CN1943579A - Use of asiatic acid in preparing medicine - Google Patents
Use of asiatic acid in preparing medicine Download PDFInfo
- Publication number
- CN1943579A CN1943579A CN 200610122561 CN200610122561A CN1943579A CN 1943579 A CN1943579 A CN 1943579A CN 200610122561 CN200610122561 CN 200610122561 CN 200610122561 A CN200610122561 A CN 200610122561A CN 1943579 A CN1943579 A CN 1943579A
- Authority
- CN
- China
- Prior art keywords
- asiatic acid
- tgf
- hepatic fibrosis
- liver
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The new use of astatic acid in manufacturing drugs is disclosed, particularly the use in the aspect of manufacturing drugs for anti hepatic fibrosis.
Description
Technical field
The present invention relates to the purposes of asiatic acid aspect the preparation medicine, particularly relate to the purposes of asiatic acid aspect the preparation anti-hepatic fibrosis medicines.
Background technology
Herba Centellae is a Umbelliferae Centella plant, is distributed widely in various places on the south the Yangtze river basin.All herbal medicine.In China's Herba Centellae external and existing more than the 2000 year history of curing the disease for oral administration.It has clearing away heat-damp and promoting diuresis, the function of removing toxic substances and promoting subsidence of swelling.Be applicable to jaundice due to damp-heat, heatstroke diarrhoea, sand Stranguria stranguria with blood, carbuncle sore tumefacting virus, injury from falling down.
The chemical constituent of Herba Centellae is based on triterpenes, as pentacyclic triterpene type ester glycosides such as asiaticoside, asiaticosides.Herba Centellae also contains the triterpene acids, as asiatic acid, Madecassic acid etc.In addition, also have a spot of polyacetylene alkene class, volatile oil, vanillic acid etc. in the Herba Centellae.
Asiatic acid is a kind of known substance.Asiatic acid available from U.S. SIGMA company is the high-efficient liquid phase chromatogram technology extract, yellowish-brown powder, odorless, bitter in the mouth.Molecular formula is C
48H
78O
5, molecular weight is 488.70 dalton (D), fusing point is 325 ℃-330 ℃, and is water insoluble, is dissolved in dimethyl sulfoxine.Its molecular structural formula is shown below:
Hepatic fibrosis is the case processes of various chronic hepatopathys in the liver cirrhosis evolution, its dominant mechanism is the hepatic stellate cell activation and is converted into fibroblast, producing a large amount of is the extracellular matrix of main component with collagen fiber, the hepatic tissue structure is changed gradually, the pathological process that liver function constantly descends.The signal of transforming growth factor (TGF β) impels the relevant expression of gene of fibrosis through intracellular Smad signal transduction, the topmost hepatic fibrosis signal pathway of TGF β/Smad signal pathway, TGF β is with after hepatic stellate cell (HSC-T6) TGF beta receptor combines, make the Smad2/3 phosphorylation, and combine with Smad4 and to enter nucleus, start transcribing of liver hepatic stellate cell (HSC-T6) fibrin related gene.Smad7 is the negative feedback regulatory factor of TGF signal beta approach, can suppress the Smad2/3 phosphorylation, and then suppresses hepatic fibrosis.Under pathological conditions, the TGF signal beta continues to make the Smad2/3 phosphorylation, causes fibrin gene transcription and albumen synthetic.Process of the present invention proves: asiatic acid can suppress rats'liver sternzellen (HSC-T6) activation and transform, and alpha actin (alpha-SMA) is expressed descend.Simultaneously, process of the present invention proves: asiatic acid can suppress rats'liver sternzellen collagen protein synthesis, thereby suppresses hepatic fibrosis.Process of the present invention also proves: asiatic acid suppresses the liver collagen protein synthesis by raising the inhibitory action of Smad7 Negative feedback signal performance to TGF β/Smad signal transduction.Hepatic fibrosis is a reversible process, takes the positive therapeutic measure to preventing that liver cirrhosis from being vital in the hepatic fibrosis stage.The treatment of Western medicine anti-hepatic fibrosis at present still lacks ideal medicine.Asiatic acid is a kind of medicine of effect of anti hepatic fibrosis significantly that has.
Hepatic stellate cell accounts for 15% of all hepatocyte sums.Under the effect of liver fibrosis due factor, hepatic stellate cell is secreted a large amount of extracellular matrixs, and substrate is mainly formed by fibrin with by hepatic stellate cell activation and the fibroblast that is transformed.Rats'liver sternzellen (HSC-T6) cell line is the cell model of research hepatic fibrosis, by U.S. Friedman SL (Division of Liver Diseases, Mount SinaiSchool of Medicine, New York, USA) professor sets up and is so kind as to give.
The documents and materials report, the medicine of useful its preparation healing skin wound of the known drugs purposes of asiatic acid, treatment keloid, and preparation prevents and treats the medicine of cardiovascular disease, control cerebrovascular disease.So far, the relevant research of asiatic acid aspect anti-hepatic fibrosis both at home and abroad all lacks convictive experimental evidence and shows that asiatic acid really can anti-hepatic fibrosis.Asiatic acid is not reported so far in the purposes aspect the preparation anti-hepatic fibrosis medicines.And our invention asiatic acid is based upon on the abundant and convictive experimental evidence basis fully in the new purposes aspect the preparation anti-hepatic fibrosis medicines.
Summary of the invention
The object of the present invention is to provide the new purposes of asiatic acid aspect the preparation anti-hepatic fibrosis medicines.
The invention provides the purposes of asiatic acid aspect the preparation anti-hepatic fibrosis medicines.
For this reason, to prove by experiment:
1, asiatic acid suppresses the beta induced rats'liver sternzellen activation of TGF and transforms, and the alpha-SMA protein expression is reduced.
2, asiatic acid suppresses the beta induced rats'liver sternzellen collagen protein synthesis of TGF.
3, the mechanism of Herba Centellae inhibition collagen protein synthesis is to raise Smad7 Negative feedback signal in TGF β/Smad signal pathway.
Below be whole experiment:
The material method:
1. cell culture
HSC-T6 keeps cultivation in low-sugar type DMEM (Invitrogen) culture medium, adds 1% mycillin (Invitrogen) and 10% hyclone (Hyclone). every hole 1 * 10
4Cell 2.5ml spreads 6 well culture plates, after 24 hours, changes and contains 0.2% hyclone DMEM and cultivated 24 hours, add AA (5 μ M, 10 μ M, 20 μ M, 30 μ M) reach 2 hours, add 1ng/ml TGF β, set up each group contrast, after 24 hours from cell extraction albumen or mRNA.
2. Protein Extraction
The culture medium of each porocyte is discarded, use the 0.01M PBS of pre-cooling to wash 2 times.The every hole of six orifice plates adds 250uL RIPA cell protein lysate, rocks to make it fully cover the bottom, places 30min on ice.The composition of RIPA protein cleavage buffer is: 1%Nonidet P-40,0.1%SDS, 1mM PMSF, 0.5%sodium deoxycholate, 1mM sodium orthovanadate, 10mM sodium fluoridein PBS.The cell sleaker is scraped and is got cell, is collected in the 1.5mL Eppendorf pipe.On ice sample is carried out Ultrasonic Pulverization, 500W, 3s * 6 time, 4 ℃, the centrifugal 10min of 12000rpm get supernatant.Be stored in-70 ℃ standby.
3. Messenger RNA (mRNA) extracting
The culture medium of each porocyte is discarded, in each hole of 12 orifice plates, add the RLT lysate that 350uL contains the β 2 mercapto ethanol with PBS buffer flushing back.Jiggle in the 1.5mL centrifuge tube that makes a collection of specimens after making lysate and cell fully contacting, extract total RNA of cell according to the description of the RNeasy Mini Kit of QIAGEN company (Cat 74104).
4. polymerase chain reaction (PCR)
RT-polymerase chain reaction (RT-PCR)
The total RNA that gets quality and be 1.5ug is the synthetic first chain cDNA (being undertaken by the test kit description) of primer with Oligo (dT), reaction reagent: 10X PCR Buffer 2.0 μ L, 50mMMgCl
22.0 μ L, 10mMdNTPs 2.0 μ L, Oligo (dT)
12-181.0 μ L, Rnase Inhibitor 1.0 μ L, M-MLV0.25 μ L, H
2O 9.75 μ L, RNA 2.0 μ L, Total Volume 20 μ L. reaction conditions: 22 ℃ of 10minutes, 42 ℃ of 15minutes, 99 ℃ of 5minutes, cDNA-20 ℃ of preservation is standby.
Real-time quantitative polymerase chain reaction (Real-Time PCR)
The sequence of primer is as follows: RatSmad7F:CGCTGTACCTTCCTCCGAT
RatSmad7R：AGAAGATATCCAGGGAGGGCTCTT
Real-Time PCR reaction reagent: 2 * iQ SYBR Green Supermix, 10 μ L, H
2O 7.2 μ L, Primer-10.4 μ L, Primer-20.4 μ L, DNA 2 μ L, reaction condition: 94 ℃, 5min, cycling condition: 94 ℃ of degeneration 20s, 60 ℃ of annealing 20s, 72 ℃ are extended 42s.40 circulations of coamplification, last circulation is hatched 5min for rearmounted 72 ℃.
5. the immune marking (Western blot)
Reagent: 0.5M Tris-HCl, PH6.8,1.5M Tris-HCl PH8.8; 40%Acrylamide/BisSolution; 20 * NuPAGE MES SDS electrophoretic buffer; 20 * NuPAGE changes the film buffer; Pvdf membrane; The X-photographic film; ECL (super signal west pico stable peroxide solution); ECL plus (Lumigen PS-3Detection Reagent Solution); 4% spacer gel, 10% separation gel, the sample of total protein 20ug; Discontinuous SDS-PAGE electrophoresis 100V, 90 minutes.Then albumen is transferred to pvdf membrane, 150V, 90 minutes.TBST washes film after changeing film.To seal 60min under 5% defatted milk powder-TBST confining liquid room temperature; TBST washes film.Hatch one anti-(1: 1000 to 1: 2000) that adds suitable concn: 4 ℃ of jogs spend the night.TBST washes film: two anti-(1: 10000 to 1: 30000) and the HRP-anti-biotin two anti-(1: 5000) in conjunction with the HRP that add suitable concn are hatched: jog 60min under the room temperature.ECL or ECL plus caused pvdf membrane between two clean transparent membranes after developing 1 minute, advance the exposure of X-line and do not wait in 2 seconds-15 minutes in the darkroom.Film after the exposure carries out developing and fixing.The result is through the scanning imaging system imaging, and carries out the content of quantitative analysis of protein matter band with Image J software.
Adopt above-mentioned experimental technique gained experimental data, can draw following result and conclusion by analysis: the result:
1.TGF β increases rats'liver sternzellen type i collagen protein expression:
2.TGF the dosage of beta induced rats'liver sternzellen type i collagen protein expression is 1ng/ml, the time is 24 hours.
3. asiatic acid suppresses rats'liver sternzellen alpha-SMA protein expression:
Asiatic acid can suppress the beta induced rats'liver sternzellen alpha-SMA protein expression of TGF, and the statistical analysis difference has significance.
4. asiatic acid suppresses rats'liver sternzellen collagen protein synthesis:
It is synthetic that asiatic acid suppresses the beta induced rats'liver sternzellen type i collagen albumen of TGF, and the statistical analysis difference has significance.
5. asiatic acid raises rats'liver sternzellen Smad7mRNA Negative feedback signal:
Asiatic acid raises rats'liver sternzellen Smad7mRNA Negative feedback signal, stops the beta induced rats'liver sternzellen type i collagen albumen of TGF synthetic by Smad7.The statistical analysis difference has significance.
Conclusion:
1. asiatic acid suppresses the beta induced rats'liver sternzellen activation of TGF and transforms.
2. it is synthetic that asiatic acid suppresses the beta induced rats'liver sternzellen type i collagen albumen of TGF.
3. asiatic acid raises Smad7mRNA Negative feedback signal, stops the beta induced rats'liver sternzellen type i collagen albumen of TGF synthetic by Smad7.Reach the drug effect that suppresses hepatic fibrosis.
From above experimental result as can be known, asiatic acid has good drug action really aspect anti-hepatic fibrosis, and asiatic acid can be used to prepare the medicine of anti-hepatic fibrosis really.
The specific embodiment
Below further specify asiatic acid of the present invention in the purposes of preparation aspect the anti-hepatic fibrosis medicines with embodiment.
Embodiment 1:
Asiatic acid acts on the rats'liver sternzellen, preparation albumen specimen, and Western blot:
1.HSC-T6 cell 1 * 10
4Spread 6 orifice plates, 5%CO
237 ℃, add asiatic acid (purchasing SIGMA company) after 24 hours as for the U.S., concentration is respectively 5 μ M, 10 μ M, 20 μ M, 30 μ M add TGF β 1ng/ml after 2 hours, continue to cultivate after 24 hours, conventional method is extracted cell protein, determining the protein quantity, and-70 ℃ store for future use or directly are Western blot.
2.Western the blot method is fully with reference to Jin Dongyan, " molecular cloning experiment guide " second edition of translation such as Li Mengfeng.Proteinic acrylamide gel electrophoresis method is referring to the 880-885 page or leaf, and protein is transferred to the method for pvdf membrane referring to the 888-893 page or leaf from the SDS acrylamide gel.
3. TBST washes film behind the commentaries on classics film.To seal 60min under 5% defatted milk powder-TBST confining liquid room temperature; TBST washes film.Anti-hatching that adds suitable concn (1: 1000 to 1: 2000): 4 ℃ of jogs spend the night.TBST washes film: two anti-(1: 10000 to 1: 30000) and the HRP-anti-biotin two anti-(1: 5000) in conjunction with the HRP that add suitable concn are hatched: jog 60min under the room temperature.ECL or ECLplus caused pvdf membrane between two clean transparent membranes after developing 1 minute, advance the exposure of X-line and do not wait in 2 seconds-15 minutes in the darkroom.Film after the exposure carries out developing and fixing.The result is through the scanning imaging system imaging.
Asiatic acid acts on the rats'liver sternzellen, extracts mRNA, RT-polymerase chain reaction (RT-PCR) and real-time quantitative polymerase chain reaction (Real-Time PCR):
1. Messenger RNA (mRNA) extracting
The culture medium of each porocyte is discarded, in each hole of 12 orifice plates, add the RLT lysate that 350uL contains the β 2 mercapto ethanol with PBS buffer flushing back.Jiggle in the 1.5mL centrifuge tube that makes a collection of specimens after making lysate and cell fully contacting, extract total RNA of cell according to the description of the RNeasy MiniKit of QIAGEN company (Cat 74104).
2. RT-polymerase chain reaction (RT-PCR)
The total RNA that gets quality and be 1.5ug is the synthetic first chain cDNA (being undertaken by the test kit description) of primer with Oligo (dT), reaction reagent: 10X PCR Buffer 2.0 μ L, 50mMMgCl
22.0 μ L, 10mMdNTPs2.0 μ L, Oligo (dT)
12-181.0 μ L, Rnase Inhibitor 1.0 μ L, M-MLV0.25 μ L, H
2O 9.75 μ L, RNA 2.0 μ L, Total Volume 20 μ L. reaction conditions: 22 ℃ of 10minutes, 42 ℃ of 15minutes, 99 ℃ of 5minutes, cDNA-20 ℃ of preservation is standby.
3. real-time quantitative polymerase chain reaction (Real-Time PCR)
The sequence of primer is as follows: RatSmad7F:CGCTGTACCTTCCTCCGAT
RatSmad7R：AGAAGATATCCAGGGAGGGCTCTT
Real-Time PCR reaction reagent: 2 * iQ SYBR Green Supermix, 10 μ L, H
2O7.2 μ L, Primer-1 0.4 μ L, Primer-20.4 μ L, DNA 2 μ L, reaction condition: 94 ℃, 5min, cycling condition: 94 ℃ of degeneration 20s, 60 ℃ of annealing 20s, 72 ℃ are extended 42s.40 circulations of coamplification, last circulation is hatched 5min for rearmounted 72 ℃.
Statistical analysis:
Use the SSPS statistical software that obtaining data are carried out the homogeneity of variance analysis, the t check is carried out in contrast between group.
From above embodiment as can be known, asiatic acid has good drug action really aspect anti-hepatic fibrosis, and asiatic acid can be used to prepare the medicine of anti-hepatic fibrosis really.
Claims (2)
1, the purposes of asiatic acid aspect the preparation anti-hepatic fibrosis medicines.
2, the purposes of asiatic acid according to claim 1 aspect the preparation medicine, the molecular structural formula of wherein said asiatic acid is shown below:
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610122561 CN1943579A (en) | 2006-09-30 | 2006-09-30 | Use of asiatic acid in preparing medicine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200610122561 CN1943579A (en) | 2006-09-30 | 2006-09-30 | Use of asiatic acid in preparing medicine |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN1943579A true CN1943579A (en) | 2007-04-11 |
Family
ID=38043373
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200610122561 Pending CN1943579A (en) | 2006-09-30 | 2006-09-30 | Use of asiatic acid in preparing medicine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN1943579A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690314A (en) * | 2011-03-22 | 2012-09-26 | 上海医药工业研究院 | Amorphous asiatic acid tromethamine salt and its preparation method |
| CN101991624B (en) * | 2009-08-27 | 2013-03-27 | 上海新康制药厂 | Method for preparing total asiatic acid, asiatic acid and madecassic acid from asiatic pennywort herb and use of prepared product |
| CN104784186A (en) * | 2015-05-06 | 2015-07-22 | 中国人民解放军第二军医大学 | Application of asiatic acid in preparation of medicine for preventing hepatitis virus |
-
2006
- 2006-09-30 CN CN 200610122561 patent/CN1943579A/en active Pending
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101991624B (en) * | 2009-08-27 | 2013-03-27 | 上海新康制药厂 | Method for preparing total asiatic acid, asiatic acid and madecassic acid from asiatic pennywort herb and use of prepared product |
| CN102690314A (en) * | 2011-03-22 | 2012-09-26 | 上海医药工业研究院 | Amorphous asiatic acid tromethamine salt and its preparation method |
| CN102690314B (en) * | 2011-03-22 | 2015-06-10 | 上海医药工业研究院 | Amorphous asiatic acid tromethamine salt and its preparation method |
| CN104784186A (en) * | 2015-05-06 | 2015-07-22 | 中国人民解放军第二军医大学 | Application of asiatic acid in preparation of medicine for preventing hepatitis virus |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Hu et al. | Bisphenol A, an environmental estrogen-like toxic chemical, induces cardiac fibrosis by activating the ERK1/2 pathway | |
| CN101052391A (en) | Peroxisome proliferator-activated receptor (PPAR) activator, and drugs, supplements, functional foods and food additives using the same | |
| CN1943579A (en) | Use of asiatic acid in preparing medicine | |
| CN1678323A (en) | Use of polyunsaturated ketones for the treatment of psoriasis | |
| CN101810866A (en) | New method for screening anti-liver injury medicament by using model organism zebra fish | |
| Roger et al. | Composition of urinary calculi: Lessons from a French epidemiologic retrospective study | |
| Stratos et al. | Inhibition of TNF-α restores muscle force, inhibits inflammation, and reduces apoptosis of traumatized skeletal muscles | |
| CN1717414A (en) | Promoter for the production of hyaluronic acid containing ginsenoside compound K | |
| Umbare et al. | Quality evaluation of Phyllanthus amarus (Schumach) leaves extract for its hypolipidemic activity | |
| CN1861101A (en) | Application of extractive of Hypericum sampsonii Hance to control RXR alpha acceptor target | |
| Jiang et al. | Hypoxia Preconditioned Serum (HPS)-hydrogel can accelerate dermal wound healing in mice—an in vivo pilot study | |
| Yoon et al. | Supplementation with eicosapentaenoic acid and linoleic acid increases the production of epidermal ceramides in in vitro canine keratinocytes | |
| Nakamura et al. | Biglycan is a novel mineralocorticoid receptor target involved in aldosterone/salt-induced glomerular injury | |
| CN1257070A (en) | Process for extracting purified isoliensinine and liensinine from plumula nelumbinis | |
| CN109985180B (en) | Application of traditional Chinese medicine compound composition in preparation of anti-hepatic fibrosis medicine | |
| CN1827132A (en) | Medicine for treating cholestasis and hepatic fibrosis and method for preparing the same | |
| CN103343160B (en) | Novel purpose of microRNA-30 family | |
| Ceausu et al. | Dormant cardiac stem cells: A promising tool in cardiac regeneration | |
| DE102017215159B4 (en) | Method for the determination of liver toxicity | |
| Mohamed et al. | Histological and biochemical studies on effect of Sofosbuvir (Sovaldi) on adult male albino rat kidney | |
| Stuepp et al. | HNK1 and Sox10 are present during repair of mandibular bone defects | |
| CN1915236A (en) | Application of woodruff glycoside in preparing medication for treating rheumatoid arthritis | |
| Zhao et al. | Effects of Dendrobium officinale polysaccharide on adipogenic differentiation of rat bone marrow mesenchymal stem cells | |
| Mdegela et al. | Effects of Commiphora swynnertonii on weight and plasma cholesterol levels in Rattus rattus | |
| Tsai et al. | Current Advances in Cellular Approaches for Pathophysiology and Treatment of Polycystic Ovary Syndrome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |