CN1951503A - Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases - Google Patents
Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases Download PDFInfo
- Publication number
- CN1951503A CN1951503A CN 200510030584 CN200510030584A CN1951503A CN 1951503 A CN1951503 A CN 1951503A CN 200510030584 CN200510030584 CN 200510030584 CN 200510030584 A CN200510030584 A CN 200510030584A CN 1951503 A CN1951503 A CN 1951503A
- Authority
- CN
- China
- Prior art keywords
- jwa
- cell
- expression
- gene
- astrocyte
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for using JWA gene or protein to prepare the anti-Parkinson's disease excitability amino acid toxic function drug. Wherein, it also discloses a drug compound with JWA gene express product or the material expressing the JWA protein. And the invention discloses a method for selecting and adjusting the compound that expresses the JWA gene. The invention improves the expression of JWA gene, to improve the ability of colloid cell to catch aminoglutaric acid, and release the hurt on black substance never caused by over aminoglutaric acid, to prevent Parkinson's disease.
Description
Technical field
The invention belongs to the cellular neurobiology field, relate to a kind of gene of regulating aminoacid picked-up ability in the cell, more specifically, the present invention relates to a kind of gene and purposes in the medicine of preparation inhibition parkinson disease toxicity of excitatory amino acid effect thereof of regulating glutamate uptake ability in the specific cells.
Background technology
(Parkinson ' s disease PD) is a kind of common nervous system degeneration to parkinson disease.The main clinical manifestation that James Parksion describes this disease first in 1817, promptly tranquillization tremble, bradykinesia, tetanic and postural reflex obstacle.(substantia nigra pars compacta contains that neural carrying out property of melanic dopamine neuron is dead to be Parkinsonian main pathological change (lose 5% every year approximately) in SNpc) to substantia nigra zona compacta.At present this disease is also lacked effective diagnosis and treatment means.
Glutamic acid is excitatory amino acid main in the mammal brain.A large amount of accumulation of glutamic acid can cause neural death among the central nervous system, are called as excitatory toxicity.The Parkinsonian cause of disease also imperfectly understands at present, unusual equal may the playing an important role in morbidity and progress of heredity, infection, endogenous or exogenous oxygen-derived free radicals and mitochondrial function.Oxidative stress institute's role in this disease pathogenic process is just receiving increasing concern.At the parkinson disease brain, the neural circuit dysfunction of ganglion basal, as subthalamic nuclei (subthalamic nucleus, STN) project the glutamic acid of black substance can efferent nerve fiber hyperfunctioning (Rodriguez etc., Ann Neurol 1998; 44:S 175-S88; Obeso etc., Neurology 2000; 55:S7-S12), excitatory amino acid glutamic acid excessively discharges.Think that at present the toxicity of excitatory amino acid effect of subthalamic nuclei glutamic acid serotonergic neuron mediation is one of the fundamental cause of nigral dopaminergic neuron unit carrying out property death (Benazzouz etc., Cell Transplant 2000; 9:215-21).
In view of this, it is believed that the overacfivity state of control subthalamic nuclei glutamic acid serotonergic neuron can slow down even end process (Rodriguez etc., the Ann Neurol 1998 of Parkinsonian PD; 44:S175-S88).Zooperal result shows that the damage subthalamic nuclei can prevent substantia nigra dopaminergic neuron death (Piallat etc., the Eur J Neurosci 1996 due to the 6-hydroxy dopamine; 8:1408-14; PiallatB etc., J Neural Transm Suppl 1999; 55:71-7.; Nakao etc., Ann Neurol1999; 45:640-51).In recent years, (as deep brain stimulation, DBS) suppress being overexcited of subthalamic nuclei excitatory neuron, treatment part Parkinsonian has obtained effect preferably to utilize high frequency stimulation in the world.In addition, the somebody is with expression inhibiting neurotransmitter γ-An Jidingsuan (γ-aminobutyric acid, GABA) synzyme glutamate decarboxylase (glutamic acid decarboxylase, GAD) vector injection of gene is gone into subthalamic nuclei, the be overexcited activity of glutamic acid serotonergic neuron of this zone is inhibited, also obtained better protect nigral dopaminergic neuron unit effect (Luo etc., Science 2002; 298:425-429).Above-mentioned data shows that all the unusual rising that reduces black substance glutamic acid is the dead extremely the key link of control nigral dopaminergic neuron unit.
Though the application of deep brain stimulation has obtained than ten-strike, this method cost height, have certain side effect, and be only applicable to the part Parkinsonian, be not suitable for early stage patient, belong to symptomatic treatment in essence.How to find other unusual rising that reduces black substance glutamic acid effectively, and then the method for protection nigral dopaminergic neuron unit is the problem that solution is needed in current parkinson disease treatment badly.
Increasing of extracellular glutamic acid level can cause neuronic damage because this process other central nervous system degenerative disease beyond the parkinson disease, as alzheimer disease and chorea (Coyle etc., Science 1993; 262:689-695; Meldrum etc., Trends Pharmacol.Sci.1990; 11:379-387.), amyotrophic lateral sclerosis (spinal cord) lateral sclerosis, and other pathological state, as epilepsy, traumatic brain injury, hyperglycemia, cerebral ischemia, anoxia (Choi, Neuron 1988; 1:623-634) also play an important role in generation of Denging and the evolution, therefore, the solution of this problem has significant universal meaning.
In the central nervous system, exist and remove the glutamic acid in the synaptic cleft fast and make it return presynaptic mechanism rapidly.This mechanism be called as the circulation of glutamic acid-glutamine (Daikhin and Yudkoff, JNutr 2000; 130:1026S-1031S).(excitatory amino acid transporter EAAT) is entered accessory glial cell by transhipment rapidly by excitatory amino acid transporter to be present in glutamic acid in the synapse space.EAAT is the transporter that a class sodium ion, potassium ion rely on.EAAT, comprise five members altogether, be respectively EAAT1, EAAT2, EAAT3, EAAT4 and EAAT5, former studies work shows that EAAT1, EAAT2 mainly are present in the neuron, and EAAT3, EAAT4 mainly are present in the glial cell, EAAT5 then mainly is present in (Niels C.Danbolt, Prog Neurobiol2001 in the visual system; 65:1-105), and EAAT3 also is present in the systems such as liver, kidney.
Cytoskeleton like gene JWA (glutamic acid transportor EAAC1 associated protein (glutamate transporterEAAC1-associated protein), GTRAP3-18), about molecular weight 22kDa, be a microtubule-associated protein of finding recently, it is prevalent in a plurality of systems of mammal whole body.At nervous system, this gene mainly is present in (Inoue K etc., Neurosci Lett.2005 in the neuron; 386:184-8).There is data to show, JWA can interact with EAAT3, thereby influence the reuptake of the activity downward modulation glutamic acid of EAAT3, this part work mainly is to finish in 293T cell (containing certain EAAT3 expresses), it is JWA (GTRAP3-18) high expressed, glutamic acid absorbs descend (Chien-liang Glenn Lin etc., Nature2001; 410,84-88).In addition, also in being rich in neuronic Mus brain Yuan Dynasty culture, obtained similar result in the document.Documents and materials also show, destroy the medicine of actin (actin), as cytochalasin (cytochalasin) B or cytochalasin (cytochalasin) D, also glutamic acid are absorbed with influence (Thorlin etc., FEBS Lett 1998; 425:453-459).But whether the reuptake of JWA gene pairs glial cell glutamic acid is influential still unknown.
The central nervous system is made up of two big class cells, mainly is neuron and glial cell.The latter comprises astrocyte, few prominent glial cell and microglia.Astrocyte has a lot of important physical functions, comprises neuronic support, and ionic equilibrium is to the release and the immune neuroregulation of neurotransmitter.Another critical function of astrocyte is exactly to form physical barriers to make focus obtain isolating after the central nervous system sustains damage, and participates in the healing of autologous tissue.The astrocyte that participates in this process can be activated in a large number, presents hypertrophy on the form, is referred to as reactive astrocytes.Therefore, the appearance of reactive astrocytes and state have been pointed out the generation of cerebral lesion and/or the existence of inflammatory reaction to a great extent, in conjunction with the develop rapidly of imaging technique in the present brain, thereby also might help the diagnosis of disease.
Therefore; glial cell is regulated in research; particularly astrocyte is to the method for glutamic acid reuptake; stop the unusual rising of extracellular glutamic acid; with protection nigral dopaminergic neuron unit; and then slow down even end Parkinsonian PD process, be urgent problem in the present prior art.
Summary of the invention
The object of the present invention is to provide a kind of glial cell that promotes; particularly astrocyte is to the gene of glutamic acid reuptake; thereby can stop the unusual rising of extracellular glutamic acid, protection nigral dopaminergic neuron unit, the process of slowing down even ending Parkinsonian PD.
In a first aspect of the present invention, provide the application of cytoskeleton sample albumen JWA in the medicine of preparation inhibition parkinson disease toxicity of excitatory amino acid effect.
In a preference of the present invention, described parkinson disease excitatory amino acid is a glutamic acid.
In a second aspect of the present invention, a kind of pharmaceutical composition is provided, its JWA gene expression product that contains effective dose maybe can be expressed the proteic cell of JWA, and pharmaceutically acceptable carrier.
In a preference of the present invention, the proteic cell of the described JWA of expression is the mammalian cell that transfection has the carrier that contains the JWA gene.In another preference, described carrier is selected from: the mammalian cell transfection is with carrier or virus.
In a preference of the present invention, described mammalian cell is a glial cell; Astrocyte particularly.
In a third aspect of the present invention, provide the application in the Parkinsonian medicine of preparation treatment of JWA albumen or gene.Described application is such as utilizing specific peptide sequence that JWA albumen is conveyed in the cell, or the cell of JWA is expressed in preparation.
In a fourth aspect of the present invention, a kind of method of regulating the chemical compound of JWA gene expression in the cell of screening is provided, it is characterized in that, may further comprise the steps:
(a) in the test group, in the culture of glial cell, add material standed for to be screened, and detect the wherein proteic expression of JWA;
(b) with the proteic expression of JWA in step (a) the test group with do not add that the proteic expression of JWA compares in the matched group of material standed for, if the JWA expressing quantity of test group is higher than (preferably being significantly higher than) matched group statistically, just show that this material standed for is the promoter of JWA protein expression; If be lower than (preferably significantly being lower than) matched group on the JWA expressing quantity statistics of test group, just show that this material standed for is the inhibitor of JWA protein expression.
In a fifth aspect of the present invention, the purposes of the proteic expression of a kind of JWA promoter is provided, be used to prepare the medicine for the treatment of Parkinson disease.
In a sixth aspect of the present invention, provide the chemical compound of JWA gene expression in a kind of usefulness promoted cell that foregoing method obtains.
Description of drawings
Fig. 1 has shown the JWA expression in the different brains of adult rat districts, and wherein A represents corpus callosum, and B represents Hippocampus, C agent's room periosteum, and under the D agent's room periosteum, E represents ventriculus tertius, and F represents the JWA expression in black substance zone.
Fig. 2 has shown that in the rat Parkinson disease model the positive astrocyte of 1 week of medicine injection back damage side black substance zone JWA is compared control sides a large amount of hypertrophy.
Fig. 3 has shown the photo of positive astrocyte of JWA and the positive astrocyte of GFAP.
Fig. 4 has shown the crown section immunohistochemistry of the brain statistical result in 1 week after the 6-OHDA damage rat medial forebrain bundle, 2 weeks and 5 weeks.
Fig. 5 has shown that blade damage cerebral cortex causes in the rat model of wound, and not seeing has the positive astrocyte of JWA to occur.
Fig. 6 has shown that variable concentrations 6-OHDA handles the detection that the JWA protein level changes behind the cell, presents certain dosage and relies on.
Fig. 7 analyzes through Western blot shown that expression vector pcDNA-JWA and pEGFP-JWA express in the glial cell of cultivating after, finds the consistent of its expression product and expection.
After Fig. 8 had shown various cells difference transfection pEGFP, pEGFP-JWA or pSEc-siRNA-JWA expression vector, (lipopolysaccharide carried out the cell migration result of experiment under the inducing LPS) at lipopolysaccharide to utilize Transwell.
Fig. 9 has shown that the HBE cell strain (B1-B4) of stably express EGFP-JWA fusion rotein is starkly lower than matched group (A1-A4) to the speed of offside growth.
Figure 10 has shown the mobility situation of HBE cell with respect to contrast.
Figure 11 has shown that transfection respectively has the astrocyte of pEGFP, pEGFP-JWA, pcDNA-JWA, pSEc-siRNA-JWA expression vector to stretch situation in the growth of In vitro culture after 6 hours.
Figure 12 has shown that cell sprawls in the test cell area quantitative statistics figure.
Figure 13 has shown that by immunofluorescence test this results suggest JWA can bring into play the effect that suppresses migration by the formation that suppresses F-actin.
Figure 14 has shown and has used captured photo behind pEGFP, the pEGFP-JWA expression vector transfection C6 cell respectively.Figure 14 A, B use captured photo behind pEGFP, the pEGFP-JWA expression vector transfection C6 cell respectively; Figure 14 C, D are each self-corresponding light field.
Figure 15 has shown that transfection has the C6 cell strain glutamic acid reuptake result of pEGFP, pEGFP-JWA expression vector.
The specific embodiment
The present invention proposes and remove the new method that causes parkinson disease substantia nigra dopaminergic neuron SDF, promptly by improving glial cell, the ability of astrocyte reuptake glutamic acid particularly, the glutamic acid of alleviating excessively release is prevented and treated Parkinsonian purpose to the neuronic damage of black substance thereby reach.
In the present invention, described JWA gene is meant the gene with GenBank accession number AF070523.1 or its functional fragment, its protein molecular weight is about 22kDa, and this albumen is a microtubule-associated protein of finding recently, and it is prevalent in a plurality of systems of mammal whole body.Described JWA gene can prepare by the technique for gene engineering of routine, prepares such as the method that can adopt synthetic.
In the present invention, the carrier that is used to be cloned into genes of interest comprises that any mammalian cell transforms or the transfection carrier, or viral vector, especially various commercially available carriers or viral vector.Include but not limited to: pcDNA3.1, pEGFP, pSEc neo etc.The specific part that genes of interest is cloned in the carrier is the technology that present technique field ordinary person knows, such as can on genes of interest and carrier, designing corresponding restriction enzyme site respectively, utilize restricted enzyme to carry out enzyme action and be connected, thereby obtain to carry the recombinant vector of genes of interest with dna ligase.
In the present invention, the cell that can be used for the carrier of the described JWA of the containing gene of transfection is a mammalian cell, such as glial cell, C6, CHO, HBE cell etc.; Preferably glial cell, particularly astrocyte.
Specific DNA transfection host cell can be carried out with routine techniques well known to those skilled in the art.When the host is an eukaryote, can select following DNA transfection method for use: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.The transformant that obtains can be cultivated with conventional method, expresses described JWA albumen.According to used host cell, used culture medium can be selected from various conventional culture medium in the cultivation.Under the condition that is suitable for the host cell growth, cultivate.After host cell grows into suitable cell density, induce the promoter of selection with suitable method (as temperature transition or chemical induction), cell is cultivated a period of time again.
In the present invention, " pharmaceutically acceptable " composition is to be applicable to people and/or animal and not have the material that excessive bad side reaction (as toxicity, stimulation and allergy) promptly has rational benefit/risk ratio.
In the present invention, " pharmaceutically acceptable carrier " is to be used for sending animal or human's pharmaceutically acceptable solvent, suspending agent or excipient to having active composition.Described carrier can be a liquid or solid.
In the present invention, the effective ingredient in described " pharmaceutical composition " includes but not limited to: a) by the active albumen of having of JWA gene expression; B) fusion rotein that is formed by connecting by active albumen of having of JWA gene expression and specific polypeptide (as the TAT polypeptide of HIV-1), described polypeptide can be carried into described albumen the glial cell (particularly astrocyte) of human body, and penetrate described cell, the proteic content of JWA rises in the described cell thereby make; C) can express the proteic cell of JWA.
Pharmaceutical composition of the present invention, it contains above-mentioned effective ingredient, and pharmaceutically acceptable carrier.Usually, can these materials are formulated in nontoxic, the inert and pharmaceutically acceptable aqueous carrier medium, wherein pH is about 5-8 usually, and preferably pH is about 6-8, although pH value can be with being changed to some extent by preparation Substance Properties and disease to be treated.The pharmaceutical composition for preparing can carry out administration by conventional route, comprising (but being not limited to): intraperitoneal, intravenous or topical; Preferably, described medicine can be carried out topical.
Pharmaceutical composition of the present invention contains above-mentioned effective ingredient and the pharmaceutically acceptable carrier or the excipient of the present invention of safe and effective amount.This class carrier comprises (but being not limited to): saline, buffer, glucose, water, glycerol, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by conventional method with normal saline or the aqueous solution that contains glucose and other adjuvant.Pharmaceutical composition such as injection, solution should be made under aseptic condition.The dosage of active component is the treatment effective dose, for example every day about 1 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, pharmaceutical composition of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that pharmaceutical composition with safe and effective amount is applied to mammal, wherein this safe and effective amount is usually at least about 10 micrograms/kg body weight, and in most of the cases be no more than about 8 mg/kg body weight, preferably this dosage is about 10 micrograms/kg body weight-Yue 1 mg/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
More specifically, the present invention mainly comprises following aspect:
(1) studied the expression pattern of JWA in the normal rat brain.Utilize immunohistochemical method, the inventor finds, in normal rat under corpus callosum, Hippocampus, ependyma, the ependyma, ventriculus tertius all has astrocyte to express JWA; Wherein have only corpus callosum JWA positive cell than horn of plenty, and the black substance zone positive astrocyte of JWA is rare.
(2) in the rat Parkinson disease model, the hyperplasia of 6-hydroxy dopamine (6-OHDA) injection can causing damage side black substance zone astrocyte, and these cells partly are the JWA positive.Be embodied in 1 week of medicine injection back damage side black substance zone and dopaminergic neuron death promptly occurs, and with a large amount of male astrocyte of JWA (Glial fibrillary acidic protein positives, be the GFAP positive), number is about about 5 times of original radix level, the damage offside then the male astrocyte of JWA do not see and be significantly increased, prolongation along with the time, injected for 2 weeks after 5 weeks at medicine, the male astrocyte number of JWA descends gradually again and returns to normal level.
In addition, the inventor also observes owing to mechanical damage (such damage is common in the daily life), and as drawing cerebral cortex and insert blade in cerebral cortex, the big cerebral trauma that causes can not activate the positive astrocyte of JWA.Show that the expression of JWA in the black substance zone has certain specificity.
After external use variable concentrations 6-OHDA handled astrocytes cultured, the JWA protein expression raised, and was doses-effect dependence.Illustrate that the expression of JWA in the black substance zone has unique space-time characteristics, and expression significantly improves under the 6-OHDA effect.
(3) JWA suppresses the migration of cell by regulating the expression and the change in location of F-actin.Mainly containing following three experimental results proves: after the first, making it expression JWA gene with pEGFP-JWA carrier transfection 293T cell, utilize Transwell to do cell migration experiment and (add lipopolysaccharide (situation under) at lower floor's culture fluid, investigate the influence of JWA gene rise to the 293T cell, found that, the mobility of the cell strain of high expressed JWA all is subjected to obvious inhibition, exist under the situation of LPS with lower floor's culture fluid and the JWA expression is low in the cell strain, all can move perforation quickly; Same phenomenon can be at the cell strain that utilizes other high expressed JWA gene, and the cell migration experiment of carrying out as the HBE cell strain of C6, CHO and JWA stably express is confirmed.
The second, scratch experiment.Utilize in the scratch experiment that the HBE cell strain of high expressed JWA gene done, compared with the control, the cell of high expressed JWA is starkly lower than matched group to the speed of offside growth.
Three, observe JWA and cytoskeletal protein F-actin expression and distribution and mutual relation with the immunofluorescence dyeing method, the result shows, in JWA albumen high expressed zone, the expression of F-actin obviously descends, prompting JWA is by suppressing the formation of F-actin, thereby suppress the stretching, extension of cell, and finally make the cell migration ability drop.
(4) method of utilizing electroporation in the C6 cell, and is done pEGFP, pEGFP-JWA transfection
3The glutamic acid reuptake experiment of H labelling found that the ability of the C6 cell reuptake born of the same parents extracellular glutamate of high expressed JWA significantly increases, and the ability drop of the 293T cell reuptake born of the same parents extracellular glutamate of this result and high expressed JWA (Lin etc., Nature 2001; 410,84-88) just in time opposite.
Compared with prior art, major advantage of the present invention:
(1) the present invention has found new function and the mechanism of action of JWA.In glial cell, the JWA up-regulated can cause the raising of glutamic acid reuptake ability.The discovery of this new function of JWA gene is for the exploitation of medicine from now on provides target molecule.Promptly can design relative medicine,, parkinson disease be played the effect of prevention and treatment by the expression of regulation and control JWA.
(2) existing parkinson disease treatment means, no matter be medicine or operation (as deep brain stimulation), be the suiting the medicine to the illness property treatment in disease later stage, be mainly used in the releasing of patient's symptom, and cause this difficult problem of cell death that new approach is provided for solving from the source by the medicine that the present invention obtains.
(3) inventor finds, JWA is under normal circumstances mainly by neuron expression, but in animal model for parkinsonism (PD model), this expression of gene then appears at activated astrocyte.According to studying data at home and abroad and the own available research achievements of the inventor (denomination of invention: a kind of labelled molecule of recognition reaction astrocyte and application thereof, application number: 200310107855.6), it is early stage that activated astrocyte often appears at disease, therefore, the JWA gene stops the continuation development of pathological changes that capital chance is provided in the disease that is expressed as of these cells in early days.
(4) experiment of the present invention also shows, JWA is also relevant with the transfer ability of cell.The inventor passes through multiple means (based on the cell migration of transwell, scratch experiment and cell are sprawled experiment) find, JWA raises, and can suppress the migration of cell, and this effect of prompting JWA is to bring into play by influencing gathering of filamentous actin (F-actin).
Central nervous system's degenerative disease is with the propagation and the migration of glial cell.In the PD rat model, the 6-OHDA damage is during 1 week, and damage side substantia nigra zona compacta and reticular zone specificity cause the positive astrocyte hypertrophy that JWA expresses, and tyrosine hydroxylase (TH) positive neuron number then obviously reduces.That is to say that normal glial cell JWA is in reduced levels, in the PD model, JWA raises.
In sum; the inventor's result of study prompting; JWA is one of specificity marker thing of activated astrocyte behind nervous system generation degeneration; and bring into play and itself suppress cell migration and the function that strengthens born of the same parents' extracellular glutamate reuptake; body is produced certain neuroprotective, for the early diagnosis and therapy medicine of studying degeneration provides new approaches and new method.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Adopt immunohistochemistry and Cytometric method.The brain sheet is fixed through conventional method, and with hatching 30 minutes with 4% sheep blood serum after PBST (PBS the contains 0.01%tritonX-100) rinsing, reuse contains the JWA antibody of 1% sheep blood serum, and (this antibody is available from U.S. Research Genetics company.Antigen is the synthetic JWA-C20 small peptide of the said firm (LEQQEEGINRLTDYISKVKE), and with keyhole worm relative hemocyanin (keyhole limpethemocyanin, KLH) phase coupling; With this polypeptide with after Freund's complete adjuvant mixes, immune new zealand white rabbit, later on once every 3 all booster immunizations; After strengthening 4 times, get blood, after blood coagulation, obtain antiserum).Hatched 48 hours reuse PBST rinsing at 4 ℃.In biotinylation second antibody (goat anti-rabbit igg, available from Sigma, the U.S.), hatched 1.5 hours then, carry out conventional ABC method reaction then, go the DAB chromogenic reaction again.Carry out cell counting with the optics microscopically through amplifying 200 times.
Experimental result shows, in normal rat under corpus callosum, Hippocampus, ependyma, the ependyma, ventriculus tertius all has astrocyte to express JWA; Wherein have only corpus callosum JWA positive cell than horn of plenty, and the black substance zone positive astrocyte of JWA is rare.The results are shown in Figure 1, wherein, A is callosal JWA expression, and B is the JWA expression of Hippocampus, and C is ependymary JWA expression, and D is subendymal JWA expression, and E is the JWA expression of ventriculus tertius, and F is the JWA expression in black substance zone.
Embodiment 2 animal model tests
180-220 is restrained the Sprague-Dawley rat to be fixed on the animals stereo position finder.With 4 microlitre 6-OHDA (2.5 μ g/ μ l are dissolved in the 0.2mg/ml ascorbic acid) (Sigma, St.Louis, MO, the U.S.) be injected into rat right side medial forebrain bundle (with respect to the elements of a fix of bregma: AP-4.4, ML+1.2, DV+7.8), injection speed is 0.4 mul/min, has injected to stop pin and syringe is slowly withdrawed from after 10 minutes again.Operation back one all lumbar injection apomorphines (0.05 milligram/kg body weight) (Sigma, St.Louis, MO, the U.S.), the rotation of test rat, generally need rotation 6 circles/minute more than as successful PD rat model model.
Rat machinery (blade) damage cerebral cortex model is vertically to insert 5 millimeters long in rat layer, 2 millimeters deep, and the blade of 1 mm wide, week back perfusion is also fixing.
6-hydroxy dopamine (6-OHDA) injection is the result show, it can cause the hyperplasia of damage side black substance zone astrocyte, and these cells partly are the JWA positive.Be embodied in 1 week of medicine injection back damage side black substance zone and dopaminergic neuron death promptly occurs, and with a large amount of male astrocyte of JWA (glial fibrillary acidic protein positives, be GFAP (Sigma, St.Louis, MO) positive), number is about about 5 times of original radix level, control sides then the quantity of the male astrocyte of JWA then do not see and be significantly increased, see Fig. 2, wherein Fig. 2 A represents control sides, and Fig. 2 B represents to damage side.Along with the prolongation of time, injected for 2 weeks after 5 weeks at medicine, the male astrocyte number of JWA descends gradually again and returns to normal level.Fig. 4 is seen in the crown section immunohistochemistry of the brain statistical result as a result in 1 week, 2 weeks and 5 weeks after the 6-OHDA damage rat medial forebrain bundle.
Positive astrocyte of JWA and the positive astrocyte of GFAP are seen Fig. 3 C1, and Fig. 3 C1 shows the positive astrocyte (red-label) of JWA, and Fig. 3 C2 has shown the positive astrocyte (Green Marker) of GFAP, and Fig. 3 C3 is the merging processing figure of preceding two figure.
The inventor also observes, because mechanical damage (such damage is common in the daily life), as drawing cerebral cortex and insert blade in cerebral cortex, the big cerebral trauma that causes can not activate the positive astrocyte of JWA.See Fig. 5, blade damage cerebral cortex causes in the rat model of wound, and not seeing has the positive astrocyte of JWA to occur.
1. construction of recombinant plasmid
The expression vector that uses in the present embodiment is all with commercially available plasmid such as pcDNA3.1 (American I nvitrogen, company), pEGFP (U.S. Clontech company), pSEc neo (U.S. Ambion company) be the basis, the above-mentioned corresponding plasmids of insertion such as JWA full-length cDNA that utilize dna ligase (Takara DaLian, China) to handle through restricted enzyme.These gene expression plasmids can import different cell (comprising astrocyte, 293T, CHO, C6) respectively.Astrocyte is former rat substantia nigra astrocyte of being commissioned to train foster.Preparation process is summarized as follows: take out and give birth to 1-2 days the rat substantia nigra in back, be cut into 0.5mm
3Fritter, break up with mechanicalness behind the trypsinization and to make it become single cell suspension, by 5 * 10
4Cell/centimetre
2Cultivate.Used culture medium is DMEM/F12.293T, CHO, C6 cell strain are all available from ATCC or Chinese Academy of Sciences's Shanghai cell bank.
The structure of plasmid pEGFP-JWA of reorganization: by EcoRI and two restriction enzyme sites of Kpnal, with rat JWA full length cDNA sequence be inserted into the pEGFP expression vector (U.S. Clontech company, Palto Alto, CA, USA).
The structure of the plasmid pSEc-SiRNA of reorganization: by EcoRI and two restriction enzyme sites of HindIII, to be inserted into pSEc neo expression vector (U.S. Ambion company at the siRNA (sequence is AAATGGAACAACCGCGTAGTG) of JWA 1-19 position nucleotide, Austin, TX, USA).
The structure of plasmid pcDNA-JWA of reorganization: by EcoRI and two restriction enzyme sites of Kpna1, with the JWA full length cDNA sequence be inserted into the pcDNA3.1 expression vector (American I nvitrogen company, Carlsbad, CA, USA).
The plasmid pcDNA-bFGF of reorganization: provide by Yoshikazu doctor Yonemitsu of Kyushu University.
2.Western engram analysis
Astrocyte, 293T, CHO, C6 cell are transfected to contain the plasmid of JWA gene after 48 hours, wash 3 times with phosphate buffer (PBS), add lysis buffer (1 * PBS, 1%Nonidet P-40,0.5% NaTDC (sodium deoxycholate), 0.1%SDS, protease inhibitor cocktail), scrape with cell cell is scraped and (for cerebral tissue, then be to add lysis buffer, use electric homogenizer homogenate.) placed on ice 30 minutes, use thin syringe pump lysate then, placed on ice 30 minutes.4 ℃ 10, centrifugal 10 minutes of 000g.Get supernatant.Add sample-loading buffer, 95 ℃ of water-baths 5 minutes.SDS-PAGE electrophoresis then, electricity goes to nitrocellulose filter then, with TBST (1 * TBS, 0.05%Tween 20) rinsing, hatched 45 minutes with the TBST that contains 5% defatted milk powder then, again at anti-[JWA antibody or GFAP antibody or a Tubulin antibody, Sigma, St.Louis, MO, the U.S.] in hatched 45 minutes, after the TBST rinsing again at the goat anti-rabbit igg of horseradish peroxidase (available from Sigma, St.Louis, MO, the U.S.) in hatched 45 minutes, after the rinsing according to SuperSignal West Pico ECL system (Pierce, Rockford, the IL U.S.) the operation exposure, develop.
The results are shown in Figure 6, after external use variable concentrations 6-OHDA handled astrocytes cultured, 293T, CHO, C6, the JWA protein expression raised, and was doses-effect dependence.Illustrate that the expression of JWA in the black substance zone has unique space-time characteristics, and expression significantly improves under the 6-OHDA effect.
3.Transwell experiment
Obtain pEGFP-JWA, pSEc-siRNA-JWA as previously mentioned, pcDNA-JWA, pcDNA-bFGF recombiant plasmid.With pEGFP, pEGFP-JWA, pSEc-siRNA-JWA, pcDNA-JWA, the pcDNA-bFGF plasmid transforms the 293T cell, transforms C6, CHO, HBE cell with pEGFP and pEGFP-JWA.
Be ready to cells matched group, transfection or various processing.80,000/milliliter of digestion countings place the Eppendorf pipe of a sterilization, add dyestuff Hochest33342 (10 mcg/ml, Sigma, the U.S.), hatch in the cell culture incubator 60 minutes.(number visual cell difference can change) 1,000g, centrifugal, and add the culture fluid that serum-free does not have other trophic factors, mixing.Aquesterilisa is cleaned clean, the hole on the Chamber lower plate that it's 2 hours is past ultra-vioket radiation adds the complete culture solution about 100 microlitres, perhaps contains the reagent of influential cell migration, as LPS etc., makes that liquid is slightly high to portal, because surface tension can be the semilune projection.Above the polycarbonate membrane (Polycarbonate membrane) of required size placed, can not produce bubble.Put rubber blanket, upper plate by the hole direction successively again, the symmetry screw of screwing on.Add ready cell suspension of the 3rd step, every hole 100 microlitres.Put into a wet box, place incubator to hatch 2 hours.(migration time visual cell, number difference can change) takes out Chamber, turns on screw, the cell above the polycarbonate membrane scraped off gently (following cell is treated fixed count) with " cell is scraped ".Polycarbonate membrane is dropped into stock solution methanol, fixing 15min, reuse PBS washes secondary, dries.Place between the sour microscope slide and coverslip that steeped, bubble is tried not to leave in the centre.40 times (10 times on object lens) are observed and are taken pictures, counting.(observation multiple visual cell, number difference can change) about counting, adopts ImageMaster 2D Platinum analysis software (Amersham Pharmacia Biotech, the U.S.) to analyze photo and point counts, statistics.
The Western blot analysis result of cell transfecting efficient is seen Fig. 7, confirms to have higher transfection efficiency.
The 293T cell strain is respectively behind transfection pEGFP, pEGFP-JWA, the pSEc-siRNA-JWA, and that utilizes that Transwell carries out under lipopolysaccharide (LPS) that cell migration tests (LPS attraction or do not attract) the results are shown in Figure 8; Known somatomedin bFGF migration capable of inhibiting cell, so the pcDNA-bFGF transfection is here as positive control.Found that the mobility of the cell strain of high expressed JWA all is subjected to obvious inhibition, exist under the situation of LPS with lower floor's culture fluid, all can move perforation quickly and the JWA expression is low in the cell strain; The cell migration of instantaneous high expressed bFGF (be these cells transfected pcDNA-bFGF expression plasmid) is restricted as a positive control.Same phenomenon can be confirmed at the cell strain that utilizes other high expressed JWA gene, does the Transwell experiment behind HBE cell strain transfection pEGFP, the pEGFP-JWA as C6, CHO and JWA stably express, and concrete outcome is seen Fig. 8.
4. scratch experiment
The HBE cell preparation single cell suspension that getting goes down to posterity grows fine adds cell in the 35mm ware, in 5%CO
2Hatch to full scale and be about 80% for 37 ℃ in the incubator, vertically mark an acellular thin trace with aseptic 1000ml rifle head, making cultured cell wound model.The note of taking pictures under phase contrast microscope amount wound width, later on respectively continued cultivate and 2,4,6,36 hour after measure same place as behind the cut 0 day this moment, heals substantially to the cut wound surface.Three independent experiments.
Fig. 9 shows that compared with the control, the HBE cell strain of stably express EGFP-JWA fusion rotein (cell of high expressed JWA) (B1-B4) is starkly lower than matched group (A1-A4) to the speed of offside growth.Figure 10 shows that the HBE cell significantly reduces with respect to the mobility of contrast.HBE cell migration percentage of elongation behind the cut sees Table 1, and HBE cell mobility every day has been suppressed 4.14% as can be known.
Table 1
| Matched group | High expressed pEGFP-JWA group | |
| Average mobility every day migration in second day percentage of elongation | 11.51％ 23.02％ | 7.37％ 14.74％ |
5.F-actin dyeing and cell are sprawled experiment
In long about 80% the full scale that arrives of former generation astrocytes cultured, utilize fugene 6 (available from Roche Diagnostics, the U.S.) pEGFP, pEGFP-JWA, pcDNA-JWA or pSEc-siRNA-JWA are changed over to, use trypsinization then, the cell kind is gone into to use in advance in the culture plate fully of collagen (collagen) shop, and methanol is fixed after 6 hours, uses F-actin dyestuff Phalloidin (Sigma, the U.S.) dye 30min, the mounting fluorescence microscope.Use ImageMaster 2DPlatinum (Amersham bioscience) to calculate cell number and cell area in the gained picture then.
Transfection has pEGFP, pEGFP-JWA, pcDNA-JWA, the growth of pSEc-siRNA-JWA astrocyte plantation after 6 hours to stretch situation (red-label F-actin) and see Figure 11 A-D respectively respectively.Results suggest is crossed the astrocyte (transfection has pEGFP-JWA, pcDNA-JWA) of expressing the JWA gene and is sprawled slowly, therefore compares with contrast (transfection has pEGF), and cell area is corresponding less.And after utilizing pSEc-siRNA-JWA downward modulation JWA expression of gene, cell area and normal phase are than no significance difference.Cell area quantitative statistics figure sees Figure 12.
6. the double-colored labelling of immunofluorescence
Rat brain slice is fixed through conventional method, with hatching 30 minutes with 4% sheep blood serum after PBST (PBS the contains 0.01%tritonX-100) rinsing, the JWA antibody that reuse contains 1% sheep blood serum was hatched 48 hours at 4 ℃, and reuse PBST rinsing is with brain sheet and biotin bonded two anti-(goat anti-rabbit iggs, available from Sigma, the U.S.) hatch 1.5 hours, rinsing, again with the fluorescein FITC that is combined with avidin (available from Sigma, the U.S.) hatch 1 hour, rinsing.4% paraformaldehyde is fixed 20 minutes then, and rinsing was hatched 30 minutes with 4% sheep blood serum, then with the antibody of cell marking molecule (as GFAP, U.S. Sigma company; JWA antibody) hatch, rinsing, resist with two of fluorescein Texas Red labelling then (goat anti-mouse igg, available from Sigma, the U.S.) hatch rinsing.Phalloidin (Sigma) is used to show the F-actin.With fluorescence mountant mounting, fluorescence microscope is observed down, takes a picture.
The results are shown in Figure 13, Figure 13 A-C is F-actin expression and location (green expression GFP, a red-label F-actin) in the matched group; Figure 13 D-F is that transfection has JWA and F-actin expression and mutual relation (green expression GFAP-JWA, red-label F-actin) in the astrocyte of pEGFP-JWA.In JWA albumen high expressed zone, the expression of F-actin obviously descends, and prompting JWA suppresses the formation of F-actin, thereby suppresses the stretching, extension of cell, and finally makes the cell migration ability drop.
The test of embodiment 4 glutamic acid reuptakies
The C6 cell strain of cultivating KRH (NaCl:128mmol/l, KCl:5mmol/l, CaCl
2: 2.7mmol/l, MgSO
4: 1.2mmol/l, Na
2HPO
4: 1.2mmol/l, HEPES:20mmol/l) culture medium precincubation is 60 minutes, discards KRH, adds 500 μ l KRH culture medium and (comprises 10nM, 50Ci/mmol
3H-Glu; The glutamic acid that 30uM does not demarcate) start, 37 degree incubations 5 minutes are washed twice termination with 500 ice-cold microlitre KRH culture medium, use ice-cold 0.1N NaOH cell lysis then immediately.At last, cell pyrolysis liquid adds a certain amount of scintillation solution, uses liquid glimmer instrument to measure.
Respectively with electroporation method transfection pEGFP, pEGFP-JWA visible Figure 14 of captured photo behind the C6 cell.Figure 14 A and the B captured photo that is transfection pEGFP, pEGFP-JWA behind the C6 cell; Figure 14 C and D are each self-corresponding light field.
The C6 cell strain glutamic acid reuptake that transfection has pEGFP, a pEGFP-JWA is Figure 15 as a result, (the electroporation mode transfection of the C6 cell of high expressed JWA, efficient is higher, can reach more than 80%) ability of reuptake born of the same parents extracellular glutamate significantly increased about 1.5 times, the ability drop of the 293T cell reuptake born of the same parents extracellular glutamate of this result and high expressed JWA (Lin etc., Nature 2001; 410,84-88) opposite.
Embodiment 4 JWA full-length cDNAs source
Utilizing the RT-PCR method, is masterplate with the cDNA of human liver cell strain, amplification JWA coding region full length sequence, 575bp altogether.The primer is: primer (forward): 5 '-cttcgaattctgatggacgttaatatc-3 forward; Reverse primer (reverse): 5 '-cgcggtaccttccttcactttgctg-3 '.The method that the cDNA of human liver cell obtains is as follows:
Total RNA extracts: human liver cell strain (Hep G2, Chinese Academy of Sciences's Shanghai cell bank) is added the abundant cracking of 1ml Trizol, homogenate is poured in the 1.5ml centrifuge tube, room temperature leaves standstill 5min; Add chloroform 0.2ml, leave standstill 2min behind the vibration mixing; 4 ℃ are centrifugal, and 12,000g * 30min; Get the upper strata water to another centrifuge tube, add the 0.5ml isopropyl alcohol, leave standstill 10min behind the mixing, 4 ℃ are centrifugal, and 12,000g * 10min, visible white RNA precipitation; Add 75% ethanol 1ml washing precipitation, 4 ℃ are centrifugal, and 7,500g * 10min abandons supernatant, and dry postprecipitation is resuspended in the no RNase water.Quantitative with DU-650 type UV spectrophotometer measuring, with the unified 1 μ g/ μ l that is diluted to of RNA.
RT reaction: get RNA 4 μ g (4 μ l), oligodT
(36)AGC 3 μ l, ddH
2O 9 μ l, mixing is placed 4min for centrifugal back 70 ℃, adds 5 * buffer, 6 μ l under the condition of ice bath, and dNTPs (5 * 10
-3Mol/L) 1 μ l, M-MLV 0.5 μ l, ddH
2O 8.5 μ l, cumulative volume 30 μ l, 42 ℃ of reaction 90min, 70 ℃ of 5min deactivation reverse transcription.Promptly synthetic cDNA article one chain is as the template of PCR.
The PCR:PCR system is totally 50 μ l (containing R-T product 2 μ l), and condition is: 95 ℃ of pre-degeneration 5min, 95 ℃ of 30s subsequently, 60 ℃ of 45s, 72 ℃ of 60s, totally 35 circulations; 72 ℃ are extended 10min.Simultaneously be with human gene group DNA template in contrast.The PCR product detects with 1% agarose gel electrophoresis.
As a result, obtained the amplified production of JWA coding region full length sequence, electrophoresis detection shows the about 580bp of length.In addition, use similar approach, make the pcr amplification product that contains rat JWA coding region full length sequence.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (9)
1. the application of cytoskeleton sample albumen JWA in the medicine of preparation inhibition parkinson disease toxicity of excitatory amino acid effect.
2. application as claimed in claim 1 is characterized in that, described parkinson disease excitatory amino acid is a glutamic acid.
3. a pharmaceutical composition is characterized in that, the JWA gene expression product that contains effective dose maybe can be expressed the proteic cell of JWA, and pharmaceutically acceptable carrier.
4. pharmaceutical composition as claimed in claim 3 is characterized in that, the proteic cell of the described JWA of expression is the mammalian cell that transfection has the carrier that contains the JWA gene.
(in another preference, described carrier is selected from: mammalian cell transfection with carrier or virus).
5. pharmaceutical composition as claimed in claim 4 is characterized in that, described mammalian cell is glial cell (a particularly astrocyte).
6.JWA albumen or the gene application in the Parkinsonian medicine of preparation treatment (as utilizing specific peptide sequence JWA albumen is conveyed in the cell, or the cell of JWA being expressed in preparation).
7. one kind is screened the method for regulating the chemical compound of JWA gene expression in the cell, it is characterized in that, may further comprise the steps:
(a) in the test group, in the culture of glial cell, add material standed for to be screened, and detect the wherein proteic expression of JWA;
(b) with the proteic expression of JWA in step (a) the test group with do not add that the proteic expression of JWA compares in the matched group of material standed for, if the JWA expressing quantity of test group is higher than (preferably being significantly higher than) matched group statistically, just show that this material standed for is the promoter of JWA protein expression; If be lower than (preferably significantly being lower than) matched group on the JWA expressing quantity statistics of test group, just show that this material standed for is the inhibitor of JWA protein expression.
8. the purposes of the proteic expression of a JWA promoter is characterized in that, is used to prepare the medicine for the treatment of Parkinson disease.
9. the chemical compound of JWA gene expression in the promoted cell that obtains with the described method of claim 7.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510030584 CN1951503A (en) | 2005-10-17 | 2005-10-17 | Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200510030584 CN1951503A (en) | 2005-10-17 | 2005-10-17 | Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1951503A true CN1951503A (en) | 2007-04-25 |
Family
ID=38058182
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200510030584 Pending CN1951503A (en) | 2005-10-17 | 2005-10-17 | Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1951503A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102297971A (en) * | 2011-06-15 | 2011-12-28 | 南京医科大学 | Kit for detecting expression of JWA in cancer or malignant tumor tissue |
| CN110201173A (en) * | 2019-06-21 | 2019-09-06 | 周建伟 | The anti-aging purposes of JWA gene and related compound |
| WO2024055457A1 (en) * | 2022-09-16 | 2024-03-21 | 苏州明人医药生物科技有限公司 | Use of jwa polypeptide in preparation of anti-parkinson's disease drug |
-
2005
- 2005-10-17 CN CN 200510030584 patent/CN1951503A/en active Pending
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102297971A (en) * | 2011-06-15 | 2011-12-28 | 南京医科大学 | Kit for detecting expression of JWA in cancer or malignant tumor tissue |
| CN110201173A (en) * | 2019-06-21 | 2019-09-06 | 周建伟 | The anti-aging purposes of JWA gene and related compound |
| CN110201173B (en) * | 2019-06-21 | 2020-11-10 | 周建伟 | Anti-aging application of JWA gene and related compounds |
| CN114340677A (en) * | 2019-06-21 | 2022-04-12 | 先声药业有限公司 | Anti-aging application of JWA gene and related compounds |
| CN114340677B (en) * | 2019-06-21 | 2023-10-20 | 先声药业有限公司 | JWA gene and anti-aging application of related compounds |
| WO2024055457A1 (en) * | 2022-09-16 | 2024-03-21 | 苏州明人医药生物科技有限公司 | Use of jwa polypeptide in preparation of anti-parkinson's disease drug |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | NG2 glial cells provide a favorable substrate for growing axons | |
| JP5645816B2 (en) | Pharmaceutical composition comprising core factor related to proliferation and differentiation of central nerve cell | |
| Oumesmar et al. | Developmental expression of platelet-derived growth factor α-receptor in neurons and glial cells of the mouse CNS | |
| CN102164611B (en) | Therapeutic use of a growth factor, METRNL | |
| US9701675B2 (en) | Activation of TRPV4 ion channel by physical stimuli and critical role for TRPV4 in organ-specific inflammation and itch | |
| Ke et al. | The effect of astragalin on the VEGF production of cultured Müller cells under high glucose conditions | |
| Chung et al. | Expression of chondroitin sulfate proteoglycans in the chiasm of mouse embryos | |
| Kaji et al. | Localization of D-β-aspartic acid–containing proteins in human eyes | |
| O'Neill et al. | Nogo and Nogo‐66 receptor in human and chick: Implications for development and regeneration | |
| CN109563130A (en) | For treating the TDP-43 mitochondria positioning inhibitor of neurodegenerative disease | |
| de la Fuente et al. | Calpain inhibition increases SMN protein in spinal cord motoneurons and ameliorates the spinal muscular atrophy phenotype in mice | |
| CN1951503A (en) | Application of cytoskeleton like gene JWA in inhibiting toxicity of excitatory amino acid for treating Parkinson's diseases | |
| JP2021508673A (en) | Taupeptide immunogenic construct | |
| Matragoon et al. | Electroporation-mediated gene delivery of cleavage-resistant pro–nerve growth factor causes retinal neuro-and vascular degeneration | |
| Huxlin et al. | Glial reactivity in the retina of adult rats | |
| Angelo et al. | P75NTR expression is induced in isolated neurons of the penumbra after ischemia by cortical devascularization | |
| Zhang et al. | The degeneration and apoptosis patterns of cone photoreceptors in rd11 mice | |
| JP2023072043A (en) | Material for treating encephalopathy, method for treating encephalopathy, material for regenerating brain neuron, and method for regenerating brain neuron | |
| Cheng et al. | Repopulated retinal microglia promote Müller glia reprogramming and preserve visual function in retinal degenerative mice | |
| CN102648977B (en) | Application of follistatin-related protein 1 in adjusting Na, K-ATPase activity | |
| WO1999053945A1 (en) | Neuron growth inhibitory molecules or derivatives thereof used to immunize mammals thereby promoting axon regeneration | |
| Justine et al. | The homology of cortical microtubules in platyhelminth spermatozoa: a comparative immunocytochemical study of acetylated tubulin | |
| Lv et al. | Clearance of β-amyloid and synapses by the optogenetic depolarization of microglia is complement selective | |
| KR101358601B1 (en) | The method for preparing dopamine neurons | |
| KR20200089151A (en) | A pseudo type rabies virus vaccine using virus-like particles |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |