET	13	768	GAG-GAT	Glu-Asp
						768-2	RET	13	768	GAG-GAC	Glu-Asp
790-1	RET	13	790	TTG-TTT	Leu-Phe
						790-2	RET	13	791	TAT-TTT	Tyr-Phe
804-1	RET	14	804	GTG-TTG	Val-Leu
						804-2	RET	14	804	GTG-ATG	Val-Met

904-1	RET	15	904	TCC-TGC	Ser-Cys
						918-1	RET	16	918	ATG-ACG	Met-Thr
922-1	RET	16	922	TCC-TAC	Ser-Tyr

Annotate: in the Nucleotide, the Nucleotide number that has the preceding digitized representation of wild-type to begin from codon ATG; The displacement sudden change has taken place in the fs representative; X represents translation termination; Del represents base deletion, and on behalf of base, ins insert.

2. the design of probe

According to above pathogenic relevant mutational site, present embodiment adopts Primer Priemer5.0 software (Canadian Primer company exploitation) designing probe, shown in the concrete probe sequence table 2.

Table 2 probe sequence

The site	Numbering	Probe sequence	Sequence numbering
				SDHB-127GCC	127-w	NH 2-5′-ttttttttttttttta atc aag aaa ttt gcc atc tat cga	1
SDHB-127CCC	127-1	NH 2-5′-ttttttttttttttta caa gaa att tcc cat cta tcg	2
				SDHB-136&137CGA	136-w，137-w	NH 2-5′-ttttttttttttttta gcc atc tat cga tgg gac cc	3
SDHB-137CAA	137-1	NH 2-5′-ttttttttttttttta gcc atc tat caa tgg gac c	4
				SDHB-136GGA	136-1	NH 2-5′-ttttttttttttttta tgc cat cta tgg atg gga c	5
SDHB-136TGA	136-2	NH 2-5′-ttttttttttttttta gcc atc tat tga tgg gac c	6
				SDHB-268CGA	268-w	NH 2-5′-tttttttttttttttt ttt gac ctt ccg aag atc at	7
SDHB-268TGA	268-1	NH 2-5′-tttttttttttttttt ctt tga cct tct gaa gat cat g	8
				SDHB-591	591-w	NH 2-5′-tttttttttttttttt agc tgc ccc agc tac tgg	9
SDHB-591delC	591-1	NH 2-5′-tttttttttttttttt agc tgc cca gct act ggt	10
				SDHB-620/621	620/621-w	NH 2-5′-tttttttttttttttt aca aat atc tgg ggc ctg c	11
SDHB-620/621delTG	620/621-1	NH 2-5′-tttttttttttttttt aca aat atc ggg cct gca	12
				SDHB-688&689CGC	688-w，689-w	NH 2-5′-tttttttttttttttt aga gga gcg cct ggc	13
SDHB-688TGC	688-1	NH 2-5′-tttttttttttttttt gag gag tgc ctg gcc a	14
				SDHB-689CAC	689-1	NH 2-5′-tttttttttttttttt gag gag cac ctg gcc a	15
SDHB-713/716	713/716-w	NH 2-5′-tttttttttttttttt gga ccc att ctc tct ata ccg	16
				SDHB-713/716delTCTC	713/716-1	NH 2-5′-tttttttttttttttt agg acc cat tct ata ccg ct	17
SDHD-64CGA	64-w	NH 2-5′-ttttttttttttttta ctg ttg ctt cga act cca gt	18

SDHD-64TGA	64-1	NH 2-5′-tttttttttttttttt ctc tgt tgc ttt gaa ctc cag	19
				SDHD-94TCA	94-w	NH 2-5′-tttttttttttttttt tgc tca tat ctc agc att tct t	20
SDHD-94TCAdelTC	94-1	NH 2-5′-tttttttttttttttt ctg ctc ata tca gca tttctt c	21
				SDHD-112CGA	112-w	NH 2-5′-ttttttttttttttta ctt cag gac cga cct atc c	22
SDHD-112TGA	112-1	NH 2-5′-ttttttttttttttta ctt cag gac tga cct atc cc	23
				SDHD-148/149	148/149-w	NH 2-5′-tttttttttttttttt gca cat aca ctt gtc acc ga	24
SDHD-148/149insA	148/149-1	NH 2-5′-tttttttttttttttt gca cat aca act tgt cac cg	25
				SDHD-202/203	202/203-w	NH 2-5′-tttttttttttttttt cac tgg act agc gag agg g	26
SDHD-202/203insA	202/203-1	NH 2-5′-tttttttttttttttt act gga cta agc gag agg g	27
				SDHD-274GAC	274-w	NH 2-5′-tttttttttttttttt tct gcg atg gac tat tcc c	28
SDHD-274TAC	274-1	NH 2-5′-tttttttttttttttt tct gcg atg tac tat tcc ctg	29
				SDHD-334/337	334/337-w	NH 2-5′-tttttttttttttttt caa gtt gtt act gac tat gtt cat g	30
SDHD- 334/337delACTG	334/337-1	NH 2-5′-ttttttttttttttta gga caa gtt gtt act atg ttc atg	31
				SDHD-361CAG	361-w	NH 2-5′-tttttttttttttttt gga tgc ctt gca gaa agc tg	32
SDHD-361TAG	361-1	NH 2-5′-tttttttttttttttt gga tgc ctt gta gaa agc tg	33
				VHL-277&278GGC	277-w，278-w	NH 2-5′-tttttttttttttttttttttttttttttt ctt cga cgg cga gcc	34
VHL-277TGC	277-1	NH 2-5′-tttttttttttttttt ctt cga ctg cga gcc g	35
				VHL-278GAC	278-1	NH 2-5′-tttttttttttttttt ctt cga cga cga gcc g	36
VHL-292&293TAC	292-w，293-w	NH 2-5′-tttttttttttttttttttttttttttttt gca gcc cta ccc aac g	37
				VHL-292CAC	292-1	NH 2-5′-tttttttttttttttt gca gcc cca ccc aac	38
VHL-293TGC	293-1	NH 2-5′-tttttttttttttttt gca gcc ctg ccc aac	39
				VHL-334TAC	334-w	NH 2-5′-tttttttttttttttt cat cca cag cta ccg agg tac	40
VHL-334CAC	334-1	NH 2-5′-ttttttttttttttta cca cag cca ccg agg t	41
				VHL-467TAT	467-w	NH 2-5′-tttttttttttttttt ccc ttc cag tgt ata ctc tga aag a	42
VHL-467TGT	467-1	NH 2-5′-tttttttttttttttt ctt cca gtg tgt act ctg aaa ga	43
				VHL-482CGA	482-w	NH 2-5′-tttttttttttttttt aaa gag cga tgc ctc cag	44
VHL-482CAA	482-1	NH 2-5′-ttttttttttttttta gaa aga gca atg cct cca g	45
				VHL-499&500CGG	499-w，500-w	NH 2-5′-tttttttttttttttt agg ttg tcc gga gcc tag	46
VHL-499TGG	499-1	NH 2-5′-tttttttttttttttt cag gtt gtc tgg agc cta gt	47
				VHL-500CAG	500-1	NH 2-5′-tttttttttttttttt cag gtt gtc cag agc cta gt	48

VHL-533CTG	533-w	NH 2-5′-ttttttttttttttta tac agg aga ctg gac atc gtc	49
				VHL-533CCG	533-1	NH 2-5′-tttttttttttttttt cag gag acc gga cat cgt	50
VHL-551CTC	551-w	NH 2-5′-tttttttttttttttt tca ggt cgc tct acg aag at	51
				VHL-551CAC	551-1	NH 2-5′-tttttttttttttttt tca ggt cgc act acg aag a	52
VHL-562CTG	562-w	NH 2-5′-ttttttttttttttta cta cga aga tct gga aga cca	53
				VHL-562GTG	562-1	NH 2-5′-tttttttttttttttt tac gaa gat gtg gaa gac cac	54
RET-609tgc	609-w	NH 2-5′-tttttttttttttttt tgg cac ctg caa ctg c	55
				RET-609agc	609-1	NH 2-5′-tttttttttttttttt tgg cac cag caa ctg c	56
RET-609tgg	609-2	NH 2-5′-ttttttttttttttta ggc acc tgg aac tgc tt	57
				RET-609cgc	609-3	NH 2-5′-tttttttttttttttt tgg cac ccg caa ctg	58
RET-609ggc	609-4	NH 2-5′-tttttttttttttttt tgg cac cgg caa ctg	59
				RET-609tcc	609-5	NH 2-5′-tttttttttttttttt tgg cac ctc caa ctg ct	60
RET-609tac	609-6	NH 2-5′-tttttttttttttttt tgg cac cta caa ctg ctt c	61
				RET-609ttc	609-7	NH 2-5′-tttttttttttttttt tgg cac ctt caa ctg ctt	62
RET-611tgc	611-w	NH 2-5′-tttttttttttttttt ctg caa ctg ctt ccc tga	63
				RET-611cgc	611-1	NH 2-5′-tttttttttttttttt ctg caa ccg ctt ccc t	64
RET-611ttc	611-2	NH 2-5′-tttttttttttttttt cct gca act tct tcc ctg	65
				RET-611agc	611-3	NH 2-5′-tttttttttttttttt cct gca aca gct tcc ct	66
RET-611tgg	611-4	NH 2-5′-tttttttttttttttt ctg caa ctg gtt ccc tga	67
				RET-611tac	611-5	NH 2-5′-tttttttttttttttt cct gca act act tcc ctg a	68
RET-611ggc	611-6	NH 2-5′-tttttttttttttttt ctg caa cgg ctt ccc t	69
				RET-611tcc	611-7	NH 2-5′-tttttttttttttttt ctg caa ctc ctt ccc tga	70
RET-618tgc	618-w	NH 2-5′-tttttttttttttttt agg aga agt gct tct gcg	71
				RET-618ttc	618-1	NH 2-5′-tttttttttttttttt gag gag aag ttc ttc tgc ga	72
RET-618tcc	618-2	NH 2-5′-tttttttttttttttt agg aga agt cct tct gcg a	73
				RET-618cgc	618-3	NH 2-5′-tttttttttttttttt agg aga agc gct tct gc	74
RET-618ggc	618-4	NH 2-5′-tttttttttttttttt gag gag aag ggc ttc tgc	75
				RET-618agc	618-5	NH 2-5′-tttttttttttttttt gag gag aag agc ttc tgc g	76
RET-618tac	618-6	NH 2-5′-tttttttttttttttt gag gag aag tac ttc tgc gag	77
				RET-618tgg	618-7	NH 2-5′-tttttttttttttttt gga gaa gtg gtt ctg cga	78
RET-620tgc	620-w	NH 2-5′-tttttttttttttttt gtg ctt ctg cga gcc c	79

RET-620ggc	620-1	NH 2-5′-tttttttttttttttt gtg ctt cgg cga gcc	80
				RET-620tgg	620-2	NH 2-5′-tttttttttttttttt gct tct ggg agc ccg	81
RET-620tac	620-3	NH 2-5′-tttttttttttttttt gtg ctt cta cga gcc cg	82
				RET-620cgc	620-4	NH 2-5′-tttttttttttttttt gtg ctt ccg cga gcc	83
RET-620ttc	620-5	NH 2-5′-tttttttttttttttt tgc ttc ttc gag ccc g	84
				RET-620tcc	620-6	NH 2-5′-tttttttttttttttt agt gct tct ccg agc cc	85
RET-620agc	620-7	NH 2-5′-tttttttttttttttt gtg ctt cag cga gcc c	86
				RET-630tgc	630-w	NH 2-5′-ttttttttttttttta cca ctg tgc gac gag c	87
RET-630ttc	630-1	NH 2-5′-tttttttttttttttt tcc act gtt cga cga gct	88
				RET-630tcc	630-2	NH 2-5′-tttttttttttttttt tcc act gtc cga cga gc	89
RET-630tac	630-3	NH 2-5′-tttttttttttttttt tcc act gta cga cga gct g	90
				RET-630cgc	630-4	NH 2-5′-tttttttttttttttt tcc act gcg cga cga	91
RET-630agc	630-5	NH 2-5′-tttttttttttttttt tcc act gag cga cga gc	92
				RET-630ggc	630-6	NH 2-5′-tttttttttttttttt atc cac tgg gcg acg a	93
RET-630tgg	630-7	NH 2-5′-tttttttttttttttt tcc act gtg gga cga gc	94
				RET-632gag	632-w	NH 2-5′-ttttttttttttttta gtg cga cga gct gtg c	95
RET-632aag	632-1	NH 2-5′-ttttttttttttttta gt gcg aca agc tgt gcc	96
				RET-633ctg	633-w	NH 2-5′-tttttttttttttttt cga cga gct gtg ccg	97
RET-633GGctg	633-1	NH 2-5′-tttttttttttttttt acg agg gct gtg ccg	98
				RET-634tgc	634-w	NH 2-5′-tttttttttttttttt gag ctg tgc cgc acg	99
RET-634cgc	634-1	NH 2-5′-tttttttttttttttt gag ctg cgc cgc ac	100
				RET-634ggc	634-2	NH 2-5′-tttttttttttttttt gag ctg ggc cgc ac	101
RET-634ttc	634-3	NH 2-5′-tttttttttttttttt gag ctg ttcc gca cgg	102
				RET-634agc	634-4	NH 2-5′-tttttttttttttttt gag ctg agc cgc acg	103
RET-634tgg	634-5	NH 2-5′-tttttttttttttttt gct gtg gcg cac gg	104
				RET-634tac	634-6	NH 2-5′-tttttttttttttttt cga gct gta ccg cac g	105
RET-634tcc	634-7	NH 2-5′-tttttttttttttttt agc tgt ccc gca cgg	106
				RET-640gcc	640-w	NH 2-5′-ttttttttttttttta gat cgc agc cgc tgt c	107
RET-640ggc	640-1	NH 2-5′-ttttttttttttttta gat cgc agg cgc tgt c	108
				RET-641gct	641-w	NH 2-5′-ttttttttttttttta cgc agc cgc tgt cct	109
RET-641tct	641-1	NH 2-5′-tttttttttttttttt tcg cag cct ctg tcc tc	110

RET-648gtc	648-w	NH 2-5′-tttttttttttttttt tcc ttc atc gtc tcg gtg	111
				RET-648atc	648-1	NH 2-5′-ttttttttttttttta cct tca tca tct cgg tgc	112
RET-768gag	768-w	NH 2-5′-tttttttttttttttt ccg agt gag ctt cga gac	113
				RET-768gat	768-1	NH 2-5′-tttttttttttttttt ccc gag tga tct tcg aga	114
RET-768gac	768-2	NH 2-5′-tttttttttttttttt ccc gag tga cct tcg ag	115
				RET-790ttg	790-w	NH 2-5′-ttttttttttttttta cat caa att gta tgg ggc ctg	116
RET-790ttt	790-1	NH 2-5′-ttttttttttttttta cat caa att tta tgg ggc ct	117
				RET-790ttc	790-2	NH 2-5′-ttttttttttttttta cat caa att cta tgg ggc ct	118
RET-791tat	791-w	NH 2-5′-ttttttttttttttta catc aaa ttg tat ggg gcc tg	119
				RET-791ttt	791-1	NH 2-5′-ttttttttttttttta catc aaa ttg ttt ggg gcc t	120
RET-804gtg	804-w	NH 2-5′-tttttttttttttttt ctc ctc atc gtg gag tac gc	121
				RET-804ttg	804-1	NH 2-5′-tttttttttttttttt ctcc tca tct tgg agt acg c	122
RET-804atg	804-2	NH 2-5′-tttttttttttttttt ctcc tca tca tgg agt acg c	123
				RET-904tcc	904-w	NH 2-5′-ttttttttttttttta gaa gag gat tcc tac gtg aag	124
RET-904tgc	904-1	NH 2-5′-ttttttttttttttta gaa gag gat tgc tac gtg aag	125
				RET-918atg	918-w	NH 2-5′-tttttttttttttttt gtt aaa tgg atg gca att ga	126
RET-918acg	918-1	NH 2-5′-ttttttttttttttta taa atg gac ggc aat tga	127
				RET-922tcc	922-w	NH 2-5′-tttttttttttttttt gcaa ttg aat ccc ttt ttg atc	128
RET-922tac	922-1	NH 2-5′-tttttttttttttttt gca att 9aa tac ctt ttt gat c	129

Annotate: have W person to be wild-type in the numbering.

The preparation of embodiment 2 gene chips

1. gene probe is synthetic

Equipment: ABI3300 dna synthesizer

Purification process: HPLC method

Client: worker's biotechnology Services Co., Ltd is given birth in Shanghai

The sequence of gene probe is as shown in table 2.

Quality detecting method: the hybridization sensitivity of detection probes.Specifically be exactly the synthetic probe with water dissolution and be diluted to 10pmol/ul, add the point sample damping fluid and be made into sampling liquid, point sample is also fixing on substrate then, hybridizes with it with the standard pcr amplification product (band biotin labeling) of demarcating concentration, and its signal value must not be lower than 50 after detecting.

2. the point sample of gene chip:

Equipment: GMS417 gene chip sample applying instrument, the U.S., Affymetrix company.

Reagent: BaiO ^Point sample damping fluid: Baiao Science and Technology Co. Ltd., Shanghai

Method: according to the method for GMS417 gene chip sample applying instrument working instructions records point sample according to the following steps:

1), work out the point sample program of spot sample mode as shown in table 3 according to the chip design principle:

2)

Table 3 chip sample application array figure

The sign row	Positive	Positive	Positive	Positive
					The sign row	SDHB-127GCC	SDHB-127CCC	SDHB-136&137CGA	SDHB-137CAA
The sign row	SDHB-136&137CGA	SDHB-136GGA	SDHB-136TGA
					The sign row	SDHB-268CGA	SDHB-268TGA	SDHB-591	SDHB-591delC
The sign row	SDHB-620/621	SDHB-620/621delTG	SDHB-688&689CGC	SDHB-688TGC
					The sign row	SDHB-688&689CGC	SDHB-689CAC	SDHB-713/716	SDHB-713/716delTCTC
The sign row	SDHD-64CGA	SDHD-64TGA	SDHD-94TCA	SDHD-94TCAdelTC
					The sign row	SDHD-112CGA	SDHD-112TGA	SDHD-148/149	SDHD-148/149insA
The sign row	SDHD-202/203	SDHD-202/203insA	SDHD-274GAC	SDHD-274TAC
					The sign row	SDHD-334/337	SDHD-334/337delACTG	SDHD-361CAG	SDHD-361TAG
The sign row	VHL-277&278GGC	VHL-277TGC	VHL-277&278GGC	VHL-278GAC
					The sign row	VHL-292&293TAC	VHL-292CAC	VHL-292&293TAC	VHL-293TGC
The sign row	VHL-334TAC	VHL-334CAC	VHL-467TAT	VHL-467TGT
					The sign row	VHL-482CGA	VHL-482CAA	VHL-499&500CGG	VHL-499TGG
The sign row	VHL-499&500CGG	VHL-500CAG	VHL-533CTG	VHL-533CCG
					The sign row	VHL-551CTC	VHL-551CAC	VHL-562CTG	VHL-562GTG
The sign row	609-w	609-1	609-2	609-3
					The sign row	609-4	609-5	609-6	609-7
The sign row	Negative	Negative	Negative	Negative
The sign row	Positive	Positive	Positive	Positive
					The sign row	611-w	611-1	611-2	611-3

The sign row	611-4	611-5	611-6	611-7
					The sign row	618-w	618-1	618-2	618-3
The sign row	618-4	618-5	618-6	618-7
					The sign row	620-w	620-1	620-2	620-3
The sign row	620-4	620-5	620-6	620-7
					The sign row	630-w	630-1	630-2	630-3
The sign row	630-4	630-5	630-6	630-7
					The sign row	632-w	632-1	633-w	633-1
The sign row	634-w	634-1	634-2	634-3
					The sign row	634-4	634-5	634-6	634-7
The sign row	640-w	640-1	648-w	648-1
					The sign row	768-w	768-1	768-2	641-w
The sign row	790-w	790-1	790-2	641-1
					The sign row	804-w	804-1	804-2
The sign row	791-w	791-1	904-w	904-1
					The sign row	918-w	918-1	922-w	922-1
The sign row	Negative	Negative	Negative	Negative

3) will synthesize the qualified probe of good detection with the pure water dissolving and be diluted to 10pmol/ul;

4) will dilute good probe solution and BaiO ^The point sample damping fluid joins the specified location of 384 orifice plates then with 1: 1 mixed according to the point sample program;

5) aldehyde group modified substrate is placed on the sample application platform of point sample instrument successively;

6) above-mentioned point template is placed point sample instrument, start the point sample program of point sample instrument, finish the point sample process automatically.

7) quality inspection of point sample effect: whether the substrate behind the point sample is placed observation point sample effect under the stereoscopic microscope successively, and emphasis is to have or not leak source, even, neat between the each point.

3. probe fixing on chip:

Equipment: BaiO ^The gene chip fixer, Baiao Science and Technology Co. Ltd., Shanghai

Reagent: BaiO ^Gene chip activation solution: Baiao Science and Technology Co. Ltd., Shanghai

Method: the gene chip activation solution can make the increased activity of aldehyde radical on the aldehyde group modified slide glass, improves the fixed efficiency of amido modified gene probe.During use, with BaiO ^Gene chip activation solution (the bottle end is precipitated as normal phenomenon) is poured in the open container (as little lunch box), together puts into BaiO with the chip that point sample finishes ^In the gene chip fixer, 25-30 ℃ of standing over night both can.

The processing and the pcr amplification of embodiment 3 blood samples

1. to the requirement of blood sample:

The vein whole blood, the EDTA anti-freezing is no less than 500ul.

2. the collection of blood sample, storage method:

(1) gather: gather examinee's venous blood 500ul, extract with sterile hypodermic needle for single use, be collected in the aseptic 1.5ml centrifuge tube of the 2%EDTA solution that contains 50ul, will manage and cover, the several that turns upside down makes mixing.

(2) deposit: whole blood to be measured is in 2-4 ℃ of preservation, preservation period 3 months;-20 ℃ of preservation period half a year, but-80 ℃ of prolonged preservation.The operation steps of freezing preservation is the same with the frozen method of cell strain.

(3) transportation: adopt the on the rocks or bubble chamber of curling stone to add dry ice sealing transportation.

3. the preparation method of blood sample dna profiling:

Equipment: TGL-16B table model high speed centrifuge, Anting Scientific Instrument Factory, Shanghai

The HHS112 water bath with thermostatic control, Shanghai No.5 Medical Equipment Factory

The Eppendorf micropipet, 10ul, 20ul, 100ul, 1000ul

Reagent: extracting tucks in 1, and extracting tucks in 2: Baiao Science and Technology Co. Ltd., Shanghai

(1) get aseptic 1.5ml centrifuge tube (providing for oneself), tuck in 1 solution 300ul to whole blood 100ul to be checked that wherein adds mixing and extracting, abundant mixing, room temperature left standstill 8 minutes; Centrifuge tube is put in the whizzer centrifugal 1 minute of 6000g;

(2) take out centrifuge tube, the supernatant liquor that inclines, the visible a small amount of white precipitate in centrifuge tube bottom;

(3) add extracting in centrifuge tube and tuck in 2 solution 60ul, fully vibration makes resolution of precipitate; In the boiling water bath 15 minutes;

(4) take out centrifuge tube, put in the whizzer, 12, centrifugal 15 minutes of 000g.Centrifugal back supernatant liquor can be directly used in pcr amplification.

Embodiment 4 usefulness PCR method increase respectively and marker gene

Primer design adopts Primer Priemer 5.0 softwares, and concrete primer sequence sees Table 4.

Table 4 primer sequence

Numbering	Primer sequence	Sequence numbering
			1-FP	5′cat ctg ttg tgc cag caa a 3′	130
2-FP	5′cat ggt att gga tgc ttt aat ca 3′	131
			3-FP	5′gct cta cga gtg cat tct ctg t 3′	132
4-FP	5′agg cct atc gct gga tga 3′	133
			5-FP	5′agt cct gtt aaa gga gag gtt ctt a 3′	134
6-FP	5′tgt gtg ttt ctc aca tca act ttt at 3′	135
			7-FP	5′cat tgc att tga act tga cag a 3′	136
8-FP	5′gtc gtg ctg ccc gta tg 3′	137
			9-FP	5′gga ttt ggt ttt tgc cct t 3′	138
10-FP	5′agg ctg agt ggg cta cg 3	139
			11-FP	5′gcc tct ctc tcc atc tgt aag 3′	140
13-FP	5′cct caa gca gca tcg tct 3′	141
			14-FP	5′gca gag agc aag tgg ttc 3′	142
15-FP	5′ttt ttc cta cag ctc gtt c 3′	143
			16-FP	5′cta cag cac tcc tct ggtta 3′	144
1-RP	5 ' vitamin H--tgt gaa aag cat gtc cct aaa t 3 '	145
			2-RP	5 ' vitamin H--cag ctg ttt tcc aga tgt ctc tat 3 '	146
3-RP	5 ' vitamin H--ttg gac ttc tgg atg ctt ga 3 '	147
			4-RP	5 ' vitamin H--ctt ctg gcg tgt cag ctc t 3 '	148
5-RP	5 ' vitamin H--ggc atg acc att agt gaa ggt a 3 '	149
			6-RP	5 ' vitamin H--tgc cag tga cca tga aga gt 3 '	150
7-RP	5 ' vitamin H--tgg caa cag ctt tgc aga 3 '	151
			8-RP	5 ' vitamin H--agc gag act ccg tct cag a 3 '	152
9-RP	5 ' vitamin H--caa tgc gct cct gtg tca 3 '	153
			10-RP	5 ' vitamin H--ctc aga tgt gct gtt gag ac 3 '	154
11-RP	5 ' vitamin H--gca ccg gaa gag gag tag 3 '	155
			13-RP	5 ' vitamin H--aaa cag ggc agg agc agt a 3 '	156
14-RP	5 ' vitamin H--ggc aaa tga gat gag gtc 3 '	157

15-RP	5 ' vitamin H--gct cca cta atc ttc ggt at 3 '	158
			16-RP	5 ' vitamin H--gct agc act gca gac agg t 3 '	159

Annotate: FP is a upstream primer, and RP is a downstream primer.Increase respectively the 2nd, 3,6, No. 7 exons of SDHB of 1-FP/1-RP, 2-FP/2RP, 3FP/3RP and 4FP/RP; Increase respectively the 2nd, 3, No. 4 exons of SDHB of 5-FP/5-RP, 6-FP/6-RP, 7FP/7-RP; Increase respectively the 1st and No. 3 exon of VHL of 8-FP/8-RP and 9FP/RP; 10-FP/10-RP, 11-FP/11-RP, 13-FP/13-RP and 16-FP/16-RP the 10th, 11 of the RET that increases respectively, the 13-16 exon.

Entrust Shanghai biotechnology Services Co., Ltd synthetic primer (sequence sees Table 4), be diluted with water to 10pmol/ul then.With the Taq enzyme (production code member of purchasing: Lot, CE1101-1, TaKaRa), 10 * damping fluid (production code member: Lot, A2402-2, TaKaRa), the pcr amplification template of dNTP (production code member: D0056, Shanghai biotechnology Services Co., Ltd), pure water and embodiment 2 acquisitions is pressed the amplification system of following prescription:

Reaction system	Volume (ul)	Volume (ul)
			Template	3 (1-5,11,13,14, No. 16 templates)	3 (6-10, No. 15 templates)
10 * damping fluid	2.5	2.5
			DNTP (each 2.5mM)	2	2
MgCl 2(25mM)	1.5	1.5
			DMSO	1.5	1.5
20mg/ml BSA	1	1
			Primer 1 (10pmol/ul)	2	1
Primer 2 (10pmol/ul)	2	1
			Taq enzyme (1U/ul)	1	1
ddH2O	8.5	10.5

Annotate: 16 dna profilings of random choose also can be adjusted the volume of template and pure water as the case may be in order to adjust reaction parameter.

Increase according to following program with pcr amplification instrument (MJ Research, PTC 100): 94 ℃, 5min; Press 94 ℃ then, 30sec, 50 ℃, 30sec, 72 ℃, 30sec does 40 circulations, and last 72 ℃, 5min.

The PCR product of embodiment 5 marks and the hybridization of gene chip

Adopt the chip hybridization test kit and the colouring reagents box of Baiao Science and Technology Co. Ltd., Shanghai to carry out this cross experiment.Described chip hybridization test kit (production code member: BST05010, Baiao Science and Technology Co. Ltd., Shanghai) comprises: prehybridization solution, hybridization buffer, washing lotion 1, reaction cabin.Described chip colouring reagents box (production code member: BST06010, Baiao Science and Technology Co. Ltd., Shanghai) comprises: antibody liquid, washing lotion 2, washing lotion 3, colour developing liquid.

(1) pcr amplification liquid among the embodiment 3 and negative positive amplification liquid (amounting to 100ul) are joined in the thin-walled tube of same 0.2ml, 98 ℃ of thermally denatures 5 minutes are put into ice chest rapidly after the taking-up, placed 5 minutes for-20 ℃;

(2) take out the gene chip among the embodiment 1, carry out sample number into spectrum, in the hybridization cabin, add prehybridization solution solution 200 μ l, left standstill 5 minutes in 43 ℃, absorb this damping fluid;

(3) get aseptic 1.5ml centrifuge tube (white be equipped with), sucking-off 120 μ l hybridization buffers from the hybridization buffer bottle add the pcr amplification product mixture of sex change, and mixing all joins (should note not having bubble during liquid feeding produces) in the hybridization cabin with liquid;

(4) gene chip is put into 43 ℃ of thermostat containers rapidly, be incubated 30 minutes.Get the 1.5ml centrifuge tube simultaneously, sucking-off 700 μ l washing lotions 1 from 1 bottle of washing lotion, preheating in 43 ℃ of thermostat containers;

(5) from thermostat container, take out gene chip, absorb solution in the hybridization cabin;

(6) in the hybridization cabin, add 200 μ l, 1,43 ℃ of insulation of washing lotion 5 minutes of preheating, absorb then.Repeat this step twice again;

(7) add washing lotion 2 solution 200 μ l in the hybridization cabin, room temperature was placed 2 minutes;

(8) absorb solution in the hybridization cabin, add antibody liquid solution 200 μ l in the hybridization cabin, room temperature was placed 20 minutes;

(9) absorb solution in the hybridization cabin, add washing lotion 2 solution 200 μ l in the hybridization cabin, room temperature left standstill 5 minutes.Repeat this step more once;

(10) absorb solution in the hybridization cabin, add washing lotion 3 solution 200 μ l in the hybridization cabin, room temperature was placed 2 minutes;

(11) absorb solution in the hybridization cabin, add colour developing liquor 200 μ l in the hybridization cabin, 43 ℃ of lucifuges were placed 40 minutes;

(12) absorb solution in the hybridization cabin, carefully remove the hybridization cabin, 43 ℃ of oven dry are put carefully with distilled water flushing once by the slide glass that will develop the color colour developing district.

The detection of embodiment 6 gene chip hybridization signals

The colour developing slide glass faced down detect on the film trap that is buckled in BaiO  biochip recognition instrument, the instrument operation instruction is seen in concrete operations.Detected image can be exported detected result automatically through Array Doctor software analysis.Described gene chip detects gained result's photo and sees Fig. 1.

The result shows, the person under inspection all has signal in RET804 codon wild-type and mutant, and (A: wild-type, B: mutant), it be G/T heterozygous genes type that software is differentiated the result, belongs to the high risk population of pheochromocytoma, verifies through sequencing result to meet fully.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Claims (10)

1. a gene chip that is used to measure the pheochromocytoma susceptibility is characterized in that, it comprises solid phase carrier and be fixed in oligonucleotide probe on the described solid phase carrier in order that described oligonucleotide probe comprises:

(a) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of RET gene;

(b) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of SDHB gene;

(c) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of sdhd gene; With

(d) specifically at the cause a disease oligonucleotide probe of relevant mutational site of the pheochromocytoma of vhl gene.

2. gene chip as claimed in claim 1 is characterized in that, the pathogenic relevant mutational site of the pheochromocytoma of described RET gene is selected from:

The 609th amino acids codon TGC → AGC in the RET gene extron 10;

The 609th amino acids codon TGC → TGG in the RET gene extron 10;

The 609th amino acids codon TGC → CGC in the RET gene extron 10;

The 609th amino acids codon TGC → GGC in the RET gene extron 10;

The 609th amino acids codon TGC → TCC in the RET gene extron 10;

The 609th amino acids codon TGC → TAC in the RET gene extron 10;

The 609th amino acids codon TGC → TTC in the RET gene extron 10;

The 611st amino acids codon TGC → CGC in the RET gene extron 10;

The 611st amino acids codon TGC → TTC in the RET gene extron 10;

The 611st amino acids codon TGC → AGC in the RET gene extron 10;

The 611st amino acids codon TGC → TGG in the RET gene extron 10;

The 611st amino acids codon TGC → TAC in the RET gene extron 10;

The 611st amino acids codon TGC → GGC in the RET gene extron 10;

The 611st amino acids codon TGC → TCC in the RET gene extron 10;

The 618th amino acids codon TGC → TTC in the RET gene extron 10;

The 618th amino acids codon TGC → TCC in the RET gene extron 10;

The 618th amino acids codon TGC → CGC in the RET gene extron 10;

The 618th amino acids codon TGC → GGC in the RET gene extron 10;

The 618th amino acids codon TGC → AGC in the RET gene extron 10;

The 618th amino acids codon TGC → TAC in the RET gene extron 10;

The 618th amino acids codon TGC → TGG in the RET gene extron 10;

The 620th amino acids codon TGC → GGC in the RET gene extron 10;

The 620th amino acids codon TGC → TGG in the RET gene extron 10;

The 620th amino acids codon TGC → TAC in the RET gene extron 10;

The 620th amino acids codon TGC → CGC in the RET gene extron 10;

The 620th amino acids codon TGC → TTC in the RET gene extron 10;

The 620th amino acids codon TGC → TCC in the RET gene extron 10;

The 620th amino acids codon TGC → AGC in the RET gene extron 10;

The 630th amino acids codon TGC → TTC in the RET gene extron 11;

The 630th amino acids codon TGC → TCC in the RET gene extron 11;

The 630th amino acids codon TGC → TAC in the RET gene extron 11;

The 630th amino acids codon TGC → CGC in the RET gene extron 11;

The 630th amino acids codon TGC → AGC in the RET gene extron 11;

The 630th amino acids codon TGC → GGC in the RET gene extron 11;

The 630th amino acids codon TGC → TGG in the RET gene extron 11;

The 632nd amino acids codon GAG → AAG in the RET gene extron 11;

Near codon ACGAGCTGTGCCGCACGGTGAT → ACGAGggCTGTGCCGCAC GGTGAT the 633rd amino acids in the RET gene extron 11;

The 634th amino acids codon TGC → CGC in the RET gene extron 11;

The 634th amino acids codon TGC → GGC in the RET gene extron 11;

The 634th amino acids codon TGC → TTC in the RET gene extron 11;

The 634th amino acids codon TGC → AGC in the RET gene extron 11;

The 634th amino acids codon TGC → TGG in the RET gene extron 11;

The 634th amino acids codon TGC → TAC in the RET gene extron 11;

The 634th amino acids codon TGC → TCC in the RET gene extron 11;

The 640th amino acids codon GCC → GGC in the RET gene extron 11;

The 641st amino acids codon GCT → TCT in the RET gene extron 11;

The 648th amino acids codon GTC → ATC in the RET gene extron 11;

The 768th amino acids codon GAG → GAT in the RET gene extron 13;

The 768th amino acids codon GAG → GAC in the RET gene extron 13;

The 790th amino acids codon TTG → TTT in the RET gene extron 13;

The 791st amino acids codon TAT → TTT in the RET gene extron 13;

The 804th amino acids codon GTG → TTG in the RET gene extron 14;

The 804th amino acids codon GTG → ATG in the RET gene extron 14;

The 904th amino acids codon TCC → TGC in the RET gene extron 15;

The 918th amino acids codon ATG → ACG in the RET gene extron 16;

The 922nd amino acids codon TCC → TAC in the RET gene extron 16;

The pathogenic relevant mutational site of the pheochromocytoma of described SDHB gene is selected from:

The 43rd amino acids codon GCC → CCC in the SDHB gene extron 2;

The 46th amino acids codon CGA → GGA in the SDHB gene extron 2;

The 46th amino acids codon CGA → TGA in the SDHB gene extron 2;

The 46th amino acids codon CGA → CAA in the SDHB gene extron 2;

The 90th amino acids codon CGA → TGA in the SDHB gene extron 3;

The 591st disappearance of the codon of the 198th amino acids base C in the SDHB gene extron 6;

The codon the 620th of the 207th amino acids and 621 disappearance base TG in the SDHB gene extron 6;

Codon CGC → the TGC of the 230th amino acids in the SDHB gene extron 7;

Codon CGC → the CAC of the 230th amino acids in the SDHB gene extron 7;

The codon 713-716 position of the 23rd 8-240 amino acids disappearance base TCTC in the SDHB gene extron 7;

The pathogenic relevant mutational site of the pheochromocytoma of described sdhd gene is selected from:

The 64th C → T of the codon of the 22nd amino acids in the sdhd gene exon 2;

The 94th TCA disappearance of the codon of the 32nd amino acids TC in the sdhd gene exon 2;

The 38th amino acids codon CGA → TGA in the sdhd gene exon 2;

Insert A between the codon 148-149 position of the 50th amino acids in the sdhd gene exon 2;

Insert A between the codon 202-203 position of the 68th amino acids in the sdhd gene exon 3;

The 92nd amino acids codon GAC → TAC in the sdhd gene exon 3;

Lack ACTG between the codon 334-337 position of the 112nd amino acids in the sdhd gene exon 4;

The 121st amino acids codon CAG → TAG in the sdhd gene exon 4;

The pathogenic relevant mutational site of the pheochromocytoma of described vhl gene is selected from:

The 93rd amino acids codon GGC → TGC in the vhl gene exons 1;

The 93rd amino acids codon GGC → GAC in the vhl gene exons 1;

The 98th amino acids codon TAC → CAC in the vhl gene exons 1;

The 98th amino acids codon TAC → TGC in the vhl gene exons 1;

The 112nd amino acids codon TAC → CAC in the vhl gene exons 1;

The 156th amino acids codon TAT → TGT in the vhl gene exon 3;

The 161st amino acids codon CGA → CAA in the vhl gene exon 3;

The 167th amino acids codon CGG → TGG in the vhl gene exon 3;

The 167th amino acids codon CGG → CAG in the vhl gene exon 3;

The 178th amino acids codon CTG → CCG in the vhl gene exon 3;

The 184th amino acids codon CTC → CAC in the vhl gene exon 3;

The 188th amino acids codon CTG → GTG in the vhl gene exon 3.

3. gene chip as claimed in claim 1 is characterized in that, the kind of described oligonucleotide probe is the 20-250 kind, and each oligonucleotide probe contains 10-30 continuous nucleotide.

4. gene chip as claimed in claim 1 is characterized in that, 5 of each oligonucleotide probe ' end also comprises the poly-poly-deoxythymidylic acid of one section amido modified 4-25.

5. gene chip as claimed in claim 1 is characterized in that described pathogenic relevant mutational site is positioned at the middle part of place, mutational site oligonucleotide probe.

6. gene chip as claimed in claim 1 is characterized in that,

(a) be selected from SEQ ID NO:55-129 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of RET gene specifically;

(a) be selected from SEQ ID NO:1-17 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of SDHB gene specifically;

(a) be selected from SEQ ID NO:18-33 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of sdhd gene specifically; With

(a) be selected from SEQ ID NO:34-54 at the cause a disease sequence of oligonucleotide probe of relevant mutational site of the pheochromocytoma of vhl gene specifically.

7. method of determining RET, SDHB, SDHD and vhl gene type in the sample simultaneously may further comprise the steps:

(1) extracting obtains DNA from sample;

(2) be template with the DNA that obtains in the step (1), amplification obtains to comprise the amplified production in mutational site in RET, VHL, SDHB, the sdhd gene;

(3) amplified production of gained in the markers step (2);

(4) with amplified production and the claim 1 described gene chip hybridization of gained in the step (3) through mark;

(5) detect the hybridization signal of gene chip, thereby determine RET, SDHB, SDHD and vhl gene type in the sample.

8. method as claimed in claim 7 is characterized in that, in step (2), respectively RET, VHL, SDHB, sdhd gene separately independently in the amplification system amplification comprise the amplified production of mutational site gene.

9. test kit that is used to measure RET, SDHB, SDHD and vhl gene type, this test kit comprises the described gene chip of claim 1.

10. the described purposes that is used to measure the gene chip of pheochromocytoma susceptibility of a claim 1 is characterized in that, is used to prepare the test kit that detects the pheochromocytoma susceptibility.

Images