CN1944460A - ALR polypeptide and application thereof - Google Patents

Abstract

The present invention relates to a liver regeneration enhancement factor (ALR) polypeptide. The present invention also relates to the application for these polypeptides, which is in particular used for cureing the disease state.

Description

ALR polypeptide and application thereof

Technical field

The present invention relates to augmenter of liver regenration (ALR) polypeptide.The present invention also relates to the application of these polypeptide, especially for the treatment morbid state.

Background technology

Known liver has surprising regenerative power, and liver growth and regeneration need multiple specificity and nonspecific hormone and other somatomedin.Non-specific liver stimulator comprises Regular Insulin, Urogastron (EGF), pHGF (HGF), insulin-like growth factor I (IGF-1) and transforming growth factor (TGF-α).A kind of liver specificity liver nutrition (hepatotrophic) somatomedin is augmenter of liver regenration (augmenter of liver regeneration or ALR) (being also referred to as hepatocyte growth factor (HPO)).Originally, ALR identified and from rats'liver excitor substance (HSS) purifying obtain (Hagiya etc., 1994).

In vivo with in vitro study in, shown that ALR can increase by 40% partial hepatectomy (PH) or the inductive proliferative response of PBC (PCS) institute.Use eck's fistula (Eck fistula) test to obtain similar result, wherein in the hepatic portal injection proliferative response that ALR excited be better than the caused slight liver cell proliferation of PBC (Polimeno etc., 1999).ALR also can stimulate in the body in the liver cell DNA synthetic, and has found that it has FAD-Thiol oxidase activity, is similar to yeast homologue ERV1p, and ALR can be provided role in plastosome genetic expression.In addition, shown that the ALR specific receptors is present in all normal and unusual liver cells, its be cell cultured supernatant propagation necessary (Wang etc., 1997).

All very clear in the quite a long time, be used to comprise fulminant hepatic failure liver disease ALR may have clinical implication (Francavilla etc., 1994).In addition, seemingly a kind of protein with important physiological property of ALR is not limited in liver regeneration, its effect be present in the active regeneration cell in nucleus and plastosome transcript synthetic or stable relevant, particularly relevant (Giorda etc., 1996) with the testis sexual cell.

From human fetal liver library, separated and cloned coding people ALR cDNA (Giorda etc., 1996; Yang etc., 1997a).The ALR and the rat ALR of this cDNA coding have 87% amino acid sequence identity, have 42% amino acid sequence identity with yeast ERV.The gene of coding total length people ALR (hALR) comprise the coding region of 5 ' non-translational region of 157 Nucleotide, 1570 Nucleotide and 3 ' non-translational region of 86 Nucleotide (Giorda etc., 1996; Cheng etc., 2000).HALR comprises 125 amino acid, and estimated molecular weight is the 15.1kDa (see figure 1).Research has shown that reorganization hALR can cell cultured supernatant and hepatoma cells propagation in the external and body, can also promote hepatocellular regeneration and injury recovery (Yang etc., 1997b).

The expression that had been presented at reorganization hALR in protokaryon (E.coli) and eucaryon (COS cell and the S.cerevisiae) cell already has the activity suitable with the natural hALR of purifying.Francavilla etc.(U.S. Patent number 5,811,397) have reported the clone and the expression of another kind of people ALR gene (being called HPO-205), and 205 amino acid whose protein of this genes encoding have the similar activity with hALR, but comprise 80 extra amino acid at the N-end.

Up to now, the mixture of different pHGFs has been used to treat hepatopathy.Owing to shown that hALR is a kind of important somatomedin in liver regeneration and recovery, therefore needed exploitation hALR especially as a kind of feasible therapeutical agent or medicine.

The present invention is based on the inventor and finds to compare with its natural type, exists extra histidine residues can improve functional performance, specificity and the biological activity of hALR at the N and/or the C-end of hALR polypeptide.These extra residues also produce favourable improvement to the production characteristic of reorganization hALR, and Open from This Side is used for the treatment of the method for agent or drug development.

Summary of the invention

According to a first aspect of the invention, provide a kind of ALR polypeptide of purifying, wherein said polypeptide comprises the one or more histidine residues that are positioned at N and/or C-terminal.

In one embodiment, described polypeptide comprises 3-18 the histidine residues that is positioned at N and/or C-terminal.Described polypeptide can comprise 12 histidine residues that are positioned at N and/or C-terminal.In one embodiment, described polypeptide comprises 12 histidine residues that are positioned at C-terminal.Described polypeptide can comprise the aminoacid sequence shown in SEQ ID NO:5, and/or is that nucleotide sequence shown in SEQ ID NO:6 is coded.

In another embodiment, described polypeptide can comprise 18 histidine residues that are positioned at N and/or C-terminal, for example is positioned at 18 histidine residues of C-terminal.Described polypeptide can comprise the aminoacid sequence shown in SEQ ID NO:7, and/or is that nucleotide sequence shown in SEQ ID NO:8 is coded.

Also in another embodiment, described polypeptide can comprise 6 histidine residues that are positioned at C-terminal, be positioned at 6 histidine residues and 6 histidine residues that are positioned at C-terminal of N-terminal, or be positioned at 3 histidine residues of N-terminal and be positioned at 9 histidine residues of C-terminal.

According to a second aspect of the invention, a kind of ALR polypeptide of purifying is provided, comprise aminoacid sequence shown in SEQID NOs:1 or 3, or a kind of aminoacid sequence that sequence shown in SEQ ID NOs:1 or 3 is carried out one or more replacements, disappearance and/or interpolation that comprises, wherein said ALR polypeptide obtains modifying by add one or more Histidines at N and/or C-terminal.

The isolated nucleic acid molecule of the polypeptide of a kind of coding first or second aspect is provided according to a third aspect of the invention we.Described nucleic acid molecule can comprise the nucleotide sequence shown in SEQ ID NO:2 or 4, and comprises one or more Histidine coding password that are positioned at 5 ' and/or 3 ' end.

Described nucleic acid molecule can comprise 12 Histidine coding password that are positioned at 3 ' end.

Described nucleic acid molecule can comprise 18 Histidine coding password that are positioned at 3 ' end.

According to a forth aspect of the invention, provide a kind of carrier that comprises the nucleic acid of the third aspect.

Randomly, described nucleic acid can be operably connected on one or more adjusting sequences.

The host cell of the carrier of a kind of nucleic acid that comprises the third aspect or fourth aspect is provided according to a fifth aspect of the invention.

The host cell of the polypeptide of a kind of expression first or second aspect is provided according to a sixth aspect of the invention.

The antibody of the polypeptide of a kind of selective binding first or second aspect is provided according to a seventh aspect of the invention.

According to an eighth aspect of the invention, a kind of patient's of being used for the treatment of method is provided, has comprised the step of the antibody of the host cell of carrier, the 5th or the 6th aspect of nucleic acid, the fourth aspect of ALR polypeptide, the third aspect of first or the second aspect that give described patient treatment significant quantity or the 7th aspect.

According to a ninth aspect of the invention, a kind of method that is used for the treatment of or prevents patient's hepatopathy is provided, and wherein said method comprises the ALR polypeptide of first or the second aspect that give described patient treatment significant quantity, the nucleic acid of the third aspect, the carrier of fourth aspect or the host cell of the 5th or the 6th aspect.

Described hepatopathy can be relevant with liver failure.

Liver injury, liver failure or the hepatopathy of the optional self-contained paracetamol toxicity of described hepatopathy (acetaminophentoxicity), fatty liver, liver cirrhosis, viral hepatitis, cancer, jaundice, ascites, fetor hepaticus, blood coagulation failure (failure of coagulation), fibrosis, severe hepatitis (comprising acute hepatitis, subacute hepatitis, chronic hepatitis), severe chronic hepatitis, non-severe hepatitis or any other type.

According to the tenth aspect of the invention, provide first or the host cell of the carrier of the nucleic acid of the ALR polypeptide of second aspect, the third aspect, fourth aspect or the 5th or the 6th aspect preparation be used for the treatment of or the medicine of prevention of liver disease in application.

According to an eleventh aspect of the invention, a kind of method that is used to stimulate patient's liver regeneration is provided, and wherein said method comprises the ALR polypeptide of first or the second aspect that give described patient treatment significant quantity, the nucleic acid of the third aspect, the carrier of fourth aspect or the host cell of the 5th or the 6th aspect.

According to a twelfth aspect of the invention, a kind of method that is used for cell cultured supernatant propagation is provided, and wherein said method comprises ALR polypeptide, the nucleic acid of the third aspect, the carrier of fourth aspect or the host cell of the 5th or the 6th aspect that one or more liver cells is exposed to first or second aspect of treatment significant quantity.

According to a thirteenth aspect of the invention, provide a kind of method that is used for the treatment of or prevents patient's hepatopathy, wherein said illness is relevant with the level that ALR raises, and wherein said method comprises the ALR antibody of the 7th aspect that gives described patient treatment significant quantity.

According to a fourteenth aspect of the invention, provide a kind of method that is used to suppress hepatocyte growth, wherein said method comprises the ALR antibody that one or more liver cells is exposed to the 7th aspect of treatment significant quantity.

According to a fifteenth aspect of the invention, provide a kind of pharmaceutical composition, comprised first or the polypeptide of second aspect, the nucleic acid of the third aspect, the carrier of fourth aspect, the host cell or the 7th aspect antibody of the 5th or the 6th aspect.

Described pharmaceutical composition can comprise one or more additives.Described one or more additives can be selected from Regular Insulin, Urogastron, pHGF, rhIGF-1 or transforminggrowthfactor-.Usually, described composition also comprises one or more pharmaceutically acceptable carriers, thinner or adjuvant.

According to a sixteenth aspect of the invention, provide a kind of and be used for the treatment of or prevent the patient to give birth to the method for disease, wherein said method comprises the ALR polypeptide of first or the second aspect that give described patient treatment significant quantity, the nucleic acid of the third aspect, the carrier of fourth aspect or the host cell of the 5th or the 6th aspect.

According to a seventeenth aspect of the invention, provide a kind of method that is used to produce reorganization ALR, described method comprises step:

(a) with one or more Histidine coding password at the terminal artificial reconstructed ALR coded polynucleotide of N-and/or C-;

(b) the ALR coded polynucleotide is imported in the proper host cell and so as to comprise at N-and/or C-end under the condition of ALR expression of polypeptides of one or more Histidines culturing cell and

(c) the described ALR polypeptide of purifying.

Usually, when comparing, so produce the ALR polypeptide of modifying and shown one or more improved characteristics with the polypeptide of unmodified.Described characteristic is optional not to need to separate folding (sex change) and refolding subsequently (renaturation) in output, stability, solvability, purity or biological activity and preparation process; The improved characteristics double and other method obtained, for example improved characteristics that other hincky acid is modified or other method obtained.

According to an eighteenth aspect of the invention, also provide a kind of ALR polypeptide of producing according to the method for the 17 aspect.

According to a nineteenth aspect of the invention, also provide a kind of polyoxyethylene glycol (PEG)-modified polypeptides, comprised a kind of polypeptide that is limited as first, second or the tenth eight aspect.

According to a twentieth aspect of the invention, provide a kind of fusion rotein again, comprised a kind of polypeptide that is limited as first, second or the tenth eight aspect.

Under fusion rotein can comprise the polypeptide that is limited as first, second or the tenth eight aspect, it is covalently bound to another polypeptide, for example albumin.

The present invention also relates to variant, derivative, homologue, analogue and fragment according to the ALR polypeptide and the nucleic acid of above-mentioned aspect and embodiment.

According to above-mentioned aspect and embodiment, described ALR polypeptide and nucleic acid can be derived from any animal, can utilize the recombinant nucleic acid technology to produce.Usually, described ALR is a kind of Mammals ALR, for example, is primates, sheep, ox, dog, cat, pig, horse or mouse source.Preferably, described Mammals ALR is people ALR.

Description of drawings

Embodiment of the present invention now obtain describing, with regard to accompanying drawing only as illustration.To be connected each terminal histidine residues number of ALR in order describing, to have used a kind of nomenclature, is term " ALR " in this back that is positioned at the histidine residues number of N-end, then succeeded by the histidine residues number that is positioned at the C-end.For instance, 0ALR0 refers to a kind of ALR molecule (for the natural type of ALR) that does not have Histidine to connect at N or C-terminal, and 0ALRl2 refers to a kind ofly not have the Histidine connection and be connected with the ALR molecule of 12 Histidines at C-terminal at N-terminal.

The nucleotide sequence (SEQ ID NO:2) and the aminoacid sequence (SEQ ID NO:1) of figure .1. Augmenter of Liver Regeneration (ALR).Aminoacid sequence is arranged under the dna sequence dna.

Figure .2. contains the structure of the expression plasmid pAED-ALR/0ALR0 of ALR.Expression vector pAED4 with T7 promotor is selected as expression system.NdeI and HindIII restriction site are added to 5 ' and 3 ' end of ALR gene by polymerase chain reaction (PCR).Then, the PCR product of purifying is connected in the multiple clone site of pAED4 carrier (NdeI and HindIII).Constructed plasmid is checked order with the conclusive evidence gene order.

The PCR product of figure .3.0ALR0.From people liver 5 '-stretch plus cDNA library, amplify people ALR (0ALR0) with the Taq polymerase kit.Use PCR to add the restriction site of NdeI and HindIII to N ' and C ' end respectively.Then, observe the PCR product by 1% agarose gel electrophoresis.Swimming lane: M, mark, the PCR product reaction of swimming lane 1,5 μ l.Observe and have-band of 387bp, show the 0ALR0 amplification of succeeding.

The elution profile of ALR derivative after passing through the nickel affinity chromatography column purification of figure .4. polyhistidine mark.The ALR cracking of the polyhistidine mark that will in escherichia coli host BL21 (DE3) pLysS, express, and by nickel affinity chromatography column purification soluble protein.In the elution profile of the ALR of polyhistidine mark, observe three peaks.First peak is the elutriant that is used for the initial damping fluid of sample injection rear pillar washing.Second peak shows is non-specific binding at the soluble protein of about 0.1M imidazoles place wash-out.What the 3rd peak showed is the elutriant of the ALR of polyhistidine mark.(a) 0ALR6, wash-out goes out at 0.2M imidazoles place; (b) 3ALR9, wash-out goes out at 0.42M imidazoles place; (c) 6ALR6, wash-out goes out at 0.45M imidazoles place; (d) 0ALR12, wash-out goes out at 0.42M imidazoles place.

The SDS-PAGE of the ALR of figure .5. polyhistidine mark analyzes.Marking protein is also by the nickel affinity chromatography column purification from the 200ml nutrient solution.On 12% reduction SDS-PAGE, load and analyze the fraction of purifying.Swimming lane: M, mark, BC, the soluble protein before being loaded on the S100HR post; FT passes, and is the elutriant at first peak on the elution profile.(a) 0ALR6,3-10: fraction 3-10; (b) 3ALR9,3-22: fraction 3-22; (c) 6ALR6,3-26: fraction 3-26; (d) 0ALR12,3-24: fraction 3-24.The band of about 15kDa is the ALR of polyhistidine mark.

The SDS-PAGE of 0ALR12 analyzes behind the figure .6. ni-sepharose purification.Under different damping fluids, the analysis of 0ALR12 in 12% non-reduced SDS- PAGE.Swimming lane 1 and 3, mark, swimming lane 2 is present in the 0ALR12 in the elution buffer (the 0.5M imidazoles, pH 7.4 for 0.5M NaCl, 0.02M sodium phosphate).Find four kinds of isomer: 15kDa monomer, 30kDa dimer, 45kDa tripolymer, the 60kDa tetramer.Swimming lane 4 according to swimming lane 2, but has added reducing agent dithiothreitol (DTT).

The 0ALR6 of figure .7. polyhistidine mark and the mass spectroscopy (ESI-MS) of 0ALR12.(a) 0ALR6 has two peaks, is respectively that molecular weight is monomer and the dimer of 15848Da and 31695Da.(b) 0ALR12 has monomer and the dimer that molecular weight is respectively 16718Da and 33436Da.These observed values are similar to calculated value, relative deviation for 0ALR6＜0.02%, for 0ALR12＜0.3%.

Figure .8. secondary structure is measured.Use the secondary structure of Jasco 810 polarization photometers by circular dichroism spectrum (CD) prediction reorganization ALR.Protein carries out buffer-exchanged in pH 7.0 potassiumphosphates, concentration is 0.25 μ g/ml-0.5 μ g/ml.Thereby measured spectrum by in wavelength 190nm-250nm scope, measuring.The spectral class of 0ALR6 and 0ALR12 is similar to 0ALR0, shows that these three kinds of protein all have similar secondary structure.

The isoelectrofocusing of the ALR of figure .9. polyhistidine mark.The 0ALR0 of purifying, 0ALR6 and 0ALR12 (data not shown) carry out buffer-exchanged in water.Then, contain amphotericeledrolyte carry out isoelectrofocusing (IEF) on the polyacrylamide gel.Focusing finishes, and spends the night and decolours 1 hour in 7% acetate gel-colored with Coomassie blue G-250.Swimming lane C, wide range calibration thing has shown some calibration protein matter of listing among the figure and their pI; Swimming lane 1,0ALR0; Swimming lane 2,0ALR6; Swimming lane 3, bovine serum albumin (BSA).

The spectrum of the ALR of the polyhistidine mark of figure .10. purifying.Measure the absorbancy in the 350nm-550nm scope.The spectrum mark as shown in the figure.This ALR spectrum has the feature of FAD part, but has shown the difference different with free FAD.Two maximum values at 360nm and 450nm place are that FAD molecule absorbancy is peculiar.For protein example, this absorbancy maximum value about 10nm that in the 450nm scope, drifts about.Dotted line is represented the free peaked position of FAD.Employed FAD concentration soluble in water is 7.5 μ M.

The FAD assay of figure .11.0ALR12.By the protein of protein denaturation measurement in conjunction with FAD.Measure the concentration of 0ALR12 by the Bradford assay method.Protein was boiled 30 minutes and add 15%TCA with the FAD that dissociates.Then by the centrifugal metaprotein of removing.Then measure the spectrum of dissociated FAD in the 350nm-550nm scope.By means of free FAD standard substance, calculate FAD content from the OD value at climax.This result shows that there is about 0.8 FAD molecule in the protein of every monomer unit, thinks that thus there is a FAD molecule in every monomer unit.

The dose-dependently Thiol oxidase activity of figure .12.ALR.Dithiothreitol (DTT) and 0ALR12 incubation with different concns.After adding 20 μ M DTNB, measure the oxygenizement of sulfydryl by the minimizing that utilizes light-dividing device to detect delustring at the 412nm place at listed time point.Control value is labeled as ().The concentration of using is 2pmol (■); 5pmol (▲); 10pmol (*); 20pmol (◇); 40pmol (●).Take this higher protein concn, mercaptans content minimizing faster, observed the concentration dose effect.

The external Thiol oxidase activity of the ALR of figure .13. reorganization polyhistidine mark.With dithiothreitol (DTT) and 10pmol ALR incubation.After adding 20 μ M DTNB, measure the oxygenizement of sulfydryl by the minimizing that utilizes light-dividing device to detect delustring at the 412nm place at listed time point.0ALR0,0ALR6 and 0ALR12 value are labeled as (*) respectively, (◇) with (▲).The nonprotein same sample of incubation (◆) or only contain the pure FAD () of equal quantities under the same conditions.The activity of 0ALR12 is similar to 0ALR0.By contrast, observe 0ALR6 and only have half activity of 0ALR12.

The proliferation activity of the ALR of figure .14. polyhistidine mark.As shown in the figure, with the ALR albumen incubation of HepG2 liver cell and different concns.Behind the incubation 2 days, carry out MTS and measure.Proliferation activity is the ratio of ALR albumen and contrast absorbancy (being untreated cell) relatively.Observe ALR albumen and have proliferation activity, 0ALR12 has the highest activity.

Figure .15.0ALR12 is to the proliferation activity of HepG2.As shown in the figure, with the 0ALR12 incubation of HepG2 liver cell and different concns.Behind the incubation 2 days, carry out MTS and measure.Proliferation activity is the ratio of ALR albumen and contrast absorbancy (being untreated cell) relatively.Except that 0ALR12, pHGF also is used for comparison.A kind of negative control thing, BLIP also is shown among the figure.

Figure .16.0ALR12 is to the proliferation activity of MCF7.As shown in the figure, with the 0ALR12 incubation of MCF7 cell and different concns.Behind the incubation 2 days, carry out MTS and measure.Proliferation activity is the ratio of ALR albumen and contrast absorbancy (being untreated cell) relatively.Except that 0ALR12, pHGF also is used for comparison.A kind of negative control thing, BLIP also is shown among the figure.

Figure .17. produces the fermentograph of 0ALR12 bacterial strain.0ALR12 expresses in escherichia coli host BL21 (DE3) pLysS.The monitoring Several Parameters comprises temperature (), pH (▲), stirring velocity (◇) and PO ₂(zero).Along with the carrying out of fermentation, temperature and pH value tend towards stability, and are respectively 37 ℃ and pH 7.0.Work as PO ₂Begin from 85% to reduce at 70% o'clock, stirring velocity increases so that keep PO gradually from 400rpm ₂(being limited to 20% down).

Figure .18. fermentation produces the growth curve of 0ALR12 bacterial strain.Pass through OD ₆₀₀(◆) and biomass (▲) are represented incubation growth.By enzymatic glucose analysis-e/or determining glucose concn (●), when bacterial cell entered vegetative period, glucose concn is exponential form to be reduced.In system, add 0.5mM IPTG and be used to induce ALR to express, work as OD ₆₀₀Reach at 13.0 o'clock, provide extra glucose to system.

Figure .19.2 rises the elution profile of 0ALR12 fermented liquid.The cracking intestinal bacteria are by nickel affinity column purifying soluble protein.From elution profile, observe two peaks.What first peak showed is the non-specific soluble protein that comes out at about 0.1M imidazoles place wash-out.What second peak showed is to contain the proteic elutriant of 0ALR12.

Figure .20. is by the elution profile of 0ALR18 behind the nickel affinity column purifying.From elution profile, observe two peaks.First peak is the elutriant that is used for washing after sample is injected the initial damping fluid of post.Second peak shows is the soluble protein of the non-specific binding of coming out at about 0.1M imidazoles place wash-out.

The solvability analysis of Figure 21 .0ALR18.Analyze the different piece of 0ALR18 to study its solvability by 12%SDS-PAGE.Swimming lane: M, mark; TP comprises insoluble and total protein soluble part; I, the insoluble protein of lysis; BC, the soluble protein before being loaded into the nickel post; FT passes liquid, and it is the elutriant at first peak in the elution profile; F2, fraction 2, the soluble protein of the non-specific binding of coming out at about 0.1M imidazoles place wash-out; 10-17, fraction 10-17.The band of about 15kDa is 0ALR18.

Definition

Term used herein " polypeptide " refers to the polymer that a kind of amino acid by linking together by peptide bond forms, and comprises its fragment or analog. In this article, term " polypeptide " and " protein " are used interchangeably, although for the present invention, " polypeptide " can consist of the part of full length protein.

Term used herein " nucleic acid molecules " refers to the known analog of a kind of deoxyribonucleotide, ribonucleotide base, natural nucleotide or list or the double-chain polymer of their mixture. Unless otherwise, this term comprises related particular sequence and complementary series thereof. Term " nucleic acid " and " polynucleotides " are Alternate in this article. Should be understood that " 5 ' end " relevant with nucleic acid molecules used herein is corresponding to the nucleic acid molecules of coded polypeptide N-end, and " 3 ' end " is terminal corresponding to the C-of coded polypeptide.

Term " purifying " refers to that the material of discussing has left its natural environment or host, and relevant impurity reduces or eliminates so that the molecule of discussing is the species of preponderating that exist. Therefore, in fact, the species of term " purifying " feeling the pulse with the finger-tip be the species of preponderating that exist (namely., on mole foundation, its more any other independent species are for more in composition), and preferably, the fraction of purifying is a kind of composition basically, and wherein said purpose species comprise the macromolecular complex kind at least about all existence of 30% (on mole foundation). In general, pure composition should comprise greater than all of about 80-90% and be present in macromolecular complex kind in the composition basically. Most preferably, that the purpose species are purified to is substantially of the same race (can't detect pollution species in the composition by the conventional detection method), and wherein composition is comprised of single macromolecular complex kind basically. Term " purifying " was used interchangeably with " separation ".

Term used herein " variant " refers to basically similar sequence. Usually, polypeptide or polynucleotide sequence variant have qualitatively biologically active jointly. In addition, these polypeptide or polynucleotide sequence variant can have at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homogeneity. Also be included in this term " variant " implication is the homologue of polypeptide of the present invention or polynucleotides. Homologue is normally from polypeptide or the polynucleotides of different plant species, but basically with in this disclosed corresponding polypeptide or polynucleotides total identical biological function or activity.

Therefore, term used herein " variant " can refer to the polypeptide that produced by coding ALR nucleic acid, but is different from wild type ALR, be since its through different process so that have the amino acid sequence of change. The alternative splicing of elementary rna transcription thing that for example, can be by producing wild type ALR is to produce variant.

Term " fragment " refers to polypeptide or the polynucleotide molecule of coding component or the component of polypeptide of the present invention or polynucleotides or its variant. Usually fragment has the qualitative biologically active identical with its polypeptide that forms or polynucleotides. Fragments of peptides length can be about 5 to about 150 amino acid, and about 5 to about 100 amino acid, and about 5 to about 50 amino acid, and about 5 to about 25 amino acid. Perhaps, fragments of peptides length can be about 5 to about 15 amino acid. Therefore, term " fragment " refers to form total length ALR polypeptide and has the qualitative bioactive peptide molecule identical with total length ALR polypeptide. Described fragment can be derived from total length ALR polypeptide or obtain by some other methods are synthetic, for example chemical synthesis.

Therefore, term " fragment " component of nucleic acid molecules or polynucleotides of the present invention of component that also can refer to encode. Polynucleotide passage might not need the to encode polypeptide of retains biological activity. For example, fragment also can be used as hybridization probe or PCR primer. Fragment can be derived from polynucleotides of the present invention or be synthesized by some other methods, for example chemical synthesis. Use techniques well known, polynucleotides of the present invention and fragment thereof also can be used for preparing antisense molecule.

The term relevant with polypeptide used herein " analog " refers to a peptide species, it is the derivative of polypeptide of the present invention, this derivative comprises one or more amino acid whose interpolations, disappearance, replacement, and so consequently this polypeptide keeps the function identical with the ALR polypeptide of above-mentioned evaluation basically.

Term used herein " conservative 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor " refers in the polypeptide chain (primary sequence of protein) that an amino acid is replaced by another amino acid with similar quality or replaces. For example, charged amino acid glutamic acid (Glu) by similar charged amino acid aspartic acid (Asp) replacement should be conservative 49-Phe ,82-Ser,115-Arg,144-Met,145-Asn ,161-Arg,169-Met Human Connective tissue growth factor.

Term used herein " basically " refers to great majority but may not be all, and therefore for the compositing area that a kind of polypeptide " basically " of modification lacks corresponding wild type peptide, but this compositing area of polypeptide reserve part of this modification. For example, " basically " polypeptide of modification that lacks the compositing area of corresponding wild type peptide can keep about 50% or the sequence of described compositing area still less, although since omitted this regional sequence part and usually so that this compositing area inactivation structurally and/or on the function.

No matter in which way term used herein " treatment " refers to treating disease state or symptom, prevent disease produces or prevent on the contrary, hinder, postpone or reverse any or all usage of PD or other undesirable symptom.

Term used herein " treatment effective dose " is included in the non-toxicity of the medicament that provides required result for the treatment of in its implication or compound but enough amounts. Required exact amount can be different according to the patient, depend on such factors such as resembling the species that are treated, patient's age and general status, the order of severity that is treated illness, certain medicament that will give and administering mode. Therefore, can not determine accurate " effective dose ". But, for any specific case, can only use conventional experimental technique just can determine suitable " effective dose " by those of ordinary skills.

In this context, term " comprises " and refers to " comprise substantially, but need not to comprise fully ". In addition, the variant that term " comprises (comprising) " is such as " comprising (comprise) " with also have " comprising (comprises) " implication of respective change.

Embodiment

The present invention is based on wondrous and unexpected discovery, promptly compares with the ALR natural type, exists extra histidine residues showing and has improved its functional performance, specificity and biological activity.

According to the sequence homology of FAD dependent form Thiol oxidase Erv2p, the contriver has determined that the terminal and C-end of the N-of ALR all is positioned at the surface and therefore exposes, and is suitable for carrying out the potential modification.Therefore, the contriver (His) residue is added on arbitrary end of two exposed distal ends, the destruction that appears not cause ALR polypeptide structure and/or function with polyhistidine.Therefore the more important thing is that the Histidine side chain is a polarity and hydrophilic, adding the polyhistidine residue to ALR has increased the proteic solvability of recombinant expressed ALR, has reduced the formation of inclusion body and has improved stability and the biological activity of ALR.

Therefore, the invention provides the ALR polypeptide of purifying, wherein said polypeptide comprises the histidine residues of one or more N of being positioned at and/or C-terminal.In an embodiment of ALR polypeptide, comprise the aminoacid sequence shown in the SEQ ID NO:5.In another embodiment, the ALR polypeptide comprises the aminoacid sequence shown in the SEQ ID NO:7.

The present invention also provides the ALR polypeptide of purifying, comprise the aminoacid sequence shown in SEQ ID NO:1 or 3 or comprise the aminoacid sequence that the sequence shown in SEQ ID NO:1 or 3 is carried out one or more replacements, disappearance and/or interpolation, wherein the ALR polypeptide obtains modifying by add one or more histidine residues at N and/or C-terminal.

The present invention further provides the nucleic acid molecule of the above-mentioned ALR polypeptide of separated coding.Described nucleic acid molecule can comprise the nucleotide sequence shown in SEQ ID NO:2 or 4 and comprise one or more Histidine coding password at 5 ' and/or 3 ' end, adds one or more histidine residues corresponding to N and/or C-terminal at coded polypeptide.For example, to can be the polynucleotide that comprise sequence shown in the SEQ ID NO:6 coded for the ALR polypeptide of the present invention that comprises 12 histidine residues at C-terminal.Perhaps, to can be the polynucleotide that comprise sequence shown in the SEQ ID NO:8 coded for the ALR polypeptide of the present invention that comprises 18 histidine residues at C-terminal.

In addition, the invention provides the carrier and the host cell that comprise above-mentioned nucleic acid molecule, the host cell of expressing above-mentioned ALR polypeptide is provided, and the antibody that the above-mentioned ALR polypeptide of selective binding is provided.

The present invention also provides the method for the reorganization ALR polypeptide that is used to prepare modification, comprises step:

(a) with one or more Histidine coding password at the terminal artificial reconstructed ALR coded polynucleotide of N-and/or C-;

(b) the ALR coded polynucleotide is imported in the proper host cell and so that comprise culturing cell under the condition of ALR expression of polypeptides of one or more Histidines at N-and/or C-end; With

(c) the reorganization ALR polypeptide of purifying modification.

Usually, when comparing with the unmodified polypeptide, prepared like this modification ALR polypeptide has shown one or more improved characteristics.Described characteristic is optional from output, stability, solvability, purity or biological activity.

The present invention also provides the ALR polypeptide according to method for preparing.

The contriver finds to have many advantages by adding reorganization ALR that polyhistidine modifies than the reorganization ALR of natural A LR and unmodified.For example, the ALR that modifies according to an embodiment of the present invention has functional performance, specificity and the biological activity of improvement than natural A LR.And these extra residues have also produced favourable improvement to the preparation characteristic of reorganization ALR, have therefore opened up the method that is used for the treatment of the agent exploitation.Particularly, add N and/or the C-terminal of histidine residues, be beneficial to and use metal affinity column chromatography method to carry out affinity purification, thereby increased the rate of recovery and the purity of reorganization ALR to ALR.As this paper institute illustration, this method makes the recovery of reorganization ALR reach about 98% purity.Compare with its natural type, the polyhistidine residue also helps functional performance, specificity and the biological activity of ALR, and histidine mark need not to remove behind the purifying.In addition, add the polyhistidine residue to ALR also be the prerequisite that the ALR polypeptide avoiding expressing is separated folding (sex change) and refolding subsequently (renaturation).

And the ALR of Xiu Shiing is stable when expressing according to an embodiment of the present invention, so conformation integrity and biological activity obtain keeping.Shown that also the polyhistidine residue can increase reorganization ALR solvability.Its ALR albumen for the no histidine mark of having reported does not dissolve in intestinal bacteria, promptly forms inclusion body, has clear superiority.In addition, the polyhistidine residue does not disturb the secretion of ALR and non-immunogenicity almost, so the prepared reorganization ALR of this method can be used and need not to remove in advance the polyhistidine residue.

Compare with its natural type, functional performance, specificity and biological activity that ALR polypeptide of the present invention is improved and reorganization ALR preparation method's improvement is for road has been paved in the exploitation of ALR therapeutical agent.

Polypeptide

As disclosed herein, the present invention relates to the ALR polypeptide, compare with corresponding wild type ALR polypeptide and comprise one or more Histidine additives.For example, described polypeptide can comprise 1-20,2-18, a 4-16 or 6-14 histidine residues at N and/or C-end.Preferably, comprise 3-18 histidine residues at N and/or the described Histidine additive of C-terminal, more preferably, comprise 12-18 histidine residues at N and/or the described Histidine additive of C-terminal, and most preferably, comprise 12 or 18 histidine residues at N and/or the described Histidine additive of C-terminal.Preferably, described wild-type ALR is derived from Eukaryotic any ALR polypeptide, more preferably is Mammals ALR, most preferably is people ALR.The aminoacid sequence of wild-type people ALR is shown in SEQ ID NO:1.The nucleotide sequence of encoding wild type ALR shown in SEQ ID NO:2, or for show enough sequence identity and with the sequence of SEQ ID NO:2 sequence hybridization.The term of the ALR of relating to polypeptide used herein " wild-type " comprises the polypeptide that exists with its natural type.

Alternatively, wild-type ALR polypeptide is HPO-205 type ALR, comprises the aminoacid sequence shown in SEQ ID NO:3.The nucleotide sequence of HPO-205 type wild-type ALR shown in SEQ ID NO:4, or for show enough sequence identity and with the sequence of SEQ ID NO:4 sequence hybridization.

As disclosed herein, ALR polypeptide of the present invention can comprise its fragment, analogue or variant, comprises one or more aminoacid insertion, disappearance or replacement.Therefore, by adding, lack or replace the ALR polypeptide that one or more amino-acid residue modifies and also fall within the scope of protection of the present invention in that N-and/or C-being terminal.

According to the present invention, can use well-known recombinant DNA of those skilled in the art and standard molecular biological technology to prepare the ALR polypeptide.The technical director can obtain certainly, for example, resemble Sambrook etc., Molecular Cloning:A Laboratory Manual, Cold SpringHarbor, New York, 1989 and Ausubel etc., Current Protocols inMolecular Biology, Greene Publ.Assoc.and Wiley-Intersciences, 1992 such authoritative textbooks.A can prepare the ALR peptide by utilizing one or more protease digestion polypeptide such as endoLys-C, endoArg-C, endoGlu-C and staphylococcus V8 proteolytic enzyme.Can be by the peptide fragment that comes purifying to digest as high performance liquid chromatography (HPLC) technology.

ALR polypeptide of the present invention and fragment, analogue and variant also can obtain by the well-known liquid phase of those skilled in the art or solid state chemistry standard method are synthetic.For example, above-mentioned molecule can synthesize (Steward, J.M. and Young, J.D., Solid Phase Peptide Synthesis. (the 2nd edition .) Pierce ChemicalCo., Illinois, USA (1984) with the solid state chemistry method of Steward and Young.

Generally speaking, such synthetic method comprise add one or more amino acid or suitable protection successively amino acid to the peptide chain of growth.Preferably, first amino acid whose amino or carboxylic group are protected by suitable blocking group.Then, have in the sequence of having carried out complementation (amino or the carboxyl) group of protection suitably next amino acid by interpolation and be suitable for forming under the condition of amido linkage, be connected to the amino acid of being protected on the inert support or be applied in the solution.Then, remove blocking group and add next (protection) amino acid from new interpolation amino-acid residue, or the like.All amino acid needed all connected after, remove successively or simultaneously any residual blocking group and any carrier in case of necessity with the preparation desired polypeptides.

Can realize the amino acid change of ALR polypeptide by the well-known technology of various equivalent modifications.For example, can realize amino acid change by the nucleotide subsitution technology, this technology comprises Nucleotide (conservative and/or non-conservative) interpolation, disappearance or replaces that collateral condition is the reading frame that will keep correct.Illustrative technology comprises random mutagenesis, directed mutagenesis, oligonucleotide mediated or polynucleotide mediated mutagenesis, by using the disappearance in the selection zone that existing or engineered restriction endonuclease sites carries out, and polymerase chain reaction.

Polynucleotide

Embodiment of the present invention provide the polynucleotide of the above-mentioned ALR polypeptide of separated coding, and the variant of these polynucleotide and fragment.As mentioned above, the present invention relates to the purposes of polynucleotide of the present invention in various treatments are used.

The present invention also relates to oligonucleotide or fragment based on polynucleotide sequence of the present invention, it is used as primer or probe.Oligonucleotide is the one section short sequence that is applicable to such as the nucleotide residue of the nucleic acid amplification reaction of PCR, and preferably, length is at least about 10 Nucleotide to about 50 Nucleotide, and more preferably, length is that about 15 Nucleotide are to about 30 Nucleotide.Probe is the nucleotide sequence of variable-length, for example at about 10 Nucleotide between several thousand Nucleotide, normally be used to detect homologous sequence by hybridization.The level of homology between sequences (sequence identity) is determined by the severity of hybridization conditions.Can under low stringency condition, medium stringent condition or high stringent condition, hybridize in particular as the nucleotide sequence that is probe with homologue or other variant of polynucleotide disclosed herein.Low stringent hybridization condition carries out in 2xSSC under 50 ℃ corresponding to hybridization.Well-known many condition and the factors that can be used for changing the hybridization severity of those skilled in the art.For instance, be by length and the character (DNA, RNA, based composition) of hybridization to the nucleic acid of given nucleic acid; Salt concn and other composition, for example whether methane amide, dextran sulfate, polyoxyethylene glycol etc. exist; And the temperature change of hybridization and/or washing step.For example, hybridization filter paper can be in 2X SSC, 0.5%SDS, and at least 55 ℃ (low severity), at least 60 ℃ (medium severity), at least 65 ℃ (medium/high severity), at least 70 ℃ (high severity) or at least 75 ℃ (very high severity) following washed twice, each 30 minutes.

In specific embodiment, polynucleotide of the present invention can be cloned in the carrier.Described carrier can be that plasmid vector, virus vector and/or expression vector or any other are applicable to the suitable carrier that exogenous array inserts, imports host cell and express the sequence that imports.Usually, described carrier is a carrier for expression of eukaryon, can comprise expressing control and job sequence, for example promotor, enhanser, ribosome bind site, polyadenylation signal and transcription termination sequence.

Antibody

The invention provides antibody and the fragment and the analogue of selective binding ALR polypeptide of the present invention.Suitable antibody includes, but are not limited to polyclone, mono-clonal, chimeric, humanization, strand, Fab fragment and Fab expression library.Antibody of the present invention can be used as the agonist and the antagonist of ALR polypeptide or its fragment, variant or analogue.

Preferably, Antibody Preparation is from the discontinuity zone or the fragment of ALR polypeptide of the present invention, particularly relate to give therapeutic activity and/or part or substrate bonded those.Antigenicity ALR polypeptide comprises at least about 5, preferably at least about 10 amino acid.

The method for preparing suitable antibodies can be those skilled in the art and recognizes easily.For example, a kind of resisting-the ALR monoclonal antibody, comprise the Fab part usually, can use Antibodies-ALaboratory Manual, Harlow and Lane compile., hybridoma technology preparation described in the Cold Spring HarborLaboratory, N.Y. (1988).

In fact, in the monoclonal antibody process of preparation anti-ALR polypeptide of the present invention and fragment, variant or analogue, any being provided for all can be used by cultivating the technology that continuous cell line prepares antibody molecule.These technology comprise at first by Kohler etc., Nature, the hybridoma technology of 256:495-497 (1975) exploitation and trioma technology, people B-quadroma technology [Kozbor etc., Immunology Today, 4:72 (1983)] and be used to prepare human monoclonal antibodies the EBV-hybridoma technology [Cole etc., Monoclonal Antibodies and CancerTherapy, the 77-96 page or leaf, Alan R.Liss, Inc., (1985)].Immortality, antibody produced cell system can create by the technology except merging, for example with carcinogenic dna direct conversion bone-marrow-derived lymphocyte or use the Epstein-Barr virus transfection.Referring to, as., M.Schreier etc., " Hybridoma Techniques " (1980); Hammerling etc., " MonoclonalAntibodies and T-cell Hybridomas " (1981); Kennett etc., " Monoclonal Antibodies " (1980).

In a word, for the method for preparing the hybridoma that produces monoclonal antibody, the myelomatosis or (self-perpetuating) clone of controlling oneself are merged with the lymphocyte that obtains from the Mammals spleen, and described lymphocyte is its recognition factor bound fraction or recognition factor or its replication orgin specific DNA joint portion branch hyperimmunization.The hybridoma that generation is used for implementing monoclonal antibody of the present invention by itself and recognition factor of the present invention carry out immunoreactive ability with and the ability that suppresses the specific transcriptional activity of target cell obtain identifying.

Being used to implement monoclonal antibody of the present invention can obtain preparation by starting the cultivation of mono-clonal hybridoma, and described culture comprises nutritional medium, and this substratum contains the hybridoma that secretion has the antibody molecule of suitable antigen-specific.Cultivation maintains and is enough to make hybridoma that antibody molecule is secreted into the condition of substratum and under the time.Collect the substratum that contains antibody then.Then by the further separation antibody molecule of well-known technology.

Similarly, several different methods known in the art also can be used for preparing the polyclonal antibody of anti-ALR polypeptide of the present invention or its fragment or analogue.In order to prepare the ALR polyclonal antibody, can include but not limited to rabbit, mouse, rat, sheep, goat etc. by injection ALR polypeptide or its fragment, variant or the various host animals of analogue immunity.In addition, ALR polypeptide or its fragment, variant or analogue can be coupled to immunogenic carrier, as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).And, can use various adjuvants to increase immunne response, include but not limited to freund adjuvant (fully and not exclusively), such as the mineral coagulant of aluminium hydroxide, surfactant, Pluronic polyols, polyanion, peptide, oil-emulsion, keyhole limpet hemocyanin, dinitrophenol(DNP) and the people's adjuvant that comes in handy such as lysolecithin, for example BCG (bacille Calmette-Guerin vaccine) and CBP (Corynebacteriumparvum).

Also can pass through the required antibody of multiple technology screening known in the art.The assay method that is used for the immunologic opsonin binding antibody can comprise, but be not limited to, radioimmunoassay, ELISAs (enzyme-linked immunosorbent assay), sandwich immunoassay, immunoradiometric assay, gel diffusion precipitation, immunodiffusion, original position immunoassay, Western trace, precipitin reaction, agglutination reaction, complement in conjunction with mensuration, immunofluorescence assay, alumin A test and immunoelectrophoresis measure or the like (referring to, Ausubel etc. for example., compile, 1994, Current Protocols in Molecular Biology, the 1st volume, John Wiley ﹠amp; Sons, Inc., New York).The detectable mark that utilization is positioned on the anti-ALR antibody of one-level can carry out the antibodies detection.Perhaps, utilize it with secondary antibody or carry out suitably the reagent of mark and combine and to detect anti-ALR antibody.Multiplely known in the artly be used for detecting immunoassay bonded method and fall within the scope of the present invention.

Antibody of the present invention can be used in the diagnostic method and test kit of well-known qualitative or detection by quantitative body fluid or tissue of those of ordinary skills, or antibody can be used for treating in the method and composition of various diseases, imbalance and illness.

Described antibody (or its fragment) has improved the ability of its anti-ALR polypeptide of the present invention or its fragment, variant or analogue, and it has binding affinity for ALR.Preferably, described antibody (or its fragment) has greater than about 10 ⁵M ^-1Binding affinity or avidity, more preferably greater than about 10 ⁶M ^-1, also more preferably greater than about 10 ⁷M ^-1, and most preferably greater than about 10 ⁸M ^-1

The appropriate vol that antibody will obtain according to the present invention, a kind of batch fermentation method of serum free medium of using can be used for preparing antibody.After fermentation, can operate antibody purification by multistep, comprise chromatography and virally inactivated/removal step.For example, antibody can at first separate by the albumin A affinity chromatography, uses solvent/detergent treatment with all lipid envelope virus of inactivation then.Further purifying normally by negatively charged ion and cation-exchange chromatography, can be used for removing residual protein, solvent/detergent and nucleic acid.Purified antibody uses gel-filtration column can further obtain purifying and prepares in 0.9% salt solution.Then, with the sterilization of the batch preparations thing prepared, filter virus and make up a prescription.

Composition and route of administration

ALR polypeptide of the present invention and polynucleotide can be used as therapeutical agent.For example, can find the application of these molecules in treatment or prevention patient disease or illness by the above-mentioned molecule that gives the patient treatment significant quantity.For example, above-mentioned disease and illness can comprise liver failure.Particularly, liver injury, liver failure or the hepatopathy of the optional self-contained paracetamol toxicity of described disease and illness (acetaminophen toxicity), fatty liver, liver cirrhosis, viral hepatitis, cancer, jaundice, ascites, fetor hepaticus, blood coagulation failure (failure of coagulation), fibrosis, severe hepatitis (comprising acute hepatitis, subacute hepatitis, chronic hepatitis), severe chronic hepatitis, non-severe hepatitis or any other type.Perhaps, above-mentioned disease and illness can comprise sterile disease.For example, described fertility disease can be synthetic with unusual stem cell, the cytosol Fe/S protein biology of weakening or unusual spermatogeny, weakening is synthetic or sexual dysfunction is relevant.

Therefore, the invention provides the method that is used to stimulate patient's liver regeneration and/or hepatocyte growth, wherein said method comprises above-mentioned ALR polypeptide, nucleic acid, carrier or the host cell that gives the patient treatment significant quantity.

The present invention also provide above-mentioned ALR polypeptide, ALR nucleic acid, carrier or host cell preparation be used for the treatment of or the medicine of prevention of liver disease in purposes.

In addition, the invention provides the pharmaceutical composition that comprises above-mentioned ALR polypeptide, ALR nucleic acid, carrier, host cell or antibody.Described pharmaceutical composition can comprise one or more additives.The group of the optional self-contained Regular Insulin of described one or more additives, Urogastron, pHGF, rhIGF-1 or transforminggrowthfactor-.Typically, described composition also can comprise one or more pharmaceutically acceptable carriers, thinner or adjuvant.

Therefore, the composition that has related to the pharmaceutically useful that comprises ALR polypeptide and polynucleotide is used for the treatment of or preventing disease and illness.

The agonist of ALR polypeptide of the present invention and antagonist comprise anti-ALR antibody, also can be used as therapeutical agent.Therefore, the methods of treatment that the present invention also relates to use above-mentioned agonist and antagonist and comprise its pharmaceutical composition.

Generally speaking, be applicable to that the composition of the inventive method can be prepared according to known method of those of ordinary skills and program, correspondingly can comprise pharmaceutically acceptable carrier, thinner and/or adjuvant.

Can give composition by standard way.Generally speaking, can by parenteral (as in intravenously, the backbone, subcutaneous or intramuscular), oral or local approach give as described in composition.Administration can be whole body, zone or topical.Depend on many factors in the following concrete route of administration that will use of any particular case, comprise the severity of characteristic, the illness of the illness that will treat, the required dosage and the possible side effect of compound of the particular compound that will be sent.

Generally speaking, can prepare suitable composition according to the known method of those of ordinary skills, described composition comprises pharmaceutically acceptable thinner, adjuvant and/or vehicle.Described thinner, adjuvant and vehicle should be " acceptable ", are compatible with other composition of composition, and harmless to its receptor.

The example of pharmaceutically acceptable carrier or thinner is softening water or distilled water; Salts solution; The plant base oil is for example peanut oil, Thistle oil, sweet oil, Oleum Gossypii semen, Semen Maydis oil, sesame oil, peanut oil or Oleum Cocois of peanut oil, Thistle oil, sweet oil, Oleum Gossypii semen, Semen Maydis oil, sesame oil for example; Silicone oil comprises polysiloxane, for example methyl polysiloxane, phenyl polysiloxane and tolyl polysiloxane; Volatile silicone; Mineral oil is whiteruss, soft wax or squalane for example; Derivatived cellulose is methylcellulose gum, ethyl cellulose, carboxymethyl cellulose, Xylo-Mucine or Vltra tears for example; Low-level chain triacontanol, for example ethanol or Virahol; Rudimentary aralkyl hexalin (lower aralkanols); Rudimentary polyalkylene glycol or rudimentary alkylene glycol, for example polyoxyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1,3 butylene glycol or glycerol; Fatty acid ester, for example Wickenol 111, Wickenol 101 or ethyl oleate; Polyvinylpyrrolidone; Agar; Carrageenin; Tragacanth gum or Sudan Gum-arabic and mineral jelly.Usually, calculate by weight carrier and account for 10% to 99.9% of composition.

Composition of the present invention can a kind ofly be suitable for existing by the form of drug administration by injection, there is (capsule for example with a kind of form that is suitable for oral dosage form, tablet, the capsule sheet, elixir), with a kind of ointment that is suitable for topical, the form of emulsifiable paste or lotion exists, exist as the form that eye drops is sent with a kind of being suitable for, exist by the aerosol form of inhalation with a kind of being suitable for, for example, there are i.e. subcutaneous injection intramuscularly or intravenous injection with a kind of form that is suitable for administered parenterally by sucking or oral suction in the nose.

As a kind of Injectable solution or suspension that is used for administration, nontoxic injection can be accepted diluent or carrier and can comprise, woods Ge Shi (Ringer ' s) solution, isotonic saline solution, phosphate buffered saline (PBS), ethanol and 1,2 propylene glycol.

Some examples of the suitable carriers that is used to orally use, thinner, vehicle and assistant agent comprise peanut oil, whiteruss Xylo-Mucine, methylcellulose gum, sodium alginate, Sudan Gum-arabic, tragacanth gum, glucose, sucrose, Sorbitol Powder, N.F,USP MANNITOL, gelatinum and Yelkin TTS.These oral dosage forms can comprise suitable seasonings and pigment in addition.When using in capsule, capsule can be coated with the compound that can postpone disintegration, for example glyceryl monostearate or distearin.

Assistant agent generally includes tenderizer, emulsifying agent, thickening material, sanitas, sterilant and buffer reagent.

The solid dosage of oral administration can comprise acceptable tackiness agent in people and animals' pharmacy practice, sweeting agent, disintegrating agent, thinner, seasonings, Drug coating, sanitas, lubricant and/or delay agent (time delay agents).Suitable binder comprises Sudan Gum-arabic, gelatinum, W-Gum, tragacanth gum, sodium alginate, Walocel MT 20.000PV or polyoxyethylene glycol.Suitable sweeting agent comprises sucrose, lactose, glucose, aspartame sugar or asccharin.Suitable disintegrants comprises W-Gum, methylcellulose gum, polyvinylpyrrolidone, guar gum, xanthan gum, wilkinite, alginic acid or agar.Suitable diluent comprises lactose, sorbyl alcohol, N.F,USP MANNITOL, glucose, kaolin, Mierocrystalline cellulose, lime carbonate, Calucium Silicate powder or Lin Suanergai.Suitable seasonings comprises spearmint oil, wintergreen oil, cherry, orange or raspberry seasonings.Suitable Drug coating comprises polymkeric substance or superpolymer, wax, Fatty Alcohol(C12-C14 and C12-C18), zein, shellac or the gluten of vinylformic acid and/or methacrylic acid and/or their ester.Suitable sanitas comprises Sodium Benzoate, vitamin-E, alpha-tocopherol, xitix, methyl hydroxybenzoate, propylparaben or sodium bisulfite.Examples of suitable lubricants comprises Magnesium Stearate, stearic acid, sodium oleate, sodium-chlor or talcum.Suitable delay agent comprises glyceryl monostearate or glyceryl SUNSOFT Q-182S.

Except that mentioned reagent, the liquid dosage form that is used for oral administration can comprise liquid vehicle.Suitable liquid vehicle comprises water, and oil is sweet oil, peanut oil, sesame oil, sunflower oil, Thistle oil, peanut oil, Oleum Cocois for example, whiteruss, ethylene glycol, propylene glycol, polyoxyethylene glycol, ethanol, propyl alcohol, Virahol, glycerine, Fatty Alcohol(C12-C14 and C12-C18), triglyceride or its mixture.

The suspension that is used for oral administration can further comprise dispersion agent and/or suspension agent.Suitable suspension agent comprises Xylo-Mucine, methylcellulose gum, Vltra tears, polyvinylpyrrolidone, sodium alginate or acetyl-ethanol (acetyl alcohol).Suitable dispersion agent comprises Yelkin TTS, such as the polyoxyethylene ester of stearic lipid acid, polyoxyethylene Sorbitol Powder list or dioleate, stearate or laurate, polyoxyethylene sorbitanic list or dioleate, stearate or laurate or the like.

The emulsion that is used for oral administration can further comprise one or more emulsifying agents.Suitable emulsifying agent comprises the dispersion agent of as above institute's illustration or such as the natural gum of guar gum, Sudan Gum-arabic or tragacanth gum.

Being used to prepare the administered parenterally method for compositions is conspicuous to those skilled in the art, more details are described in, for example, Remington ' s PharmaceuticalScience, the 15th edition., Mack Publishing Company, Easton, Pa., be incorporated herein by reference at this.

Topical formulations of the present invention comprises activeconstituents and one or more acceptable carriers, and randomly any other therapeutic component.The formulation that is suitable for topical comprises and is suitable for infiltrating through skin to fluid that needs therapentic part or semi-fluid prepared product, for example liniment, lotion, emulsifiable paste, ointment or paste, and the drops that is suitable for eye, ear or nasal administration.

Drops of the present invention can comprise aseptic aqueous solution or oily solution or suspension.These solution can and randomly comprise tensio-active agent by obtaining preparation in the aqueous solution that activeconstituents is dissolved in bactericide and/or mycocide and/or any other suitable sanitas.Then, by filtering the resulting solution of clarification, be transferred in the suitable containers it and sterilization.Sterilization can be carried out by autoclaving or 90 ℃-100 ℃ maintenance half an hour or by filtering, and then by Aseptic technique solution is transferred in the container.Being suitable for being included in the bactericide in the drops and the example of mycocide is Phenylmercurinitrate or Phenylmercuric Acetate (0.002%), benzalkonium chloride (0.01%) and chlorhexidine acetate (0.01%).The solvent that is suitable for preparing oily solution comprises glycerine, rare alcohol and propylene glycol.

Lotion of the present invention comprises the lotion that those are applicable to skin or eye.Eye wash can comprise aseptic aqueous solution, randomly comprises bactericide, and can be prepared by being similar to above-mentioned those methods relevant with the drops preparation.Be applied to the lotion of skin or liniment also can comprise quicken dry and and the reagent of cooling skin, for example ethanol or acetone, and/or such as the wetting agent (moisturiser) of glycerine, or such as the oils of Viscotrol C or peanut oil.

Emulsifiable paste of the present invention, ointment or paste are the semisolid dosage forms that is used for the activeconstituents of external application.They can make by ground or Powdered activeconstituents are mixed, described activeconstituents Individual existence or in solution or be suspended in the aqueous solution or the on-aqueous liquid, described on-aqueous liquid has the main component that contains fat or do not conform to fat.Described main component can comprise hydrocarbon polymer, for example hard, soft or whiteruss, glycerine, beeswax, metallic soap, mucilage, the oils of natural origin, for example Prunus amygdalus oil, Semen Maydis oil, peanut oil, Viscotrol C or sweet oil; Lanolin or derivatives thereof, or lipid acid, for example stearic acid or oleic acid, and alcohols, for example propylene glycol or polyoxyethylene glycol.

Described composition can mix any suitable tensio-active agent, for example anionic, cationic or such as the nonionic surface active agent of sorbitan ester or its polyoxyethylene deriv.Also can comprise suspension agent such as natural gum, derivatived cellulose or such as the inorganic materials of silica (silicaceoussilicas), and other composition such as lanolin.

Described composition also can liposome form give.Liposome derives from phosphatide or other lipid material usually, is formed by the list or the multilayer aqueous fluid crystalline substance that are dispersed in the water medium.Can accept on any nontoxic, physiology that can form liposome and metabolizable lipid can be utilized.Composition can comprise stablizer, sanitas, vehicle or the like in the liposome.Preferred lipid is natural or synthetic phosphatide and phosphatidylcholine (Yelkin TTS).The method for preparing liposome is known in the art, and relevant concrete reference is: Prescott, compile., Methods in Cell Biology, the 14th volume, Academic Pres s, New York, N.Y. (1976), the 33rd page and following or the like, its content is incorporated herein by reference at this.

In order to reach the object of the invention, molecule or reagent can therapeutic or the prophylactic compositions form give the patient.In treatment is used, with composition to be enough to cure or to stop the amount of disease and complication thereof to give ill patient to small part.Described composition should provide molecule or reagent to be enough to effectively treat patient's amount.

The described treatment effective dose level that is used for any concrete patient will depend on multiple factor, comprise: the illness of being treated and the severity of this illness, the activity of employed molecule or reagent, employed composition, patient's age, body weight, general health, sex and diet, administration time, route of administration, the chelating speed of molecule or reagent, the time that treatment is continued, with this medicine for the treatment of associating or using simultaneously, and the well-known correlative factor of other field of medicaments.

Those skilled in the art should be able to determine treatment necessary reagent of indication or effective, the nontoxic amount of compound by normal experiment.

Generally speaking, effective dosage ranges should about 0.0001 milligram to about 1000 milligrams/kg body weight/24 hours; Preferably, about 0.001 milligram to about 750 milligrams/kg body weight/24 hours; About 0.01 milligram to about 500 milligrams/kg body weight/24 hours; About 0.1 milligram to about 500 milligrams/kg body weight/24 hours; About 0.1 milligram to about 250 milligrams/kg body weight/24 hours; About 1.0 milligrams to about 250 milligrams/kg body weight/24 hours.More preferably, effective dosage ranges should about 1.0 milligrams to about 200 milligrams/kg body weight/24 hours; About 1.0 milligrams to about 100 milligrams/kg body weight/24 hours; About 1.0 milligrams to about 50 milligrams/kg body weight/24 hours; About 1.0 milligrams to about 25 milligrams/kg body weight/24 hours; About 5.0 milligrams to about 50 milligrams/kg body weight/24 hours; About 5.0 milligrams to about 20 milligrams/kg body weight/24 hours; About 5.0 milligrams to about 15 milligrams/kg body weight/24 hours.

Perhaps, effective dose can be up to about 500 milligrams/square metre.Generally speaking, effective dosage ranges should be at about 25 to about 500 milligrams/square metre, preferably about 25 to about 350 milligrams/square metre, more preferably about 25 to about 300 milligrams/square metre, also more preferably about 25 to about 250 milligrams/square metre, even more preferably about 50 to about 250 milligrams/square metre, most preferably about 75 to about 150 milligrams/square metre.

Usually, in treatment was used, the planted agent treated in the time length of symptom.

In addition, it should be apparent to those skilled in the art that the optimal number of individual dose and characteristic and the degree that the symptom of just treating should be depended in the interval, the form of administration, approach and position, and the characteristic of the special entity of just treating.Similarly, above-mentioned top condition also can be depending on ordinary method.

Those skilled in the art also should be understood that the best course of treatment, and for example for alloted days, the dose quantity of the composition that give every day can be those skilled in the art and determines by using the conventional determination test course of treatment.

Embodiment of the present invention also relate to the giving of polynucleotide of the ALR that encodes.In this case, polynucleotide are operably connected to usually on the promotor and make these polynucleotide are given to produce suitable peptide sequence behind the patient.Described polynucleotide can be to give the patient in carrier.Described carrier can be a kind of plasmid vector, virus vector, expression vector or any suitable carrier that is suitable for inserting exogenous array, and they import in the eukaryotic cell and express the sequence that is imported.Generally speaking, carrier is a kind of carrier for expression of eukaryon and can comprises expression control and job sequence, for example promotor, enhanser, ribosome bind site, polyadenylation signal and transcription termination sequence.The nucleic acid construct that is given can comprise naked DNA or can exist with the form of one or more pharmaceutically acceptable carriers with composition.

The present invention is now described according to certain embodiments, and it should not be considered as limiting by any way invention scope.

Embodiment

The preparation of embodiment 1-recombinant human ALR

1.1 the amplification of people ALR

For separation of human ALR gene (being called 0ALR0 herein), design forward (Arg1:5 '-AATTACATATGCGGACGCAGCAG-3 ') (SEQ ID NO:9) and reverse (Arg2:5 '-AATTAAAGCTTCTAGTCACAGGAGCC-3 ') (the SEQ ID NO:10) primer and 0ALR0 cDNA that is used to increase, Taq polymerase kit (Roche) has been used in this amplification.Primer Arg1 contains NdeI restriction enzyme enzyme recognition site, and primer Arg2 contains the HindIII site.With these two kinds of primers (final concentration is respectively 300nM) and archaeal dna polymerase (2.0 unit), deoxyribonucleotide (final concentration is respectively 200 μ M), reaction buffer and ddH ₂O adds in the microminiature tube of the 0.2ml that contains 5 μ l people liver 5 '-stretch plus cDNA libraries (clontech) together.Use following condition to carry out (94 ℃, 5 minutes) before the PCR:PCR, and the 25PCR circulation (94 ℃, 1 minute; 57 ℃, 1 minute; 72 ℃, 1 minute) and PCR after (72 ℃, 7 minutes).Behind agarose gel electrophoresis, between 250bp and 500bp, observe a band (figure .3).

1.2 the structure of expression plasmid

For 0ALR0 cDNA, use pAED4 as the expression plasmid carrier in the expression in escherichia coli amplification.As shown in Figure 2, behind NdeI and HindIII digestion PCR product, using fast, connection test kit (Rapid Ligation Kit) (Roche) is inserted in the corresponding multiple clone site of pAED4.Confirm to contain the recombinant plasmid of people ALR by dna sequencing (Tech Dragon Limited).Plasmid DNA with correct sequence is called pAED-ALR.

1.3 crossing of recombinant human ALR (0ALR0) expressed

CaCl by standard ₂The phosphate conversion method is transformed into pAED-ALR in e. coli bl21 (DE3) the pLysS bacterial strain.(the 1L substratum contains 16g Trypsin at the 5ml 2xTY substratum that contains 0.1mg/ml penbritin (USB) and 34 μ g/ml paraxin (USB) then, 10g yeast extract and 5g NaCl) in inoculation cell transformed T, and on gyrate shaker with 280rpm in 37 ℃ of incubations 10 hours.Then, with 2ml enlarged culturing base (expanded culture) incubation in containing the 200ml 2xTY substratum of 0.1mg/ml penbritin.Optical density(OD) (OD 0.8 ₆₀₀) under, isopropyl ss-(IPTG USB) carries out protein expression and induces the D-thiogalactoside with 0.2mM.After inducing 4 hours, by 6, centrifugal 20 minutes results bacteriums and before purifying, being housed under-80 ℃ under the 000g.

1.4 the insoluble protein purifying of recombinant human ALR (0ALR0)

Be purifying 0ALR0, the cell of gathering in the crops be resuspended in the lysis buffer (pH 8.0 for 50mM Tris-Cl, 1mM EDTA) that concentration is 10g cell/100ml and 15 μ g/ml N,O-Diacetylmuramidases (Sigma).With the suspension body in 30 ℃ of incubations 1 hour, then at about 3 minutes on ice with supersound process.In 4 ℃ with 10, the cell suspension that the centrifugal supersound process of 000rpm obtains 1 hour, abandoning supernatant.In order to remove non-ALR protein, the cell precipitation that will contain inclusion body is resuspended in the 4M urea (be dissolved in 100mM Tris-Cl, pH 8.0), and concentration is 20g/100ml.At room temperature stirred suspension 120 minutes and with 10, centrifugal 30 minutes of 000rpm.Collection contains the cell precipitation of inclusion body and uses 100mM Tris-Cl, pH 8.0 washings.

Then, inclusion body is resuspended in 8M urea (be dissolved in 100mM Tris-Cl, pH 8.0) and 1% mercaptoethanol, concentration is that 20g/100ml is so that separate unfolded protein.Stir at room temperature that suspension spends the night and then with 10, centrifugal 30 minutes of 000rpm collects supernatant liquor.For refolding protein, use 100mM Tris pH 8.0 that urea concentration is diluted to 2M from 8M.Subsequently, add 0.2mM Sleep-promoting factor B and 1mM reduced glutathion and kept 10 hours down at 4 ℃.After the refolding, dialysis protein is to remove urea.

Embodiment 2-comprises the preparation of the pAED-ALR derivative of different Histidine sequences

2.1 the preparation of the ALR of polyhistidine mark

By the synthetic several ALR derivatives of PCR with 6 Histidines and 12 Histidines.The primer that is used for the ALR preparation of polyhistidine mark is listed in table 1.Every kind 5 ' terminal primer comprises a NdeI restriction enzyme enzyme recognition site and every kind 3 ' terminal primer comprises a HindIII recognition site.Use these identification recognition sites, the ALR derivative of polyhistidine mark can be cloned in the corresponding restriction site of expression vector pAED4.

Natural people ALR (0ALR0) is used as the preparation that template is used for the ALR derivative of polyhistidine mark.Use high frequency high fidelity Taq polymerase kit (Roche) to carry out PCR, reaction conditions is as follows: before the PCR (95 ℃, 5 minutes), 25 PCR circulate (95 ℃; 30 seconds; 50 ℃, 30 seconds; 72 ℃, 40 seconds) and PCR after (72 ℃, 10 minutes).

Table 1: the primer that is used for the ALR preparation of polyhistidine mark

The ALR derivative	Employed primer	Sequence
			0ALR0	(5’)Arg1	AATTACATATGCGGACGCAGCAG(SEQ ID NO：9)
(3’)Arg2	AATTAAAGCTTCTAGTCACAGGAGCC(SEQ ID NO： 10)
		0ALR6His		(5’)Arg1	AATTACATATGCGGACGCAGCAG(SEQ ID NO：9)
(3’)LHB130	AATTAAAGCTTCTAATGATGGTGATGGTGATGGTCACA GGAGCCATCCTTCCA(SEQ I D NO：11)
			0ALR12His	(5’)Arg1	AATTACATATGCGGACGCAGCAG(SEQ ID NO：9)
(3’)LHB135	AATTAAAGCTTCTAGTGGTGGTGGTGGTGGTGATGATG GTGATGGTGATGGTCACAGGAGCCATCCTTCCA(SEQ ID NO：12)
		3HisALR9His		(5’)LHB153	AATTACATATGCACCACCACCGGACGCAGCAGAAG (SEQ ID NO：13)
(3’)LHB155	AATTAAAGCTTCTAGTGGTGGTGATGATGGTGATGGTG ATGGTCACAGGAGCCATCCTTCCA(SEQ ID NO： 14)
			6HisALR6His	(5’)LHB154	AATTACATATGCACCACCACCATCACCACCGGACGCAG CAGAAG(SEQ ID NO：15)
(3’)LHB130	AATTAAAGCTTCTAATGATGGTGATGGTGATGGTCACA GGAGCCATCCTTCCA(SEQ ID NO：11)
		0ALR18His		(5’)Arg1	AATTACATATGCGGACGCAGCAG(SEQ ID NO：9)
(3’)KAR30	AATTAAAGCTTCTAGTGGTGATGGTGGTGATGGTGGTG GTGGTGGTGGTATGATGGTGATGGTGATGGTGATGGTG GTGATGGTGGTCACAGGAGCCATCCTTCCA(SEQ ID NO：16)

2.2 the structure of the ALR derivative of reorganization polyhistidine mark

Use to connect test kit (Roche) fast, the PCR product cloning of the ALR derivative of polyhistidine mark is gone among the NdeI and HindIII restriction site of pAED4 expression vector.Confirm recombinant plasmid by dna sequencing (Tech Dragon Limited).The create name of constructed plasmid sees Table 2.

Table 2: the create name of constructed plasmid

The PCR-carrier cloning	Create name
		0ALR0	pAEDALR
0ALR6	pAEDALR6His
		0ALR12	pAEDALR12His
3ALR9	pAED3ALR9His
		6ALR6	pAED6ALR6His
0ALR18	pAEDALR18His

2.3 the expression and the purifying of the ALR derivative of polyhistidine mark

Use e. coli bl21 (DE3) pLysS bacterial strain to carry out protein expression, the used method of method and as above pAED-ALR is identical.Merge existence permission use  KTA to proteic histidine mark _FPLC(Amersham Pharmacia) utilizes the nickel agarose column to carry out quick A LR purifying.The cell of being gathered in the crops is resuspended in the solubilising damping fluid (50mM Tris, 0.1M NaCl) that contains 15 μ g/ml N,O-Diacetylmuramidases (Sigma) with 10g/100ml.30 ℃ of following incubation suspensions 1 hour, then at about 3 minutes on ice with supersound process.Then in 4 ℃ with 10, the cell suspension of the centrifugal supersound process gained of 000rpm 1 hour.Collect supernatant liquor and carry out protein purification.Preparation nickel post is also used binding buffer liquid (pH 7.4 for 0.5M NaCl, 0.02M sodium phosphate) balance.After the supersound process, before last nickel post, filter clarified extract by 0.45 μ m strainer.After elutriant flows through post, by lavation buffer solution (pH 7.4 for 0.5M NaCl, 0.02M sodium phosphate) the washing matrix of adding 5 times of bed volumes.Use the albumen of elution buffer (the 0.5M imidazoles, pH 7.4 for 0.5M NaCl, 0.02M sodium phosphate) with 0-100% gradient elution histidine mark.Then, analyze whole elutriants with estimated output and purity, and the fraction that will contain desirable proteins is concentrated and is used for further research by SDS-PAGE.

Figure .4 has shown the elution profile of the ALR polypeptide of different polyhistidine marks, all observes 2 peaks in all figure.Analyze (figure .5), the ALR albumen that a back peak is considered to express in conjunction with SDS-PAGE.The ALR albumen of more every kind of His-mark shows that those have more that the albumen of polyhistidine residue has higher purity in that wash-out goes out from the post under the higher imidazole concentration, and OALR12 has the purity greater than 95%.

Then, use Bradford assay method (Bio-Rad) to measure protein concentration.The expression level of the ALR of polyhistidine mark is listed in the table 3.Data show that the expression level of 3ALR9 and 0ALR12 is higher than 6ALR6, though they all comprise 12 His-marks (table 3) altogether.Should notice that 6ALR6 has provided low expression level.

Table .3: the expression level of the ALRs of polyhistidine mark

Protein	Expression level/mg/L
		0ALR6	~150
6ALR6	~30
		3ALR9	~90
0ALR12	~120
		0ALR18	All do not dissolve

The structural analysis of the ALR of embodiment 3-polyhistidine mark

3.1 mass spectroscopy

Before mass spectroscopy, use Amicon Ultra-4 centrifugal filter equipment (molecular weight cut-off=10,000Da; Millipore USA) carries out desalination to sample in 20mM bicarbonate of ammonia.Then, (Micromass carries out the electrospray ionization mass spectrometry test on UK) at the Q-TOF2 mass spectrograph that is equipped with Masslynx 3.5 softwares.The five equilibrium acetonitrile that begins to contain 0.2% formic acid adds in the protein solution and contains acetonitrile with preparation: the final solution of damping fluid 50: 50 (v/v) and 0.1% formic acid.Use syringe pump (Cole Parmer, 74900 series) final protein solution to be injected in the mass spectrograph with 300 μ l/h flow velocitys.For all tests, capillary voltage is set at 2.5KV, and cone (cone) voltage maintains 30V.Use white (MW=16950.5) external calibration centroidal axis (mass axis) of horse cardiac muscle red eggs.Obtain multi-charge spectrum (multiply charged spectra) by scanning 600-2000m/z mass range, and the multi-charge spectrum is deconvoluted by maximum entropy (Maximum Entropyed) program that is included in MassLynx 3.5 software packages.

Mass spectroscopy has confirmed 0ALR6 (figure .7a) and 0ALR12 (figure .7b) monomer and dimeric molecular weight.Observed value is respectively 15848Da and 16718Da (monomer) and 31695Da and 33436Da (dimer).

Table 4 has also compared observed value and the theoretical value of 0ALR6 and 0ALR12.Each observed value of 0ALR6 is compared with calculating (theory) value to have＜0.02% relative deviation.Correspondingly, 0ALR12 has＜0.3% relative deviation.These numerical value and aforementioned research (Li etc. (2002)) those numerical value of being reported are identical.Except that main peak, some small peaks also are clearly.These small peaks may be to have event owing to remain in the salt on ALR polypeptide surface.

The comparative result of table 4:0ALR6 and 0ALR12 observed value and calculated value

		Molecular weight/the Da that measures	Theoretical molecular weight/Da	Relative deviation/%
					0ALR6	Monomer	15848	15850	0.006
Dimer	31695	31699	0.012
				0ALR12		Monomer	16718	16673	0.2
Dimer	33339	33436	0.27

From Fig. 7, can find out that dimeric peak is high a lot of than monomer, show that therefore recombinant human OALR6 and OALR12 with the homodimer form but not monomeric form is natural exists, are that the institute of the sex change SDS/PAGE electrophoresis result among Fig. 6 further confirms.

3.2 circular dichroism

Utilize Jasco 810 spectropolarimeters to measure circular dichroism (CD) spectrum of the ALR derivative of polyhistidine mark, this polariscope has used has the cylindrical cell of path length as the band water jacket of 1.0mm.Provide temperature control by the Neslab RTE-211 circulating water bath that is connected with MTP-6 programmable temperature device.Protein sample is dissolved in the 10mM potassiumphosphate (pH 7.0), and concentration range is 0.25mg/ml-0.5mg/ml.Monitor the thermally denature of ALR by the extreme ultraviolet mol ovality of measuring 190nm-250nm.Collect data and, use Yang CD as a reference with J810 1.0 software analysis.

The CD spectrum that Jasco 810 spectropolarimeters are measured has shown that the ALR derivative of polyhistidine mark has and the similar spectrogram of natural A LR (figure .8).List in the table 5 by means of the secondary structure that the YangShi reference analysis obtains.Alpha-helix between ALR and the derivative thereof is similar with the per-cent of beta sheet in secondary structure.These results show that adding histidine mark does not influence the folding of ALR secondary structure.

Table 5: analyze secondary structure

	ALR	OALR6	OALR12
				Alpha-helix β-Beta corner random coil	38.1％ 34.4％ 0 27.5％	33％ 40.8％ 0 26.3％	32.7％ 41.4％ 0 25.9％
Amount to	100％	100％	100％

3.3 isoelectrofocusing

Measure the proteic iso-electric point of ALR (pI) by using isoelectrofocusing (IEF).At first sample and water are carried out buffer-exchanged and be housed in 4 ℃ before use.Then, containing amphotericeledrolyte (Pharmalyte, wide region pH3-10, Amersham) carry out isoelectrofocusing (IEF) in the polyacrylamide gel, Model 111 mini-IEF grooves (Bio-Rad) have been used, according to manufacturers instruction instruct to use the wide region marker (Broad pI test kit, pH 3.5-9.3, Amersham).BSA in contrast.The IEF gel divided for 3 steps ran:

	Voltage	Electric current	Time
				The 1st step: the 2nd step: the 3rd step:	100V 200V 450V	6mA 6mA 4mA	15 minutes 15 minutes 75 minutes

Behind the electrophoresis, use Coomassie blue G-250 to gel-colored, " dying soon " spent the night and be need not vibration, and then decolouring was used for strengthening and preserving in 1 hour in 7% (v/v) acetate.

Fig. 9 has shown the IEF result of 0ALR0 and 0ALR6.According to the calibration value of wide region, draw out the typical curve that band and dyestuff Front distance are ordered to pI.Then calculate proteic iso-electric point according to typical curve.Table 6 has been listed calculating (theory) iso-electric point of 0ALR0 (pI 7.17), 0ALR6 (pI 7.16) and 0ALR12 (pI 7.093).Similar iso-electric point shows that the existence of histidine mark does not influence proteic iso-electric point between every kind of ALR.

Table .6: calculating (theory) iso-electric point of the ALR polypeptide of histidine mark

Protein	Iso-electric point
		BSA (contrast)	4.84
0-0	7.17
		0-6	7.16
0-12	7.093

3.4 measure non-covalent bonded FAD

For identifying combined FAD, use Lambda 35UV/VIS spectrometer (PerkinElmer) directly to write down the visible spectrum of the ALR derivative of histidine mark, then use UVWinLab 2.85.04 version software to analyze.The absorbancy scope is 350nm-550nm.Under the same conditions, the reference sample that has comprised the pure FAD of 7.5 μ M (Sigma) is also measured.

Figure .10 has shown that every kind of polyhistidine mark ALR derivative has FAD part but shown the character different with free FAD.The maximum absorbance of free FAD is 449.08nm.0ALR6 has shown the displacement (455.71nm) of about 5nm, and 0ALR12 has the displacement (453.96nm) of about 4nm and the displacement (452.79nm) that 0ALR0 has about 3nm.As if also displacement of the shoulder at peak (at 480nm) compared more obvious with free FAD spectrum.Absorbancy hint FAD and these ALR protein binding of displacement.

Proteic FAD content can calculate by protein denaturation.After using the Bradford assay method to measure protein concentration, albumen was boiled 30 minutes, add 15% tetrachloric acid (TCA) the FAD molecule is disintegrated down from albumen.Then, by the dissociated FAD of spectrometry.After thermally denature, observe albumen spectrographic peak and be moved to 445nm, show thus and removed all metaproteins, only have dissociated FAD (figure .11) from 454nm.

Then use free FAD to calculate FAD content according to the 0D value at climax as standard.This result shows that there is about 0.8 FAD molecule in every protein monomer unit in all three kinds of ALR albumen 0ALR0,0ALR6 and 0ALR12.This numerical value hints that there is a FAD molecule in each monomer unit.This discovery is similar to the measurement result to Ervlp (17).

The activity ratio between the embodiment 4-people ALR derivative

Measure 4.1 Thiol oxidase is active

By using the ALR protein-active of sulfhydryl oxidase enzyme assay test person polyhistidine mark.The ALR albumen of 50pmol purifying is diluted in 1ml measures damping fluid (the 2M urea is dissolved in the 100mM potassiumphosphate, 1mM EDTA, pH 7.5) and 1,4-dimercapto-2 in the 3-butyleneglycol (DTT), is equivalent to 50nmol reductive thiol group.From collect 200 μ l aliquots containigs from the 1ml sample, measure initial mercaptans content.Collect 200 extra μ l aliquots containigs at interval and measure mercaptans content at different time.

By 200 μ l diluted samples are measured in the damping fluid at 790 μ l, adding 10 μ lDTNB (EllmanShi reagent) then is that 10 μ M are to measure mercaptans content to final concentration.After 2 minutes, measure 412nm place's delustring and calculate the employed thiol group of albumen.

Figure .12 has shown the dose-dependently Thiol oxidase activity of OALR12.Albumen is more, just has more thiol group to be used, and therefore viewed mercaptan per-cent is just correspondingly lower.This result hints that the Thiol oxidase activity of ALR depends on proteic concentration.

The Thiol oxidase activity of the ALRs of 3 kinds of histidine marks is shown among Figure 13.Compare with contrast and FAD (negative control), mercaptans content reduces in ALR.This result shows that ALR albumen still has function after adding Histidine.Use same protein concentration that the thiol group of 3 kinds of proteic comparison sheet express contracts 15% of ALR is used up in 30 minutes by 0ALR12.This result shows that the activity of 0ALR12 is similar to 0ALR0, and 0ALR6 mercaptan activity is lower.Therefore, add 12 histidine marks and do not influence ALR CXXC binding site to ALR.On the other hand, compare the active relative minimizing of Thiol oxidase with 0ALR0 from 0ALR6, adding 6 histidine marks may influence the ALRCXXC binding site to ALR.

Known ALR redox state for the control that comprises the propagation and the various kinds of cell function of apoptosis play a major role (Wu etc. (2003)), and ALR can also stimulate cellular proliferation and regenerate (Lu etc. (2002), Polimeno etc. (1999)), the existence of ALR Thiol oxidase activity is also relevant with hepatocyte growth.

4.2 reorganization ALR biological activity test

Several clones are used to test the biological activity of reorganization ALR.Cell is placed on the 96 hole culture plates (IWAKI), 3000 cells/well, the EagleShi substratum (DMEM) that DulbeccoShi improvement arranged in the hole (Gibco), it comprises 10% fetal bovine serum (Gibco), at 5%CO ₂And 30%O ₂In the air in 37 ℃ of cultivations.After 24 hours, use serum-free DMEM that cell is starved.After 1 day, add the recombinant human ALR of different concns, EGF and pHGF are as positive control, and β-Nei Xiananmei arrestin (BLIP) is as negative control.The incubation time is 48 hours, then instructs according to manufacturers instruction (Bio-gene) and carries out MTS mensuration.

The biological activity of ALR on cell proliferation is shown among Figure 14.The ALR albumen of all polyhistidine marks all demonstrates the hepatocellular proliferation activity to HepG2.Find that also 0ALR6 and 0ALR12 have the dose-dependently result.According to 3 kinds of proteic comparative results of ALR, 0ALR12 is considered to that HepG2 is had better effects, observes proliferation activity at 100pM and 500pM concentration place.And such activity is not observed in 0ALR0 and 0ALR6.

Whether have enough potential curative effects in order to measure ALR albumen, the commodity medicine of a kind of Wei of being known as Jia (pHGF) is used in the comparative study.Wei Jia be a kind of from the commercial channel obtainable product, it has positive effect to liver treatment.Figure 15 has shown 0ALR12 even still had relative proliferation activity low to the 1pM place to have conspicuous dose-dependent effect, and is just saturated until 100pM concentration.This comparative study shows that 71nM pHGF and 100pM 0ALR12 have similar cultivation effect.This result shows that the cultivation effect of the 0ALR12 that recombinates is fairly obvious.

Figure .14 and 15 has shown the relative proliferation activity of 0ALR12.Viewed difference might be because employed damping fluid difference is in cultivation effect.Sample cushions in TrispH 8.0 among Figure 14, and the damping fluid of sample and pH 7.0 carries out buffer-exchanged among Figure 15, it is believed that and can stablize this medicine.Because ALR albumen lower solvability in the Tris damping fluid, therefore cultivation effect may be lower when comparing with the sample of the buffer-exchanged of pH 7.0..

In order to confirm the ALR specificity, used another kind of clone MCF7 (human breast cell system).Figure 16 has shown the proliferation activity result of 0ALR12 to the MCF7 cell.These data show does not have tangible cultivation effect to the MCF7 cell, therefore hints that ALR only has specificity to liver cell.

The summary of the ALR of embodiment 5-polyhistidine mark

The ALR molecule that has synthesized 5 kinds of different polyhistidine marks, i.e. 0ALR6,6ALR6,3ALR9,0ALR12 and 0ALR18.Table 7 has shown the comparative result of these 5 kinds of ALR albumen and natural A LR (0ALR0).

Table 7: accept the new ALR albumen (0ALR6,6ALR6,3ALR9,0ALR12 and 0ALR18) of test and the comparative result of natural A LR (0ALR0) for five kinds

	0ALR0	0ALR6	6ALR6	3ALR9	0ALR12	0ALR18
							Molecular weight	15026.9	15849.8	16672.7	16672.7	16672.7	17602.7
Expression level	Medium	Very high	Low	High	High	High
							Purity	---	Medium	High	Medium	Very high	---
Output	---	~150 mg/L	~30 mg/L	~90 mg/L	~120 mg/L	All all are soluble protein not
							Solvability in elution buffer	---	Medium	Medium	Low	Medium	Very low
The Thiol oxidase activity of comparing with 0ALR0	++	+	---	---	++	---
							Cell-proliferation activity	+	++	---	---	+++	---

In the new ALR albumen of 4 kinds of tested solubilities, other all has high expression level except that 6ALR6.But, behind nickel affinity column purifying, to effective not as to 12 histidine marks of the effect of the purity of 6 histidine marks.0ALR12 has very high purity (being higher than 95%).

Based on expression level and purity, 6ALR6 and 3ALR9 are excluded outside further studying.0ALR6 and 0ALR12 are carried out functional study.The active activity that shows 0ALR12 of measuring of Thiol oxidase is similar to natural 0ALR0.In addition, cell proliferating determining shows that also 0ALR12 has better biological effect than 0ALR6.And, confirmed that 0ALR12 and commercial channel obtainable liver disease drug Wei Jia (pHGF) has comparable biological effect.

Embodiment 6-mass preparation 0ALR12

6.1 fermentation

The glycerine stoste of 501 prepared bacterial strains (pAEDALR12 plasmid among BL21 (DE3) pLysS) is seeded in the erlenmeyer flask, contain 200ml 2xTY substratum in the flask, substratum contains 10 μ M riboflavin, 0.1mg/ml penbritin and 0.2% glucose, and under 37 ℃ on gyrate shaker with 280rpm incubation 10 hours.Then, in stirred tank bio-reactor (B.Braun, Biostat B) 100ml enlarged culturing thing being diluted to final volume is 2L, the online detection instrument that this reactor is equipped with temperature, stir speed (S.S.), pH and oxygen to press.Air flow is set in 11 liters/minute, and temperature is 37 ℃ and by adding 2.5M sodium hydroxide pH is controlled between the 6.95-7.04.Stir speed (S.S.) is set in 400rpm, and the minimum threshold of dissolved oxygen is 70% (and have 20% air saturation minimum threshold).

Figure .17 and 18 has shown fermentation service chart and growth curve respectively.It is the PO of 400rpm and 80% that culturing process begins to have minimum stir speed (S.S.) in the batching stage ₂PO ₂Keep until cell arrival growth phase with high density with glucose content.At this growth phase, optical density(OD), cellular biomass and glucose consumption rate are exponential form to be increased.Reach the O.D. of 13.0-14.0 ₆₀₀The IPTG or the 28mM lactose that add the 0.5mM final concentration are used to induce.Protein expression starts and cell growth rate slows down and is O.D. ₆₀₀And cellular biomass is indicated.Then, with in the extra 30g glucose injected system and under 37 ℃, cultivated again 4 hours or 20 ℃ of following overnight incubation.Then, by at centrifugal 20 minutes harvested cells of 4 ℃ of following 7000g, and before protein purification, preserve in-80 ℃.

6.2 purifying

For purifying 0ALR12, the method that is adopted is similar to the method for small scale purification, but has carried out some modifications.The cell of results is resuspended in the solubilising damping fluid (50mMTris, 0.1M NaCl) with 10g/100ml, and (APV Far EastLtd) carries out lysis by APV-1000 High-Voltage Experimentation chamber homogenizer.Then, use 1500U/L DNase I and carried out DNA digestion in 1 hour at 37 ℃ of following incubations.Under 4 ℃ with the cell suspension of supersound process with 10, centrifugal 1 hour of 000rpm.Collect supernatant liquor and use the  KTA that is equipped with 20ml nickel agarose column _FPLC(Amersham Pharmacia) carries out protein purification.

The wash-out collection of illustrative plates of 0ALR12 large scale purification is the amplification (figure .19) of small scale purification.Nonspecific proteins is eluted in beginning, and the main fraction of 0ALR12 is eluted at about 0.35M imidazole concentration place.In service 2 liters of fermentations, obtain about 300mg-400mg 0ALR12 albumen usually.Then, collected fraction is used for further research and analysis.

6.3 analytical procedure

(Yellow Springs Instrument, Ohio USA) measure glucose level to use the enzymatic glucose analyser.Measure protein content by using bovine serum albumin as the Bradford assay method of standard substance.

Crossing of embodiment 7-0ALR18 expressed

The method that makes up and express the 0ALR18 polypeptide in intestinal bacteria is similar to the method that those descriptions are used for 0ALR12.The plasmid that comprises 0ALR0 is used as template, two oligonucleotide (Arg1:5 '-AATTACATATGCGGACGCAGCAG-3 ' (SEQ ID NO:9); KAR30,5 '-AATTAAAGCTTCTAGTGGTGATGGTGGTGATGGTGGTGGTGGTGGTGGTATGATGG TGATGGTGATGGTGATGGTGGTGATGGTGGTCACAGGAGCCATCCTTCCA-3 ') (SEQ ID NO:16) is used as primer.Then confirm plasmid sequence (Tech Dragon Ltd) and in e. coli bl21 (DE3) pLysS, express.It is identical with the described proteic method of ALR that is used for other polyhistidine mark to be used for method that 0ALR18 expresses.Collect expressed proteins and use  KTA _FPLC(Amersham Pharmacia) and nickel agarose column purifying.

Figure .20 has shown the proteic purifying figure of solubility 0ALR18, and showing does not have the peak of discovery corresponding to 0ALR18.This result shows that 0ALR18 is not present in the soluble proteins part.Knownly also observed the non-specific binding peak, so not existing of solubility 0ALR18 unlikely is because due to the unsuitable lysis.

Then analyze the solvability of the different piece of 0ALR18 with research 0ALR18 by 12%SDS-PAGE.Result (figure .21) shows that almost 100% 0ALR18 expresses with insoluble protein.Therefore, the solvability of 0ALR18 is far below 0ALR12, and it is proved and contains 50% the soluble proteins of having an appointment.The result of the ALR protein solubility comparison of different polyhistidine marks shows that 0ALR6 is similar with the 0ALR12 solvability but 0ALR18 is insoluble fully.

Embodiment 8-composition

What molecule of the present invention and reagent and those were identified for the inventive method can be used for treatment or prevents various symptom or illness.Above-mentioned molecule and reagent can give separately, though more commonly give as pharmaceutical composition.

According to the enforcement that this paper provided best mode of the present invention, concrete preferred compositions is summarized as follows.Following content is only as the illustrative example of composition and limit the scope of the invention never in any form.

8.1 be used for the composition of administered parenterally

Can prepare a kind of composition of intramuscularly that is used for to contain aseptic buffered water of 1mL and 1mg suitable reagent or molecule.

Similarly, a kind of composition that is used for venoclysis can comprise the aseptic woods Ge Shi of 250ml (Ringer ' s) solution and suitable reagent or the molecule of 15mg.

8.2 injectable administered parenterally composition

A kind of composition that is suitable for drug administration by injection can obtain by the suitable reagent of 1% (weight) or molecule and 10% (volume) propylene glycol and water are mixed with.By filtering to this solution sterilization.

8.3 capsule composition

The composition of a kind of suitable reagent that exists with capsule form or molecule can be by preparing in the two-piece type hard capsule of the Powdered reagent of 50mg or molecule, 100mg lactose, 35mg talcum and 10mg Magnesium Stearate being inserted standard.

8.4 eye drop composition

A kind of representative compositions that is used for administration as eye drops is summarized as follows:

The reagent or the compound 0.3g that are fit to

Methyl hydroxybenzoate 0.005g

Nipasol 0.06g

Pure water is approximately to 100.00ml.

Methyl hydroxybenzoate and nipasol are dissolved in the 70ml pure water solution that cooling is obtained in 75 ℃.Then, add the reagent or the molecule that are fit to, carry out sterilization by membrane filter (0.22 μ m aperture) filtering solution, and in the sterile chamber of under aseptic condition, packing into.

8.5 be used for the composition of inhalation

For capacity for the aerosol container of 20-30ml: the lubricant of reagent that 10mg is suitable or compound and 0.5-0.8% (weight) such as polysorbate85 or oleic mixture are dispersed in the propelling agent such as freonll-11, and are used in the nose in the suitable aerosol container of packing into or the oral cavity inhalation.

8.6 ointment compositions

A kind of representative compositions that is used for administration as ointment comprises suitable reagent of 1.0g or molecule, and white paraffin disperses product level and smooth to prepare, homogeneous to 100.0g.

8.7 topical cream composition

A kind of representative compositions that is used for administration as topical cream is summarized as follows:

The reagent or the molecule 1 .0g that are fit to

Polawax GP 200 25.0g

Lanolin anhydrous bp93 3.0g

Cera alba 4.5g

Methyl hydroxybenzoate 0.1g

Deionization or sterilized water are to 100.0g

Described nonionic emulsifying wax (polawax), beeswax and lanolin is heating together under 60 ℃, adds methyl hydroxybenzoate solution and uses high speed agitator to homogenize.Then, be cooled to 50 ℃.Then add reagent or molecule and carry out the integral body dispersion, and use the low-speed agitator cooling compositions.

8.8 local detergent composition

A kind of representative compositions that is used for administration as local lotion is summarized as follows:

The reagent or the molecule 1 .2g that are fit to

Sorbitan laurate 0.8g

Polysorbate20 0.7g

Cetostearyl alcohol 1.5g

Glycerine 7.0g

Methyl hydroxybenzoate 0.4g

Sterilized water is to 100.00ml

Under 75 ℃, methyl hydroxybenzoate and glycerine are dissolved in the water of 70ml.Sorbitan laurate, polysorbate20 and cetostearyl alcohol are melted under 75 ℃ and add in the aqueous solution.Prepared milk sap is homogenized, add in the residual water as suspension with the cooling of continous way agitator and with reagent or molecule.Stir whole suspension until homogenizing.

Reference

Cheng, J., Zhong, Y.W., Liu, Y., Dong, J., Yang, J.Z., and Chen, J.M.Cloning and sequencing analysis of human genomic DNAof augmenter of liver regeneration.World J Gastroenterol2000; 6 (2): 275-277

Francavilla A., Hagiya M., Porter K.A., Polimeno L., Ihara I. and Starzl T.E.Augmenter of liver regeneration:Its place inthe universe of hepatic growth factors.Hepatology 1994; 20 (3): 747-757

Giorda R., Hagiya M., Seki T., Shimonishi M., Sakai H., Michaelson J., Francavilla A., Starzl TE. and Trucco M.Analysis of the structure and expression of the augmenterof liver regeneration (ALR) gene.Mod Med 1996; 2 (1): 97-108

Hagiya M., Francavilla A., Polimeno L., Ihara I., Sakai H., Seki T., Shimonishi M., Porter K.A. and Starzl T.E.Cloningand sequence ahalysis of the rat augmenter of liverregeneration (ALR) gene:Expression of biologically activerecombinant ALR and demonstration of tissue distribution.Proc Natl Acad Sci USA 1994; 91:8142-46

Li, Y., Wei, K., Lu, C., Li, Y., Li, M., Xing, G., Wei, H., Wang, Q., Chen, J., Wu, C., Chen, H., Yang, S., and He, F.Identification of hepatopoietin dimerization, itsinteracting regions and alternative splicing of itstranscription.Eur J Biochem 2002; 269:3888-3893

Lu J., Xu W.X., Zhan Y.Q., Cui X.L., Cai W.M., He F.C. and YangX.M.Isolation and characterization of a novel transcriptof hepatopoietin.Acta Biochim Biophys Sin 2002; 34:225-30

] Polimeno L., Lisowsky T. and Francavilla A.From yeast to man-from mitochondria to liver regeneration:a new essentialgene family.Ital J Gastroenterol Hepatol 1999; 31:494-500

Wang G., Yang X.M., Zhang Y., Wang Q.M., Chen H., Wei H., XingG.C., Xie L., Hu Z.Y., Zhang C., Fang D.C., Wu C.T. and HeF.C.Identification of characterization of receptors formammalian hepatopoietin that is homologous to yeast ERV1.JBiol Chem 1999; 274 (17) 11469-72

Wu C.K., Dailey T.A., Dailey H.A., Wang B.C. and Rose J.P.Thecrystal structure of augmenter of liver regeneration:Amammalian FAD-dependent sulfhydryl oxidase.Protein Science2003; 12:1109-1118

Yang X.M., Xie L., Qiu Z.H., Wu C. and He F.C.Cloning andcharacterizing of a new type human liver regenerationaugmenter.Sci China 1997a; 6:642-47

Yang X.M., Xie L., Wang Q.M., Wei H.D., Wu C.T. and He F.C.Expression and Activity of Recombinant Human Augmenter ofLiver Regeneration.Acta Biochim Biophys Sin (in Chinese) 1997b; 29:414-18.

Sequence table

＜110〉the unknown

＜120〉ALR polypeptide and application thereof

<130>EC：CNC：15435HK2

<160>16

＜170〉PatentIn is 3.2 editions

<210>1

<211>125

<212>PRT

＜213〉homo sapiens

<400>1

Met Arg Thr Gln Gln Lys Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro

1 5 10 15

Pro Asp Arg Glu Glu Leu Gly Arg His Ser Trp Ala Val Leu His Thr

20 25 30

Leu Ala Ala Tyr Tyr Pro Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp

35 40 45

Met Ala Gln Phe Ile His Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu

50 55 60

Cys Ala Glu Asp Leu Arg Lys Arg Leu Cys Arg Asn His Pro Asp Thr

65 70 75 80

Arg Thr Arg Ala Cys Phe Thr Gln Trp Leu Cys His Leu His Asn Glu

85 90 95

Val Asn Arg Lys Leu Gly Lys Pro Asp Phe Asp Cys Ser Lys Val Asp

100 105 110

Glu Arg Trp Arg Asp Gly Trp Lys Asp Gly Ser Cys Asp

115 120 125

<210>2

<211>378

<212>DNA

＜213〉homo sapiens

<400>2

atgcggacgc agcagaagcg ggacaccaag tttagggagg actgcccgcc ggatcgcgag 60

gaactgggcc gccacagctg ggctgtcctc cacaccctgg ccgcctacta ccccgacctg 120

cccaccccag aacagcagca agacatggcc cagttcatac atttattttc taagttttac 180

ccctgtgagg agtgtgctga agacctaaga aaaaggctgt gcaggaacca cccagacacc 240

cgcacccggg catgcttcac acagtggctg tgccacctgc acaatgaagt gaaccgcaag 300

ctgggcaagc ctgacttcga ctgctcaaaa gtggatgagc gctggcgcga cggctggaag 360

gatggctcct gtgactag 378

<210>3

<211>205

<212>PRT

＜213〉homo sapiens

<400>3

Met Ala Ala Pro Gly Glu Arg Gly Arg Phe His Gly Gly Asn Leu Phe

1 5 10 15

Phe Leu Pro Gly Gly Ala Arg Ser Glu Met Met Asp Asp Leu Ala Thr

20 25 30

Asp Ala Arg Gly Arg Gly Ala Gly Arg Arg Asp Ala Ala Ala Ser Ala

35 40 45

Ser Thr Pro Ala Gln Ala Pro Thr Ser Asp Ser Pro Val Ala Glu Asp

50 55 60

Ala Ser Arg Arg Arg Pro Cys Arg Ala Cys Val Asp Phe Lys Thr Trp

65 70 75 80

Met Arg Thr Gln Gln Lys Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro

85 90 95

Pro Asp Arg Glu Glu Leu Gly Arg His Ser Trp Ala Val Leu His Thr

100 105 110

Leu Ala Ala Tyr Tyr Pro Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp

115 120 125

Met Ala Gln Phe Ile His Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu

130 135 140

Cys Ala Glu Asp Leu Arg Lys Arg Leu Cys Arg Asn His Pro Asp Thr

145 150 155 160

Arg Thr Arg Ala Cys Phe Thr Gln Trp Leu Cys His Leu His Asn Glu

165 170 175

Val Asn Arg Lys Leu Gly Lys Pro Asp Phe Asp Cys Ser Lys Val Asp

180 185 190

Glu Arg Trp Arg Asp Gly Trp Lys Asp Gly Ser Cys Asp

195 200 205

<210>4

<211>618

<212>DNA

＜213〉homo sapiens

<400>4

atggcggcgc ccggcgagcg gggccgcttc cacggcggga acctcttctt cctgccgggg 60

ggcgcgcgct ccgagatgat ggacgacctg gcgaccgacg cgcggggccg gggcgcgggg 120

cggagagacg cggccgcctc ggcctcgacg ccagcccagg cgccgacctc cgattctcct 180

gtcgccgagg acgcctcccg gaggcggccg tgccgggcct gcgtcgactt caagacgtgg 240

atgcggacgc agcagaagcg ggacaccaag tttagggagg actgcccgcc ggatcgcgag 300

gaactgggcc gccacagctg ggctgtcctc cacaccctgg ccgcctacta ccccgacctg 360

cccaccccag aacagcagca agacatggcc cagttcatac atttattttc taagttttac 420

ccctgtgagg agtgtgctga agacctaaga aaaaggctgt gcaggaacca cccagacacc 480

cgcacccggg catgcttcac acagtggctg tgccacctgc acaatgaagt gaaccgcaag 540

ctgggcaagc ctgacttcga ctgctcaaaa gtggatgagc gctggcgcga cggctggaag 600

gatggctcct gtgactag 618

<210>5

<211>137

<212>PRT

＜213〉artificial sequence

<400>5

Met Arg Thr Gln Gln Lys Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro

1 5 10 15

Pro Asp Arg Glu Glu Leu Gly Arg His Ser Trp Ala Val Leu His Thr

20 25 30

Leu Ala Ala Tyr Tyr Pro Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp

35 40 45

Met Ala Gln Phe Ile His Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu

50 55 60

Cys Ala Glu Asp Leu Arg Lys Arg Leu Cys Arg Asn His Pro Asp Thr

65 70 75 80

Arg Thr Arg Ala Cys Phe Thr Gln Trp Leu Cys His Leu His Asn Glu

85 90 95

Val Asn Arg Lys Leu Gly Lys Pro Asp Phe Asp Cys Ser Lys Val Asp

100 105 110

Glu Arg Trp Arg Asp Gly Trp Lys Asp Gly Ser Cys Asp His His His

115 120 125

His His His His His His His His His

130 135

<210>6

<211>414

<212>DNA

＜213〉artificial sequence

<400>6

atgcggacgc agcagaagcg ggacaccaag tttagggagg actgcccgcc ggatcgcgag 60

gaactgggcc gccacagctg ggctgtcctc cacaccctgg ccgcctacta ccccgacctg 120

cccaccccag aacagcagca agacatggcc cagttcatac atttattttc taagttttac 180

ccctgtgagg agtgtgctga agacctaaga aaaaggctgt gcaggaacca cccagacacc 240

cgcacccggg catgcttcac acagtggctg tgccacctgc acaatgaagt gaaccgcaag 300

ctgggcaagc ctgacttcga ctgctcaaaa gtggatgagc gctggcgcga cggctggaag 360

gatggctcct gtgaccatca ccatcaccat catcaccacc accaccacca ctag 414

<210>7

<211>143

<212>PRT

＜213〉artificial sequence

<400>7

Met Arg Thr Gln Gln Lys Arg Asp Thr Lys Phe Arg Glu Asp Cys Pro

1 5 10 15

Pro Asp Arg Glu Glu Leu Gly Arg His Ser Trp Ala Val Leu His Thr

20 25 30

Leu Ala Ala Tyr Tyr Pro Asp Leu Pro Thr Pro Glu Gln Gln Gln Asp

35 40 45

Met Ala Gln Phe Ile His Leu Phe Ser Lys Phe Tyr Pro Cys Glu Glu

50 55 60

Cys Ala Glu Asp Leu Arg Lys Arg Leu Cys Arg Asn His Pro Asp Thr

65 70 75 80

Arg Thr Arg Ala Cys Phe Thr Gln Trp Leu Cys His Leu His Asn Glu

85 90 95

Val Asn Arg Lys Leu Gly Lys Pro Asp Phe Asp Cys Ser Lys Val Asp

100 105 110

Glu Arg Trp Arg Asp Gly Trp Lys Asp Gly Ser Cys Asp His His His

115 120 125

His His His His His His His His His His His His His His His

130 135 140

<210>8

<211>432

<212>DNA

＜213〉artificial sequence

<400>8

atgcggacgc agcagaagcg ggacaccaag tttagggagg actgcccgcc ggatcgcgag 60

gaactgggcc gccacagctg ggctgtcctc cacaccctgg ccgcctacta ccccgacctg 120

cccaccccag aacagcagca agacatggcc cagttcatac atttattttc taagttttac 180

ccctgtgagg agtgtgctga agacctaaga aaaaggctgt gcaggaacca cccagacacc 240

cgcacccggg catgcttcac acagtggctg tgccacctgc acaatgaagt gaaccgcaag 300

ctgggcaagc ctgacttcga ctgctcaaaa gtggatgagc gctggcgcga cggctggaag 360

gatggctcct gtgaccacca tcatcaccac caccatcacc atcaccatca tcaccaccac 420

caccaccact ag 432

<210>9

<211>23

<212>DNA

＜213〉artificial sequence

<400>9

aattacatat gcggacgcag cag 23

<210>10

<211>26

<212>DNA

＜213〉artificial sequence

<400>10

aattaaagct tctagtcaca ggagcc 26

<210>11

<211>53

<212>DNA

＜213〉artificial sequence

<400>11

aattaaagct tctaatgatg gtgatggtga tggtcacagg agccatcctt cca 53

<210>12

<211>71

<212>DNA

＜213〉artificial sequence

<400>12

aattaaagct tctagtggtg gtggtggtgg tgatgatggt gatggtgatg gtcacaggag 60

ccatccttcc a 71

<210>13

<211>35

<212>DNA

＜213〉artificial sequence

<400>13

aattacatat gcaccaccac cggacgcagc agaag 35

<210>14

<211>62

<212>DNA

＜213〉artificial sequence

<400>14

aattaaagct tctagtggtg gtgatgatgg tgatggtgat ggtcacagga gccatccttc 60

ca 62

<210>15

<211>44

<212>DNA

＜213〉artificial sequence

<400>15

aattacatat gcaccaccac catcaccacc ggacgcagca gaag 44

<210>16

<211>106

<212>DNA

＜213〉artificial sequence

<400>16

aattaaagct tctagtggtg atggtggtga tggtggtggt ggtggtggta tgatggtgat 60

ggtgatggtg atggtggtga tggtggtcac aggagccatc cttcca 106

Claims (32)

1. the ALR polypeptide of a purifying, wherein said polypeptide comprises the one or more histidine residues that are positioned at N and/or C-terminal.

2. the polypeptide of claim 1, wherein said polypeptide comprises 12 histidine residues that are positioned at C-terminal.

3. the polypeptide of claim 2 comprises the aminoacid sequence shown in SEQ ID NO:5.

4. the polypeptide of claim 1, wherein said polypeptide comprises 18 histidine residues that are positioned at C-terminal.

5. the polypeptide of claim 4 comprises the aminoacid sequence shown in SEQ ID NO:7.

6. the polypeptide of claim 1, wherein said polypeptide comprises 6 histidine residues that are positioned at C-terminal.

7. the polypeptide of claim 1, wherein said polypeptide comprise 6 histidine residues that are positioned at N-terminal and 6 histidine residues that are positioned at C-terminal.

8. the polypeptide of claim 1, wherein said polypeptide comprise 3 histidine residues that are positioned at N-terminal and 9 histidine residues that are positioned at C-terminal.

9. the ALR polypeptide of a purifying, comprise aminoacid sequence or a kind of aminoacid sequence that sequence shown in SEQ ID NOs:1 or 3 is carried out one or more replacements, disappearance and/or interpolation that comprises shown in SEQ ID NOs:1 or 3, wherein said polypeptide obtains modifying by add one or more Histidines at N and/or C-terminal.

10. isolated nucleic acid molecule of ALR polypeptide of encoding, wherein said nucleic acid molecule comprise as SEQ ID NO:2 or 4 arbitrary shown in nucleotide sequence, and comprise and be positioned at 5 ' and/or 3 ' terminal one or more Histidine coding password.

11. comprising, the nucleic acid molecule of claim 10, wherein said nucleic acid molecule be positioned at 3 ' 12 terminal Histidine coding password.

12. comprising, the nucleic acid molecule of claim 10, wherein said nucleic acid molecule be positioned at 3 ' 18 terminal Histidine coding password.

13. carrier that comprises any described nucleic acid molecule of claim 10-12.

14. the carrier of claim 13, wherein said nucleic acid molecule are operably connected on one or more adjusting sequences.

15. a host cell comprises any one nucleic acid molecule of claim 10-12.

16. a host cell comprises the carrier of claim 13 or 14.

17. a host cell is expressed any one the ALR polypeptide of claim 1-9.

18. an antibody, it binds selectively to any one the ALR polypeptide of claim 1-9.

19. any one host cell of the carrier of any one nucleic acid molecule of any one ALR polypeptide, the claim 10-12 of claim 1-9, claim 13 or 14 or claim 15-17 preparation be used for the treatment of or the medicine of prevention of liver disease in application.

20. a method that is used for cell cultured supernatant propagation, wherein said method comprise one or more liver cells are exposed in any one host cell of the carrier of any one nucleic acid molecule of the claim 1-9 of treatment significant quantity any ALR polypeptide, claim 10-12, claim 13 or 14 or claim 15-17.

21. a method that is used to suppress hepatocyte growth, wherein said method comprise one or more liver cells are exposed in the antibody of the claim 18 for the treatment of significant quantity.

22. a pharmaceutical composition comprises any one host cell of carrier, the claim 15-17 of any one nucleic acid molecule of claim 1-9 any ALR polypeptide, claim 10-12, claim 13 or 14 or antibody and one or more pharmaceutically acceptable carriers, thinner or the adjuvant of claim 18.

23. the pharmaceutical composition of claim 22 comprises one or more additives.

24. the pharmaceutical composition of claim 23, wherein said one or more additives are selected from: Regular Insulin, Urogastron, pHGF, rhIGF-1 or transforminggrowthfactor-.

25. one kind is used for the treatment of or prevents the method that the patient gives birth to disease, wherein said method comprises the carrier or any one host cell of claim 15-17 of any one nucleic acid molecule of the claim 1-9 that gives the patient treatment significant quantity any ALR polypeptide, claim 10-12, claim 13 or 14.

26. a method that is used to prepare the ALR polypeptide of recombinant modified, wherein said method comprises step:

(a) with one or more Histidine coding password at the terminal artificial reconstructed ALR coded polynucleotide of N-and/or C-;

(b) the ALR coded polynucleotide is imported in the proper host cell and so that comprise culturing cell under the condition of ALR expression of polypeptides of one or more Histidines at N-and/or C-end; With

(c) the ALR polypeptide of the described recombinant modified of purifying.

27. the method for claim 26, wherein the ALR polypeptide of the modification that so prepares when comparing with the polypeptide of unmodified has shown one or more improved characteristics, described characteristic is selected from does not need to separate folding (sex change) and refolding subsequently (renaturation) in output, stability, solvability, purity or biological activity and the preparation process; The improved characteristics double and other method obtained, for example improved characteristics that other hincky acid is modified or other method obtained.

28. ALR polypeptide according to claim 26 or 27 preparations.

29. polyoxyethylene glycol (PEG) modified polypeptides or Pegylation albumen comprise any one polypeptide of claim 1-9.

30. a fusion rotein comprises any one polypeptide of claim 1-9.

31. the described fusion rotein of claim 30, wherein said polypeptide and albumin are covalently bound.

32. one kind by adding the polyhistidine modified polypeptides, wherein described modified polypeptides has shown one or more improved characteristics when comparing with the polypeptide of unmodified, described characteristic is selected from does not need to separate folding (sex change) and refolding subsequently (renaturation) in output, stability, solvability, purity or biological activity and the preparation process; The improved characteristics double and other method obtained, for example improved characteristics that other hincky acid is modified or other method obtained.

Images